WO2015042649A1

WO2015042649A1 - A quantitative assay for target dna in a mixed sample comprising target and non-target dna

Info

Publication number: WO2015042649A1
Application number: PCT/AU2014/000942
Authority: WO
Inventors: Howard Robert SLATER; Damien Luis BRUNO; Devika GANESAMOORTHY
Original assignee: Murdoch Children's Research Institute
Priority date: 2013-09-27
Filing date: 2014-09-26
Publication date: 2015-04-02

Abstract

The present disclosure relates generally to an assay to detect and quantitate target nucleic acid in a mixture of target and non-target nucleic acid, kits useful for same and its use in non-invasive diagnostic methodologies. The assay comprises identifying copy number variation (CNV) polymorphisms present in the target nucleic acid and absent in non-target nucleic acid. Embodiments disclosed include quantitating the level of fetal DNA in sample of maternal DNA and fetal DNA, and quantitating the level of donor-derived DNA in sample from a transplant recipient comprising self DNA and non-self or donor DNA.

Description

AN ASSAY

FIELD

[0001] The present disclosure relates generally to an assay to detect and quantitate target nucleic acid in a mixture of target and non-target nucleic acid, kits useful for same and its use in non-invasive diagnostic methodologies.

BACKGROUND

[0002] Bibliographic details of the publications referred to by author in this specification are collected alphabetically at the end of the description.

[0003] Reference to any prior art in this specification is not, and should not be taken as, an acknowledgment or any form of suggestion that this prior art forms part of the common general knowledge in any country.

[0004] Clinical diagnosis and monitoring of the state of health of transplanted organs and tissue or to undertake fetal diagnosis frequently requires invasive medical procedures. For pregnancy, for example, amniocentesis and chorionic villus sampling are quite invasive procedures. Furthermore, current procedures generally do not involve quantitative methods, which can lead to false negative results.

[0005] Non-invasive target nucleic acid detection is therefore a major goal for clinicians and diagnosticians. This is particularly the case for non-invasive prenatal diagnosis (NIPD) to detect cell-free DNA of fetal origin in maternal plasma (Lo et al. (1997) Lancet 350 ( 6J:485-487). PCR-based testing of maternal plasma for determination of fetal sex or Rhesus D status in D-negative women is now routine in several countries, including the United Kingdom. The long sought goal of NIPD to detect trisomy 21 has also been achieved by means of massive parallel sequencing (MPS) of maternal plasma DNA (Chiu et al. (2008) Proc. Natl. Acad. Set USA 105(51 ): 20458- 20463; Fan et al. (2008) Proc. Natl. Acad. Sci. USA 105(42 J: 16266-1627 Ί). However, it is important to note that application of MPS technology in an economically feasible way does not presently provide sufficient depth of coverage of the genome (or more specifically of polymorphic markers that would facilitate identification of fetal reads) for estimation of the fetal fraction.

[0006] Furthermore, most groups performing NIPD currently rely on analysis of Y- chromosome sequences, which is only applicable about half the time, or on a separate, upfront test based on analysis of differentially methylated sequences for determining the fetal fraction in maternal plasma.

[0007] International Patent Application No. PCT/2004/000287 contemplated the use of cell-free fetal DNA circulates in the plasma of pregnant women to identify fetal- specific alleles. The method involved identifying alleles which are not present in maternal cells and screening a maternal sample of nucleic acids for the presence of an allele not present in maternal cells. The allele is generally from an HLA locus.

[0008] Chimerism includes the co-existence of nucleic acids originating from more than heterologous sources (e.g. from two individual subjects). The most frequently encountered examples are donor-recipient mixtures in individuals who have received an allogeneic organ (or stem cell) transplant and fetal-maternal mixtures in the blood plasma of pregnant women. Plasma DNA chimerism, which refers to the situation where mixtures of "self" and "non-self" circulating cell-free DNA (ccfDNA) is present in an individual's blood plasma, has recently acquired major clinical significance and application in noninvasive detection of chromosome aneuploidy in the first and second trimesters of pregnancy. In a research context, plasma DNA chimerism analysis promises new avenues for monitoring the immunological rejection of organ transplants which is the major unmet need in this field of medicine.

[0009] Quantitative assessment of plasma DNA chimerism relies on distinct genetic differences between the DNA from each of the sources (e.g. recipient and donor or mother and fetus). Copy number variants (CNVs) or CNV polymorphisms have not hitherto been used for this purpose. CNVs are losses or gains of segments of the genome, ranging from a hundred base pairs to several megabases, which vary in copy number between individuals in a population (Stankiewicz et al. (2010) Ann. Rev. Med. (57:437-455). Genome analyses using MPS and microarray technologies have revealed that almost 10 - 15% of the genome is subject to copy number variation (Conrad et al. (2010) Nature 4(54:704-712), accounting for more nucleotide variation than all single nucleotide changes combined. The ubiquity, genomic size, allelic distribution and inheritance pattern of CNVs make them attractive putative genetic markers.

[0010] US Patent Application No. 13/458,341 (Nygren Anders and Sequenom, Inc.) proposed the use of inhibitory primers to determine the amount of a minority nucleic acid in a sample that contained minority and majority nucleic acids. It can be used to determine the copy number of the minority nucleic acid species but does not employ CNV polymorphism.

[0011] International Application No. PCT/AU2008/001440 describes the use of CNVs to identify, monitor or isolate particular cell types in a mixture of cell types. The method was useful for monitoring organ and tissue health such as in transplant patients, cancer patients and neurological conditions such as aneuploid and polyploidy. The method is reliant on isolating cellular material and hence is invasive to some extent, it was also not quantitative.

[0012] Cell-free fetal DNA in the maternal plasma may originate from cytotrophohiastic ceils. (Faas et al. (20! 2) Expert Opin Biol Ther. 12 (Suppl 1 ):S 19-26). Quantitative changes of cell-free fetal DNA in maternal plasma has been used as an indicator for impending preeclampsia and other pathological conditions during pregnancy (Hahn et al. (2011 ) Placenta 32:S 17-20). None of these studies has used CNV's in the process of quantitation of cell-free fetal DNA.

[0013] It is important to accurately quantitate nucleic acid chimerism for monitoring, for example, of fetal and tissue transplant health with minimal invasiveness. This is underscored by the possibility of false negative results in the fetal fraction prior to NIPD testing due to insufficient levels of fetal DNA being present in the maternal plasma sample. Hence, to undertake quantitative sequence analysis such as MPS or to analyze nucleic acid fragmentation in body fluid, quantitative determination of the level of target nucleic acids is required. There is a need in diagnostic testing regimes to ensure that samples do not have unacceptahly low levels of target nucleic acid. There is a need, therefore, to be able to readily quantitate nucleic acid chimerism in a sample,

SUMMARY

[0014] Enabled herein is a target nucleic acid detection and quantitation method to measure target nucleic acid chimerism in a sample of target and non-target nucleic acids. The present specification teaches highly accurate quantitation of nucleic acid chimerism of cell-free (cf) target nucleic acid molecules relative to non-target nucleic acid molecules. The method is based on a cop number variant (CNV) polymorphism including a copy number deletion (CND) polymorphism. The CNV polymorphism is used to identify target in a mixture comprising target and non-target nucleic acid in and to quantitate the level of target nucleic acid. The term "CN V locus" is also used herein. Examples of target nucleic acid include fetal-derived and transplant tissue-derived including stem cell-derived cell- free nucleic acid, particularly circulating, cell-free DNA (ccfD A). This approach avoids the problem of measuring non-target (e.g. host nucleic acid) in the mixture of nucleic acids. The subject method relies on a bi-allelic null genotype, (i.e. 0 copy or null genotype) in the non-target nucleic acid (I.e. an absence o the CNV) and the presence of a heterozygous (i.e. 1 copy) or homozygous (i.e. 2 copy) genotype at the corresponding nucleic acid locus or location in the target nucleic acid (i.e. presence of 1 or 2 copies of the CNV). The method is largely non-invasive and does not require cell isolation or disruption of captured cells.

[0015] In an embodiment, the CNV is a copy number deletion (CND) selected from a panel of from 2 to 41 CNDs presented in Table 7. In an embodiment, the panel comprises 10 to 30 CNDs selected from the list presented in Table 7. In an embodiment, the panel comprises from 10 to 20 CNDs selected from the list in Table 7. In an embodiment, the panel comprises 10 CNDs selected from the list presented in Table 7. The CND may be detected by any means known in the art for detecting and quantitating nucleic acids, for example quantitative PCR (qPCR), digital PCR, Next Generation Sequencing (NGS) or NanoString technology. In an example, the CND panel defined in Table 6 can be detected using the primers and probes listed in Table 2 or 3. In another example, the sequence read data generated by NGS can be used to quantitate the CND panel defined in Table 7. The null genotype in the non-target nucleic acid is a homozygous deletion and the heterozygous or homozygous genotype in the target nucleic acid comprises one or two copies of the nucleic acid insertion at the same site.

[0016] In an embodiment, the "target" nucleic acid is referred to as the "non-self" nucleic acid and the non-target is referenced to as the "self" nucleic acid. Hence, the method described herein identifies and quantitates nucleic acid chimerism in the form of non-self (target) nucleic acid in a mixture with self (non-target) nucleic acid. In relation to pregnant females, non-self is the fetus and self is the mother and in transplantation patients, non-self refers to the transplanted tissue and self is the recipient.

[0017] The signal strength of the target nucleic acid (e.g. as measured by quantitative amplification of the CNV polymorphism or via amplification-independent NGS or NanoString technology) is proportional to the quantity of target nucleic acid in the sample or in the case of NGS, via sequence read data. This approach is non-invasive and enables a determination of levels of target nucleic acid relative to non-target nucleic acid. As any one individual in a population is null at several of these CNV loci, the method has high predictive informative value and no prior knowledge of the "self" genotype is necessarily required.

[0018] In one example, the present disclosure relates to a method for quantitating the level of fetal DNA in a maternal fluid sample comprising fetal and maternal DNA, said method comprising: identifying a heterozygous or homozygous form of a CNV polymorphism which is present in fetal DNA and absent in the maternal DNA in cell-free DNA isolated and/or enriched from the maternal sample and, determining the level of fetal DNA in the sample based on the identified CNV polymorphism.

[0019] In another example, the present disclosure relates to a method for quantitating the level of non-self DNA in a transplant recipient sample comprising self and non-self DNA, said method comprising: identifying a heterozygous or homozygous form of a CNV polymorphism which is present in non-self DNA and absent in the self DNA in cell-free DNA isolated and/or enriched from the transplant recipient sample and, determining the amount of non-self DNA in the sample based on the identified CNV polymorphism.

[0020] One of skill in the art would be aware of various methods that may be used to determine the amount of fetal or non-self DNA in a sample, once a CNV has been identified. For example, determining the level of fetal or non-self DNA in the sample may comprise subjecting the cell free DNA to an amplification reaction with primers which target the identified CNV. In an example, the amplification reaction is qPCR or digital PCR.

[0021] In another example, determining the level of fetal or non-self DNA in the sample may comprise assessing the cell free DNA with an amplification-independent detection means which target the identified CNV. In an example, the amplification- independent detection means is nucleic acid sequencing (e.g. deep sequencing; NGS), NanoString technology.

[0022] In an embodiment, a method is enabled for quantitating the presence of fetal DNA in a maternal fluid sample comprising fetal and maternal DNA, the method comprising: (i) isolating and/or enriching cell-free DNA from the maternal sample; and (ii) determining the amount of fetal DNA based on a heterozygous or homozygous form of a CNV polymorphism which is present in fetal DNA and absent in the maternal DNA based on sequence read data.

[0023] In an embodiment, a method is enabled for quantitating the fetal DNA fraction in a maternal fluid sample comprising fetal and maternal DNA, the method comprising: (i) isolating and/or enriching cell-free DNA from the maternal sample; and (ii) quantifying the amount of fetal DNA in the cell-free DNA by determining the level of a nucleic acid comprising a heterozygous or homozygous form of a CNV polymorphism which is present in fetal DNA and absent in the maternal DNA.

[0024] By "quantitating" includes detecting. The term "quantitating" includes determining the level or amount of target relative to non-target nucleic acid. [0025] In an embodiment, a method is enabled for quantitating the fetal DNA fraction in a maternal fluid sample comprising fetal and maternal DNA, the method comprising: (i) isolating and/or enriching cell-free nucleic acid from the sample; (ii) quantifying the amount of cell-free nucleic acid in the sample by determining the level of a nucleic acid present in both fetal and maternal nucleic acids; (iii) quantifying the amount of fetal nucleic acid in the cell-free nucleic acid by determining the level of a nucleic acid comprising a heterozygous or homozygous form of a CNV polymorphism that is absent in the maternal nucleic acid; and determining the fetal DNA fraction from the amount of fetal nucleic acid and cell-free DNA.

[0026] In an embodiment, a method is provided for determining the level of non-self DNA in a mixture of self and non-self DNA, the method comprising screening the DNA mixture for a non-self DNA which comprises a 1 (heterozygous) or 2 (homozygous) copy non-delete- allele genotype which is absent (null genotype) in the self DNA.

[0027] In one example, the cell free DNA is fragmented genomic DNA.

[0028] For example, the cell-free nucleic acid may be resultant from cell apoptosis. Accordingly, the methods of the present disclosure enable quantitation of target nucleic acid based on a fragmented nucleic acid source. The target nucleic acid comprises the heterozygous or homozygous non-delete- allele.

[0029] In another example, the methods of the present disclosure encompass a method for quantitating a target nucleic acid in a mixture of target and non-target nucleic acid in a sample, the method comprising: (i) isolating and/or enriching fragmented cell-free nucleic acid from the sample; (ii) subjecting the cell-free nucleic acid to either an amplification reaction with primers which target a heterozygous or homozygous form of a CNV polymorphism which is present in the target nucleic acid and absent in the non-target nucleic acid or to an amplification-independent determination of a heterozygous or homozygous feature of a CNV polymer which is present in the target and absent in the non-target nucleic acid; and (iii) determining the amount of target nucleic acid based on the level of amplified product or sequence read data.

[0030] In another example, the present disclosure relates to a method for quantitating a target nucleic acid in a mixture of non-target and target nucleic acid, the method comprising selecting a CNV polymorphism wherein the target nucleic acid is genotypically heterozygous or homozygous for the CNV polymorphism and the non-target nucleic acid is genotypically null for the CNV polymorphism and (i) isolating and/or enriching the sample for cell-free nucleic acid; and (ii) subjecting the mixture of cell-free nucleic acid either to an amplification reaction with primers which target the CNV polymorphism internally and/or flanking the polymorphism wherein the level detection of a specific product is indicative of the amount of the target nucleic acid or subjecting the mixture to an amplification-independent determination of a CNV polymorphism wherein sequence read data determine the amount of target nucleic acid.

[0031] In another example, the present disclosure relates to a method for quantitating chimerism in a mixture of target and non-target nucleic acids, the method comprising selecting a panel of two or more CNV loci which at least one is present in the target nucleic acid and absent in the non-target nucleic acid and subjecting the mixture of nucleic acids to either amplification conditions with primers which target the CNV locus in the target nucleic acid and screening for the level of amplified nucleic acid product which is indicative of amount of target nucleic acid or to amplification-independent conditions to determine the presence and amount of CNV based on sequence read data.

[0032] In another example, the present disclosure relates to a method for determining a ratio of target nucleic acid to non-target nucleic acid in a mixture of target and non- target nucleic acid in a sample, the method comprising: (i) isolating and/or enriching cell-free nucleic acid from the sample; (ii) quantifying the amount of cell-free nucleic acid by determining the level of a nucleic acid found in both target and non-target nucleic acids; (iii) quantifying the amount of target nucleic acid in the cell-free nucleic acid by determining the level of a nucleic acid comprising a heterozygous or homozygous form of a CNV polymorphism that is absent in the non-target nucleic acid; and determining a ratio of target nucleic acid to non-target nucleic acid from the amount of target nucleic acid and non-target nucleic acid.

[0033] In one example, more than one CNV is identified.

[0034] In another example, at least 3, or at least 4, or at least 5 CNV's are identified.

[0035] In an example, the CNV is a copy number deletion (CND).

[0036] In one example the CND is selected from a panel of from 2 to 41 CNDs selected from Table 7 or a panel of from 10 to 30 CNDs selected from Table 7 or a panel of from 10 to 20 or a CNDs selected from Table 7, or a panel comprising about 10 CNDs selected from the list in Table 7. An example of a panel of 10 CNDs is presented in Table 6, which can be detected, in an amplification-dependent method, by the primers and probes defined in Table 2 or 3.

[0037] Accordingly, the present specification is instructional on an assay to quantitate a target nucleic acid in a mixture of target and non-target nucleic acids in a sample, the assay comprising: (i) isolating and/or enriching cell-free nucleic acid from the sample; (ii) subjecting the cell-free nucleic acid to either an amplification reaction with primers which target a heterozygous or homozygous form of a CND polymorphism which is present in the target and absent in the non-target nucleic acid or to amplification-independent conditions to determine the CND polymorphism; and (iii) determining the amount of target nucleic acid based on the level of amplified product or on sequence read data.

[0038] In this embodiment, the non-target nucleic acid is genotypically null for the CND polymorphism meaning it does not contain a nucleic acid insert at the same locus or location compared to the target nucleic acid which has 1 or 2 copies of the insertion.

[0039] The present specification further teaches an assay to quantitate a target nucleic acid in a mixture of target and non-target nucleic acids in a sample, the assay comprising: (i) isolating and/or enriching fragmented cell-free nucleic acid from the sample; (ii) subjecting the cell-free nucleic acid to either an amplification reaction with primers which target a heterozygous or homozygous form of a CND polymorphism which is present in the target and absent in the non-target nucleic acid or to amplification-independent conditions to determine the CND polymorphism; and (iii) determining the amount of target nucleic acid based on the level of amplified product or on sequence read data.

[0040] Taught herein is a method for quantitating the presence of a target nucleic acid in a sample comprising a mixture of target and non-target nucleic acid, the method comprising selecting a CNV such as a CND polymorphism wherein the target nucleic acid is heterozygous or homozygous for the CNV polymorphism and the non-target nucleic acid is genotypically null for the CNV polymorphism; and (i) isolating and/or enriching the sample for cell-free fragmented nucleic acid; and (ii) subjecting the mixture of cell-free nucleic acid to either an amplification reaction with primers which target the CNV polymorphism internally and/or flanking the polymorphism wherein the level of a specific product is indicative of the amount of target nucleic acid or subjecting the mixture to amplification-independent conditions to target the CNV polymorphism wherein the level of a target CNV is determined by sequence read data.

[0041] In an embodiment, the target nucleic acid is cell-free fetal DNA present in a maternal fluid sample comprising a mixture of fetal and maternal DNA.

[0042] Hence, the present specification teaches a method for quantitating the presence of fetal DNA in a maternal fluid sample comprising fetal and maternal DNA, the method comprising: (i) isolating and/or enriching cell-free DNA from the maternal sample; (ii) subjecting the cell-free DNA to either an amplification reaction with primers which target a heterozygous or homozygous form of a CNV polymorphism which is present in fetal DNA and absent in the maternal DNA or to amplification-independent conditions to target the CNV; and (iii) determining the amount of fetal DNA based on the level of amplified product or on sequence read data.

[0043] In an example, the level of fetal DNA in a maternal sample can be indicative of pathological damage to the fetus and/or to the placenta. In an example it is indicative of nucleic acid such as DNA being released by cytotrophoblast in the placenta. In an embodiment, circulating fetal nucleic acid including DNA or levels thereof is indicative of preeclampsia, pathological damage to the fetus, cellular damage to the placenta or a related condition.

[0044] In an example, the fetal DNA can also be subject to genetic testing including quantitative sequence analysis. Genetic testing includes testing for treatable or non- treatable health problems that can affect the health of the fetus. In an example, the genetic testing includes testing for birth defects, genetic abnormality, genetically inherited pathologies, fetal abnormalities and/or paternity.

[0045] In an example, the level of fetal DNA in a maternal sample can be indicative of the accuracy of a genetic testing result. For example, a low level of DNA indicates a low degree of accuracy for a genetic test and a high level of DNA indicates a high degree of accuracy for a genetic test.

[0046] In one example, a high or low level of DNA is assessed in the context of identifying the fetal fraction. The fractional concentration of fetal DNA in maternal serum during early pregnancy is around about 0.39% to about 11.9% (mean 3.4%). In late pregnancy, the fraction of fetal DNA in plasma is around about 2.33% to 11.4% (mean 6.2%).

[0047] In one example, a fetal fraction of less than about 3% is likely to give an inconclusive result or a result with a low degree of accuracy. In one example a low level of DNA is less than about 3%.

[0048] In another example, a fetal fraction of more than 5 or 6% indicates an unhealthy foetus. In another example, a fetal fraction of more than 11% indicates an unhealthy foetus.

[0049] In some embodiments, a clinical action is performed based on the level of fetal DNA in a maternal sample. For example, if the level of fetal DNA is indicative of an unhealthy fetus, such as the presence of preeclampsia or a related condition, the clinical action would include treating preeclampsia or a related condition. In another example, the clinical action would include performing additional testing. If the level of fetal DNA is too low to provide an accurate genetic testing result, the additional testing could include ordering a further maternal sample for genetic testing. The additional testing could also include alternative means of genetic testing, for example, amniocentesis or chorion villus biopsy. If the level of fetal DNA is sufficient and genetic testing has not been performed, the clinical action can include ordering genetic testing on the maternal sample.

[0050] In another example, the present disclosure relates to a non-invasive in-vitro assay comprising quantitating the level of non-self DNA according to the methods of the present disclosure and then determining a patients response to immunotherapy based on the level of non-self DNA.

[0051] In an embodiment, the CNV is a CND.

[0052] In an embodiment, a panel of from 2 to 41 CNDs are selected from Table 7. In an embodiment, the panel comprises 10 to 30 CNDs selected from Table 7 which includes a panel of from 10 to 20 CNDs selected from Table 7 as well as a panel comprising at least 10 CNDs selected from Table 7. An example of a 10 CND panel is presented in Table 6, which can be detected using an amplification-dependent method by the primers and probes listed in Table 2 or 3 or alternatively by amplification-independent methods such as NGS or NanoString technology.

[0053] The present specification teaches a method for quantitating the presence of fetal DNA in a maternal fluid sample comprising fetal and maternal DNA, the method comprising: (i) isolating and/or enriching cell-free DNA from the maternal sample; (ii) subjecting the cell-free DNA to either an amplification reaction with primers which target a heterozygous or homozygous form of a CND polymorphism which is present in fetal DNA and absent in the maternal DNA or to amplification-independent conditions to targe the CND polymorphism; and (iii) determining the amount of fetal DNA based on the level of amplified product or on sequence read data.

[0054] In another aspect, the non-self DNA is from a transplanted organ or tissue including stem cells (non-self DNA) and the non-target nucleic acid is the host or recipient of the transplant (self DNA).

[0055] Hence, enabled herein is a method for quantitating the presence of non-self DNA in a transplant recipient sample comprising self and non-self DNA, the method comprising: (i) isolating and/or enriching cell-free DNA from the transplant recipient sample; (ii) subjecting the cell-free DNA to either an amplification reaction with primers which target a heterozygous or homozygous form of a CNV polymorphism which is present in non-self DNA but absent in self DNA or to amplification-independent conditions to target the CNV; and (iii) determining the amount of non-self DNA based on the level of amplified product or on sequence read data.

[0056] In another example, the level of non-self DNA provides an indication of the health of the transplant. For example, an increased level of DNA indicates damage or rejection of the transplant. In this example, an increased level of DNA may indicate that an immunotherapy treatment regimen should be initiated or amended.

[0057] In an embodiment, the CNV is a CND. In an embodiment, a panel of from 2 to 41 CNDs are selected from Table 7. In an embodiment, the panel comprises from 10 to 30 CNDs selected from Table 7. This includes a panel of from 10 to 20 as well as a 10 CND panel selected from Table 7. An example of a panel of 10 CNDs is presented in Table 6 and can be detected using an amplification-dependent method by the primers and probes listed in Table 2 or 3 or by amplification-independent means such as NGS and NanoString technology.

[0058] Enabled herein is a method for quantitating the presence of non-self DNA in a transplant recipient sample comprising self and non-self DNA, the method comprising: (i) isolating and/or enriching cell-free DNA from the transplant recipient sample; (ii) subjecting the cell-free DNA to either an amplification reaction with primers which target a heterozygous or homozygous form of a CND polymorphism which is present in non-self DNA but absent in self DNA or to amplification-independent conditions to target the CND; and (iii) determining the amount of non-self DNA based on the level of amplified product or based on sequence read data.

[0059] Further enabled is a kit for quantitating target nucleic acid in a mixture of target and non-target nucleic acid comprising primers for use in an amplification reaction which target a CNV polymorphism present in target nucleic acid but absent in non-target nucleic acid. The CNV polymorphism may be heterozygous or homozygous. In an embodiment, the CNV is a CND polymorphism. Alternatively, the kit comprises components required for amplification-independent detection systems such as NGS and NanoString technology.

[0060] In an embodiment, the nucleic acid is DNA, generally genomic DNA which includes fragmented DNA. In an embodiment, the target DNA is non-self DNA (e.g. fetal or transplant DNA) which comprises a non-delete-allele (1 or 2 copy genotype) whereas the non-target DNA is self DNA (e.g. host or maternal DNA) which comprises the "null" or 0 copy genotype (bi- allelic genomic deletion). [0061] In an embodiment, the quantitated target nucleic acid is then subjected to quantitative sequence analysis such as but not limited to massive parallel sequencing (MPS). Alternatively, NGS or NanoString Technology is used.

[0062] Enabled herein is a method for analyzing target nucleic acid in a sample comprising a mixture of target and non-target nucleic acid in a sample, the method comprising: (i) isolating and/or enriching cell-free nucleic acid from the sample; (ii) subjecting the cell-free nucleic acid to either an amplification reaction with primers which target a heterozygous or homozygous form of a CNV polymorphism which is present in the target nucleic acid and absent in the non-target nucleic acid or to amplification- independent conditions to target the CNV polymorphism; and (iii) determining the amount of target nucleic acid based on the level of amplified product or based on sequence read data.

[0063] In an embodiment, the CNV is not located in an HLA locus.

[0064] Another embodiment enabled herein is a set of primers for use in an amplification reaction which target a heterozygous or homozygous form of a CNV polymorphism such as a CND polymorphism which is present in a target nucleic acid but absent in a non-target nucleic acid; wherein the amount of amplified product correlates with the level of target nucleic acid.

[0065] In an example, the subject is a human.

[0066] In an example, the present disclosure relates to the use of the primers disclosed herein in the manufacture of a non-invasive in-vitro diagnostic assay for performing the method of the present disclosure.

[0067] Abbreviations used in the specification are defined in Table 1.

Table 1

Abbreviations

Abbr viation Ι Ϊηϊίί η

Cell- free

cfDNA Cell-free DN

ccfDMA Circulating cell-free DNA

CND Copy irnber deletion (also CNV deletion)

Panel of CND markers

^■CNV Copy number variation

Cq Quantificatioo cycle (also known as Ct [threshold cycle])

Ct Cycle threshold

CtCV Cycle threshold coefficient of variation

ΐϊΕ Genomic copy (IGE = 6.t pg DNA pel inL)

MPS Massively parallel sequencing

NiPD Noninvasive prenatal diagnosis

Null genotype Bl-ailelic CND

PCE Polymerase chain reaction

"qPC ^" Quantitative PCR

[0068] Nucleotide and amino acid sequence are referred to by a sequence identifier number (SEQ ID NO), The SEQ ID NQs correspond numerically to die sequence identifiers <400>i (SEQ ID NO: 1 ), <40Q>2 (SEQ ID NG:2), etc. A. summary of the sequence identifiers is provided in Table 2, A sequence listing is provided after the claims, {0069] A suoiniary of sequence identifiers used throughout the subject specification is provided in Table 2,

Table 2

Summary of sequence identifiers

BRIEF DESCRIPTION OF THE FIGURES

[0070] Some figures contain color representations or entities. Color photographs are available from the Patentee upon request or from an appropriate Patent Office. A fee may be imposed if obtained from a Patent Office. Figure 1 is a diagrammatic and photographic representation showing (a) CND_01 Internal PCR: Shaded region indicates the deleted segment. Lanes 2, 22 are amplification control samples without the deletion and lane 21 is a control sample with the deletion as a negative amplification control. Twelve of the 21 samples (including the negative amplification were not amplified (i.e. these are a null copy as the samples contain a deleted region); nine of the 21 samples including the control samples in lanes 2 and 22, an amplified product was detected indicating that these samples have 1 or 2 copies of the allele; lanes 1 and 24 - Marker and lane 23 - blank (b) CND_01 External PCR: Lanes 2, 22 are the same 21 control samples as in (a). Nineteen of the 21 samples 19/21 are null or 1 copy; 2/21 are 2 copy wild-type (arrowed) the template is not amplified due to its large size.; lane 1 and 24 - Marker VIII and lane 23 - blank. Figure 2 is a graphical representation of a spiking experiment of CND_01 loci - Correlation for Expected vs. Observed GE: values.

[0071] Figure 3 is a graphical representation of CNV-deletion qPCR assay on a maternal sample. The β-globin (HBB) gene was used as an internal reference. Fetal DNA was detected using the CNV-deletion method (CND10-70GE/ml). A standard curve based quantitation method was used to detect and quantitate non-self DNA in the plasma samples. Figure 4 is a graphical representation of null genotype frequency. Distribution of the number of "null" CNDs observed in the three respective population cohorts: 92 kidney transplant recipients (bold line), 93 controls from the local population (dashed line) and the HapMap publication data (dotted line). On average, a given sample was null for 5 CND markers. Figure 5 is a graphical representation of informative capacity of the CND panel. Observed and simulated projections of the number of informative markers obtained using panels of 10 (existing panel), 20 and 30 CNDs in unrelated donor-recipient pairs. The cumulative proportion for 0, at least 3 and at least 5 informative markers is given in the inset table. Figure 6 is a graphical representation of performance characteristics of the qPCR CND assays. Sensitivity of the assays was assessed in 2 ways. First, a 1-copy DNA control sample was used to spike a 0-copy DNA sample of known quantities. Second, a serial dilutions spanning 0 to 16,000GE were performed, with quadruple replicates. Precision and accuracy were determined by using a mixed effects model for the increase in levels over increasing concentrations. Figures 7A and B are graphical representations of time-course graphs of transplant-derived cefD^'NA levels in 4 patients. A) Two asymptomatic patients with stable biochemistry and no rejection events, B) Two "rejectors" with antibod -mediated rejection as determined by biopsy at the indicated time point. Treatment regime details, including commencement and termination dates, are indicated by arrows. Figure 8 is a graphical representation showing the comparison of CND-based measurement of fetal fraction to that obtained using an SRY quantitative PCR assay and SNP-based massively parallel sequencing data. Linear regression (Deming) showing much better agreement (for slopes and intercept values - see insert) between fetal fraction values calculated using CND-qPCR and SNP-based MPS data than those obtained by SRY q-PCR. Deming regression analysis was carried out using the R package "Method Comparisons Regression(mer)" from h$g?:/ cr¾n^ Figure 9 is a photographic representation of CND-based plasma ecfD A detection. (A) Qualitative internal PCR assay on cellular and plasma ccfDNA for CND02 from four control individuals. Cellular DNA: lane 2, 4, 6 and 8. Plasma DNA: lane 3, 5. 7 and 9 (lanes are arrowed and numbered). The size ladder is the DNA molecular weight marker VIII (Roche). (B) Detection of "non-self" ccfDNA in the plasma of a kidney transplant recipient The internal PCRs on recipient cellular DNA show that this patient is null for CND_02, CND„03 and CND_08 (i.e. absence of a band at around 60bp). PCRs for CND_03 and CND_08 on DNA isolated from recipient plasma demonstrate presence of "non-self, transplant-derived DNA. The absence of detectable PCR product for the CNDJ32 assay on recipient plasma suggests that both recipient and donor were null for this CND. The size ladder is the DNA molecular weight marker ^'VIII (Roche). Figure 10 is a graphical representation showing (A) Amplification Plots for CND05 showing the standard curve (1-16,000 GE), no template control (NTC) and 0-copy DNA sample (1 ,000 GE input per 2.5 μΐ reaction); all run in triplicate. Amplification plots are color coded (see below X-axis); arrows also indicate the 1 GE, 0-copy DNA and NTC plots. The amplification plots for the 0-copy DNA reactions fall outside of the standard curve (i.e. are well below the threshold) indicating very low-level mis-amplification of non-target DNA. (B) The Ct (Cycle Threshold) Coefficient of Variation (CtCV ) for each CND assay is shown across the linear dynamic range (Table 7). Between 16-16,000 GE the CtCV% ranged from 0.1. ¾ to 1.7% (median 0.6%). The ClCV% (median) for the 4 GE triplicate reactions was 4.4 fold greater (2.6%) than, the median value for 1.6,000-1 GE reactions. This is consistent with a lower limit of quantification of 16 GE for these CND assays. Notably, reaction failures were recorded only for the 1 GE reactions (typically 1/2 out of 3 replicates failed) with no difference between CND qPCR assays.

[0072] Figure 11 is a bar graph demonstrating results from a 15 CND panel assay, colour coded by fluorescent hydrolysis probe reporting dye. The ACE marker is used to provide an estimate of two copy recipient positive levels (i.e. total cell-free DNA). CND assay results which fall within 30% of the ACE level (indicated by the dashed red line) are considered recipient two copy positive as well. CND assay results which fall within a 30% range of half of the ACE result (indicated by the dashed orange lines) are considered recipient one copy positive results. All remaining results falling below this range are reviewed as possible informative results. In Figure 11A (SID 1), CND markers 02B and 09B are recipient two copy positive results whilst CND markers 05B, 12B, 01B and 07B are recipient one copy positive results. CND markers 06B, 15B, 13B, 04B and 16B are informative (recipient negative, graft positive) results, and can be further broken into graft two copy (06B, 15B, 13B) and graft one copy (04B, 16B) informative results. Correcting for the graft two copy results by halving them, the mean graft-derived cell free DNA concentration in this sample (SID 1) is calculated to be 9 GE/mL (95% CI 8.1-9.9) based on five informative markers. In Figure 11B (SID 5), there are no two copy positive results. CND markers 18B, 09B, 19B, 12B and 06B are recipient one copy positive results. CND markers 14B, 02B and 3B are informative markers. Correcting CND markers 14B for its two copy number yields a mean graft-derived cell free DNA concentration in this sample (SID 5) of 10.5 (95% CI 5.1-15.9) GE/mL based on three informative markers.

[0073] Figure 12 is a Two Dimension Scatter Plot of digital PCR multiplex assay. The dots in the upper left hand side quadrant are Channel l(FAM) positive droplets, which corresponds to the ACE assay. The dots in the lower right hand side quadrant are channel 2(HEX) positive droplets, which corresponds to the CND19B assay. The dots in the lower left hand side quadrant are double positivity for both Channel l(FAM) and Channel 2(HEX). The ACE assay is reporting 180 positive droplets, which is about double that for CND19B (103 positive droplets). In this way, the multiplex assay combination of ACE and CND enables distinction between 1-copy and 2-copy CND targets, which is important for estimation of donor cfDNA level and fraction. DETAILED DESCRIPTION

[0074] Throughout this specification, unless the context requires otherwise, the word "comprise" or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element or integer or method step or group of elements or integers or method steps but not the exclusion of any element or integer or method step or group of elements or integers or method steps.

[0075] As used in the subject specification, the singular forms "a", "an" and "the" include plural aspects unless the context clearly dictates otherwise. Thus, for example, reference to "a CNV" includes a single CNV, as well as two or more CNVs; reference to "an assay" includes single assay, as well as two or more assays; reference to "the disclosure" includes a single and multiple aspects taught by the disclosure; and so forth. Aspects taught and enabled herein are encompassed by the term "invention". All such aspects are enabled within the width of the present invention.

[0076] As will be understood by those of skill in the art, various molecular techniques and DNA modification and detection methods utilized in the present disclosure are standard procedures, well known to those skilled in the art. Such techniques are described and explained throughout the literature in sources such as, J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory Press (1989), T.A. Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991), D.M. Glover and B.D. Hames (editors), and F.M. Ausubel et al. (editors), Current

Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, including all updates until present), Ed Harlow and David Lane (editors) Antibodies: A Laboratory Manual, Cold Spring Harbour Laboratory, (1988), and J.E. Coligan et al.

(editors) Current Protocols in Immunology, John Wiley & Sons (including all updates until present).

[0077] The term "and/or", e.g., "X and/or Y" shall be understood to mean either "X and Y" or "X or Y" and shall be taken to provide explicit support for both meanings or for either meaning.

[0078] As used herein, the term "about", unless stated to the contrary, refers to +/- 10%, more preferably +/- 5%, of the designated value.

[0079] It is envisaged that the methods of the present disclosure can be performed in- vitro as an in-vitro method or an in-vitro assay.

[0080] The term "method" and "assay" may be used interchangeably depending on the context. In essence, the assay is performed on a sample potentially comprising a heterogeneous mixture of nucleic acids of target and non-target nucleic acids. In an embodiment, the sample is a fluid sample from a subject and the nucleic acid is cell-free (cf) nucleic acid such as cfDNA. It may also be referred to as circulating cell-free (ccf) nucleic acid. Examples of fluid samples include serum, plasma whole blood, urine, lymph fluid, sputum and tissue fluid. The sample may be treated to remove whole cells such as by centrifugation, affinity chromatography (e.g. immunoabsorbent means) and filtration. In an embodiment, the nucleic acid is fragmented and the sample is enriched for fragmented cell-free nucleic acid.

[0081] The sample is generally from a subject. The term "subject" as used herein refers to an animal, including a mammal such as a primate including a lower primate and higher primate such as a human who can benefit from the assay enabled herein. A subject regardless of whether a human or non-human animal or embryo may be referred to as an individual, subject, animal, patient, host or recipient. The assay disclosed herein has both human and veterinary applications. For convenience, an "animal" specifically includes livestock animals such as cattle, horses, sheep, pigs, camels, goats and donkeys. With respect to horses, these include horses used in the racing industry as well as those used recreationally or in the livestock industry.

[0082] Examples of laboratory test animals include mice, rats, rabbits, guinea pigs and hamsters. Rabbits and rodent animals, such as rats and mice, provide a convenient test system or animal model as do primates and lower primates.

[0083] Taught herein is a procedure to quantitate a target nucleic acid in a mixture of target and non-target nucleic acids for the purpose of nucleic acid analysis. The assay described herein detects and quantitates chimerism with respect to nucleic acids in a sample. Chimerism is the co-existence of nucleic acids originating from heterologous subjects or sources. The target nucleic acid type may be present in low to high levels relative to non-target nucleic acids. In an embodiment, the target nucleic acid is, for example, nucleic acid of fetal or allergenic cell origin. In this context, the non-target nucleic acid is the host (e.g. pregnant maternal subject or transplant recipient).

[0084] The present disclosure teaches an assay for quantitating target nucleic acid in a heterogeneous mixture of nucleic acids (target and non-target nucleic acids). In an embodiment, the assay allows for the detection of low levels of target nucleic acid which could otherwise lead to test failures, false negatives or equivocal results. The assay is predicated in part on detecting target nucleic acid based on copy number variation (CNV) wherein the non-target nucleic acid has a null genotype (homozygous absence) of the CNV and the target nucleic acid is genotypically 1 copy (heterozygous presence) or 2 copies (homozygous presence) of the CNV. This is described as the non-target nucleic acid having a null genotype and the target nucleic acid having a 1 or 2 copy genotype. Hence, described herein is an approach that takes advantage of the ubiquity of polymorphic CNV loci in genomes. In an embodiment, the CNV is not located in an HLA locus.

[0085] In an embodiment, the assay comprises:

(1) selecting a CNV polymorphism wherein the target nucleic acid is genotypically heterozygous or homozygous for the CNV polymorphism and the non-target nucleic acid is genotypically null for the CNV polymorphism;

(2) isolating and/or enriching a sample of cell-free nucleic acid including fragmented nucleic acid; and

(3) subjecting the mixture of cell-free nucleic acid to an amplification reaction with primers which target the CNV polymorphism;

wherein the level of amplification product correlates to the amount of target nucleic acid.

[0086] For example, the assay can comprise:

[0087] wherein the level of amplification product correlates to the amount of target nucleic acid.In an alternative, the assay comprises:

( 1) selecting a CNV polymorphism wherein the target nucleic acid is genotypically heterozygous or homozygous for the CNV polymorphism and the non-target nucleic acid is genotypically null for the CNV polymorphism;

(3) subjecting the mixture to amplification-independent detection means to identify the target CNV polymorphism;

wherein the sequence read data determine the amount of target nucleic acid. [0088] In an embodiment, the "target" nucleic acid is referred to as the "non-self" nucleic acid and the non-target is referenced to as the "self" nucleic acid. Hence, the method described herein quantitates nucleic acid chimerism in the form of non-self (target) nucleic acid in a mixture of self (non-target) nucleic acid. In pregnant females, the target nucleic acid is from the fetus and the non-target nucleic acid is from the pregnant mother. For a transplant patient, target nucleic acid is from the transplanted tissue while the non- target nucleic acid is from the transplant recipient.

[0089] Taught herein is a method for quantitating the presence of a target nucleic acid in a mixture of target and non-target nucleic acid, the method comprising screening the mixture for the presence of a heterozygous or homozygous form of a CNV in target nucleic acid which is absent in non-target nucleic acid. Enabled herein is a method for detecting the presence of a target DNA in a mixture of target and non-target DNA, the method comprising screening the mixture for the presence of a heterozygous or homozygous form of a CNV which is present in the target DNA but absent in the non-target DNA.

[0090] Screening is in one embodiment by an amplification reaction using primers which target the CNV. The level of amplified product directly correlates the level of target nucleic acid. In an alternative embodiment, screening is by amplification-independent detection means such as NGS or NanoString technology. In relation to NGS, the amount of target nucleic acid is based on sequence read data.

[0091] Taught herein is a method for quantitating the presence of a target nucleic acid in a mixture of target and non-target nucleic acid in a sample, the method comprising: (i) isolating and/or enriching cell-free nucleic acid from the sample; (ii) subjecting the cell- free nucleic acid to amplification independent detection means which target a heterozygous or homozygous form of a CNV polymorphism which is present in the target nucleic acid and absent in the non-target nucleic acid; and (iii) determining the amount of target nucleic acid based sequence read data.

[0092] Enabled herein is a method for quantitating a target nucleic acid in a sample comprising a mixture of target and non-target nucleic acid, the method comprising selecting a CNV polymorphism wherein the target nucleic acid is heterozygous or homozygous for the CNV polymorphism and the non-target nucleic acid is genotypically null for the CNV polymorphism; and (i) isolating and/or enriching the sample for cell-free nucleic acid; and (ii) subjecting the mixture of cell-free nucleic acid to amplification independent detection means which target the CNV polymorphism internally and/or flanking the polymorphism wherein the level of sequence read data is indicative of the amount of target nucleic acid.

[0093] In one example, more than one CNV is identified using the methods of the present disclosure. For example, at least 2 CNV's can be identified and assessed via the methods of the present disclosure. In another example, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18 at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41 CNV's are identified and assessed.

[0094] In an embodiment, a CNV polymorphism is selected from a panel of CNVs. In one aspect, the panel comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 CNVs.

[0095] In an embodiment, the CNV is a CNV-deletion (copy number deletion [CND]) wherein one of the non-target DNA is homozygous deleted (null genotype, 0 copy) and the other of the target nucleic acid is heterozygous present (1 copy) or homozygous present (2 copies). Hence, the target will have one or two copies of the nucleic acid insert at a defined locus which is homozygous absent in the non-target nucleic acid. In an embodiment, a CNV is selected which is not located in an HLA locus.

[0096] Taught herein is a method for quantitating the present of a target nucleic acid in a mixture of target and non-target nucleic acid in a sample, the method comprising: (i) isolating and/or enriching cell-free nucleic acid from the sample; (ii) subjecting the cell- free nucleic acid to amplification independent detection means which target a heterozygous or homozygous form of a CND polymorphism which is present in the target nucleic acid and absent in the non-target nucleic acid; and (iii) determining the amount of target nucleic acid based on sequence read data.

[0097] In another example, more than one CND is identified using the methods of the present disclosure. For example, at least 2 CND's can be identified and assessed via the methods of the present disclosure. In another example, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18 at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41 CND's are identified and assessed.

[0098] In an embodiment, a CND polymorphism is selected from a panel of CNDs. In one aspect, the panel comprises from 2 to 41 CNDs selected from the list presented in Table 7. By "2 to 41" means 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 CNDs. In an embodiment, the panel comprises from 10 to 30 CNDs selected from the list in Table 7. In another embodiment, the panel comprises from 10 to 20 CNDs selected from the list in Table 7. In another embodiment, a panel comprises 10 CNDs selected from Table 7. An example of a panel of 10 CNDs is defined in Table 6. Such CNDs can be detected using primers and probes defined in Table 2 or 3.

[0099] In an alternative, determination of the target nucleic acid is by amplification-independent means. Taught herein is a method for quantitating the presence of a target nucleic acid in a mixture of target and non-target nucleic acid in a sample, the method comprising: (i) isolating and/or enriching cell-free nucleic acid from the sample; (ii) subjecting the cell-free nucleic acid to amplification-independent detection means which target a heterozygous or homozygous form of a CNV polymorphism which is present in the target nucleic acid and absent in the non-target nucleic acid; and (iii) determining the amount of target nucleic acid based sequence read data.

[00100] Enabled herein is a method for quantitating a target nucleic acid in a sample comprising a mixture of target and non-target nucleic acid, the method comprising selecting a CNV polymorphism wherein the target nucleic acid is heterozygous or homozygous for the CNV polymorphism and the non-target nucleic acid is genotypically null for the CNV polymorphism; and (i) isolating and/or enriching the sample for cell-free nucleic acid; and (ii) subjecting the mixture of cell-free nucleic acid to amplification-independent detection means which target the CNV polymorphism internally and/or flanking the polymorphism wherein the level of sequence read data is indicative of the amount of target nucleic acid.

[00101] In an embodiment, the CNV is a CNV-deletion (copy number deletion [CND]) wherein one of the non- target DNA is homozygous deleted (null genotype, 0 copy) and the other of the target nucleic acid is heterozygous present (1 copy) or homozygous present (2 copies). Hence, the target will have one or two copies of the nucleic acid insert at a defined locus which is homozygous absent in the non-target nucleic acid. In an embodiment, a CNV is selected which is not located in an HLA locus.

[00102] Taught herein is a method for quantitating the presence of a target nucleic acid in a mixture of target and non-target nucleic acid in a sample, the method comprising: (i) isolating and/or enriching cell-free nucleic acid from the sample; (ii) subjecting the cell-free nucleic acid to amplification-independent detection means which target a heterozygous or homozygous form of a CND polymorphism which is present in the target nucleic acid and absent in the non-target nucleic acid; and (iii) determining the amount of target nucleic acid based on sequence read data.

[00103] As each informative CND provides an independent measure of non-self DNA, an additional benefit afforded by this approach is the ability to use the unique marker profile of each recipient to reveal sample mix-ups as well as the presence of exogenous (non-transplant derived) ccfDNA that may arise from some medical interventions (e.g. plasma pheresis). This approach also allows for ready identification and handling of outliers. This is especially relevant for removing measurements derived from 2-copy DNA that arise when the donor is homozygous wild type for a given CND locus.

[00104] The signal strength of the amplified product is proportional to the amount of target nucleic acid. Hence, taught herein is a method for detecting and quantitating the target nucleic acid. In an embodiment, an additional step includes isolating and/or enriching for fragmented cell-free nucleic acid. In an embodiment, the method is partially based on solid phase or digital amplification and/or nucleic acid capture. Alternatively, sequence read data determine the level of target nucleic acid.

[00105] Taught herein is a method for quantitating a target nucleic acid in a mixture of target and non-target nucleic acid in a sample, the method comprising: (i) isolating and/or enriching fragmented cell-free nucleic acid from the sample; (ii) subjecting the cell-free nucleic acid to either an amplification reaction with primers which target a heterozygous or homozygous form of a CNV polymorphism which is present in the target nucleic acid and absent in the non-target nucleic acid or to amplification-independent means; and (iii) determining the amount of target nucleic acid based on the level of amplified product or based on sequence read data.

[00106] In an embodiment, the nucleic acid is present in circulating fluid in a subject such as but not limited to serum, plasma, whole blood, urine, lymph fluid, sputum or tissue fluid. A fluid sample may be treated to separate fluid from whole cells. The "fluid" is regarded as a sample, generally from a subject. Generally, the sample is circulating fluid.

[00107] Enabled herein is an assay to quantitate target nucleic acid in circulating fluid comprising target and non-target nucleic acids, the assay comprising subjecting the mixture to cell removal means and then to an either amplification reaction with primers that target a selected CNV locus wherein the target nucleic acid is heterozygous or homozygous for the CNV locus and the non-target nucleic acid is genotypically null for the CNV locus and screening for the level of amplification product wherein the level of the amplification product is indicative of amount of target or to amplification-independent detection means to target the CNV.

[00108] The cell removal means includes centrifugation, affinity chromatography (e.g. immunoabsorbent means) and filtration. Amplification-independent detection means include NGS and NanoString technology. Amplification-dependent assays include qPCR.

[00109] The term "nucleic acid" as used herein designates single- or double-stranded DNA, mRNA, RNA, cRNA, RNAi and includes cDNA, genomic DNA such as fragmented genomic DNA and DNA-RNA hybrids. Generally, the nucleic acid tested in the cells is chromosomal (genomic) DNA.

[00110] Taught herein is a method for detecting the presence of a target DNA in a mixture of target and non-target DNA in a sample, the method comprising screening the mixture for the presence of a CNV the target DNA which is absent in non-target DNA.

[00111] Taught herein is a method for detecting the presence of a target DNA in a mixture of target and non-target fragmented DNA in a sample, the method comprising screening the mixture for the presence of a CNV in the target DNA which is absent in the non-target DNA.

[00112] Various methods of isolating and/or enriching DNA, in particular genomic DNA such as fragmented genomic DNA are known to those of skill in the art. In general, known methods involve disruption and lysis of the starting material followed by the removal of proteins and other contaminants and finally recovery of the DNA. For example, techniques involving alcohol precipitation; organic phenol/chloroform extraction and salting out have been used for many years to extract and isolate DNA. One example of DNA isolation is exemplified below. However, there are various other commercially available kits for genomic DNA extraction (Life technologies; Qiagen). Purity and concentration of DNA can be assessed by various methods, for example,

spectrophotometry .

[00113] Enabled herein is a method for detecting a target DNA in a mixture of target and non-target fragmented DNA in a sample, the method comprising selecting a panel of two or more CNV loci of which at least one is present in the target DNA and absent in non-target DNA, subjecting the mixture of DNA to either amplification conditions which amplify a CNV locus in the target DNA and screening for the level of amplified DNA products which is indicative of target DNA or to amplification-independent detection means wherein sequence read data determine the amount of target DNA.

[00114] The present specification is instructional on an assay to quantitate a target nucleic acid in a mixture of target and non-target nucleic acids in a sample, the assay comprising: (i) isolating and/or enriching cell-free nucleic acid from the sample; (ii) subjecting the cell-free nucleic acid to either an amplification reaction with primers which target a heterozygous or homozygous form of a CND polymorphism which is present in the target and absent in the non-target nucleic acid or to amplification-independent detection means wherein sequence read data determine the amount of targe nucleic acid; and (iii) determining the amount of target nucleic acid based on the level of amplified product or sequence read data.

[00115] Taught herein is a method for quantitating the presence of a target nucleic acid in a sample comprising a mixture of target and non-target nucleic acid, the method comprising selecting a CNV such as a CND polymorphism wherein the target nucleic acid is heterozygous or homozygous for the CNV polymorphism and the non-target nucleic acid is genotypically null for the CNV polymorphism; and (i) isolating and/or enriching the sample for cell-free fragmented nucleic acid; and (ii) subjecting the mixture of cell-free nucleic acid to either an amplification reaction with primers which target the CNV polymorphism internally and/or flanking the polymorphism wherein the level of a specific product is indicative of the amount of target nucleic acid to amplification-independent detection means wherein sequence read data determine the amount of target nucleic acid.

[00116] Examples of CNDs are listed in Table 7. In an embodiment, a CND is selected from a panel of from 2 to 41 including from 10 to 30 or 10 to 20 including 10 CNDs selected from Table 7. One particular panel of 10 is defined in Table 6 which may be detected in an amplification-based method using the primers and probes defined in Table 2 or 3.

[00117] The present specification is instructional for a method for quantitating of a target DNA in a mixture of target and non-target DNA in a sample, the method comprising selecting a CNV polymorphism wherein the target DNA is heterozygous or homozygous for the CNV polymorphism and the non-target DNA is genotypically null for the CNV polymorphism; and (i) isolating and/or enriching the sample for cell-free DNA; and (ii) subjecting the mixture of cell-free DNA to either an amplification reaction with primers which target the CNV polymorphism internally and/or flanking the polymorphism wherein the level of a specific product is indicative of the amount of target DNA or to amplification-independent detection means wherein sequence read data determine the amount of target DNA.

[00118] Further taught herein is a method for quantitating a target DNA in a mixture of target and non-target DNA, the method comprising selecting a CNV polymorphism wherein the target DNA is heterozygous or homozygous for the CNV polymorphism and the non-target DNA is genotypically null for the CNV polymorphism; and (i) isolating and/or enriching the sample for cell-free DNA; and (ii) subjecting the mixture of cell-free DNA to either an amplification reaction with primers which target the CNV polymorphism internally and/or flanking the polymorphism wherein the level of a specific product is indicative of the amount of target DNA or to amplification-independent detection means wherein sequence read data determine the amount of target DNA, wherein the target DNA is subjected to genetic analysis.

[00119] By "genetic analysis" includes screening for mutations, SNPs or methylation patterns associated with a disease or condition as well as subjecting the target nucleic acid to quantitative or semi-quantitative sequence analysis using for example, qPCR, digital PCR, massive parallel sequencing, NGS, NanoString technology, methylation array.

[00120] In an embodiment, the circulating fluid is from a pregnant female subject and the target nucleic acid is fetal DNA. The level of fetal circulating cell-free DNA (fetal ccfDNA) can be a guide to the stage and health of the pregnancy and the state of health of the placenta and can also ensure that there is sufficient fetal DNA to undertake any genetic testing with a reduced risk of false negatives or equivocal results. In an embodiment it is indicative of nucleic acid such as DNA being released by cytotrophoblast in the placenta. In an embodiment, circulating fetal nucleic acid including DNA or levels thereof is indicative of preeclampsia or a related condition. The ability to quantitate target nucleic acid such as target DNA enables application of quantitation sequencing analysis technology such as MPS methods or read counting of fragmented nucleic acid in fluid based on a sufficient level of target nucleic acid.

[00121] Hence, also taught herein is a method for quantitating fetal cfDNA in a mixture of pregnant female host and fetal cfDNA, the method comprising screening the mixture for the presence of a CNV in the fetal cfDNA which is absent in the maternal cfDNA.

[00122] Hence, the present specification teaches a method for quantitating the presence of fetal DNA in a maternal fluid sample comprising fetal and maternal DNA, the method comprising: (i) isolating and/or enriching cell-free DNA from the maternal sample; (ii) subjecting the cell-free DNA to either an amplification reaction with primers which target a heterozygous or homozygous form of a CNV polymorphism which is present in fetal DNA and absent in the maternal DNA or to amplification-independent detection means; and (iii) determining the amount of fetal DNA based on the level of amplified product or based on sequence read data.

[00123] As indicated above, the level of fetal DNA in a maternal sample can be indicative of pathological damage to the fetus and/or to the placenta. The circulating cell free DNA may be derived from the placenta from cytotrophoblastic cells. In an example, the level of fetal DNA in a maternal sample can be indicative of a pathological condition. For example, the level of fetal DNA in a maternal sample can be indicative of preeclampsia.

[00124] In an embodiment, the CNV is a CND. Examples of CNDs are listed in Table 7. In an embodiment, a CND is selected from a panel of from 2 to 41 including from 10 to 30 or 10 to 20 including 10 CNDs selected from Table 7. One particular panel of 10 is defined in Table 6 which may be detected in an amplification-based method using the primers and probes defined in Table 2 or 3.

[00125] The present specification teaches a method for quantitating the presence of fetal DNA in a maternal fluid sample comprising fetal and maternal DNA, the method comprising: (i) isolating and/or enriching cell-free DNA from the maternal sample; (ii) subjecting the cell-free DNA to either an amplification reaction with primers which target a heterozygous or homozygous form of a CND polymorphism which is present in fetal DNA and absent in the maternal DNA or to amplification-independent detection means; and (iii) determining the amount of fetal DNA based on the level of amplified product or based on sequence read data.

[00126] Enabled herein is a method for quantitating fetal cfDNA in a sample comprising a mixture of pregnant female host and fetal cfDNA, the method comprising selecting a CNV polymorphism wherein fetal cfDNA is heterozygous or homozygous for the CNV polymorphism and the host cfDNA is genotypically null for the CNV polymorphism; and (i) isolating and/or enriching the sample for cfDNA; and (ii) subjecting the mixture of cfDNA to either an amplification reaction with primers which target the CNV polymorphism internally and/or flanking the polymorphism wherein the level of a specific product is indicative of the amount of fetal cfDNA or to amplification- independent detection means wherein the sequence read data determine the amount of cfDNA.

[00127] In an embodiment, the CNV is a CND. Examples of CNDs are listed in Table 7. In an embodiment, a CND is selected from a panel of from 2 to 41 including from 10 to 30 or 10 to 20 including 10 CNDs selected from Table 7. One particular panel of 10 is defined in Table 6 which may be detected in an amplification-based method using the primers and probes defined in Table 2 or 3.

[00128] In an embodiment, the fetal and host cfDNA are fragmented.

[00129] In an embodiment, the fetal cfDNA identified is subject to further genetic testing.

[00130] Taught herein is a method for detecting and quantitating fetal cfDNA in a sample comprising a mixture of maternal and host cfDNA, the method comprising selecting a CND polymorphism wherein the fetal cfDNA is heterozygous or homozygous for the CND polymorphism and the maternal cfDNA is genotypically null for the CND polymorphism; and (i) isolating and/or enriching the sample for fragmented cfDNA; and (ii) subjecting the mixture of cfDNA to either an amplification reaction with primers which target the CND polymorphism internally and/or flanking the polymorphism wherein the detection of a specific product is indicative of the presence and amount of fetal cfDNA or to amplification-independent detection means wherein the sequence read data determines the presence and amount of fetal cfDNA.

[00131] In an embodiment, provided herein is a method for analyzing cell-free fetal DNA in a maternal cell-free sample comprising a mixture of fetal and maternal DNA, the method comprising selecting a CNV polymorphism wherein the fetal DNA is heterozygous or homozygous for the CNV polymorphism and the maternal DNA is genotypically null for the CNV polymorphism; and (i) isolating and/or enriching the sample for cell-free DNA; and (ii) subjecting the mixture of cell-free DNA to either an amplification reaction with primers which target the CNV polymorphism internally wherein the level of a specific amplified product is indicative of the amount of fetal DNA or amplification-independent detection means; then subjecting the fetal DNA to genetic testing or a quantitative sequence analysis such as MPS, NGS or NanoString technology.

[00132] In an embodiment, the pregnant female host is a pregnant female human subject. In an embodiment, the DNA is fragmented and the method includes isolating and enriching for fragment DNA.

[00133] Other applications include monitoring the health of transplanted tissues or organs. In this case, the target DNA is non-self DNA from the transplanted material. The presence of non-self DNA may indicate apoptosis or necrosis of the transplanted tissue.

[00134] Hence, taught herein is a method for quantitating target non-self DNA in a host comprising self DNA, the method comprising screening a fluid mixture for the presence of a CNV in non-self DNA which is absent in the DNA.

[00135] Further taught herein is a method for quantitating non-self DNA in a host comprising self DNA, the method comprising selecting a panel of two or more CNV loci of which at least one is present in the non-self DNA and absent in self DNA, subjecting the mixture of non-self and self DNA to either amplification conditions which amplify a CNV locus in the non-self DNA and screening for the level of amplified non-self DNA products which is indicative of the amount of non-self DNA or to amplification-independent detection means wherein the sequence read data determine the amount of non-self DNA.

[00136] Enabled herein is a method for quantitating the presence of non-self DNA in a transplant recipient sample comprising self and non-self DNA, the method comprising: (i) isolating and/or enriching cell-free DNA from the transplant recipient sample; (ii) subjecting the cell-free DNA to either an amplification reaction with primers which target a heterozygous or homozygous form of a CNV polymorphism which is present in non-self DNA but absent in self DNA or to amplification-independent detection means; and (iii) determining the amount of non-self DNA based on the level of amplified product product or sequence read data.

[00137] Enabled herein is a method for quantitating the presence of non-self DNA in a transplant recipient sample comprising self and non-self DNA, the method comprising: (i) isolating and/or enriching cell-free DNA from the transplant recipient sample; (ii) subjecting the cell-free DNA to either an amplification reaction with primers which target a heterozygous or homozygous form of a CND polymorphism which is present in non-self DNA but absent in self DNA or to amplification-independent detection means; and (iii) determining the amount of non-self DNA based on the level of amplified product or sequence read data.

[00138] Enabled herein is a method for quantitating the presence of non-self cell-free nucleic acid such as DNA in a sample comprising a mixture of self and non-self cell-free nucleic acid, the method comprising selecting a CNV such as a CND polymorphism wherein the non-self nucleic acid is heterozygous or homozygous for the CNV polymorphism and the self nucleic acid is genotypically null for the CNV polymorphism; and (i) isolating and/or enriching the sample for cell-free nucleic acid including fragmented nucleic acid; and (ii) subjecting the mixture of cell-free nucleic acid to either an amplification reaction with primers which target the CNV polymorphism internally and/or flanking the polymorphism wherein the level of a specific product is indicative of the amount of non-self nucleic acid or to amplification-independent detection means wherein the sequence read data determine the amount of non-self nucleic acid.

[00139] The presence or amount of non-self nucleic acid correlates to apoptosis of a transplanted organ or tissue.

[00140] The amount of non-self DNA can be measured in GE/ml.

[00141] In one example, a level of greater than around 20 GE/ml is indicative of damage, in particular apoptosis to a transplanted organ.

[00142] In one example, a level of greater than around 21 GE/ml, greater than around 22 genome GE/ml, greater than around 23 GE/ml, greater than around 24 GE/ml is indicative of damage, in particular apoptosis to a transplanted organ.

[00143] In one example, a level of greater than around 25 GE/ml is indicative of damage, in particular apoptosis in a transplanted organ.

[00144] In one example, a level of greater than around 26 GE/ml, greater than around 27 GE/ml, greater than around 28 GE/ml, greater than around 29 GE/ml, greater than around 30 GE/ml is indicative of damage, in particular apoptosis to a transplanted organ.

[00145] By "self nucleic acid" or "self DNA" means nucleic acid from the subject in which a sample has been taken. "Non-self" nucleic acid or DNA is from a fetus or transplant cell.

[00146] In an embodiment, the CNV is a CNV-deletion (CND). In another embodiment the CNV is an addition, multiplication, duplication, inversion or transposition. In an embodiment, the nucleic acid is fragmented, resulting from apoptosis of cells.

[00147] The instant method includes the selection of primers which amplify a region in target nucleic acid internal or flanking a CNV such as a CND, wherein, the target is homozygous or heterozygous for the CNV and the non-target is null for the CNV.

[00148] Enabled herein is a set of primers for use in a method for quantitating a target nucleic acid in a sample comprising a mixture of target and non-target nucleic acid, the method comprising selecting a CNV polymorphism wherein the target nucleic acid is heterozygous or homozygous for the CNV polymorphism and the other of the target or non-target nucleic acid is genotypically null for the CNV polymorphism; and (i) isolating and/or enriching the sample for cell-free nucleic acid; and (ii) subjecting the mixture of cell-free nucleic acid to an amplification reaction with primers which target the CNV polymorphism internally and/or flanking the polymorphism wherein the level of detection of a specific product is indicative of the amount of target nucleic acid.

[00149] Another embodiment enabled herein is a set of primers for use in an amplification reaction which target a heterozygous or homozygous form of a CNV polymorphism such as a CND polymorphism which is present in a target nucleic acid but absent in a non-target nucleic acid; wherein the amount of amplified product correlates with the level of target nucleic acid.

[00150] In an embodiment, the nucleic acid is fragmented.

[00151] In an embodiment, the CNV is a CND. Examples of CNDs are listed in Table 7. In an embodiment, a CND is selected from a panel of from 2 to 41 including from 10 to 30 or 10 to 20 including 10 CNDs selected from Table 7. One particular panel of 10 is defined in Table 6 which may be detected using the primers and probes defined in Table 2 or 3.

[00152] In an embodiment, the primers target a CND selected from CND_01 through CND_10.

[00153] In an embodiment, the primers are selected from the list in Table 2 or 3.

[00154] The instant disclosure further enables genetic testing of target nucleic acid (e.g. fetal, transplant or cancer circulating nucleic acid). As used herein, "genetic analysis", "genetic testing" and "genetic diagnosis" are used interchangeably and broadly cover detection, analysis, identification and/or characterization of genetic material and includes and encompasses terms such as, but not limited to, genetic identification, genetic diagnosis, genetic screening, genotyping, cancer cell identification, pre-natal genetic diagnosis, paternity testing and DNA fingerprinting which are variously used through this specification.

[00155] Genetic testing to assess the presence of CNV polymorphisms in the cells or other chromosomal mutations or alterations in chromosome number contemplated herein include aneuploidy (e.g. trisomy associated with Down Syndrome or Turner Syndrome), polyploidy (e.g. triploidy such as associated with whole cell 69 chromosomes), or any syndrome where an established aetiology of segmented copy number abnormality (e.g. Prader Willi Syndrome). The CNV polymorphism may also be characteristic of a type of stage of cancer or state of transplanted tissue health.

[00156] A "probe" or "primer" is usually a single- stranded or double stranded oligonucleotide, including having 20-1000 contiguous nucleotides which, for example, is capable of annealing to a complementary nucleic acid. Generally, the probe or primer is suitably labelled with a reporter molecule capable of giving an identifiable signal. "Signals" include light waves, fluorescence, radio signals or other emissions. The probes hybridize to complementary regions of the chromosome (or mRNA) under particular stringency conditions. A "signal" includes a combination of signals such as a color generated by two other colors. The present method is amenable to solid support and digital PCR.

[00157] Hence, enabled herein is a method for quantitating the presence of a target nucleic acid in a mixture of target and non-target nucleic acid in a sample, the method comprising selecting a CNV polymorphism wherein the target nucleic acid is heterozygous or homozygous for the CNV polymorphism and the non-target nucleic acid is genotypically null for the CNV polymorphism; and (i) isolating and/or enriching the sample for cell-free nucleic acid; and (ii) subjecting the mixture of cell-free nucleic acid to solid phase or digital amplification reaction with primers which target the CNV polymorphism internally and/or flanking the polymorphism wherein the level of a specific product is indicative of the amount of target nucleic acid. In an alternative, the mixture of cell-free nucleic acid is subjected to amplification-independent detection means wherein the sequence read data determine the amount of target nucleic acid.

[00158] The target of the probe may be referred to as a "genetic marker" or "marker" or "deletion CNV" or "repeat CNV" which includes any locus or region of a genome having the CNV polymorphism. The genetic marker may be a coding or non-coding region of a genome. For example, genetic markers may be coding regions of genes, non-coding regions of genes such as introns or promoters, or intervening sequences between genes such as those that include polymorphisms, such as single nucleotide polymorphisms (SNPs), tandem repeat sequences, for example, satellites, microsatellites, short tandem repeats (STRs) and minisatellites, although without limitation thereto based on the target nucleic acid. Deletion CNV's are particularly useful, especially those associated with a phenotype or disease condition or which are useful for distinguishing between cell types. Deletion CNV's include deletions of from 50bp to 100 Mb including 50, 60, 70, 80, 90 or lOObp, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900 or l,000kb and 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100Mb. A "CNV" includes a copy number deletion and insertion.

[00159] Genetic analysis may be performed by any method including, but not limited to, fluorescence in situ hybridization (FISH), microscopy including scanning microscopy, digital PCR, methylation array, primed in situ synthesis (PRINS) and nucleic acid sequence amplification, such as in the form of multiplex fluorescent PCR amplification (MFPCR) or methods that employ nucleic acid arrays such as a microarray format. The target nucleic acid may also be subject to quantitative sequencing such as MPS. Alternatively, NGS or NanoString technology is used.

[00160] It will be appreciated that genetic analysis may be performed using microarrays which are particularly useful when analyzing the presence or absence of nucleic acids in samples or using multiple CNVs.

[00161] Reporter molecules providing a colored signal are useful in the present assay. Colored signals include fluorescent signals.

[00162] These reporter molecules are generally attached to the nucleic acid probe.

Standard chemistry is used to attach the reporter molecules. In this regard, terms such as

"label", "reporter molecule", "signaling molecule" and the like are used interchangeably throughout the subject specification. The reporter molecule genes are a signal. Reference to the "signal" includes a combination of signals.

[00163] Rhodamine (red) and fluorescein (green) are useful labels.

[00164] The genetic testing may also include multiplexing such as multiplex amplification or multiplex PCR which refers to amplification of a plurality of genetic markers in a single amplification reaction. Alternatively, multiple hybridization reactions all with different reporter molecules may be used to identify or test for a range of genetic abnormalities.

[00165] Nucleic acid amplification techniques are well known to the skilled addressee, and also include ligase chain reaction (LCR) as for example described in Ausubel et al. (1995-1999) Current protocols in molecular biology 15, John Wiley & Sons NY, strand displacement amplification (SDA) as for example described in US Patent No. 5,422,252; rolling circle replication (RCR) as for example described in Liu et al. (1996) J. Am. Chem. Soc. 775: 1587 and International Application WO 92/01813 and International Application WO 97/19193; nucleic acid sequence-based amplification (NASBA) as for example described by Sooknanan et al. (1994) Biotechniques 77: 1077; and Q-β replicase amplification as for example described by Tyagi et al. (1996) Proc. Natl. Acad. Sci. USA 93:5395.

[00166] The above-mentioned are examples of nucleic acid sequences amplification techniques but are not presented as an exhaustive list of techniques. Persons skilled in the art will be well aware of a variety of other applicable techniques as well as variations and modifications to the techniques described herein.

[00167] The detected and quantitated target nucleic acid may be further subjected to quantitative sequence analysis.

[00168] Hence, a method is provided for analyzing target nucleic acid in a mixture of target and non-target nucleic acid in a sample, the method comprising selecting a CNV polymorphism wherein the target nucleic acid is heterozygous or homozygous for the CNV polymorphism and the non-target nucleic acid is genotypically null for the CNV polymorphism; and (i) isolating and/or enriching the sample for cell-free nucleic acid; and (ii) subjecting the mixture of cell-free nucleic acid to either an amplification reaction with primers which target the CNV polymorphism internally and/or flanking the polymorphism, determining the level of target nucleic acid based on level of product or to amplification- independent detection means and then subjecting the product to quantitative sequence analysis.

[00169] Enabled herein is a method for analyzing target nucleic acid in a sample comprising a mixture of target and non-target nucleic acid in a sample, the method comprising: (i) isolating and/or enriching cell-free nucleic acid from the sample; (ii) subjecting the cell-free nucleic acid to either an amplification reaction with primers which target a heterozygous or homozygous form of a CNV polymorphism which is present in the target nucleic acid and absent in the non-target nucleic acid or to amplification- independent detection means; and (iii) determining the amount of target nucleic acid based on the level of amplified product or sequence read data.

[00170] In an embodiment, the quantitative sequence analysis is massive parallel sequencing (MPS), NGS or NanoString technology.

[00171] Another embodiment enabled herein is a set of primers for use in an amplification reaction which target a heterozygous or homozygous form of a CNV polymorphism such as a CND polymorphism which is present in a target nucleic acid but absent in a non-target nucleic acid; wherein the amount of amplified product correlates with the level of target nucleic acid.

[00172] Enabled herein is a method for analyzing cell-free fetal DNA in a maternal cell-free sample comprising a mixture of fetal and maternal DNA, the method comprising selecting a CNV polymorphism wherein the fetal DNA is heterozygous or homozygous for the CNV polymorphism and the maternal DNA is genotypically null for the CNV polymorphism; and (i) isolating and/or enriching the sample for cell-free nucleic acid; and (ii) subjecting the mixture of cell-free nucleic acid to an amplification reaction with primers which target the CNV polymorphism internally wherein the level of a specific amplified product is indicative of the amount of fetal DNA. [00173] Taught herein is a method for analyzing cell-free fetal non-self DNA in a maternal cell-free sample comprising a mixture of fetal and maternal DNA, the method comprising selecting a CNV polymorphism wherein the fetal non-self DNA is heterozygous or homozygous for the CNV polymorphism and the maternal DNA is genotypically null for the CNV polymorphism; and (i) isolating and/or enriching the sample for cell-free nucleic acid; and (ii) subjecting the mixture of cell-free nucleic acid to an amplification reaction with primers which target the CNV polymorphism internally wherein the level of a specific amplified product is indicative of the amount of fetal non- self DNA.

[00174] The present disclosure further teaches kits, such as test kits, for detecting target nucleic acid and/or detecting genetic alterations, disorders or abnormalities in target nucleic acid. The kit comprises compartments adapted to contain a solid support to receive a sample comprising circulating fluid from a test subject, nucleic acid probes, and reagents for recording or detecting reporter molecule signals such as fluorescence from the labels. The kits may also be interfaced with FACS machines, microscopic devices and/or cell collection devices.

[00175] Further enabled is a kit for quantitating target nucleic acid in a mixture of target and non-target nucleic acid comprising primers for use in an amplification reaction which target a CNV polymorphism present in target nucleic acid but absent in non-target nucleic acid. The CNV polymorphism may be heterozygous or homozygous. In an embodiment, the CNV is a CND polymorphism. Alternatively, the kit comprises reagents for NGS or NanoString methodologies.

[00176] In an example, the kit is a gene chip comprising primers that direct amplification of the CNV's of the present disclosure.

[00177] The kits are also defined as when used in accordance with the subject assay.

[00178] The present disclosure further enables a non-invasive diagnostic assay comprising identifying target nucleic acid in circulating fluid in a host, and then subjecting the target nucleic acid to one or more genetic tests.

[00179] In applying the methods of the present disclosure, it is considered that a diagnostic determination regarding damage to the fetus or placenta or the organ transplant rejection can be made. However, the diagnostic determination may or may not be conclusive with respect to the definitive diagnosis upon which a treating physician will determine a course of treatment or intervention. Put another way, a diagnostic

determination obtained using the methods of the present disclosure would be understood by one skilled in the art to refer to the process of attempting to determine or identify possible damage or rejection, and to the opinion reached by this process.

[00180] It is envisaged that the claimed method may be performed as a reflexive test.

[00181] In the context of the present disclosure, a "reflexive test" or "reflex test" can refer to a subsequent test (e.g., a second test) that is undertaken based upon the results obtained in a previous test (e.g., a first test). For example, when detecting whether a fetus or placenta is damaged or an organ is subject to rejection, a positive indication from an initial test or clinical assessment that the fetus or placenta is damaged or the organ is subject to rejection can lead to a desire to perform the methods of the present disclosure.

[00182] Alternatively, a "reflexive test" or "reflex test" can refer to a test that

automatically results in the performance of one or more secondary tests based on positive indication of damage to the fetus or placenta or an indication that an organ is subject to rejection.

[00183] For example, performing the methods of the present disclosure can lead to a desire to perform a further "gold standard" test to confirm damage or rejection.

[00184] In another example, a sample of cell free DNA amplified by the methods of the present disclosure may be subject to further analysis. In an example the further analysis is genetic analysis_^

[00185] It is also envisaged that the assays and methods of the present disclosure may be performed as an adjunctive test. In the context of the present disclosure, an "adjunctive test" provides information that adds to or assists in the interpretation of the results of other tests, and/or provides information useful for confirming or resolving an inconclusive test. For example, in a clinical setting clinical assessment or routine blood test may indicate damage to the fetus or placenta or rejection of an organ transplant. Such an assessment is generally inconclusive and requires confirmation. Therefore, in an example, to assist in determining damage to the fetus or placenta or whether an organ transplant is subject to rejection, the methods of the present disclosure can performed as an adjunct to clinical assessment or other testing. .

[00186] In performing adjunctive testing it is envisaged that the methods of the present disclosure will be performed at or about the same time as the secondary test. However, these steps may be performed separately.

[00187] It is envisaged that the methods of the present disclosure may be implemented by a system such as a computer implemented method. For example, the system may be a computer system comprising one or a plurality of processors which may operate together (referred to for convenience as "processor") connected to a memory. The memory may be a non-transitory computer readable medium, such as a hard drive, a solid state disk or CD- ROM. Software, that is executable instructions or program code, such as program code grouped into code modules, may be stored on the memory, and may, when executed by the processor, cause the computer system to perform functions such as determining that a task is to be performed to assist a user to quantitate the level of a target nucleic acid in a sample; receiving data indicating the level of expression of a CNV polymorphism such as a CND in a mixture of target and non-target nucleic acid, the non-target DNA being genotypically null for the CNV polymorphism and the target DNA being heterozygous or homozygous for the CNV; processing the data to determine the level of expression of the CNV polymorphism in the mixture of target and non-target nucleic acid; outputting the level of expression of the CNV polymorphism in the mixture of target and non-target nucleic acid.

[00188] For example, the memory may comprise program code which when executed by the processor causes the system to determine the level of expression of a CNV polymorphism such as a CND in a mixture of target and non-target nucleic acid, the non- target DNA being genotypically null for the CNV polymorphism and the target DNA being heterozygous or homozygous for the CNV or receive data indicating the level of expression of a CNV polymorphism such as a CND in a mixture of target and non-target nucleic acid, the non-target DNA being genotypically null for the CNV polymorphism and the target DNA being heterozygous or homozygous for the CNV; report the level of expression of the CNV polymorphism.

[00189] In another example, the system may be coupled to a user interface to enable the system to receive information from a user and/or to output or display information. For example, the user interface may comprise a graphical user interface, a voice user interface or a touchscreen.

[00190] In an example, the system may be configured to communicate with at least one remote device or server across a communications network such as a wireless communications network. For example, the system may be configured to receive information from the device or server across the communications network and to transmit information to the same or a different device or server across the communications network. In other embodiments, the system may be isolated from direct user interaction.

[00191] In another example, performing the methods of the present disclosure to quantify the level of expression of a CNV polymorphism such as a CND in a mixture of target and non-target nucleic acid, the non-target DNA being genotypically null for the CNV polymorphism and the target DNA being heterozygous or homozygous for the CNV, enables establishment of a diagnostic or prognostic rule based on the level of expression of the CNV polymorphism.

[00192] In an example, the diagnostic or prognostic rule is based on the application of a statistical and machine learning algorithm. Such an algorithm uses relationships between the level of expression of a CNV polymorphism such as a CND in a mixture of target and non-target nucleic acid, the non-target DNA being genotypically null for the CNV polymorphism and the target DNA being heterozygous or homozygous for the CNV and disease status, organ status, fetal status, response to immunotherapy observed in training data (with known disease status; organ status, fetal status, response to immunotherapy) to infer relationships which are then used to predict the status or response to therapy of patients with unknown status or response to therapy. In an example, an algorithm is employed which provides an index of probability of status, response to therapy, developing a pathological condition such as preeclampsia, pathological damage to the fetus or placenta, damage or rejection of an organ transplant. In an example, the algorithm performs a multivariate or univariate analysis function.

[00193] In one example, the present disclosure relates to a knowledge base of training data comprising the level of expression of a CNV polymorphism such as a CND in a mixture of target and non-target nucleic acid, the non-target DNA being genotypically null for the CNV polymorphism and the target DNA being heterozygous or homozygous for the CNV and disease status or response to treatment which, upon input of a second knowledge base of data comprising corresponding levels of expression of a CNV polymorphism such as a CND in a mixture of target and non-target nucleic acid, the non-target DNA being genotypically null for the CNV polymorphism and the target DNA being heterozygous or homozygous for the CNV from a subject with an unknown status, provides a probability that predicts the nature of unknown status or response to treatment.

[00194] The term "training data" can include knowledge of the level of expression of a CNV polymorphism such as a CND in a mixture of target and non-target nucleic acid, the non-target DNA being genotypically null for the CNV polymorphism and the target DNA being heterozygous or homozygous for the CNV in individuals with for example, fetal or placental damage, organ transplant damage or rejection or preeclampsia. EXAMPLES

[00195] Embodiments contemplated herein are now described by the following non- limiting Examples.

Materials and Methods

Sample collection

[00196] Peripheral blood samples (10-20mL) were taken from pregnant women at between gestation and collected in EDTA tubes. Renal transplant recipients were recruited through the Nephrology Department, Austin Health, Melbourne, Australia.

Sample processing and DNA extraction

[00197] Blood samples were generally collected in the presence of EDTA and were processed within 4-6 hours after blood collection. Peripheral blood samples from pregnant women were also collected in cell-free DNA BCT (Registered Trade mark) tubes (Streck, Omaha, USA). Samples were generally collected by venepuncture and generally processed within 4-48 hours. Blood was centrifuged at 1600g for 10 minutes in 15mL falcon tubes at 4°C to separate blood cells from plasma. Next, the plasma portion was transferred to 1.5mL micro-centrifuge tubes and centrifuged at 16000g for 10 minutes at 4°C to remove residual cells. Cell-free plasma was transferred to new microcentrifuge tubes and stored at -80°C and the buffy coat portion of the blood sample (containing cells) was stored at -20°C until further processing. Plasma DNA (5-10mL) was isolated from the plasma using the QIAamp Circulating Nucleic Acid Kit (Qiagen, Australia). Genomic DNA was isolated from the buffy coat using the Nucleobond Blood Extraction Kit (Macherey-Nagel, Diiren, Germany).

Plasma ccfl)NA isolation

[00198] DNA was isolated from plasma using the QIAamp Circulating Nucleic Acid Kit (Qiagen, Melbourne, Australia) according to the manufacturer's guidelines, with slight modifications in reagent volumes as described below. Briefly, lmL aliquots of plasma were lysed with ΙΟΟμί of Proteinase K and 0.8mL of ACL buffer containing 5^g of carrier RNA. This was mixed thoroughly by vortexing and incubated at 60°C for 30 minutes. The tubes were centrifuged at 2000rpm for 30 seconds and 1.8mL of buffer ACB was added and mixed thoroughly by vortexing. This was followed by incubation of the lysate-buffer ACB mixture on ice for 5 minutes. The QIAvac 24 Plus system (Qiagen) was used for processing of Qiagen mini spin columns. Briefly, Vac Connectors and tube extenders were connected to the Qiagen mini spin columns. The lysate mixture was applied to the tube extenders and the vacuum pump was used to draw the lysate mixture through the columns. Tube extenders were discarded at this point. The column was washed with Buffer ACW1 (600μί), Buffer ACW2 (750μΙ_) and 750μΙ. of ethanol (100% v/v) respectively. The wash buffers were added and drawn through the column by the vacuum pump. The column was removed from the QIAvac 24 Plus system and placed in a clean tube and centrifuged at 13000rpm for 3 minutes. Flow through was discarded and the column was placed in a new collection tube and incubated in a heat block at 56°C for 10 minutes to dry the membrane. The column was placed in a new collection tube and 50 to ΙΟΟμί of RNase free dH₂0 was added to the centre of the membrane and incubated at room temperature for 5 minutes. The column was centrifuged at 13000rpm for 1 minute and the eluted volume was re-applied to the column and incubated at room temperature for a further 5 minutes. Finally, the column was centrifuged at 13000rpm for 1 minute to elute the DNA.

DNA isolation from leukocytes

[00199] Genomic DNA was isolated from the leukocyte fraction of blood samples using the Nucleobond Blood Extraction Kit (Macherey-Nagel, Diiren, Germany) according to the manufacturer's instructions. Cellular DNA was quantified with NanoDrop ND-1000 UV Vis spectrophotometer according to the manufacturer's instructions.

Quantitation of ccfDNA by qPCR

[00200] Quantification of circulating cell-free (ccf) fetal DNA ("fetal ccf-DNA") in the plasma was achieved by measuring each informative CNV-deletion locus using custom designed qPCR assays. These assays were developed using Primer Express software v3.0 (Applied Biosystems) and TaqMan probes were labeled with HEX and FAM reporter dyes to facilitate muliplexing. Informative CNV-deletions (CNDs) were defined as those which show 0-copy in the maternal DNA and demonstrate a detectable level of non-self DNA in the plasma. The concentration of non-self DNA in plasma was calculated using the formula described in Lo et al. (1998) Am J Hum Genet <52(4):768-775 and represented in genomic equivalents (i.e. genomic copies, 1GE = 6.6pg) per mL (i.e. GE/mL). The final fetal fraction in maternal plasma (GE/mL) was calculated as the average of all informative CNDs for each sample - and inter-assay variation amongst replicates were determined using standard procedures. Quality control was provided by obtaining multiple independent measurements of fetal ccfDNA concentration.

CND quantitative PCR assay development

[00201] qPCR assays for renal transplant samples were developed with TaqMan probes were based on a panel of 10 CND markers. Each qPCR assay uses the CND-specific internal PCR primers and a target specific TaqMan probe (Table 3). The CND assays were labeled with VIC fluorescence reporter.

[00202] Quantitative PCRs were performed in duplicate in a reaction volume of l0μL as detailed in Table 4 and the reactions were performed on the ViiA 7 Real Time PCR system (Applied Biosystems, Melbourne, Australia). ViiA 7 software version 1.2 (Applied Biosystems) was used for the data analysis. The quantification cycle (Cq) was based on the intersection between the amplification curve and an empirically adjusted threshold. The concentration of ccfDNA in genomic equivalents per mL of plasma (i.e. GE/mL) was calculated using the formula described by Lo et al. (1998) supra. PCR efficiencies were standardized across all ten CND qPCR assays; all assays had a slope between -3.3 and -3.6 (average of -3.4).

[00203] As an example, for the 1000GE standard curve point, the DNA input volume was 2.5μ1 so the concentration of input DNA was 400ϋΕ/μ1. The final concentration of DNA in the reaction volume was lOOGE/μΙ ( 1000GE total). The Cq was based on the intersection between the amplification curve and an empirically adjusted threshold. The concentration of ccfDNA in genomic equivalents per mL of plasma (i.e. GE/mL) was calculated using the formula described by Lo et al. (1998) supra. PCR efficiencies were standardized across all ten CND qPCR assays. The standard curve characteristics for all assays are provided in Table 8.

Calculation of fetal fraction (%)

[00204] Using massively parallel sequencing: Plasma ccfDNA was extracted as described above from blood samples from 12 pregnant women. Duplicates of these samples had previously been used for non-invasive prenatal testing using massively parallel sequencing (NIPT) provided by a commercial company (Natera, Redwood City, USA); the procedure is described in Zimmermann et al. (2012) Prenat Diagn 32: 1233-1241. In all cases the genomic analysis report provided the fetal fraction (%) of the total ccfDNA present in the sample and showed the fetus to be male. This measure of fetal fraction was used as the primary comparator for the fetal fraction assays described below which used ccfDNA extracted from the remaining^' duplicate samples.

00205] Using SRY and HBB quantitative PCR assays: Quantitative PCR analysis of male, fetal DNA in 12 maternal plasma samples was performed using primers and probes for the SR Y gene located on chromosome Y; total ccfDNA was similarly assayed using the Betagiobin gene (HBB), both as previously described (Lo et al (1998) supra). The two assays were multiplexed using different fluorescent dyes (FAM for HBB and VIC for SRY). Fetal ccfDNA fraction (%.) was calculated from the ratio of SRY to HBB DNA concentrations .

[00206] Using CND and HBB quantitative PCR: Fetal ccfDNA levels in the 12 maternal plasma samples was measured by quantitative PCR a described above using informative CND markers. Seven samples had at least two informative CNDs and five had one. Total ccfDNA was agai measured using the HBB quantitative PCR assay and the fetal fraction ( ) calculated from the ratio of the individual CND (5 samples) or mean of multiple CND measurements (7 samples) as above.

Statistical Analysis

1002073 All statistical analyses were performed using the R statistical programming language (http://www.r--project.org/).

Table 3

Genotyping and qPCR assay design

External PCR

TaqMan Probe Forward Primer Reverse Primer

V I C-TGGTGG AAG AATAATTTACA TGGAAAGGTAAGATACGCACA CC I I I I AATTTGGCCCATACC (SEQ ID NO:3) (SEQ ID NO:4) (SEQ ID NO:5)

VIC-AGAGGCAGCTTCATG CAGGGCTCAATTTCTCCATC ATGTCCAGTGTTGGGAGAGG (SEQ ID NO:8) (SEQ ID NO:9) (SEQ ID NO:10)

VIC-ACATGCCTGGCTTC GAATTGATCCTGCCTTACCC AGGTGCATGGTGCACAGTAT (SEQ ID NO:13) (SEQ ID NO:14) (SEQ ID NO:15)

VIC-TGTATACACAGAGGCTGC CTGCTGCTG C AAAGG I I I I A ACATGCCAAGGAGATGGACT (SEQ ID NO:18) (SEQ ID NO:19) (SEQ ID NO:20)

V I C-TGTGTGGG AGGCAAT TGACCTAAAATCAGGCCACT GGGGGAAACACCTCCATA (SEQ ID NO:23) (SEQ ID NO:24) (SEQ ID NO:25)

V I C-TGAGCCCTCTTTCTT GCTTAGAGGAGGTAAATAACTTAGCAA TGGGAATGTATATTGGAAAACAA (SEQ ID NO:28) (SEQ ID NO:29) (SEQ ID NO:30)

VIC-TCAAGCTGCCAATGTG TGAACAACCATACATGCAGAAA GCCTTTTTGGAATAGTTTAAAAGC (SEQ ID NO:33) (SEQ ID NO:34) (SEQ ID NO:35)

VIC-TGCGTTTGGGCTGTGT I I I I ATGGAATAGCAAACAAGGA TGCAGTGTAGCTGGGATCAA (SEQ ID NO:38) (SEQ ID NO:39) (SEQ ID NO:40)

VIC-AATGCACAGACTTGC GAGGGTTCATGCCCTTAACA G C A AAAG CTG CCTG CTTAAC (SEQ IOD NO:43) (SEQ ID NO:44) (SEQ ID NO:45)

V I C-TCTGCCTCGTTAATG AG TGAAATGGGAGAATGGAAGG GAGGGTTTCCTTAAGGTCCTC (SEQ ID NO:48) (SEQ ID NO:49) (SEQ ID NO:50) Internal PCR (PCR2)

CNPjd chr start_hgl8 end_hgl8

Forward Primer Reverse Primer

GGGATTACAATCGAGAGCTACCA GTGGCCTGAAGTGCATCTTAAA

chr2 219,760,351 219,762,572

CNVR1138.3 (SEQID N0:51) (SEQID NO:52)

GGTGGGATTCGCCACACA GGCAAGTATCCCCGGTTGA

chr7 73,467,042 73,469,172

CNVR3451.1 (SEQID NO:54) (SEQID NO:55)

TGTCATGTGCAATAGAGACTGTTGTC TGGCCAGGGCAATTCATC

chrlO 4,698,559 4,700,493

CNVR4596.1 (SEQID NO:57) (SEQID NO:58)

ACTGCCTTACACTGGCTTCCA AACAGCCCTTGGCCTTCC

chr2 54,419,132 54,420,976

CNVR801 full (SEQID NO:60) (SEQID NO:61)

IGCCCAGCCAAGACAI 1111 TGTGGAGAAAGTAGGGCAAACA chrl3 38,831,627 38,833,387

CNVR5853 full (SEQID NO:63) (SEQID NO:64)

G G AC AATG CCCTTAG CA AATG TG CTAC ACG C ATGG A AATAG CT

chr2 76,627,234 76,628,943

CNVR842.1 (SEQID NO:66) (SEQID NO:67)

G AGTG CAGTGG C ATG ATTGTG AGGTTCACGCCATCCTCCT

chrl 185,731,458 185,733,106

CNVR431.1 (SEQID NO:69) (SEQID NO:70)

GGGIGI IGGCCCCI 1111 GTCAACCTGCCTGGTGTTGTT chr9 17,900,038 17,901,633

CNVR4203.1 (SEQID NO:72) (SEQID NO:73)

TCCCCAGCGTCTTCTCTTATG CAACAACGTACAGGCAGAACATC

chr2 159,668,040 159,669,209

CNVR1037.1 (SEQID NO:75) (SEQID NO:76)

EXAMPLE 1

Selection of CNV-deletion loci

[00208] Every individual genome has a different copy number variant (CNV) profile consisting of many thousands of losses (i.e. deletions) and gains (i.e. delectations, amplifications, etc.) spread out throughout the genome. Some of these occur at copy number variable regions which have been identified in large-scale CNV genotyping studies but many are also unique. Of known CNV regions, these can be stratified in terms of allelic distribution of copy number states (i.e. 0, 1, 2, 3, etc), genomic size, and population frequency. For the purposes of detecting microchimerism in plasma DNA, CNV regions are selected having an allelic distribution of 0, 1, 2 (but not duplications) and having a 0- copy allele frequency of greater than 0.4. The latter is not to be taken as a restriction but rather reflected an approach for development of a panel of assays capable of detecting microchimerism in the vast majority of samples without the need for screening the paternal genome. Such CNVs are common in the population and an initial panel of 10 (see Table 5) was selected by in silico analysis of public HapMap data (Conrad et al. (2010) supra; McCarrol et al. (2008) Nature Genet 40(10): \ \ββ-\ \ΊΑ). The Hap Map data include copy number information for each CNV identified by a high resolution microarray analysis. For frequency calculations, only data from unrelated individuals were included (n=122). CNVs with 0, 1 and 2 copy genotypes were selected for analysis. CNVs with allelic distributions extending to more than 2 copies and chromosomes X and Y CNVs were excluded. For each selected CNV, frequencies of 0, 1 and 2 copy genotypes were calculated. CNVs overlapping with segmental duplications were excluded. All ten CNVs were less than 3kb in size; however the method applies to CNVs of all size ranges. In terms of clinical application it is important to note that all ten CNV regions are polymorphic and none of them is of any intrinsic clinical significance.

EXAMPLE 2

Genotyping of CNV-deletion loci

[00210] PCRs have been designed with primers located within (i.e. internal PCR) and flanking (i.e. external PCR) the 10 'CNV-deletion' loci. The internal PCR gives a specific product for 1 copy (heterozygous deleted), or 2 copies (wild-type) genotypes and an absence of a specific product indicates a null or 0 copy (homozygous deleted) genotype. The external PCR gives a precise product shorter than the "wild type" (Note: the larger, "wild-type" product is absent as the undeleted allele is too large to be amplified) confirming all the null deletions detected by the internal PCR. The combination of internal and external PCR was used to determine the genotype status for each CND (i.e. 0, 1 or 2 copies) in the maternal cellular DNA. Genotyping results obtained for 21 control samples are shown in Figure 1. Absence of a band indicates an individual with a "null" genotype (Figure la) and it is observed in 12 individuals. This is consistent with the predicted 50% frequency for CND_01 (Table 5). The 9 individuals showing a PCR product band were either "heterozygotes" (1 copy) or "wild-type homozygotes" (2 copies), as inferred from the external PCR results (Figure lb). The results from the external PCR (Figure lb) also confirm that the homozygous deletions were real rather than PCR failures. To prove unequivocally that the genotyping assay was accurate, the "internal PCR" and the "external PCR" products shown were sequenced and mapped back to a genome location using BLAT. In all cases this was to the correct, unique genome locus. The expected frequencies of all 10 CNV-deletions were confirmed by genotyping DNA samples of 100 individuals sourced from a local general population (Table 5). The expected and observed frequencies were similar for most CNDs, except for CND_10, which had a relatively low "0 copy" frequency in our control population.

Table 4

Reagent volumes and PCR conditions for CND qPCR assays

Reagent Volume per Final PCR conditions

reaction Concentration

(μί)

lOx Buffer (15mM MgCl₂) 1.00 IX (1.5mM MgCl₂) 50°C for 2 minutes

MgCl₂ (25mM) 1.00 2.5mM 95°C for 10 minutes Ί 60 dNTPs (lOmM) 0.20 0.20mM 95°C for 15 seconds J ^CycleS

HBB Forward Primer + 0.40 0.40μΜ 60°C for 1 minute

Reverse Primer (ΙΟμΜ)

CND Forward Primer + 0.40 0.40μΜ

Reverse Primer (ΙΟμΜ)

HBB Probe (ΙΟμΜ) 0.20 0.20μΜ

CND Probe (ΙΟμΜ) 0.20 0.20μΜ

Hot Start Taq (5υ/μΙ_) 0.20 1U

RNAse free dH₂0 3.90 -

DNA 2.50 variable

10.0

Table 5

In silico and in vitro genotype frequencies for the initial panel of 10 CNDS

EXAMPLE 3

Quantitative PCR

[00213] Target- specific hydrolysis probes (TaqMan MGB) were designed for each CNV-deletion locus and labeled with HEX reporter dyes. The β-globin (HBB) gene was used as an internal reference and a TaqMan MGB probe (as described in Lo et al. (1998) supra) was labeled with FAM reporter dye to facilitate multiplexing with each CNV- deletion assay. Analysis of the SRY gene, as reported in Lo et al. (1998) supra, was also performed and the results for fetal fraction in male fetuses compared to those obtained using the CNV-deletion method. A standard curve based quantitation method was used to detect and quantitate non-self DNA in the plasma samples. Based on the level on the total level of HBB at 1644GE/ml the level of CNDIO at 70 GE/ml represents 4.26 % of the total DNA (Figure 3).

EXAMPLE 4

Spiking experiment

[00214] For each CND in the panel, the lower sensitivity limit and specificity in measurement of fetal fraction were modeled empirically by using titrations of "chimeric" DNA obtained by mixing control DNA from individuals differing in their genotype status. Briefly, a DNA sample from a male individual heterozygously deleted (i.e. 1 copy) for a selected CNV-deletion locus was spiked into a DNA sample from a female individual "null" (i.e. 0 copy) for that selected CNV-deletion locus. CNV-deletion qPCR assay and SRY based qPCR assays were performed on spiked samples.

EXAMPLE 5

In silico selection of CND markers

[00215] CNDs with null deletion (i.e. 0-copy) frequencies between 0.3 and 0.7 were identified by in silico analysis of two high-resolution data sets. Data-set 1: genotype data for 5238 CNV loci generated by testing 450 HapMap samples at 500bp resolution (Conrad et al. (2010) supra). Data-set 2: genotype data for 1319 CNV loci generated by testing 270 HapMap samples at 2Kb resolution (McCarrol et al. (2008) supra). Analyses used the CEPH data only .As the CEPH HapMap data include trio data on proband and parents, calculation of 0, 1 and 2 copy genotype frequencies was performed using only parental data to minimise overestimation. No further correction, such as for autozygosity (Stevens et al. (2012) EJHG 20:657-667; Stevens et al. (2012) PLOS One 7:49575), was done. In silico selection used the following criteria: each CNV constitutes a single locus in the human genome that spanned less than 3 kilobases with copy number genotypes of 0, 1 or 2. CNVs showing copy number genotypes greater than 2 and CNVs on the X and Y chromosomes were excluded to avoid gender bias. This resulted in 54 candidates; all these CNV regions are polymorphic and none have any known intrinsic clinical significance.

The CND panel

[00217] Of the 54 CNDs identified above, the 10 predicted to have the most informative Ό- copy' genotype frequency ranking were selected as an initial panel for in vitro assessments (Table 9). The null genotype frequencies range between 0.410 and 0.508, the mean value being 0.452 with a standard deviation of 0.038. Based on these null genotype frequencies, it was calculated and later confirmed by observation that 99% of individuals are likely to be null for at least one CND in the panel (Figure A). In vitro estimation of CND frequencies

[00218] The estimated population frequencies for the 10 CNDs obtained from the in silico selection were compared with those in an unselected sample of 93 healthy individuals. The local population from which this sample was taken is ethnically very diverse and it is assumed that our random sampling reflects this. Despite a paucity of information for these CNDs in different ethnic populations, the potential of these CND markers for chimerism testing in diverse populations was highlighted by the in silico and in vitro frequencies being were very similar (Table l0).Sample genotyping [00219] Genotypes for all CND markers were determined on DNA extracted from leukocytes using a simple PCR based assay. PCR primers were designed to locate within (i.e. internal PCR) and flanking the deleted region (i.e. external PCR) of each CND marker in the panel. Short amplicons, ranging in size from 58-74 bp (average 65 bp) were chosen for the internal PCRs in order that they would be suitable for quantitation of plasma ccfDNA which is highly fragmented (Zheng et al. (2011) Clin Chem 58:549- 558). Samples with a null genotype give no 'internal' PCR product. Verification of the null genotypes was made using the external PCR assays, which give unique PCR products. The identities of the internal and external PCR amplicons were confirmed using Sanger sequencing. All internal PCR amplicon sequences of non-deleted alleles mapped to the expected regions within the CND loci and external PCR amplicons of deleted alleles mapped to the flanking regions of the CND loci. The combination of internal/external PCR results distinguishes the null, Ί copy' and '2 copy' genotypes (see Figure 1 for examples) .Informative capacity of the CND marker panel

[00221] The distributions of 'null' CND frequencies observed in three independent population cohorts are almost superimposable and indicate that, on average, the 10 panel genotype for any individual contains 4-5 null CNDs (Figure 4). An informative test result occurs when the transplant recipient or pregnant woman is null for at least one of the CNDs in the panel and the corresponding qPCR assay shows a detectable level of ccfDNA in plasma, which infers that the donor was 1- or 2-copy. In the situation where the non-self and self-DNA are from unrelated individuals, the expected proportion of test results with at least three informative markers is 46% (Figure 5). This increases to 90% and 99% using expanded panels of 20 and 30 CNDs respectively. With 30 markers (see Table 7 for marker details) it is expected that at least one informative marker virtually 100% of the time and at least 3 informative markers 99% of the time. Samples involving admixtures of sibling-sibling and parent-offspring DNA have less than 6% chance of having no informative markers when using a panel of 30 CNDs (see Figure 5).Plasma ccfDNA genotyping

[00222] The PCR assays described above for genotyping cellular genomic DNA from blood samples were used with plasma ccfDNA samples under the same conditions (see Figure 9a).Detection of "non-self" ccfDNA in plasma

[00223] A blood sample was collected from a 62-year-old male patient who had received an allogeneic kidney transplant from an unrelated female donor 13 months previously. Internal PCRs for all panel CNDs were performed on cellular DNA to identify 'null' genotypes and qPCR assays for these CNDs performed on plasma ccfDNA. The patient was 'null' for CND_02, CND_03 and CND_08; 'non-self, transplant-derived DNA was detected qualitatively for CND_03 and CND_08 (Figure 9b). Quantitation of non-self DNA using CND03 and CND08 qPCR assays gave measurements of non-self ccfDNA of 450GE/ml and 469GE\ml, respectively.

Performance of CND qPCR assays for chimerism analysis

[00224] The quantitative assays for each CND were validated by serial dilution (with quadruple replicates) and spike-in mixture experiments using well-characterised genomic DNA samples. To assess the limit of detection, a previously determined '1-copy' genomic DNA sample was spiked into a Ό-copy' genomic DNA sample, thus simulating chimerism. Multiple combinations of spiked control mixtures were prepared to assess all 10 CND qPCR assays.These experiments show each of the assays to be highly specific and sensitive; the lower limit of detection is 4 GE as defined by the average of the replicate data (Figure 6; bold/red line) for the no DNA sample (i.e. 0GE) plus 3 standard deviations. The assay measurements are linear (slope=l) from this level up to at least 16,000 GE (Figure 6). The spike-in mix experiments showed that across the range of 4-600 GE, accuracy was very high (estimated slope was 0.99 which is very close to the expected value of 1) as was the precision (the standard error of the slope estimate was 0.01). The performance of each assay is shown in Figure 6 where 95% of marker slope estimates range between 0.96 and 1.01. The slope estimates for individual CND assays (grey lines) varied slightly with a standard deviation of 0.03 indicating only very minor differences in assay performance. This is relevant in clinical applications, as each individual informative CND should provide an independent measurement of plasma DNA chimerism.The specificity of the assays was further assessed by quantitative measurement of amplification in 0-copy genomic DNA samples containing no copies of each respective CND target per diploid cell (Table 8, Figure 10). The 0-copy DNA amplification plots were consistent for all CND assays, except for CND 10, which showed "detectable" signal overlapping the standard curve at 1GE. These data indicated very low-level amplification of non- target DNA in a 0-copy background at 1000GE input per reaction and are consistent with a lower limit of quantification of 16 GE for these CND qPCR assays.The CND qPCR assays exhibited high reliability (i.e. reproducibility) upon repeat testing of the 4-fold serial dilution standards over time (eight separate qPCR experimental runs); the coefficient of variation ranged from 1.7-3.8% (total standard deviations) for measurements across 4-16,000 GE. Proof of Principle: Measurement of ccfDNA in Organ Transplantation and Non-Invasive Prenatal Testing

[00228] The technical performance characteristics of the approach indicate that the underlying premise of exploiting CNDs to quantify DNA chimerism is sound. As 'proof of principle' the minor chimeric DNA component was measured in two potential clinical applications: allogeneic organ transplantation and non-invasive parental genetic testing.Transplant-derived ccfDNA levels were measured in blood samples collected shortly after and during the weeks following transplantation from two patients who had received n allogeneic kidney transplant. Preliminary application of the CND assays in kidney transplantation (n=81) has indicated that the "stable" level of transplant-derived ccfDNA in non-rejecting patients is below 50+20 GE/ml. The promise of the CND method for monitoring the health of transplanted allogeneic kidneys is demonstrated in longitudinal studies of two patients who showed successful kidney function without any indication of rejection (cases 1 and 2) [Figure 7]. Both patients showed measurements elevated significantly above 50+20 GE/ml within the first two weeks post transplantation, which was ascribed to the trauma that the organs had undergone during the transplantation procedure. However, the levels stabilized below 70GE/mL within three weeks and remained so for all subsequent time points. Prior knowledge of the fetal ccfDNA fraction in maternal plasma samples may also have clinical utility. Therefore, the fetal DNA fraction was also measured in 12 maternal plasma samples, where the singleton fetus is known to be male, using the CND method and compared results with those derived from an SRY qPCR and also from SNP-based whole genome sequencing data (Table 10 and Figure 8). Better agreement was observed for the fetal fraction values calculated by CND-qPCR and SNP- based MPS methods. Indeed, SRY qPCR-based estimates of fetal fraction were consistently lower than those obtained by both other methods.

EXAMPLE 6

Clinical applications

In silico selection of CND markers

[00231] Copy number deletions (CNDs) with null deletion (i.e. 0-copy) frequencies between 0.3 and 0.7 were identified by in silico analysis of two high-resolution CNVHapMap data sets. Data-set 1: genotype data for 5238 CNV loci generated by testing 450 HapMap samples at 500bp resolution (Conrad et al. (2010) supra). Data-set 2: genotype data for 1319 CNV loci generated by testing 270 HapMap samples at 2Kb resolution (McCarrol et al. (2008) supra). Analyses used the CEPH data only. As the CEPH HapMap data include trio data on proband and parents, calculation of 0, 1 and 2 copy genotype frequencies was performed using only parental data to minimise over estimation. No further correction, such as for autozygosity (Stevens et al. (2012) supra; Stevens et al. (2012) supra), was done. In silico selection used the following criteria: each CNV showed a single locus location exclusively in the human genome with copy number genotypes of 0, 1 or 2 and spanned less than 3 kilo bases. CNVs showing copy number genotypes greater than 2 and those on chromosomes X and Y were excluded to avoid gender bias. This resulted in 54 candidates; all these CNV regions are polymorphic and none has any known intrinsic clinical significance.

EXAMPLE 7

The copy number deletion panel

[00233] Of the 54 CNDs identified in Example 5, the 10 predicted to have the most informative "0-copy" genotype frequency ranking (i.e. approximately 0.4-0.5) were selected as an initial panel for in vitro assessments (Table 6). The null genotype frequencies range between 0.410 and 0.508, the mean value being 0.452 with a standard deviation of 0.038. Based on these null genotype frequencies, it was calculated and later confirmed by observation that 99% of individuals are likely to be genotypically null (0 copy) for at least one CND in the panel (Figure 4), thus confirming their high informative capacity. Table 6

Genomic details of the panel of 10 selected CNDs

EXAMPLE 8

In vitro estimation of CND frequencies

[00234] The estimated population frequencies for the 10 CNDs obtained from the in silico selection were compared with those in an unselected sample of 93 healthy individuals from a local, racially diverse population. This number was sufficiently large for the purpose of identifying an initial panel of CNDs for assay development and proof of concept studies. The in silico and in vitro frequencies were very similar (see Table 5) demonstrating the potential of these ten CND markers for chimerism testing in diverse populations.

EXAMPLE 9

Sample genotyping

[00235] Genotypes for all CND markers were determined on DNA extracted from leukocytes using a simple PCR based assay. PCR primers were designed to locate within (i.e. internal PCR) and flanking the deleted region (i.e. external PCR) of each CND marker in the panel. Short amplicons, ranging in size from 58bp to 74bp (average 65bp) were chosen for the internal PCRs in order that they would be suitable for quantitation of plasma ccfDNA which is highly fragmented (98% of fragments are shorter than 250bp [Zheng et al. (2011) Clin Chem supra]). Samples with a null genotype give no 'internal' PCR product. Verification of the null genotypes was made using the external PCR assays, which give unique PCR products; in the case of wild type (i.e. non-deleted) alleles, these assays are designed to give no product as the template sequences are too long to be amplified using standard PCR conditions. Deleted alleles, on the other-hand, generate an external amplicon of unique size and sequence. The identities of the internal and external PCR amplicons were confirmed using Sanger sequencing. All internal PCR amplicon sequences of non-deleted alleles mapped to the expected regions within the CND loci and external PCR amplicons of deleted alleles mapped to the flanking regions of the CND loci. The combination of internal/external PCR results distinguishes the null (no product/product), "1 copy" (product/product) and "2 copy" (product/no product) genotypes.

EXAMPLE 10

Informative capacity of the CND marker panel

[00238] The distributions of "null" CND frequencies observed in three independent population cohorts (92 kidney transplant recipients, 93 in vitro control samples and the in silico data described above) are almost super imposable and indicate that, on average, the 10 panel genotype for any individual contains 4-5 null CNDs (Figure 4). An informative test result occurs when the transplant recipient is null for at least one of the CNDs in the panel (Figure 4) and the corresponding qPCR assay shows a detectable level of ccfDNA in plasma, which infers that the donor was 1- or 2-copy. In the situation where the non-self and self-DNA are from unrelated individuals the expected proportion of test results with at least three informative markers is 46% (Figure 5). This increases to 90% and 99% using expanded panels of 20 and 30 CNDs respectively. With 30 markers (see Table 7 for marker details) it is expected at least one informative marker 100% of the time and at least 3 markers 99% of the time. Samples involving admixtures of sibling-sibling and parent- offspring DNA have less than 1% chance of having no informative markers when using a panel of 30 CNDs (Figure 6), indicating that the approach is universally applicable to any donor-recipient pair, excepting of course identical twins. As each informative CND provides an independent measure of non-self DNA, an additional benefit afforded by this approach is the ability to use the unique marker profile of each recipient to reveal sample mix-ups as well as the presence of exogenous (non-transplant derived) ccfDNA that may arise from some medical interventions (e.g. plasma pheresis). This approach also allows for ready identification and handling of outliers. This is especially relevant for removing measurements derived from 2-copy DNA that arise when the donor is homozygous wild type for a given CND locus.

Table 7

Details of 41 CND markers

Table 8

Standard Curve Characteristics for CND qPCR assays 01-10

EXAMPLE 11

Plasma ccfDNA genotyping

[00240] The PCR assays described above for genotyping cellular genomic DNA from blood samples were used with the same conditions with plasma ccfDNA samples. Intraindividual genotyping results for all 10 CNDs using cellular and plasma ccfDNA samples showed complete concordance (Figure 7A).

EXAMPLE 12

Qualitative detection of "non-self" ccfDNA in plasma

[00241] A blood sample was collected from a 62-year-old male patient who had received an allogeneic kidney transplant from an unrelated female donor 13 months previously. Internal PCRs for all panel CNDs were performed on cellular DNA to identify "null" genotypes and qPCR assays for these CNDs performed on plasma ccfDNA. The patient was "null" for CND_02, CND_03 and CND_08; "non-self", transplant-derived DNA was detected for CND_03 and CND_08 (Figure 7B). EXAMPLE 13

Performance of CND qPCR assays for chimerism analysis

[00242] The quantitative assays for each CND were validated by serial dilution (with quadruple replicates) and spike-in mixture experiments using well-characterized genomic DNA samples. To assess the limit of detection, a previously determined "1- copy" genomic DNA sample was spiked into a "0-copy" genomic DNA sample, thus simulating chimerism. Multiple combinations of spiked control mixtures were prepared to assess all 10 CND qPCR assays.

[00243] These experiments show each of the assays to be highly specific and sensitive; the lower limit of detection is 4-16GE as defined by the average of the replicate data for the no DNA sample (slope=13 standard deviations. The assay measurements are linear (slope=l) from this level up to at least 16,000GE. The spike-in mix experiments showed that across the range of 4-600GE, accuracy was very high (estimated slope was 0.99 which is very close to the expected value of 1) as was the precision (the standard error of the slope estimate was 0.01). The performance of each assay showed that 95% of marker slope estimates ranged between 0.96 and 1.01. The slope estimates for individual CND assays (grey lines) varied slightly with a standard deviation of 0.03 indicating only very minor differences in assay performance. This is relevant in clinical applications, as each individual, informative CND should provide an independent measurement of plasma DNA chimerism.

[00244] The CND qPCR assays exhibited high reliability (i.e. reproducibility) upon repeat testing of the 4-fold serial dilution standards over time (8-9 separate qPCR experimental runs); the coefficient of variation ranged from 1.7-3.8% (total standard deviations) for measurements across 0-16,000 GE.

EXAMPLE 14

Clinical application in a transplant setting

[00245] The technical performance characteristics of the subject assay indicates that the underlying premise of exploiting common CNDs to quantify DNA chimerism is sound. The transplant-derived ccfDNA levels were measured in blood samples collected shortly after and during the weeks following transplantation from 4 patients who had received an allogeneic kidney transplant.

[00246] The application of this assay in kidney transplantation (n=81) has indicated that the "stable" level in non-rejecting patients is below 50+20GE/ml. The promise of the CND method for monitoring the health of transplanted allogeneic kidneys is demonstrated in longitudinal studies of 2 "stable" patients (cases 1 and 2) and 2 patients (cases 3 and 4) with biopsy-determined antibody mediated rejection. Both "stable" patients showed measurements elevated significantly above 50+20GE/ml within the first 2 weeks post transplantation. However, the levels stabilized below 70GE/mL within 3 weeks and remained so for all subsequent time points. Throughout this period, levels of transplant-derived ccfDNA correlated with clinical status and biopsy (protocol) assessments. In comparison, the two "rejectors" showed very high levels (-300-400 GE/mL) at times coincident with biopsy-determined rejection. Notably, the levels in both the "rejectors" dropped after a change in therapeutic management. Except for case 3, assessment of transplant-derived ccfDNA levels was based on multiple CND assay measurements.

[00247] Those skilled in the art will appreciate that the disclosure described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the disclosure contemplates all such variations and modifications. The disclosure also enables all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of the steps or features or compositions or compounds.

Table 9

In silico and in vitro genotype frequencies for the initial panel of 10 CNDs.

HapMap Frequency In Vitro Frequency

CND 0- 1 - 2- 0- 1- 2- marker copy copy copy copy copy copy

CND_01 0.508 0.418 0.074 0.57 0.387 0.043

CND_02 0.517 0.400 0.083 0.591 0.366 0.043

CND_03 0.504 0.413 0.083 0.387 NA* NA*

CND_04 0.462 0.429 0.109 0.624 0.28 0.096

CND_05 0.454 0.471 0.076 0.591 0.323 0.086

CND_06 0.473 0.375 0.152 0.452 0.473 0.075

CND_07 0.426 0.434 0.139 0.376 0.441 0.183

CND_08 0.433 0.433 0.133 0.511 0.322 0.167

CND_09 0.421 0.455 0.124 0.409 0.484 0.107

CND_10 0.410 0.418 0.172 0.269 0.656 0.075 Table 10

CND, SRY and Total plasma ccfl)NA measurements and fetal fraction estimates for 12 singleton male pregnancy samples qPCR Copy Number CND-based SRY-based SNP-based

Maternal (GE/mL) Fetal Fetal Fraction MPS⁰ Fetal

Plasma HBB Fraction % % Fraction %

Sample CND SRY (Total) (difference¹³) (difference¹³)

Sample 1 95 52 629 15 (+2) 8 (-5) 13

Sample 2 127 57 1389 9 (+2) 4 (-3) 7

Sample 3 176 78 1175 15 (+2) 7 (-6) 13

Sample 4 62 58 855 7 (0) 7 (0) 7

Sample 5 60 55 920 6 (-6) 6 (-6) 12

Sample 6 48 49 924 5 (0) 5 (0) 5

Sample 7 132 75 1746 7 (+l) 4 (-2) 6

Sample 8 82^a 52 721 11 (-2) 7 (-6) 13

Sample 9 45 38 587 8 (-l) 6 (-3) 9

Sample 10 225 81 1651 14 (+3) 5 (-6) 11

Sample 11 43 29 531 8 (0) 6 (-2) 8

Sample 12 47 45 803 6 (-l) 6 (-l) 7

EXAMPLE 15

Additional Methods

Digital PCR

[00248] The technical "Digital droplet PCR (ddPCR) is a relatively new method which importantly provides absolute quantification of nucleic acid that is less dependent on PCR reaction efficiency and is accurate at low target concentrations. Each PCR reaction is distributed into approximately 15,000x1 microlitre water- in-oil emulsion droplets. The distribution of target DNA sequence into droplets is dependent on concentration. After the PCR reaction is run with a hydrolysis probe, a droplet reader quantifies fluorescence in each individual droplet. The number of positive droplets divided by the total number of generated droplets is used to calculate the target concentration."

Plasma ccfDNA isolation

[00249] DNA was isolated from plasma using the QIAamp Circulating Nucleic Acid Kit (Qiagen, Melbourne, Australia) according to the manufacturer's guidelines, with slight modifications in reagent volumes as described below. Briefly, lmL aliquots of plasma were lysed with ΙΟΟμί of Proteinase K and 0.8mL of ACL buffer containing 5^g of carrier RNA. This was mixed thoroughly by vortexing and incubated at 60°C for 30 minutes. The tubes were centrifuged at 2,000rpm for 30 seconds and 1.8mL of buffer ACB was added and mixed thoroughly by vortexing. This was followed by incubation of the lysate-buffer ACB mixture on ice for 26 5 minutes. The QIAvac 24 Plus system (Qiagen) was used for processing of Qiagen mini spin columns. The column was washed with Buffer ACW1 (600μΙ_), Buffer ACW2 (750μΙ_) and 750μΙ_ of ethanol (100%), which were added and drawn through the column by the vacuum pump. The column was removed from the QIAvac 24 Plus system and placed in a clean tube and centrifuged at 13,000rpm for 3 minutes. Flow through was discarded and the column was placed in a new collection tube and incubated in a heat block at 56°C for 10 minutes to dry the membrane. The column was placed in a new collection tube and 50 to ΙΟΟμί of RNase free dH20 was added to the centre of the membrane and incubated at room temperature for 1 5 minutes. The column was centrifuged at 13,000rpm for 1 minute and the eluted volume was re-applied to the column and incubated at room temperature for a further 5 minutes. Finally, the column was centrifuged at 13,000rpm for 1 minute to elute the DNA. DNA isolation from blood cell fraction:

[00250] Genomic DNA was isolated from leukocytes using the Nucleobond Blood Extraction Kit (Macherey-Nagel, Diiren, Germany) according to the manufacturer's instructions. DNA was quantified with the NanoDrop ND-1000 UV Vis spectrophotometer.

Design of primers and probes

[00251] A panel of 15 CNV-deletion (CND) markers and Angiotensin I converting enzyme (ACE) control was developed for for quantitative PCR (qPCR) assays. Angiotensin I converting enzyme (ACE) is present in 2-copies per diploid human genomic DNA and thus , was used as a control to measure the total cell-free circulating DNA level. PrimerQuest an online Primer designing tool from Integrated DNA Technologies was used to generate PCR Primer and Zen double-quenched probes (DQP- ZEN and Iowa Black FQ quenchers) for all qPCR assays( IDT Zen probes have showed to be able to increase the accuracy and reliability of 5' nuclease qPCR experiments). The specificity of each primer pair was tested by both High Resolution Melt Curve analysis on the ViiA 7 Real time PCR system (Applied Biosystems) and gel electrophoresis. To be able to duplex the qPCR assays in one ddPCR reaction, the CND markers and ACE were randomly generated with either fluorescent reporting dyes FAM or HEX as Table 1.

[00252] Sequence details of the 15 CND panel and the ACE control are shown below in table 11.

Table 11

Sequence details of the 15 CND panel and the ACE control

Table 12

Sequence details of the 15 CND panel and the ACE control

Droplet digital PCR

[00253] The ddPCR Absolute Quantification experiments were performed using Bio- Rad QX200 Droplet Digital system (Bio-red, Pleasanton, CA), following manufacturer's instruction http://www.gene-quantification.de/bio-rad-ddpcr-app-guide-6407.pdf. In brief, 25ul of ddPCR reaction mixture was assemble including 2x Droplet PCR Supermix (Cat#l 863024), primers(900nM), probes(250nM) and 2.5ul of DNA template. The 20ul ddPCR mixture and 70ul of droplet generator oil (cat#l 863004) were loaded into the Bio-Rad DG8 Cartridge (cat#l 864008) and then the cartridge was placed into the Bio-Rad QX200 Droplet Generator to generate droplets. The generated droplets then were transfered to an Eppendrof Twin Tec PCR Semi- skirted 96 wells plate (cat#Epp0030128.605) and the plate was heat sealed by Bio-Rad PX1 PCR Plate Sealer and then placed into a Bio-Rad CIOOOTM Thermal Cycler for PCR. The PCR conditions were setup according to manufacturer's protocol: denature DNA at 95°C for lOmins, following PCR enrichment by 30 second at 95°C andl min at 60°C for 40 cycles, and hold the reaction at 12 °C. No- Template Controls were included in each ddPCR run for all assays. After PCR, the plate was read by Bio-Rad QX200 Droplet Reader to obtain the result.

Data analysis

[00254] The ddPCR droplets' data obtained were analyzed by Bio-Rad QuantaSoft analysis software. An amplitude threshold was applied to define positive droplets from negative droplets according to the corresponding No Template control droplet amplitude level. The Concentration (copy/ul) data obtained were converted to GE/mL by using the formula previously described (Lo et al. 1998, AM J HumGenetl998;62:768-75).

BIBLIOGRAPHY

Ausubel et al. (1995-1999) Current protocols in molecular biology 15, John Wiley & Sons NY

Chiu et al. (2008) Proc. Natl. Acad. Sci. USA 105(51 ):20458-20463

Conrad et al. (2010) Nature 464 (7289):Ί0 -Ί\2

Faas et al. (2012) Expert Opin Biol Ther. 12 (Suppl 1):S 19-26

Fan et al. (2008) Proc. Natl. Acad. Sci. USA 105(42): 16266- 16271

Hahn et al. (2011) Placenta 32:S 17-20

Liu et al. (1996) J. Am. Chem. Soc. 775: 1587

Lo et al. (1997) Lancet 350 (9076J:485-487

Lo et al. (1998) Am J Hum Genet 62(4):Ίβ -ΊΊ5

McCarrol et al. (2008) Nature Genet 40(10): 1166-1174

Sooknanan et al. (1994) Biotechniques 77: 1077

Stankiewicz et al. (2010) Ann. Rev. Med. (57:437-455

Stevens et al. (2012) EJHG 20:657-667

Stevens et al. (2012) PLOS One 7:49575

Tyagi et al. (1996) Proc. Natl. Acad. Sci. USA 93:5395

Zheng et al. (2011) Clin Chem 55:549-558

Zimmermann et al. (2012) Prenat Diagn 32: 1233- 1241

Claims

CLAIMS:

1. A method for quantitating the level of fetal DNA in a maternal fluid sample comprising fetal and maternal DNA, said method comprising: identifying a heterozygous or homozygous form of a CNV polymorphism which is present in fetal DNA and absent in the maternal DNA in cell-free DNA isolated and/or enriched from the maternal sample and, determining the level of fetal DNA in the sample based on the identified CNV polymorphism.

2. A method for quantitating the level of non-self DNA in a transplant recipient sample comprising self and non-self DNA, said method comprising: identifying a heterozygous or homozygous form of a CNV polymorphism which is present in non-self DNA and absent in the self DNA in cell-free DNA isolated and/or enriched from the transplant recipient sample and, determining the amount of non-self DNA in the sample based on the identified CNV polymorphism.

3. The method of Claim 1 or 2, wherein the determining the level of fetal or non-self DNA in the sample comprises subjecting the cell free DNA to an amplification reaction with primers which target the identified CNV.

4. The method of Claim 1 or 2, wherein the determining the level of fetal or non-self DNA in the sample comprises assessing the cell free DNA with an amplification- independent detection means which target the identified CNV.

5. The method of any one of Claims 1 to 4 wherein the cell free DNA is fragmented genomic DNA.

6. The method of any one of Claims 1 to 5, wherein more than one CNV is identified.

7. The method of any one of Claims 1 to 6, wherein at least 3, or at least 4, or at least 5 CNV's are identified.

8. The method of any one of Claims 1 to 7 wherein the CNV polymorphism is a copy number deletion (CND).

9. The method of any one of Claims 1 to 8, wherein the sample is selected from blood, plasma, serum, urine, lymph fluid, sputum and tissue fluid.

10. The method of Claim 9, wherein the sample is plasma, serum or urine.

11. The method of any one of Claims 1 to 10 wherein the subject is a human.

12. The method of Claim 8 wherein the CND polymorphism is selected from a panel of from 2 to 41 CND polymorphisms listed in Table 7.

13. The method of Claim 8 wherein the CND polymorphism is selected from a panel of from 10 to 30 CND polymorphisms listed in Table 7.

14. The method of Claim 8 wherein the CND polymorphism is selected from a panel of from 10 to 20 CND polymorphisms listed in Table 7.

15. The method of Claim 8 wherein the CND polymorphism is selected from a panel of about 10 CND polymorphisms listed in Table 7.

16. The method of Claim 8 wherein the CND polymorphism is selected from the panel of 10 CND polymorphisms defined in Table 6.

17. The method of any one of Claims 8 to 16 wherein the CND polymorphisms are detected by an amplification-based method using the primers selected from Table 2 or 3.

18. The method of any one of Claims 8 to 16 wherein the CND polymorphisms are detected by NGS or NanoString technology.

19. The method of Claim 1 or any one of claims 3 - 18, wherein the level of fetal DNA is indicative of a pathological condition, pathological damage to the fetus or cellular damage to the placenta.

20. The method of Claim 19, wherein the pathological condition is preeclampsia or nucleic acid released from cytotrophoblast.

21. A non-invasive in-vitro fetal diagnostic assay comprising quantitating the level of fetal DNA according to the method of Claim 1 or any one of claims 3 to 18 and then performing a genetic test for a particular condition.

22. The assay of claim 21, wherein the level of fetal DNA is indicative of the accuracy of the assay, wherein a low level of DNA indicates a low degree of accuracy for a genetic test and a high level of DNA indicates a high degree of accuracy for a genetic test.

23. A non-invasive in-vitro assay comprising quantitating the level of non-self DNA according to the method of any one of claims 2 to 18 and then determining a patients response to immunotherapy based on the level of non-self DNA.

24. A set of primers for use in the methods of anyone of claims 1 to 3 and 5 to 18.

25. The set of primers of Claim 24, wherein the primers target internally a CND.

26. The set of primers of Claim 25 wherein the CND polymorphism, is selected from the panel of CND polymorphisms listed in Table 7.

27. The set of primers of Claim 26, wherein the primers are selected from the list shown in Table 2 or 3.

28. A kit when used for the methods of any one of claims 1 or 3 to 18, the kit comprising the primers of any one of claims 24 to 27.

29. The kit of Claim 28 further comprising a compartment adapted to receive a fluid sample.

30. Use of the primers according to any one of claims 24 to 27 in the manufacture of a non-invasive in-vitro diagnostic assay for performing the method of any one of claims 1 to 3 and 5 to 16 in a subject.