WO2015040574A1 - Biological control of insects - Google Patents
Biological control of insects Download PDFInfo
- Publication number
- WO2015040574A1 WO2015040574A1 PCT/IB2014/064643 IB2014064643W WO2015040574A1 WO 2015040574 A1 WO2015040574 A1 WO 2015040574A1 IB 2014064643 W IB2014064643 W IB 2014064643W WO 2015040574 A1 WO2015040574 A1 WO 2015040574A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- insect
- dsrna
- modified
- coding region
- insects
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/60—Isolated nucleic acids
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/60—New or modified breeds of invertebrates
- A01K67/61—Genetically modified invertebrates, e.g. transgenic or polyploid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2207/00—Modified animals
- A01K2207/05—Animals modified by non-integrating nucleic acids, e.g. antisense, RNAi, morpholino, episomal vector, for non-therapeutic purpose
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/70—Invertebrates
- A01K2227/706—Insects, e.g. Drosophila melanogaster, medfly
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2330/00—Production
- C12N2330/50—Biochemical production, i.e. in a transformed host cell
Definitions
- the sterile insect technique is a species-specific biological control method that can reduce or eliminate populations of pest insects without the need of chemical pesticides.
- the technique requires the release of large numbers of sterilized males, which then compete with wild males for female mates to reduce the population (Knipling, 1960; Vreysen et al., 2000; Klassen et al., 1994; Hendrichs et al, 1995; Bloem and Bloem, 1999).
- chemosterilants are typically used to sterilize males for SIT, but these treatments can decrease their ability to compete for mates, which often necessitates the production and release of many more sterile males to increase efficacy (Holbrook and Fujimoto, 1970; Mayer et al., 1998; Helsinki and Knols, 2008). SIT is considered more effective if females are not released
- a modified insect includes decreased expression of a testis-specific coding region compared to a control insect.
- the modified insect is male.
- the modified insect includes, when compared to the control insect, reduced fertility, reduced fecundity, or a combination thereof.
- the competiveness of the modified insect is not significantly reduced compared to the control insect.
- the modified insect is a member of the family Culicidae (e.g., Aedes spp., Anopheles spp., or Culex spp.), the family Tephritidae (e.g., Ceratitis capitata, Anaslrepha spp., or Bactrocera spp.), the family Tortricidae (e.g., Cydia pomonella), the Order Diptera (e.g., Cochliomyia hominivorax or Glossina spp.), or the Order Lepidoptera (e.g., Orgyia anartoides).
- Culicidae e.g., Aedes spp., Anopheles spp., or Culex spp.
- Tephritidae e.g., Ceratitis capitata, Anaslrepha spp., or Bactrocera spp.
- the modified insect is a mosquito, such as Aedes aegypti, Aedes albopictus, Aedes vexans, Anopheles gambiae, Anopheles farauti, Anopheles quadrimaculatus, Anopheles stephensi, Culex pipiens, Culex quinquefasciatus, or Culex tarsalis.
- the testis-specific coding region is selected from Table 2 or a homologue thereof. The expression of more than one testis-specific coding region may be decreased.
- the modified insect further includes decreased expression of a coding region encoding a sex differentiation polypeptide, such as a doublesex female splice variant, compared to a control insect.
- a sex differentiation polypeptide such as a doublesex female splice variant
- the method includes administering to an insect, such as a juvenile insect, a composition that includes a double stranded RNA (dsRNA) that inhibits expression of a testis-specific coding region.
- dsRNA double stranded RNA
- the juvenile insect is allowed to mature into an adult, wherein the adult insect has reduced fertility, reduced fecundity, or a combination thereof, compared to a control insect.
- the testis-specific coding region is selected from Table 2 or a homologue thereof. The expression of more than one testis-specific coding region may be decreased.
- the method is used to make a modified insect that is a member of the family Culicidae (e.g., Aedes spp., Anopheles spp., or Culex spp.), the family Tephritidae (e.g., Cer otitis capitata, Anastrepha spp., or Bactrocera spp.), the family Tortricidae (e.g., Cydia pomonella), the Order Diptera (e.g., Cochliomyia hominivorax or Glnssina spp.), or the Order Lepidoptera (e.g., Orgyia anartoides).
- Culicidae e.g., Aedes spp., Anopheles spp., or Culex spp.
- Tephritidae e.g., Cer otitis capitata, Anastrepha spp., or Bac
- the modified insect is a mosquito, such as Aedes aegypti, Aedes albopictus, Aedes vexans, Anopheles gambiae, Anopheles far auti, Anopheles qiiadrimaculatus, Anopheles stephensi, Culex pipiens, Culex quinquefasciatus, or Culex tarsalis.
- Aedes aegypti Aedes albopictus
- Aedes vexans Anopheles gambiae
- Anopheles far auti Anopheles qiiadrimaculatus
- Anopheles stephensi Culex pipiens, Culex quinquefasciatus, or Culex tarsalis.
- the administering includes feeding the composition to the insect.
- the dsRNA may be present in bacteria that are fed to the insect, and the bacteria may be living or inactivated.
- the insect is a larva or a pupa.
- the testis-specific coding region is selected from Table 2 or a homologue thereof.
- the composition further includes at least one additional dsRNA that inhibits expression of a testis-specific coding region.
- the method further includes administering to the insect a second dsRNA that inhibits expression of a coding region encoding a doublesex female splice variant. Also provided is a modified insect produced by the method, and a population of an insect produced by the method.
- the method includes releasing into an environment a population of a modified insect described herein, wherein the number of viable progeny in the next generation is reduced. In one embodiment, the reduction is determined by comparison to release of a wild-type insect into the environment.
- the method includes administering to a population of an insect at a juvenile stage a composition that includes a double stranded RNA (dsRNA) that inhibits expression of a coding region encoding a doublesex female splice variant, and wherein the population of the insect has a reduced number of males compared to a population of the insect not administered the composition.
- dsRNA double stranded RNA
- double stranded RNAs disclosed herein, including the single stranded RNA polynucleotides and single stranded DNA and double stranded polynucleotides corresponding to the double stranded RNAs
- the term "and/or” means one or all of the listed elements or a combination of any two or more of the listed elements.
- Conditions that are "suitable” for an event to occur, or “suitable” conditions are conditions that do not prevent such events from occurring. Thus, these conditions permit, enhance, facilitate, and/or are conducive to the event.
- the steps may be conducted in any feasible order. And, as appropriate, any combination of two or more steps may be conducted simultaneously.
- Figure 1 Testis-specific coding regions ofAedes aegypti encoding polypeptides.
- insects such as mosquitoes
- SIT sterile insect technique
- SIT is a biological method of controlling pest insects by releasing large number of sterile males into a locality, where they compete with wild males for mates, and can effectively reduce or eliminate the pest population.
- modified insects refers to an insect that has been altered “by the hand of man” through the introduction of an exogenous polynucleotide.
- exogenous polynucleotide refers to a polynucleotide that has been introduced into an insect and includes, but is not limited to, a polynucleotide that is not normally or naturally found in an insect.
- the exogenous polynucleotide is a double stranded RNA (dsRNA).
- a modified insect described herein has decreased expression of a testis-specific coding region compared to a control insect, decreased expression of a female-specific coding region compared to a control insect, or a combination thereof.
- a modified insect having decreased expression of a testis- specific coding region and/or decreased expression of a female-specific coding region may include an exogenous polynucleotide.
- a modified insect may be at any developmental stage, such as larva, pupa, or adult.
- a modified insect is a larva or pupa that will develop into an adult that has reduced fertility, reduced fecundity, or a combination thereof.
- a modified insect is an adult and has reduced fertility, reduced fecundity, or a combination thereof.
- a "control" insect is the same species of insect but is unmodified relative to the modified insect.
- insects that may be modified using the methods described herein include, but are not limited to, pests, such as insects that act as vectors for viral, bacterial, and/or parasite-based diseases; and/or inflict damage on crops, fruits, vegetables, animals, and/or humans.
- an insect is a member of the family Culicidae.
- mosquitoes such as Aedes spp. (e.g., A. aegypti, A. albopicliis, and A. vexans), Anopheles spp. (e.g., A. gambiae, A. farauti, A. quadrimaculatus, A. stephensi, A.
- an insect is a member of the family Tephritidae.
- insects include fruit flies such as Ceratitis capitata (commonly referred to as the Medfly), Anastrepha spp. (e.g. A. ludens, A. suspense, A. oblique) and Bactrocera spp. (e.g., B. tryoni, B. dorsalis, and B. o ae, B. cucurbitae).
- an insect is a medical or animal pest that is a member of the Order Diptera, such as a screw worm fly (Cochliomyia hominivorax), or tsetse fly (Glossina spp, such as G. palpalis, G. fuscipes, G. morsitans, G. tachinoides, G. longipalpis, G. fusca, G. tabaniformis, G. brevipalpis, G. vanhoofi, G. austeni).
- an insect is a member of the Order Lepidoptera (e.g. member of the Lymantriidae famil , e.g. Orgyia anartoides) or of the family Tortricidae, e.g. Cydia pomonella).
- a method for making a modified insect includes administering to an insect a composition that includes a polynucleotide.
- polynucleotide refers to a polymeric form of nucleotides of any length, either ribonucleotides or
- deoxynucleotides includes both double- and single-stranded DNA and RNA.
- polynucleotide may include nucleotide sequences having different functions, including for instance coding sequences, and non-coding sequences such as regulatory sequences. Coding sequence, non-coding sequence, and regulatory sequence are defined below.
- a polynucleotide can be obtained directly from a natural source, or can be prepared with the aid of recombinant, enzymatic, or chemical techniques.
- a polynucleotide can be linear or circular in topology.
- a polynucleotide can be, for example, a portion of a vector, such as an expression or cloning vector, or a fragment.
- the polynucleotide may be a double stranded R A (dsRNA) that inhibits expression of a testis-specific coding region.
- the polynucleotide may be a DNA sequence that encodes a dsRNA. It should be understood that the sequences disclosed herein as DNA sequences can be converted from a DNA sequence to an RNA sequence by replacing each thymidine nucleotide with a uridine nucleotide.
- the insect may be juvenile or adult. A juvenile insect includes all stages except adult, e.g., larva and pupa. In one embodiment, the insect administered a composition described herein is a larva.
- a "coding region” is a nucleotide sequence that encodes an unprocessed preRNA (i.e., an RNA molecule that includes both exons and introns), and is processed to result in an mRNA that is translated into a polypeptide.
- the boundaries of a coding region are generally determined by a transcription initiation site at its 5' end and a transcription terminator at its 3' end.
- a "testis-specific coding region” is a coding region that is expressed in the testis, but is either absent or expressed at undetectable levels (using qRT-PCR techniques) in other male tissues or in females.
- a “female-specific coding region” is a coding region encoding a sex differentiation polypeptide that is expressed in both males and females, but a different splice variant is expressed in males and females.
- a “female-specific coding region” is the variant that is expressed in females only.
- testis-specific coding regions have been identified that, when expression is decreased, result in decreased fertility and/or decreased fecundity, and do not significantly reduce competitiveness.
- the testis-specific coding regions encoding polypeptides that may be decreased in a modified insect include, but are not limited to, the coding regions available at the Genbank accession numbers AAEL001684, AAEL002275, AAEL004231, AAEL004471, AAEL004939, AAEL005010, AAEL005975, AAEL006726, AAEL006975, AAEL007188, AAEL007434, AAEL010639, and AAEL011310.
- Each of these coding regions are transcribed and processed to result in an mRNA sequence, which is shown in Figure 1 and Table 1. Table 1.
- the coding regions shown in Table 1 may be used in methods where the insect administered a dsRNA is a member of the family Culicidae.
- the insect is Aedes aegypti.
- a dsRNA directed to a coding region that is a homologue of a coding region shown in Table 1 may be used with other insects.
- Example 1 shows that dsRNA directed to a coding region of Drosophila melanogaster that is a homologue of a coding region shown in Table 1 reduces fertility and/or fecundity, and does not have a significant effect on competitiveness in D. melanogaster (see Table 7). This evidence that coding regions silenced A.
- aegypti genes a member of the family Culicidae, also worked in D. melanogaster, a member of the family Tephritidae, shows the applicability of the methods described herein for use with other insects.
- coding regions present in other insects that are homologues of the coding regions disclosed herein (e.g., in Table 1 and the D. melanogaster coding regions shown in Table 7) can be used for making dsRNAs to silence testis-specific coding regions with the expectation that the dsRNAs will reduce fertility and/or fecundity in other insects.
- Coding regions that are homologues are coding regions that share ancestry, e.g., they are both derived from a coding region present in a common ancestor.
- the skilled person can easily determine if a coding region in a n n-A. aegypti insect is a homolog of a coding region disclosed herein through the use of routine methods.
- the skilled person can use the nucleotide sequence of a coding region disclosed herein and design degenerate PCR primers for use in a low stringency PCR.
- Low stringency PCR is a routine method for identifying homologs of known coding region.
- the skilled person can use readily available databases to identify in another insect a homolog of a coding region disclosed herein.
- suitable databases include, but are not limited to, VectorBase (available through the world wide web at vectorbase.org) and GenBank (available through the world wide web at ncbi.nlm.nih.gov/genbank).
- the skilled person can identify a homolog of a coding region disclosed herein by the level of sequence identity between the coding region disclosed herein and another coding region.
- percent identities greater than 50% are taken as evidence of possible homology.
- the E value indicates the number of hits (sequences) in the database searched that are expected to align to the query simply by chance, so a E value less than 0.01 (i.e., less than 1% chance of the sequence occurring randomly), coupled with a percent identity of greater than 50% is considered a suitable score to identify a probable homolog.
- coding regions in an insect that are homologues of the coding regions in Table 1 may be identified using the BLAST-X algorithm against the non-redundant database at NCDI with default parameters.
- a candidate coding region is considered to be a homologue of a coding region disclosed in Table 1 if the candidate coding region has at least greater than 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% nucleotide sequence identity to the respective coding regions in Table 1.
- Decreased expression of one or more of the coding regions disclosed in Table 1 may result in decreased fertility, decreased fecundity, or a combination thereof in an insect.
- Fertility refers to the ability of a population of males to yield viable eggs after presentation to a virgin mate (see Table 4).
- a population of males receiving one or more dsR A that targets one or more mRNA is considered to have sufficiently decreased fertility if at least 50% of the males in the population are sterile, e.g., unable to produce viable eggs after presentation to a virgin female.
- Decreased fecundity refers to a reduction in the number of progeny produced by an incompletely sterile male.
- a fertile male is considered to have sufficiently decreased fecundity if the number of progeny produced by an incompletely sterile male is reduced by at least 50% compared to a control male.
- testis-specific coding region While decreased expression of a testis-specific coding region often results in reduced fertility and/or reduced fecundity, it was expected that certain mutations in testis-specific coding regions would also reduce the competitiveness of the male.
- Competitiveness refers to the ability of a male insect to seek mates and compete with wild-type male insects for a female insect. Releasing a population of modified male insects in an environment for population control is ineffective if the males are unable to compete with the wild males for females.
- silencing did not have a significant effect on competitiveness of the insect.
- Competitiveness can be measured by determining whether males administered one or more dsRNA that targets a coding region disclosed in Table 1, or a homologue thereof, (and having decreased fertility and/or decreased fecundity) causes a reduction in population when competing with control males (see Table 6). Decreasing expression of a coding region disclosed in Table 1, or a homologue thereof, does not significantly alter competitiveness of a male insect if a population size is reduced by at least 20%. Methods for determining whether competitiveness is altered are described herein.
- competitiveness can be determined by exposing 5 dsRNA-treated males and 5 untreated males to 10 virgin females, determining the number of progeny, and comparing to the number of progeny from mixing 5 untreated males to 10 virgin females.
- the method includes administering to the insect a dsRNA that inhibits expression of a sex differentiation polypeptide.
- suitable sex differentiation polypeptides include those that, when silenced in a developing insect, inhibit the development of females and increase the likelihood the developing insect will be male by the adult stage.
- a method that includes administration of such a dsRNA will result in a male-biased population.
- a population of developing insects administered such a dsRNA will result in a population of adults that are, are at least, or are no greater than, 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85 %, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% male.
- an insect is administered a dsRNA that decreases expression of one or more testis-specific coding regions and a dsRNA that inhibits expression of a sex differentiation polypeptide.
- sex differentiation polypeptides examples include, but are not limited to, doublesex, sex lethal, and transformer.
- the function of these proteins have been well described in the model insect species Drosophila melanogaster, and related genes encoding some or all these proteins have been identified in a variety of insects (Gempe and Beye, 2010).
- a sex differentiation polypeptide is expressed in both males and females, hut a different splice variant is expressed in males and females.
- the doublesex gene has been found in all insects examined to date, and usually functions in a manner similar to that observed in D. melanogaster (Salvemini, 2011).
- the transformer gene has been found is many insects examined, and evidence suggests that it is differentially spliced in females and males.
- a dsRNA for use in silencing a sex differentiation coding region is designed to target an mRNA that is necessary for the development of females.
- the splice variant that is expressed in insects that will become female is targeted, while the splice variant that is expressed in insects that will become male is not targeted.
- the identity of these splice variants is known for many insects. For those insects where the identity of the splice variants is not known, it can be easily determined by the skilled person by comparison with the known splice variants.
- Any dsRNA that decreases expression of the protein encoded by the doublesex gene may be used. Examples of two dsRNAs are shown in Table 2, and one or both may be used.
- a dsRNA used in a method described herein includes a sense strand and an anti-sense strand.
- the sense strand is at least 19 nucleotides in length; however, longer lengths are generally more desirable.
- the sense strand may be, but not limited to, at least 50, at least 100, at least 200, at least 300, or at least 400 nucleotides, for instance.
- dsRNAs greater than 30 nucleotides in length will induce an interferon-mediated cell immune response, leading to cell death. Invertebrates, including insects, lack this interferon-based response, and hence, longer dsRNAs can be delivered.
- the sense strand is substantially identical, or identical, to a mRNA that is targeted by the dsRNA, i.e., a target mRNA.
- a target mRNA i.e., a target mRNA.
- the term “identical” means the nucleotide sequence of the sense strand has the same nucleotide sequence as a portion of the target mRNA.
- substantially identical means the sequence of the sense strand differs from the sequence of a target mRNA at some number of nucleotides, but the ability of the complementary antisense strand to bind to and silence expression of the target mRNA is maintained.
- the sequence of the sense strand differs from the sequence of a target mRNA at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotides, while the remaining nucleotides are identical to the sequence of a polynucleotide, such as a mRNA.
- the other strand of a dsRNA polynucleotide referred to herein as the anti-sense strand, is substantially complementary, or complementary to the sense strand.
- complementary refers to the ability of two single stranded polynucleotides to base pair with each other, where an adenine on one polynucleotide will base pair to a thymine or uridine on a second polynucleotide and a cytosine on one polynucleotide will base pair to a guanine on a second polynucleotide.
- an antisense strand that is "complementary" to another polynucleotide, such as a target mRNA means the nucleotides of the antisense strand are complementary to a nucleotide sequence of a polynucleotide, such as a target mRNA.
- the term “substantially complementary” means the antisense strand includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotides that are not complementary to a nucleotide sequence of a polynucleotide, such as a target mRNA.
- RNA polynucleotides and single stranded DNA polynucleotides corresponding to the sense strands and antisense strands disclosed herein are also provided herein.
- double stranded polynucleotides disclosed herein including the complements of the single stranded polynucleotides.
- a dsRNA described herein may include overhangs on one or both strands.
- An overhang is one or more nucleotides present in one strand of a double stranded RNA that are unpaired, i.e., they do not have a corresponding complementary nucleotide in the other strand of the double stranded polynucleotide.
- An overhang may be at the 3' end of a sense strand, an antisense strand, or both sense and antisense strands.
- An overhang is typically 1, 2, or 3 nucleotides in length. In one embodiment, the overhang is at the 3' terminus and has the sequence uracil-uracil (or thymine-thymine if it is a DNA). Without intending to be limiting, such an overhang may be used to increase the stability of a dsRNA. In one
- an overhang if an overhang is present it is not considered when determining whether a sense strand is identical or substantially identical to a target mRNA, and it is not considered when determining whether an antisense strand is complementary or substantially
- sense and antisense strands of a double stranded RNA described herein may also be covalently attached, for instance, by a spacer made up of nucleotides.
- an shRNA includes a sense strand followed by a nucleotide loop and the analogous antisense strand.
- the antisense strand can precede the nucleotide loop structure and the sense strand can follow.
- a dsRNA described herein may be modified. Such modifications can be useful to increase stability of the polynucleotide in certain environments. Modifications can include a nucleic acid sugar, base, or backbone, or any combination thereof. The modifications can be synthetic, naturally occurring, or non-naturally occurring. A dsRNA can include modifications at one or more of the nucleic acids present in the polynucleotide. Examples of backbone modifications include, but are not limited to, phosphonoacetates,
- thiophosphonoacetates phosphorothioates, phosphorodithioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2-O-methyl ribonucleotides, and peptide- nucleic acids.
- nucleic acid base modifications include, but are not limited to, inosine, purine, pyridin-4-one, pyridin-2-one, phenyl, pseudouracil, 2,4,6-trimethoxy benzene, 3-methyl uracil, dihydrouridine, naphthyl, aminophenyl, 5-alkylcytidines (e.g., 5- methylcytidine), 5-alkyluridines (e.g., ribothymidine), 5-halouridine (e.g., 5-bromouridine) or 6-azapyrimidines or 6-alkylpyrimidines (e.g. 6-methyluridine), or propyne
- inosine purine
- pyridin-4-one pyridin-2-one
- phenyl pseudouracil
- 2,4,6-trimethoxy benzene 3-methyl uracil
- dihydrouridine naphthyl
- aminophenyl e.g., 5-al
- nucleic acid sugar modifications include, but are not limited to, 2'-sugar modification, e.g., 2'-0-methyl nucleotides, 2'-deoxy-2'-fluoro nucleotides, 2'- deoxy-2'-fluoroarabino, 2'-0-methoxyethyl nucleotides, 2'-0-trifluoromethyl nucleotides, 2'-0-ethyl-trifluoromethoxy nucleotides, 2'-0-difluoromethoxy-ethoxy nucleotides, or 2'- deoxy nucleotides.
- Polynucletotides can be obtained commercially synthesized to include such modifications (for instance, Dharmacon Inc., Lafayette, CO).
- a dsRNA useful herein is biologically active.
- a biologically active dsRNA causes the post-transcriptional inhibition of expression, also referred to as silencing, of a target coding region.
- silencing the post-transcriptional inhibition of expression
- the antisense strand of the dsRNA will hybridize with a target mRNA and signal cellular endonucleases to cleave the target mRNA. The result is the inhibition of expression of the polypeptide encoded by the mRNA.
- Whether the expression of a target coding region is inhibited can be determined by, for instance, measuring a decrease in the amount of the target mRNA in the cell, measuring a decrease in the amount of polypeptide encoded by the mRNA, or by measuring a change in a phenotype associated with expression of the polypeptide encoded by the mRNA.
- polynucleotides that may be used to silence the expression of mRNAs encoded by the coding regions disclosed in Table 1 and in Table 7 are shown in Table 2. Also included in Table 2 are examples of polynucleotides that may be used to silence the expression of mRNAs encoded by the female splice variant of the doublesex coding region.
- dsRNA for use in silencing expression (only one strand shown). encoded by coding
- GCATCCACAATCCCCATGCTGGAG (SEQ ID NO:27 ) CG3565 CTGGAGAATGCCCGCTTCAACTACGTGTATATGAAGGACATTGCTCGCCTGGCAAAGGA CTCGATCTTCTCGCATAACGAGCTGATTAGCATTGTAATGCTCTACCATAAGTTTGTGCTG GTCAATGGGCCGAGAGCAAAGTACATGACCATTCAGCAACTCTCTGCGCTGATGGAGCT CTTGTTTGAGATCGTGGATCGCGATCTCATTGCGACCATTGTGTATAGAATAGCCCATAC ACCAGGTTCCAGGCCTCCTGACTTCTTTTCCGACAAGCATATACACTTGGAGTCCTTTGTG CGGCTTTTCACCGTATACTT (SEQ ID NO: 28)
- dsRNAs shown in Table 2 may be used to silence expression of a target mRNA, and that longer dsRNAs may also be used. Also understood by the skilled person is the ability to use other dsRNAs to silence expression of the target mRNAs disclosed in Table 2.
- dsRNA polynucleotides useful in the methods described herein can be designed using methods that are routine and known in the art. For instance, candidate dsRNA
- polynucleotides that inhibit the expression of one of the mRNAs described herein may be identified using readily available algorithms.
- a candidate polynucleotide is the
- the candidate polynucleotide that is being tested to determine if it decreases expression of one of the coding regions described herein.
- the candidate polynucleotide can be identical to
- Candidate polynucleotides may be screened using publicly available algorithms (e.g., BLAST) to compare the candidate polynucleotide sequences with coding sequences. Those that are likely to form a duplex with an mRNA expressed by a non-target coding region are typically eliminated from further consideration. The remaining candidate polynucleotides may then be tested to determine if they inhibit expression of a coding region.
- BLAST e.g., BLAST
- candidate polynucleotides are individually tested by introducing a candidate polynucleotide into a cell that expresses the appropriate polypeptide.
- the candidate polynucleotides may be prepared in vitro and then administered to an insect, or to a cell that expresses the target m NA.
- Methods for in vitro synthesis include, for instance, chemical synthesis with a conventional DNA/RNA synthesizer. Commercial suppliers of synthetic polynucleotides and reagents for such syntheses are well known. Methods for in vitro synthesis also include, for instance, in vitro transcription using a circular or linear vector in a cell free system.
- the candidate polynucleotide may be administered as a dsRNA.
- a candidate polynucleotide may also be administered to an insect, or to a cell that expresses the target mRNA, as a construct that encodes the candidate polynucleotide.
- constructs are known in the art and include, for example, a vector encoding and expressing a sense strand and an antisense strand of a candidate polynucleotide, and RNA expression vectors that include the sequence encoding the sense strand and antisense strand of a candidate polynucleotide flanked by operably linked regulatory sequences, such as an RNA polymerase III promoter and an RNA polymerase III terminator, that result in the production of an RNA polynucleotide.
- operably linked regulatory sequences such as an RNA polymerase III promoter and an RNA polymerase III terminator
- a cell that can be used to evaluate a candidate polynucleotide may be a cell that expresses the appropriate target mRNA.
- a cell can be ex vivo or in vivo.
- ex vivo refers to a cell that has been removed from the body of an insect. Ex vivo cells include, for instance, primary cells (e.g., cells that have recently been removed from an insect and are capable of limited growth in tissue culture medium), and cultured cells (e.g., cells that are capable of extended culture in tissue culture medium).
- the term "in vivo” refers to a cell that is within the body of an insect.
- Methods for introducing a candidate polynucleotide into a cell, including a vector encoding a candidate polynucleotide are known in the art and routine.
- such methods include, for instance, transfection with a delivery reagent, such as lipid or amine based reagents, including cationic liposomes or polymeric DNA-binding cations (such as poly-L-lysine and polyethyleneimine).
- electroporation or viral transfection can be used to introduce a candidate polynucleotide, or a vector encoding a candidate polynucleotide.
- methods include, but are not limited to, feeding the candidate polynucleotide to an insect or soaking the insect in a composition that includes the candidate polynucleotide.
- the amount of target mRNA in a cell containing a candidate polynucleotide can be measured and compared to a control cell (e.g., the same type of cell that does not contain the candidate polynucleotide).
- a control cell e.g., the same type of cell that does not contain the candidate polynucleotide.
- Methods for measuring mRNA levels in a cell are known in the art and routine. Such methods include quantitative reverse-transcriptase polymerase chain reaction (RT-PCR). Primers and specific conditions for amplification of a target mRNA can be readily deteiTtiined by the skilled person. Other methods include, for instance, Northern blotting, and array analysis.
- RNA samples can be used to measure a decrease in the amount of polypeptide encoded by the mRNA, or to measure a decrease in the activity of the polypeptide encoded by the mRNA.
- Methods for measuring a decrease in the amount of a polypeptide include assaying for the polypeptide present in cells containing a candidate polynucleotide and comparing to a control cell. Whether a cell expresses one of the polypeptides can be determined using methods that are routine and known in the art including, for instance, Western imrnunoblot, ELISA, immunoprecipitation, or immunohistochemistry.
- a candidate polynucleotide is able to decrease the expression of a target mRNA by at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% when compared to a control cell.
- a dsRNA described herein can be encoded by a polynucleotide present in a vector.
- a vector is a replicating polynucleotide, such as a plasmid, phage, or cosmid, to which another polynucleotide may be attached so as to bring about the replication of the attached polynucleotide. Construction of vectors containing a polynucleotide described herein employs standard ligation techniques known in the art. See, e.g., Sambrook, 1989.
- a vector can provide for further cloning (amplification of the polynucleotide), i.e., a cloning vector, or for expression of the polynucleotide, i.e., an expression vector.
- the term vector includes, but is not limited to, plasmid vectors.
- a vector may result in
- a vector is capable of replication in a bacterial host, for instance E. coli.
- a polynucleotide described herein can be present in a vector as two separate complementary polynucleotides, each of which can be expressed to yield a sense and an antisense strand of the dsR A, or as a single polynucleotide containing a sense strand, a loop region, and an anti-sense strand, which can be expressed to yield an RNA polynucleotide having a sense and an antisense strand of the dsRNA.
- Selection of a vector depends upon a variety of desired characteristics in the resulting construct, such as a selection marker, vector replication rate, and the like.
- Suitable host cells for cloning or expressing the vectors herein are prokaryote or
- Suitable prokaryotes include members of the domain Bacteria and
- a suitable prokaryote is E. coli.
- An expression vector optionally includes regulatory sequences operably linked to the polynucleotide of the present invention.
- the promoter results in the
- RNA polynucleotide examples include those that cause binding of an RNA polymerase, such as an RNA polymerase III complex, to
- promoters include U6 and HI promoters.
- a promoter may be constitutive or inducible.
- Another regulatory sequence is a transcription
- Suitable transcription terminators are known in the art and include, for example
- the polynucleotide such as a dsRNA
- Methods for administering a dsRNA to an insect include, but are not limited to, administration by direct injection into an insect, administration by feeding, and administration by exposing the insect to conditions where dsRNA penetrates the cuticle (e.g., soaking the insect in a composition that includes one or more dsRNAs.
- the polynucleotide is present in a composition suitable for the chosen route of administration.
- a composition that is to be injected is formulated to be suitable for injection, for instance, isotonic with the recipient insect, and the like.
- a composition that is to be used for administration by soaking is suitable for maintaining the viability of the insect.
- An example of such a composition is an aqueous solution that is free of chlorine and pesticides.
- a dsRNA may be administered to an insect at the larva stage, the pupa stage, or the adult stage
- the polynucleotide may be complexed with a compound suitable for the chosen route of administration.
- a polynucleotide may be associated with nanoparticles (see, for instance, Zhu et al., US Published Patent Application 2013/0137747), and/or other compounds that promote the uptake of a polynucleotide by a cell (see, for instance, Whyard et al., US Published Patent Application 2013/0237586).
- the polynucleotide is present in solid form that is fed to an insect. Different solid forms may be used depending upon the insect that is to be targeted, and the use of different solid forms is known to the skilled person and routine.
- the solid form is a cell.
- the cell may be any cell that will be ingested by the insect and that can be engineered to express the dsRNA.
- the cell may be a prokaryotic cell or a eukaryotic cell.
- prokaryotic cells include members of the domain Bacteria and members of the domain Archea.
- Bacteria is the routinely used host cell Eschericia coli, and another example is Pseudomonas spp.
- eukaryotic cells include, but are not limited to, unicellular microbes such as yeasts, such as Saccharomyces cerevisiae, and plant cells.
- Other solid forms that may include the dsRNA and be fed to an insect are routinely used during laboratory culture of insects and are readily available.
- a cell is combined with a nutrient source and a matrix, such as agar or other gelatinous substance, which is then fed to an insect, such as a larva.
- a composition that includes a cell having a dsRNA, a nutrient source, and an agar is disclosed in Example 1.
- a dsRNA combined with a nutrient source and a matrix is not present in a cell.
- a cell that is fed to an insect may be capable of replication or may be inactivated, i.e., incapable of replication.
- a cell may be inactivated in any way, provided the dsRNA in the inactivated cell remains biologically active, e.g., does not lose the ability to silence a target coding region.
- Methods for inactivation of a cell are known in the art and routine, and include, for instance, heat, high pressure, antibiotics (bacteriostatic or bacteriocidal), and the like.
- the dosage administered to an insect is sufficient to result in decreased expression of the polypeptide encoded by the target mRNA.
- Such dosages can be easily determined by the skilled person.
- the concentration of dsRNA is, is at least, or is no greater than, 0.01 milligrams/milliliter (mg/ml), 0.05 mg/ml, 0.1 mg/ml, 0.5 mg/ml, or 1 mg/ml.
- mg/ml 0.01 milligrams/milliliter
- 0.05 mg/ml 0.05 mg/ml
- 0.1 mg/ml 0.5 mg/ml
- 1 mg/ml 0.01 milligrams/milliliter
- concentration of the combined dsRNAs is, is at least, or is no greater than, 0.01
- the volume injected is, is at least, or is no greater than, 5 nanoliters (nl), 10 nl, 15 nl, 20 nl, or 25 nl.
- An insect may be injected once, or more than once. In one embodiment, an insect may be injected at different developmental stages.
- the concentration of dsRNA in the aqueous solution is, is at least, or is no greater than, 0.01 mg/ml, 0.05 mg ml, 0.1 mg/ml, 0.5 mg/ml, or 1 mg/ml. In one embodiment, when more than one mRNA is present, the concentration of the combined dsRNAs is, is at least, or is no greater than, 0.01 milligrams/milliliter (mg/ml), 0.05 mg/ml, 0.1 mg/ml, 0.5 mg/ml, or 1 mg/ml.
- the insect may be exposed to the dsRNA continuously or for shorter periods.
- the insect is exposed to the solution with the dsRNA(s) for, for at least, or for no greater than, 30 minutes, 1 hour, or 2 hours each day. In one embodiment, the exposure is for, for at least, or for no greater than, 1, 2, 3, 4, 5, or 6 days. In one embodiment, the insect is a larva or a pupa and exposure is for each day of that developmental stage.
- the insect when the dsRNA is administered by feeding it to the insect, the insect is fed the composition 1 or more times each day. In one embodiment, the exposure is for, for at least, or for no greater than, 1, 2, 3, 4, 5, or 6 days. In one embodiment, the insect is a larva and exposure is for each day of that developmental stage.
- more than one dsRNA may be administered to an insect.
- an insect may be injected more than once with separate compositions, each of which contain one type of dsRNA, or injected once with a composition that includes different types of dsRNAs.
- an insect may be fed a composition that includes different microbes, each of which contains one type of dsRNA, or may be fed a single microbe that has been engineered to include more than one type of dsRNA.
- the different types of dsRNAs may target the same mRNA or different mRNAs.
- dsRNAs that target different mRNAs are synergistic in the effect they have on reducing fertility, reducing fecundity, and/or increasing male bias. Examples of combinations that are synergistic are shown in Table 14. It was also found that dsRNAs that not reduce fertility and/or fecundity when used alone can result in significant reductions of fertility and/or fecundity when used with other dsRNAs.
- a modified insect including, but not limited to, a modified insect produced by the methods disclosed herein.
- the insect may be a larva, a pupa, or an adult.
- the modified insect is male.
- a modified insect has the phenotype of decreased fecundity, decreased fertility, or the combination thereof, compared to a control.
- the modified insect has no significant alteration in competitiveness compared to a control.
- the insects of the population may be a larva, a pupa, adult, or a combination thereof.
- the population has decreased fecundity, decreased fertility, or the combination thereof, compared to a control population.
- the modified insect has no significant alteration in competitiveness compared to a control.
- the population includes adults that are male biased.
- the population is, is at least, or is no greater than, 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85 %, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% male.
- a population of modified insects may be produced by mass breeding in a containment facility.
- a population of modified insects may be produced by exposing insects in an environment to one or more polynucleotides, such as a dsRNA.
- insects in a natural environment may be exposed to a dsRNA by adding dsRNA to baited food that is present in a natural environment.
- Insects such as insects at the larval stage, ingest the baited food and the dsRNA.
- a composition that includes a food substance to act as a bait may also include an attractant, such as a pheromone, to attract insects.
- the size of a population of insects is not intended to be limiting, and may be, for instance, at least 100, at least 10,000, at least 100,000, or at least 1 million modified insects.
- a method is directed to biological control of an insect.
- Biological control refers to decreasing the population of a target insect in a defined area, and includes controlling reproduction in a population of the target insect.
- the area may be a laboratory setting, or a natural environment.
- the method includes releasing into an environment a population of modified insects. The method results in a reduction of the number of viable progeny of the insect in the environment, thereby causing a reduction in the numbers of the insect in the environment.
- the method may result in the elimination, suppression, containment, or prevention of a target insect in a defined area.
- the environment may be any location where the target insect is present.
- the insects that are released may be in any developmental stage, e.g., larval, pupal, or adult, or a combination thereof. In one embodiment, the released insects are adults.
- Methods for releasing insects into environments for use in biological control such as sterile insect technique methods, may vary depending on the insect, and are known in the art and routine.
- baited food may be used in a natural environment.
- the insect for instance, Aedes aegypti
- dsRNA double-stranded RNA
- RNAi gene-specific RNA interference
- the insects may be simultaneously fed dsRNA that targets a female-specific gene, thereby inhibiting female development.
- combinations of dsRNAs resulted in the production of male-only mosquitoes, and when tested in mating competitions with fertile males, the sterilized males were highly effective in reducing the population of mosquitoes.
- An extensive search for male-reproduction genes found that not all genes, when targeted by RNAi, would render the males sterile, and others failed to leave the males able to compete for female mates.
- RNAi phenotype can persist during the insect's development, and that the dsRNA can reach the gonad to induce the desired phenotype.
- This method of producing sterile, male-only insects is an improvement over other existing methods where sex-sorting is challenging (such as when irradiating or treating with chemosterilants), and is an improvement over the use of genetically-modified insects, where the potential of spreading the transgene into non-target populations is a concern.
- RNA double-stranded RNA
- sex-ratio can be altered by feeding larvae with dsRNA targeting the female variant of the duublesex gene, which is involved in sex differentiation.
- dsRNA targeting the female variant of the duublesex gene which is involved in sex differentiation.
- testis-specific and female-specific dsx dsRNAs it was possible to produce a population of mosquitoes that were almost entire male and either fully sterile or with severely reduced fecundity. It was also found that these dsRNAs could be expressed in bacteria, and that feeding the live or heat-killed bacteria to the mosquitoes had the same effect.
- Testis-specific genes are identified in the mosquito Aedes aegypti.
- Table 3 Genes expressed predominantly or strictly in the testis of A. aegypti genes. Genes were identified in a SSH screen, selectively amplifying genes expressed in testes relative to the rest of the male's body. RT-PCR was used to assess whether the genes showed any expression in other male tissues, in late instar larvae, or in female ovaries. Genes are ordered in ascending gene accession numbers.
- RNAi of the testis-specific genes rendered the males sterile or poorly fertile.
- RNAi double-stranded RNAs were prepared for all 15 testis- specific genes and were injected into male pupae.
- QRT-PCR confirmed that RNAi was induced in the insects, with knockdown of transcripts ranging between 40 to 94% of control levels (controls were males injected with a non-mosquito-specific g3 ⁇ 4i-dsRNA).
- Knockdown of all of the 15 targeted genes resulted in sterile or very weakly fertile males (Table 4). Not all dsRNAs, however, were equally effective; some induced high levels of RNAi and had greater impacts on male fertility, whereas other dsRNAs had weaker RNAi effects and lesser impacts on fertility or fecundity. In total, 12 dsRNAs iiiduced sterility in greater than 50% of the treated males, lower ( ⁇ 50% of controls) fecundity of the males, or both high sterility frequencies and low fecundities.
- RNAi-mediated knockdown of some testis-specific genes resulted in increased sterility frequencies and reduced fecundities in male mosquitoes.
- the potential suitability of the genes to serve as RNAi targets for SIT was assessed by noting whether fecundity was reduced more than 50% (+), sterility was induced in more than 50% of the males (+), or both + + .
- RNAi of gonad-specific genes rendered both males and females sterile or poorly fertile.
- dsRNAs were prepared for 6 genes that were identified as being expressed in both testes and ovaries, and following injection into pupae, both male and female insects were rendered sterile or with significantly reduced fecundity, relative to insects injected with dsRNA specific to the bacterial gus gene (Table 5).
- Percent fecundity of those individuals that produced viable eggs was calculated relative to three control matings between gus-dsRNA-injected individuals and virgin mates, which produced 43 ⁇ 5 viable eggs/ female by day 7, post-mating.
- RNAi of some testis-speciflc genes also reduced competitive ability of the males.
- testis-specific dsRNAs tested in the mosquito Aedes aegypti some negatively affected male mating behaviour, while others had minimal or no negative impact on male mating fitness.
- These 10 dsRNAs targeted genes that represent strong candidates for further screening to identify suitable RNAi targets to produce sterile males for SIT applications in this species. Table 6.
- dsRNA-injected males are competitive with fertile males and can reduce the number of progeny in the next generation.
- RNAi of the homologous genes in D. melanogaster also induced sterility, and some had limited or no negative effects on male mating competitiveness.
- RNAi of testes genes in D. melanogaster produce sterile males that are competing for mates.
- Values represent the reduction in targeted gene expression based on RNA derived from 10 pooled males.
- Ds-RNA-treated males were mated to two virgin females, and the number of progeny produced was compared to gus-dsRNA-treated males.
- a male's fertility/fecundity was assessed as being reduced if there were more than 30% fewer progeny than the controls (Chi square, P ⁇ 0.05). While the cut-off for a suitable reduction in fertility or fecundity was considered 30%, all these testes genes targeted in D. melanogaster resulted in a statistically significant reduction of fertility or fecundity.
- Feeding mosquito larvae dsRNAs can render the insects sterile as adults.
- Mosquito larvae were treated with several formulations of ingestible dsRNAs targeting the testes genes.
- E. coli bacteria expressing hairpin dsRNAs were fed continuously to larvae, either live or heat-killed. Using either live or dead bacteria, three of the dsRNAs were effective at inducing full sterility in many males, and significantly reduced fecundity in remaining males.
- Percent sterility represents the percentage of males that were completely sterile (no viable progeny) following mating with two virgin females.
- Percent fecundity refers to the number of viable progeny of the remaining fertile males, relative to the
- RNAi Increased concentrations of dsRNA enhanced the sterilization effect of dsRNAs (Table 9).
- RNAi is known to be dose dependent, and efficacy of RNAi can be enhanced by increasing the concentration of dsR A in the water treatments.
- Increased sterilization rates could also be achieved by combining two different dsRNAs, targeting different genes. This phenomenon was observed when mosquitoes were either exposed to dsRNA in the water or were fed E. coli expressing two different dsRNAs (Table 10).
- Doublesex is a sex-differentiation gene that is differentially spliced in male and female insects.
- the female splice variant of dsx produces DSX F , which acts as a transcription factor that controls expression of many female -specific genes in insects.
- DSX M the protein derived from the male-specific splice variant, coordinates expression of male-specific genes.
- RNAi-mediated knockdown of dsx v in mosquitoes was achieved by delivering two dsRNAs targeting the female-specific exons of dsx, either by soaking the insects in the two combined dsRNAs or by feeding equal concentrations of the two dsRNA-expressing E. coli strains, each targeting the two different dsx F sequences.
- E. coli strains Two E. coli strains were mixed, one expressing dsRNA targeting the female-specific dsxF transcript, the other expressing dsRNA targeting the AAEL004231 transcript. These were mixed with a feeding formulation (see Methods) to feed the mosquito larvae continuously. The adults that were produced were sexed and provided mates to assess their fertility (produced any offspring?) and fecundity (number of offspring). The insects fed on these E. coli developed almost entirely as males (96% males), indicating that the majority of females had failed to develop due to silencing of the dsxF transcripts (Table 12).
- Mosquitoes derived from cultures fed on E. coli expressing the two dsRNAs targeting female development and male fertility were mixed with untreated mosquitoes in small population cages holding 50 untreated females, and varying proportions of dsRNA fed males and untreated males.
- the mosquitoes collected from the dsRNA-fed cultures were not sex-sorted, which meant that a very small percentage of females were included in with the dsRNA-fed males.
- the impact on the size of the next generation was significant with even a seeding of the population of 25% dsRNA-fed insects, and the population was very strongly reduced when the proportion of sterile males exceeded 50%. (Table 13).
- Mosquito larvae were also soaked in equimolar concentrations of the two dsRNAs (0.2 mg/ml), and the percent reduction on the population was equally if not slightly more effective than the bacterial feeding method (Table 14).
- Table 13 Mixing dsRNA-fed (by E. coli feeding) mosquitoes into populations of mosquitoes reduces the effective size of the next generation. The values represent the means and standard errors for three replicate experiments.
- % dsRNA-fed mosquitoes 1 Viable progeny of % reduction from controls generation 2 (no sterile males)
- the dsKNA-treated mosquitoes typically consisted of 96% males, 4% females.
- Table 14 Male mosquito sterilization frequencies following treatment with one dsRNA (0.02 mg/ml) or simultaneously with two different dsRNAs, each at 0.01 mg/ml.
- the values in the table indicate the percentages of males sterilized with just the single dsRNA (along the diagonal) or with two different dsRNAs (values above the diagonal). Not all pairwise combinations have been tested, but it is evident that some most combinations provide higher sterility than single dsRNAs. Many pairwise combinations of dsRNAs appear synergistic (marked with an asterisk *), as they show greater than a 5% increase over a simple additive effect.
- Some of the dsRNAs used are those identified herein, including Table 2 (e.g., dsRNA 1684 below corresponds to dsRNA AAEL001684 in Table 2).
- dsRNA targets are those identified herein, including Table 2 (e.g., dsRNA 1684 below corresponds to dsRNA AAEL001684 in
- RNA isolation Testes and male accessory glands (MAGs) were dissected from 2-day old male Aedes aegypti mosquitoes and were stored in RNAlater (Ambion). Tissues stored in R Alater were centrifuged at 14,000 ⁇ for 5 min at 4°C, the supernatant was removed, and tissues were washed with 0.5 ml of DEPC-treated water and pelleted once again to remove the liquid supernatant. Total RNA extraction was performed using an RNeasy Mini Kit (Qiagen) and mRNA was isolated using an Oligotex mRNA Mini Kit (Qiagen) according to
- Subtr active library construction Suppression subtractive hybridization (SSH;
- testis-specific subtracted library was built using a PCR-Select cDNA Subtraction kit (Clontcch) according to manufacturer's recommendations, using testis cDNA as the TESTER source of cDNA, and cDNA derived from the rest of the body, minus the MAGs, serving as the DRIVER cDNA.
- the SSH-specific adapters were ligated to the TESTER cDNAs and the two pools of cDNA were hybridized for the forward subtracted library.
- Reverse subtracted libraries were built for subsequent differential screening, where the TESTER and DRIVER designations were inversed. Amplification of hybrids corresponding to common sequences was suppressed, yielding a library enriched for differentially expressed sequences within the testes.
- the forward-subtracted library was ligated into the pDrive plasmid vector (Qiagen), which was used to transform DH5a E. coli cells (Invitrogen).
- the resulting cDNA library was plated on LB agar supplemented with 100 ⁇ g/ml ampicillin, 80 ⁇ Xgal, 0.5 niM IPTG and incubated overnight at 37°C.
- testes library The efficiency of the subtraction of the testes library was estimated using qRT-PCR by comparing the abundance of a predicted non-differentially expressed gene, / ⁇ -tubulin, using the primers tubF (5' CGTCGTAGAACCGTACAAC, SEQ ID NO: 38) and tubR (5' CAGGCAGGTGGTAATCC, SEQ ID NO: 39).
- tubF 5' CGTCGTAGAACCGTACAAC, SEQ ID NO: 38
- tubR 5' CAGGCAGGTGGTAATCC, SEQ ID NO: 39.
- the testis subtracted library was screened for differentially expressed ESTs following the manufacturer's instructions using the PCR-select cDNA subtraction screening kit (Clontech). Briefly, 120 E.
- coli clones were selected randomly and grown in 50 ⁇ of LB-ampicilin (100 ⁇ g/ml) for 6 h at 37 °C with moderate shaking in 96-well plates. Two microliters of each bacterial culture were then spotted in duplicate on LB agar plates, and allowed to grow for 4 h at 37C, followed by bacterial colony lifts onto Hybond+ membranes (Amersham Biosciences) using standard techniques. Probes for the forward and reverse subtracted libraries were prepared by labeling 100 ng total cDNA from each library with 32 P-ATP by random priming, using the PCR-Select differential screening kit (Clontech) following manufacturer's instructions.
- testis genes Selected colonies (strong signal with the forward and low signal with the reverse subtracted probe) were grown overnight in 2 ml of LB-ampicillin (100 ⁇ / ⁇ l) and purified using the Qiagcn Miniprcp kit. Sequencing reactions were performed using Big Dye v3.1 chemistry. DNA sequences were compared to the A. aegypti genome within the VectorBase database and predicted Drosophila melanogaster homologues were identified using BLAST-X against the non-redundant database at NCBI with default parameters.
- RT-PCR confirmation of testis expression Tissue and sex-specific expression of the identified genes was confirmed and quantified using qRT-PCR, comparing expression of the genes' expression levels within testis, ovaries, and male bodies minus testis and MAGs.
- S7 ribosomal protein (S7rp) gene expression was used as an internal reference to compare levels of RNAi.
- a single reference gene was deemed sufficient as the PCR efficiencies of the primer sets were calculated using the method of Pfaffl (2001), and were found to be essentially equivalent for all genes targeted by RNAi ( ⁇ -t b, AeCSl, AeCS2, and hsp83) and for the S7rp reference gene, with values ranging between 95.2 and 98.1%.
- Melt curve analyses were also performed and confirmed that only a single product was amplified with each primer pair in every sample.
- AAEL003501 F CGCAAGGATCGGAAACCAAT (58) CAGCAGGATACGGTCTTC (130)
- AAAGGAGCGAAGGAGACCAA 60
- GCGGCGGATGCGATTCTC 132
- AAEL013737 F AAGACTTGGGAAGAGGACGG TGTAGTTCG GTATCGTTCGG (184)
- the cDNA served as template DNA for PCR amplification of gene fragments ranging in size from 260 to 380 bp in length, using the primers listed in Table 15.
- the gene fragments were subcloned into the cloning vector pDrive (Qiagen), and later excised from pDrive using either Apal and Pstl or Mlul and Notl restriction enzymes, then ligated into a similarly-digested plasmid pL4440, a vector possessing convergent T7 promoters (kindly provided by Andrew Fire, Stanford University).
- pDrive cloning vector
- pL4440 a vector possessing convergent T7 promoters
- RNAi kit (Ambion) was then used for in vitro transcription and purification of dsRNAs. DsRNAs were diluted to 0.1 mg/ml in 20 mM phosphate, pH 7, and each pupae was injected with 50 nl. To assess for RNAi, insects were allowed to develop until 3-days post- eclosion and RNA was extracted as described above.
- Feeding dsRNA to mosquito larvae Mosquito larvae were soaked in two concentrations of in vztro-transcribed dsRNA (0.02 and 0.2 mg/ml dsRNA) in dechlorinated tap water for 1 h each day, and then returned to their feeding trays.
- the pL4440 plasmids containing the mosquito genes were used to transform HT115(DE3) E. coli cells and dsRNA production was induced by growing the liquid cultures of Luria Broth supplemented with 50 ul/ml ampicillin and 0.4 mM IPTG.
- the cells were pelleted by centrifugation and mixed with 1% LB-agar containing ampicillin and IPTG and 1 g of finely ground Purina Rabbit Chow, cooled to 42°C to ensure the bacteria were not heat killed.
- the agar bacteria mixture was plated to a thickness of 5 mm, cooled, and then cubed into 5 mm cubes, to be fed to mosquito larvae.
- Mosquito larvae were raised in densities of 0.5 larva/ml water (groups of 10 larvae in 20 ml) and provided single cubes of bacteria-containing agar on a daily basis. As pupae developed, they were transferred to individual vials to await eclosion and sex-sorting.
- Mosquito fertility assays Individual 3-day old dsRNA-treated mosquitoes were provided virgin mates in 25 ml plastic vials for 2 days. Mosquitoes were provided 10% sucrose ad libitum, and to assess fertility and fecundity, females were provided blood meals (derived from rats) 2 days post-mating, and eggs were collected on moistened paper towels placed within the vials for a week to 10 days post-blood meal. Eggs were incubated at 25°C for 4 days, and then immersed in water to assess hatch rates and calculate fecundity. If no eggs were produced, or all eggs failed to hatch, the dsRNA-treated insect was considered sterile. For small population mating competitions involving only 20 mosquitoes, 500 ml glass jars with screen-covered lids were used, while mating competitions using 100 mosquitoes were conducted in larger (45 X 45 x 45 cm) screened cages.
- RNAi in Drosophila Fragments of D. melanogaster genes were PCR-amplified using the primers listed in Table 16. DsR As were prepared as described above, and were injected (20 nl of 0.1 mg/ml) into wandering phase late instar larvae. Two days after adult eclosion, insects were collected and RNA was extracted to assess the extent of RNAi.
- dsRNA-treated males were mated to two virgin females, and the number of progeny produced was compared to gus-dsRNA-treated males.
- a male's fertility/fecundity was considered to be reduced if there were more than 30% fewer progeny than the controls (Chi square, P ⁇ 0.05).
- the dsRNA-treated males' ability to compete with fertile males for mates was assessed by mixing five dsRNA-treated males were mixed with five untreated males and 5 females. A reduction in the production of viable adult progeny of greater than 30% was considered significant, relative to control mating with 10 fertile males (ANOVA, P ⁇ 0.05).
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Plant Pathology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Environmental Sciences (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Agronomy & Crop Science (AREA)
- Pest Control & Pesticides (AREA)
- Virology (AREA)
- Dentistry (AREA)
- Animal Behavior & Ethology (AREA)
- Animal Husbandry (AREA)
- Biodiversity & Conservation Biology (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Catching Or Destruction (AREA)
Abstract
Description
Claims
Priority Applications (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| BR112016005832A BR112016005832A2 (en) | 2013-09-20 | 2014-09-18 | BIOLOGICAL CONTROL OF INSECTS |
| MX2016003104A MX368954B (en) | 2013-09-20 | 2014-09-18 | Biological control of insects. |
| AU2014322691A AU2014322691C1 (en) | 2013-09-20 | 2014-09-18 | Biological control of insects |
| US15/022,759 US10039287B2 (en) | 2013-09-20 | 2014-09-18 | Biological control of insects |
| CN201480063607.2A CN106102456B (en) | 2013-09-20 | 2014-09-18 | Biological control of insects |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201361880498P | 2013-09-20 | 2013-09-20 | |
| US61/880,498 | 2013-09-20 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2015040574A1 true WO2015040574A1 (en) | 2015-03-26 |
| WO2015040574A8 WO2015040574A8 (en) | 2015-11-19 |
Family
ID=52688314
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IB2014/064643 Ceased WO2015040574A1 (en) | 2013-09-20 | 2014-09-18 | Biological control of insects |
Country Status (6)
| Country | Link |
|---|---|
| US (1) | US10039287B2 (en) |
| CN (1) | CN106102456B (en) |
| AU (1) | AU2014322691C1 (en) |
| BR (1) | BR112016005832A2 (en) |
| MX (1) | MX368954B (en) |
| WO (1) | WO2015040574A1 (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109055360A (en) * | 2018-09-14 | 2018-12-21 | 皖南医学院 | A method for extracting total RNA from Anopheles mosquitoes |
| CN109644946A (en) * | 2018-12-29 | 2019-04-19 | 广州瑞丰生物科技有限公司 | A kind of release method of pronghorn bug |
| CN110551720A (en) * | 2019-08-13 | 2019-12-10 | 梅州市华师昆虫发育生物学与应用技术重点实验室广梅园研发中心 | dsRNA designed based on Dsx gene of periplaneta americana, preparation method, coding gene and application thereof |
| US10647995B2 (en) | 2015-06-16 | 2020-05-12 | Pioneer Hi-Bred International, Inc. | Compositions and methods to control insect pests |
| WO2022072334A1 (en) * | 2020-09-29 | 2022-04-07 | Brandeis University | Sterile organisms, methods of making, and methods of use thereof |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12054720B2 (en) | 2018-08-29 | 2024-08-06 | The Penn State Research Foundation | Compositions and methods for use in controlling mosquito-borne viruses |
| GB2579224A (en) * | 2018-11-26 | 2020-06-17 | Zyzzle Ltd | Apparatus for producing an improved animal population |
| JP7667566B2 (en) * | 2021-12-08 | 2025-04-23 | 国立研究開発法人農業・食品産業技術総合研究機構 | Method for producing sterile lepidopteran insects and agent for sterilizing lepidopteran insects |
| CN115088681B (en) * | 2022-08-02 | 2024-03-08 | 浙江省农业科学院 | A method of obtaining sterile male insects of tomato leafminer and its application in the control of this insect |
| WO2025050010A1 (en) * | 2023-08-31 | 2025-03-06 | Verily Life Sciences Llc | Release and capture techniques for insect population monitoring and control |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AUPR621501A0 (en) | 2001-07-06 | 2001-08-02 | Commonwealth Scientific And Industrial Research Organisation | Delivery of ds rna |
| CN1184879C (en) * | 2002-07-31 | 2005-01-19 | 北京市植物园 | Scaled breeding for semanotus bifasciatus and application in biological preventing and controlling pest-insect |
| US8906876B2 (en) | 2006-01-12 | 2014-12-09 | Devgen Nv | Methods for controlling pests using RNAi |
| CA2707880C (en) * | 2009-06-17 | 2018-02-27 | The University Of Queensland | A mosquito comprising mosquito-adapted wolbachia bacteria, and method of modifying mosquito populations |
| EP2698379A4 (en) * | 2011-03-18 | 2015-04-29 | Shanghai Inst Biol Sciences | PREPARATION FOR INSECT CONTROL AND METHOD BASED ON RNAI TECHNOLOGY |
| US8841272B2 (en) | 2011-05-31 | 2014-09-23 | Kansas State University Research Foundation | Double-stranded RNA-based nanoparticles for insect gene silencing |
-
2014
- 2014-09-18 WO PCT/IB2014/064643 patent/WO2015040574A1/en not_active Ceased
- 2014-09-18 US US15/022,759 patent/US10039287B2/en not_active Expired - Fee Related
- 2014-09-18 MX MX2016003104A patent/MX368954B/en active IP Right Grant
- 2014-09-18 CN CN201480063607.2A patent/CN106102456B/en not_active Expired - Fee Related
- 2014-09-18 BR BR112016005832A patent/BR112016005832A2/en not_active Application Discontinuation
- 2014-09-18 AU AU2014322691A patent/AU2014322691C1/en not_active Ceased
Non-Patent Citations (4)
| Title |
|---|
| SALVEMINI ET AL.: "Genomic organization and splicing evolution of the doublesex gene , a Drosophila regulator of sexual differentiation, in the dengue and yellow fever mosquito Aedes aegypti", BMC EVOLUTIONARY BIOLOGY, vol. 11, no. 41, 13 February 2013 (2013-02-13), pages 1 - 19, Retrieved from the Internet <URL:http://www.biomedcentral.com/1471-2148/11/41> * |
| SHUKLA J.N. ET AL.: "Sex determination in beetles: Production of all male progeny by parental RNAi knockdown of transformer", SCIENTIFIC REPORTS, vol. 2, 24 August 2012 (2012-08-24), pages 602 * |
| THAILAYIL J. ET AL.: "Spermless males elicit large-scale female responses to mating in the malaria mosquito Anopheles gambiae", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 108, no. 33, August 2011 (2011-08-01), pages 13677 - 13681 * |
| WHYARD ET AL.: "Ingested double-stranded RNA act as species specific insecticides", INSECT BIOCHEMISTRY AND MOLECULAR BIOLOGY, vol. 39, 28 September 2009 (2009-09-28), pages 824 - 832 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10647995B2 (en) | 2015-06-16 | 2020-05-12 | Pioneer Hi-Bred International, Inc. | Compositions and methods to control insect pests |
| CN109055360A (en) * | 2018-09-14 | 2018-12-21 | 皖南医学院 | A method for extracting total RNA from Anopheles mosquitoes |
| CN109644946A (en) * | 2018-12-29 | 2019-04-19 | 广州瑞丰生物科技有限公司 | A kind of release method of pronghorn bug |
| CN109644946B (en) * | 2018-12-29 | 2021-07-16 | 广州瑞丰生物科技有限公司 | A kind of release method of pronghorn bug |
| CN110551720A (en) * | 2019-08-13 | 2019-12-10 | 梅州市华师昆虫发育生物学与应用技术重点实验室广梅园研发中心 | dsRNA designed based on Dsx gene of periplaneta americana, preparation method, coding gene and application thereof |
| CN110551720B (en) * | 2019-08-13 | 2020-11-10 | 梅州市华师昆虫发育生物学与应用技术重点实验室广梅园研发中心 | dsRNA based on Periplaneta americana Dsx gene design, its preparation method, coding gene and application |
| WO2022072334A1 (en) * | 2020-09-29 | 2022-04-07 | Brandeis University | Sterile organisms, methods of making, and methods of use thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106102456A (en) | 2016-11-09 |
| AU2014322691C1 (en) | 2020-05-14 |
| WO2015040574A8 (en) | 2015-11-19 |
| MX2016003104A (en) | 2016-10-28 |
| US10039287B2 (en) | 2018-08-07 |
| AU2014322691B2 (en) | 2019-11-14 |
| MX368954B (en) | 2019-10-23 |
| AU2014322691A1 (en) | 2016-03-17 |
| CN106102456B (en) | 2020-11-17 |
| US20160227787A1 (en) | 2016-08-11 |
| BR112016005832A2 (en) | 2017-09-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2014322691C1 (en) | Biological control of insects | |
| AU2020257097B2 (en) | Compositions and methods for controlling arthropod parasite and pest infestations | |
| Whyard et al. | Silencing the buzz: a new approach to population suppression of mosquitoes by feeding larvae double-stranded RNAs | |
| Tan et al. | Gene silencing in root lesion nematodes (Pratylenchus spp.) significantly reduces reproduction in a plant host | |
| US11117938B2 (en) | RNA interference for control of insect pests | |
| US20170191065A1 (en) | Compositions and methods of using same for increasing resistance of infected mosquitoes | |
| AU2022201685B2 (en) | Compositions and methods for controlling arthropod parasite and pest infestations | |
| CA2869831A1 (en) | Compositions for controlling varroa mites in bees | |
| US12302904B2 (en) | RNAi insecticide materials and methods | |
| JP2019533477A (en) | A novel paratransgenic system for biological control of spread mosquitoes | |
| Liu et al. | Transmission of the wMel Wolbachia strain is modulated by its titre and by immune genes in Drosophila melanogaster (Wolbachia density and transmission) | |
| Simora | Transgene Insertion of Cathelicidin Gene in Channel Catfish Ictalurus punctatus using CRISPR/Cas9 Knock-in Technology and Cathelicidin Activity Against Catfish Pathogens | |
| CA3117490C (en) | Sex-linked rnai insecticide materials and methods | |
| Mohamed et al. | Bioassay and expression alterations of acetyl cholinesterase enzyme gene to spinosad (bio-insecticides) on nontarget silkworm, Bombyx mori (Lepidoptera: Bombycidae) | |
| US20210054379A1 (en) | Yeast for producing and delivering rna bioactive molecules and methods and uses thereof | |
| US20220248690A1 (en) | Sex-linked rnai insecticide materials and methods | |
| Upton | The leucine-rich repeat immune protein family in malaria vector mosquitoes | |
| CN121718557A (en) | DsRNA for preventing and treating bark beetles with red lipid and application thereof | |
| Brinzer | Drosophila, metabolomics and insecticide action | |
| Heath | New opportunities in pest control: Sea lamprey and small RNA technologies | |
| Volpe | RNAI-MEDIATED IMMUNOSUPPRESSION FOR THE DEVELOPMENT OF NEW INSECT CONTROL TECHNOLOGIES | |
| Short | The functional and evolutionary implications of reduced immune defense due to mating in female Drosophila melanogaster |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14845723 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2016/003104 Country of ref document: MX |
|
| ENP | Entry into the national phase |
Ref document number: 2014322691 Country of ref document: AU Date of ref document: 20140918 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 15022759 Country of ref document: US |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112016005832 Country of ref document: BR |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 14845723 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 112016005832 Country of ref document: BR Kind code of ref document: A2 Effective date: 20160317 |










