CN110551720B

CN110551720B - dsRNA designed based on Dsx gene of periplaneta americana, preparation method, coding gene and application thereof

Info

Publication number: CN110551720B
Application number: CN201910744841.6A
Authority: CN
Inventors: 李胜; 朱仕明
Original assignee: Guangmeiyuan R & D Center Key Laboratory Of Insect Developmental Biology And Applied Technology Huashi Meizhou City; South China Normal University
Current assignee: Guangmeiyuan R & D Center Key Laboratory Of Insect Developmental Biology And Applied Technology Huashi Meizhou City; South China Normal University
Priority date: 2019-08-13
Filing date: 2019-08-13
Publication date: 2020-11-10
Anticipated expiration: 2039-08-13
Also published as: CN110551720A

Abstract

The invention discloses a dsRNA designed based on a Dsx gene of periplaneta americana, a preparation method, a coding gene and application thereof, wherein the dsRNA is double-stranded RNA consisting of a nucleotide sequence shown as Seq ID No.1 as a sense strand and a nucleotide sequence reversely complementary with the nucleotide sequence shown as Seq ID No.1 as an antisense strand. The dsRNA can be widely applied to the preparation of products for preventing and controlling the periplaneta americana, interfering the chemical communication of the periplaneta americana or controlling the reproduction of female adults of the periplaneta americana or preventing and controlling the periplaneta americana and other insects with the same gene target sequence. The insect sex determination gene Dsx is used as a target, a dsRNA is designed based on a gene fragment in Dsx, and the dsRNA is introduced into the body of an adult female periplaneta americana to inhibit the ovum generation and the ovary maturation, so that the reproduction of the female periplaneta americana is controlled, and the purpose of preventing and controlling pests is achieved.

Description

dsRNA designed based on Dsx gene of periplaneta americana, preparation method, coding gene and application thereof

Technical Field

The invention relates to the field of sanitary pest control, in particular to dsRNA designed based on Dsx gene of periplaneta americana, a preparation method, a coding gene and application thereof.

Background

In 1965, a recessive mutation that made the male and female progeny develop intermediately was found in Drosophila, and this mutation was called doublesex (Dsx)^[1]. Studies have shown that the Dsx gene is produced by sex-specific alternative splicing of its transcriptsA male and a female specific DSX protein, which exert a bifunctional role in somatic sexual differentiation, thereby regulating downstream target genes associated with sex-specific characteristics^[2]. Dsx was thought to be the final major regulator in all insect sex determination cascades, however, later studies negated this statement that it is believed to be a central link between sex determination and sex differentiation^[3]. Dsx homologs have different numbers in different insect species, e.g., dipteran with multiple, hymenopteran with two, and lepidopteran with only one. Dsx has multiple terminal regulation functions including regulation of wing size, mimicry, sex, behavior and hormone secretion, etc., and during reproduction, Dsx can regulate vitellogenesis, indicating that Dsx has important role in reproduction regulation^[4]. RNAi mediated Dsx silencing in the amber silkworm (Antheraea assama) completely inhibited the expression of the Vg gene, indicating that Vg is a downstream target gene of Dsx and can cause ovarian malformation, fertility decline and complete lethality of eggs, revealing the importance of Dsx as a terminal regulator in reproduction^[5]. In the red parvalsbane, Vg and a receptor gene VgR (vitellogenin receptors) thereof are identified as target genes of Dsx, Dsx RNAi causes the expression of the two genes to be down-regulated, the ovum occurrence is inhibited, and the egg laying rate and the egg hatching rate are obviously reduced^[6]。

Periplaneta americana (Periplaneta americana) belongs to the order Blattaria, insects of the family Blattaceae, commonly known as cockroaches, are highly adaptable and fertile and are world-recognized pests of urban hygiene. Transmission of pathogenic organisms, such as bacteria, protozoa and viruses; and cause allergic reactions and asthma^[7]. Along with global warming, the urbanization process is accelerated, the traffic and trade are rapidly developed, the harm degree is increasingly serious, and the pest is an important sanitary pest in units such as hotels, restaurants, families, hospitals, schools, food processing and selling units, catering units and the like. The American cockroach belongs to an incomplete metamorphosis insect, has strong fertility and environmental adaptability, can carry out parthenogenesis, spreads pathogenic microorganisms, and is a serious urban sanitary pest. Chemical control is still the main control method for controlling the population quantity of the periplaneta americana at presentLong-term abuse of organophosphates, carbamates and pyrethroids chemical insecticides has led to increased resistance of the pests and environmental pollution. Therefore, it is imperative to establish a safe and effective mechanism for controlling cockroaches.

The reproduction of female insects has an important role in species reproduction, can be used as a pest control target, has great application potential, and is widely concerned. In recent years, due to the rapid development of biotechnology, bioinformatics has been used to search for effective target genes from insect genomes, and molecular biological means such as RNA interference have been used to study the influence of the target genes on pests. The technology has the advantages of high specificity, strong specificity, no generation of harmful substances polluting the environment and the like, and provides a new direction for pest prevention and control. By using Dsx as a target, the reproduction of female periplaneta americana is controlled, the purpose of preventing and controlling pests is further achieved, and the problems that the speed of reproduction of the periplaneta americana is high, the drug resistance is strong and the like in the prior art are expected to be solved.

Reference documents:

[1]Burtis KC,Baker BS.Drosophila Doublesex Gene Controls Somatic Sexual Differentiation by Producing Alternatively Spliced Mrnas Encoding Related Sex-Specific Polypeptides.Cell[J].1989,56(6):997-1010.

[2]Hildreth PE.Doublesex,a Recessive Gene That Tranforms Both Males and Females of Drosophila into Intersexes.Genetics[J].1965,51(4):659-678.

[3]Nagaraju J,Gopinath G,Sharma V,Shukla JN.Lepidopteran Sex Determination:A Cascade of Surprises.Sexual Development[J].2014,8(1-3):104-112.

[4]Shukla J,Nagaraju J.Two Female-Specific Dsx Proteins Are Encoded by the Sex-Specific Transcripts of Dsx,and Are Required for Female Sexual Differentiation in Two Wild Silkmoth Species,Antheraea Assama and Antheraea Mylitta(Lepidoptera,Saturniidae).Insect Biochemical and Molecular Biology[J].2010,40(9):672-682.

[5]Shukla JN,Palli SR.Doublesex Target Genes in the Red Flour Beetle,Tribolium Castaneum.Scientific Reports[J].2012,2(12):948.

[6]Verhulst EC,van de Zande L.Double Nexus-Doublesex Is the Connecting Element in Sex Determination.Briefings in functional genomics[J].2015,14(6):396-406.

[7]Gomez OE,Belles X.Microrna-Dependent Metamorphosis in Hemimetabolan Insects.Proceedings of the National Academy of Sciences[J].2009,106(51):21678-21682.

disclosure of Invention

The first technical problem to be solved by the present invention is: a dsRNA which can be used for the control of insects is provided.

A second technical problem to be solved by the present invention is: provides a preparation method of the dsRNA.

A third technical problem to be solved by the present invention is: provides a gene for coding the dsRNA and an expression vector, a transgenic cell line or a host bacterium containing the coding gene.

A fourth technical problem to be solved by the present invention is: provides the application of the dsRNA.

In order to solve the first technical problem, the technical scheme of the invention is as follows: the dsRNA is double-stranded RNA which is designed based on the Dsx gene of the periplaneta americana and consists of a nucleotide sequence shown as Seq ID No.1 as a sense strand and a nucleotide sequence which is reversely complementary with the nucleotide sequence shown as Seq ID No.1 as an antisense strand.

To solve the second technical problem, the technical solution of the present invention is: the preparation method of the dsRNA comprises the following steps: cloning a DNA fragment with a nucleotide sequence shown as Seq ID No.3 into a vector, designing a primer based on the cloned vector, carrying out PCR amplification, and transcribing and synthesizing a PCR amplification product to obtain the DNA fragment.

Preferably, the preparation method specifically comprises the following steps: amplifying a DNA fragment for designing targeted silencing Dsx dsRNA by using a primer 1 and a primer 2, cloning the amplified DNA fragment into a pTOPO vector to be named as pTOPO-Dsx, then designing a primer 3 and a primer 4 which contain T7 promoters at two ends by using the pTOPO-Dsx as a template, carrying out PCR amplification, and carrying out transcription synthesis to obtain a nucleotide sequence of the primer 3 as shown in Seq ID No.6 and a nucleotide sequence of the primer 4 as shown in Seq ID No. 7.

Preferably, the RNA is obtained by transcription and synthesis of T7RiboMAX Express RNAi System.

In order to solve the third technical problem, the technical scheme of the invention is as follows: a gene encoding the above dsRNA.

The preparation method of the gene comprises the following steps: designing a promoter primer pair based on the gene, and carrying out PCR amplification to obtain the gene.

Expression vector, expression cassette, transgenic cell line or host bacterium containing the gene.

In order to solve the fourth technical problem, the technical scheme of the invention is as follows: the dsRNA is applied to the preparation of products for preventing and controlling the American cockroach or controlling the reproduction of the female adult of the American cockroach.

The dsRNA is applied to prevention and control of American cockroach and other insects with the same gene target sequence.

A method for controlling Periplaneta americana comprises the following steps: the dsRNA is introduced into female Periplaneta americana.

Further, the introducing operation is performed by means of injection; preferably, the injection operation is from a second body segment along the abdomen.

Further, the introduction operation may also be by feeding.

Further, the introduction operation was performed by injecting dsRNA once on

days

2, 4 and 6 after eclosion, respectively.

The invention has the beneficial effects that: in the scheme of the invention, the Dsx gene is used as a control target of the periplaneta americana for the first time; the method is characterized in that an insect sex determining gene Dsx is used as a target, a dsRNA is designed based on a gene fragment in the Dsx, and the dsRNA is introduced into an adult female periplaneta americana body to inhibit the ovum generation and the ovary maturation, so that the reproduction of the female periplaneta americana is controlled, and the purpose of preventing and controlling pests is achieved; the dsRNA of the scheme of the invention has high specificity, targets specific genes of specific insects, and cannot generate harmful substances polluting the environment, and the RNAi designed by the scheme of the invention obviously inhibits the ovum generation and the ovary development of female adults of the periplaneta americana, seriously influences the generation of the offspring reproduction of the female adults of the periplaneta americana, and provides a new method for preventing and controlling the pests.

Drawings

Fig. 1 is an operation flowchart of an injection method and a detection method in embodiment 2 of the present invention;

FIG. 2 is a graph showing the trend of developmental changes in Dsx and Vg mRNA levels in the bodies of fat after eclosion for Periplaneta americana female adults in example 2 of the present invention;

FIG. 3 is a diagram showing the results of detecting the post-expression level of DsxRNAi in example 2 of the present invention;

FIG. 4 is a graph showing the change in ovarian morphology following Dsx RNAi in example 2 of the present invention;

FIG. 5 is a histogram of the amount of GSI change after Dsx RNAi in example 2 of the present invention;

FIG. 6 is a histogram of the change in ovarian granulosa egg length following Dsx RNAi in example 2 of the present invention;

fig. 7 is a gel electrophoresis image of Vg changes in ovaries after Dsx RNAi and Vg RNAi and a gray scale quantification image of protein bands in example 2 of the present invention, wherein (a) Vg content changes after Dsx RNAi; (b) change in Vg content after Vg RNAi; (c) quantifying the gray level of the protein band after Dsx RNAi; (d) vg gray scale quantification of protein bands after RNAi;

FIG. 8 is a graph showing the comparison of morphological changes of both the follicular cells and patent cells after Dsx RNAi and the change of the nuclear diameter of the follicular cells after Dsx RNAi in example 2 of the present invention; wherein (a) the phenotypic changes of ovarian follicular cells and patent following Dsx RNAi; (b) change in numbers of follicular cells per unit area following Dsx RNAi; (c) change in follicular nucleus diameter following Dsx RNAi.

Wherein "+" indicated in the figure represents "significance level P < 0.05", and "+" represents "significance level P < 0.001".

Detailed Description

In order to explain technical contents, structural features, and objects and effects of the present invention in detail, the following detailed description is given with reference to the accompanying drawings in conjunction with the embodiments.

The embodiment 1 of the invention is as follows: a dsRNA designed based on a periplaneta americana Dsx gene has a sense strand sequence of nucleotides shown as Seq ID No.1, an antisense strand of the dsRNA is a nucleotide sequence which is reversely complementary with the sequence shown as Seq ID No.1, and the nucleotide sequence shown as Seq ID No.1 is specifically as follows:

CGCCCGCUGUAGGAACCACCGCCUCAAGAUAGGCCUCAAGGGCCACAAGCGCUACUGCAAGUACCGGUACUGCAACUGCGACAAGUGCUGUCUGACGGCG。

the preparation process comprises the following steps:

(1) primer design

According to the Dsx gene sequence (shown as SEQ ID No.2) in the periplaneta americana genome database, the region segment (shown as SEQ ID No. 3) with higher conservation is used for designing dsRNA. Primer design software Primer Premier 5 is used for designing primers of interference fragments, and the length of the amplified fragments is 100 bp. Fragment forward primer Dsx-FP: CGCCCGCTGTAGGAACCAC (shown in SEQ ID No. 4), reverse primer Dsx-RP: CGCCGTCAGACAGCACTTG (shown in SEQ ID No. 5). A92 bp non-coding sequence of the pSTBlue-1 vector (dsCK) was used as a negative control dsRNA^[7]And a forward primer CK-FP: GAAAGCTC, reverse primer CK-RP: GAATACAGCGGCCGCGAG are provided.

The sequence of the Dsx gene of the periplaneta americana (SEQ ID No.2) is as follows:

ATGTCTGAGAACGGTGGCGAGCCAGGGCAGGAAGGCGCCCGGCCGGACGTTGCGGCTACTAGCAGCAGTTCGCAGAGTCCTCGTACGCCCCCCAATTGCGCCCGCTGTAGGAACCACCGCCTCAAGATAGGCCTCAAGGGCCACAAGCGCTACTGCAAGTACCGGTACTGCAACTGCGACAAGTGCTGTCTGACGGCGGAGCGCCAGCGGGTCATGGCGCTGCAGACGGCGCTGCGACGCGCCCAGGCGCAGGACGAGGCCCGCCTGGCCGGCCAGGTCGGAGGCCTCAGCATCGAGAACGGCGTGCCCGTCACCCAAACGTCCGCCCCCGGGGAGCCACCCGCCCCCGGCACCAGCGCCGCCGCCATCGTGTCCCGTTCCATGGAAGGCAGCTGCGATTCGTCGTCCTCGTCGCCCTGCTCCACCGGCGGCAGAGCGCTGTCCTCCGTCACCAGCGCGGGCGGCGCCGCCCTACGCGCCAGGGTGAATCCCCCGCACACCAACTCCGCTACTCCAGTCGAATTCCAGCCGATGACAGCTGGAACTTCCCTGAAGTCTTTCCCATCACTTTCCTTCCAGGATTCTTCCCGCCACCACTCCGCGCATCTCGATAATACATTGGACACTATCAACGCCCAAGGAGAGAGTTCGGAAGTTTCCGGCGAATCTCTCCAGATGCTGCTGGAAATGTTTAGGTTTCCTCCAGTAGCGCTGCCTCTAATCTACGTTGTTCTACAAGTCTCGCAATCGGATGTCAATGTGGCATACAATCGCATCATACAGGGAAAAATGTCGATAATGTATATTATATATGCAATAAGAATATATCACAAATTTTATGTGAATATCTCTAAAGAAATAAGTTGCTTGTTGGAAAAGGATATCTTTCAAAGTACATCTGTATTTTCTGCAGAATTTCAAGTAATTCTGAGTGCACTGAATTCATATCAGTAG。

the sequence of the conserved higher region fragment of the Dsx gene sequence of the periplaneta americana is as follows:

CGCCCGCTGTAGGAACCACCGCCTCAAGATAGGCCTCAAGGGCCACAAGCGCTACTGCAAGTACCGGTACTGCAACTGCGACAAGTGCTGTCTGACGGCG

(2) construction of vectors and transformation

The single PCR product was ligated with pTOPO (Edela) vector to prepare a recombinant vector, which was designated as pTOPO-Dsx. The constructed vector was ligated to a transformed competent bacterium (DH 5. alpha.) to prepare a recombinant strain. Screening out positive clone, and extracting recombinant plasmid after amplification culture.

(3) Synthesis of Dsx dsRNA (Promega T7RiboMAXTM Express RNAi System)

Synthesis of dsRNA template: the 5 'end of the forward and reverse primers is added with a T7RNA polymerase promoter sequence 5' -TAATACGACTCACTATAGGN_(17–22)-3', respectively forward primer Dsx-FP: TAATACGACTCACTATAGGCGCCCGCTGTAGGAACCAC (shown in SEQ ID No. 6), reverse primer Dsx-RP: TAATACGACTCACTATAGGCGCCGTCAGACAGCACTTG (shown in SEQ ID No. 7). The plasmid was diluted to about 10ng and PCR amplification was performed using the diluted plasmid as a template. PCR products were recovered from the gel and used as templates for dsRNA synthesis, according to the instructions of the T7RiboMAX Express RNAi System kit.

The reaction system (20. mu.l) was composed specifically as follows:

(a) mixing, and keeping at 37 deg.C for 30 min;

(b) keeping the temperature at 70 ℃ for 10 minutes, and slowly cooling to room temperature;

(c)1:200 dilution RNase Solution. (1. mu.l RNase Solution added to 199. mu.l nuclear free water);

(d) adding 1 mul of diluted RNase Solution and 1 mul of RQ1RNase free DNase into a 20 mul reaction system, and keeping the temperature at 37 ℃ for 30 minutes;

(e) adding 0.1 times volume of 3M NaAc (sodium acetate) and 3 times volume of isopropanol, mixing, standing on ice for 5 min, centrifuging at 4 deg.C of 13000rpm/min for 10min, and removing supernatant;

(f) removing the supernatant, washing the dsRNA precipitate with 500. mu.l of 75% ethanol (DEPC water), centrifuging at 13000rpm/min at 4 ℃ for 10min, and discarding the supernatant;

(g) standing at room temperature (about 5-10min), air drying, and adding appropriate amount of nucleic-Free ddH according to yield₂O dissolving dsRNA;

(h) the concentration of dsRNA is measured by the NanoDrop, and the quality of the dsRNA is detected by electrophoresis;

(i) subpackaging, diluting to corresponding concentration, storing at-20 deg.C for use.

Note that: if there are multiple tubes of the same reaction system, they can be combined into a 1.5ml centrifuge tube after step (e) for easy handling.

The second embodiment of the invention is as follows: the application of the dsRNA in controlling the periplaneta americana comprises the following steps: taking Periplaneta americana that has just emerged as an adult, Dsx dsRNA was injected on

days

2, 4 and 6 as shown in FIG. 1. Extracting RNA from the fat body on the 5 th day for real-time fluorescent quantitative PCR detection, and performing SDS-PAGE gel electrophoresis on the ovary extracted protein; on day 6, the ovaries were stained with DAPI and phalloidin, and photographed with a confocal microscope; on day 7, ovaries were removed and photographed in a stereomicroscope.

The specific operation is as follows:

(1) injection of dsRNA and phenotypic observations statistics

Healthy female periplaneta americana on day 2 after eclosion was fully anesthetized with carbon dioxide, and dsRNA was injected into the abdominal second segment of periplaneta americana with a microinjector, 3 μ g (3 μ l, 1 μ g/μ l) Dsx dsRNA per cockroach. CK-dsRNA served as a control. Injections were given every other day for three times. Of these, 20 were injected per treatment. Taking fat on day 5, combining tissues of every 3 cockroaches into a sample, quickly freezing in liquid nitrogen, and storing at-80 deg.C for use in total RNA and protein extraction; on day 6, ovaries were taken for cell staining; on day 7 of observation, ovaries were taken for phenotypic observation and photographed. The experiment was repeated 3 times.

(2) Detection of Gene expression level after RNA interference

According to a gene sequence in a periplaneta americana genome database (Li et al, 2018), a Primer design software Primer5 is used for designing a fluorescent quantitative PCR Primer, and the length of an amplified fragment is about 80-150 bp. The primer Dsx-FP used for the fluorescent quantitative PCR detection: AGGAACCACCGCCTCAAGATAG (shown in SEQ ID No. 8), Dsx-RP: CTCCGCCGTCAGACAGCACT (shown in SEQ ID No. 9); Actin-FP: CATCCTGCGTTTGGATCTGG (shown in SEQ ID No. 10), Actin-RP: TTTCTCGTTCGGCAGTGGTG (shown in SEQ ID No. 11). Using a Hieff^TM qPCR

Green Master Mix (Low Rox Plus) reagents, according to their instructions, were used for fluorescent quantitative PCR detection. And comparing the two groups of data, calculating the relative expression quantity of the target gene by using the housekeeping gene beta-actin, and comparing whether the two groups of data have obvious difference by using a t test to obtain the relative expression quantity of the target gene in a certain treatment or a certain time point. Each sample was replicated three times and each treatment was performed in three biological replicates, and the mean and standard error of each set of data were plotted, as shown in figure 2. The fat body of female periplaneta americana during the first reproductive cycle was taken to detect the expression level change of Dsx, and it was found that the expression level of Dsx mRNA (fig. 2, left axis) gradually increased after eclosion, reached a peak value by day 5, and then decreased. The expression level of Vg mRNA (FIG. 2, right axis) was similar to that of Dsx, indicating that they are intrinsically linked.

After RNAi, the expression levels of Dsx and Vg in fat bodies are detected as shown in figure 3, the expression level of Dsx is down-regulated by 94.96%, and the expression level of Vg is remarkably down-regulated by 71.76%, namely the expression of Vg is inhibited after the Dsx is interfered, which shows that Dsx is upstream of Vg, and the expression of Vg is promoted.

(3) Observation of ovarian phenotype and determination of gonadal index GSI (gonadosomatic index)

The periplaneta americana was taken out and the body weight was measured. After anaesthesia on ice, the ovaries were fixed on wax plates using an insect needle, placed under an Olympus SZ61 dissecting microscope, the abdomen was cut open, the ovaries were peeled off from the tissue, taken out and placed in a petri dish, and cockroach normal saline was added to float the ovaries in the solution. The ovary is dissected under a microscope continuously, the peripheral muscle tissue of the ovary is taken out, then the ovary is placed under a Nikon DS-Ri2 camera for photographing, and the development condition of the ovary is recorded. Under a microscope, the ovary is stripped into single small egg tubes by using a dissecting forceps, the shapes of the small egg tubes are observed, the small egg tubes are photographed and recorded by using a Nikon DS-Ri2 camera, and the length of the first egg of the ovary is measured by using NIS-Elements BR 4.50.00 software.

The dissected ovaries were removed from the cockroach normal saline with forceps, placed on filter paper to dry the surface water, weighed with an electronic balance, and recorded. The GSI calculation is according to the following formula:

GSI ═ 100%

Ovarian development was inhibited following Dsx RNAi (as shown in figure 4), with gonadal index GSI significantly reduced by 73.75% (as shown in figure 5) and first egg length significantly reduced by 39.15% (as shown in figure 6), respectively, compared to controls. The results show that ovary maturation is inhibited to a certain extent after Dsx RNAi, which indicates that Dsx has a certain promotion effect on oogenesis.

(4) SDS-PAGE gel electrophoresis

Grinding Periplaneta americana ovary in Biyunnan RIPA lysate (PMSF is added in advance, the final concentration is 1mM), centrifuging at 4 deg.C and 12000g for 30min, and filtering the supernatant with 0.22 μm filter membrane. Protein concentrations were determined using the assist holy organism BCA kit, adjusted to 2. mu.g/. mu.l. Adding a Loading buffer into the protein sample, and carrying out boiling water bath for 5 minutes; the sample loading amount of each glue hole is 10 mu l; during electrophoresis, the voltage is firstly 80V for 30min, and after the sample enters the separation gel, the voltage is adjusted to 130V for continuous electrophoresis for 90 min; taking down the gel, placing the gel in a dyeing vessel added with Coomassie brilliant blue R250 dyeing liquid, placing the gel on a shaking table, setting the rotating speed to be 45R/min, pouring out the dyeing liquid after dyeing for 30min, and washing for 3 times by clear water; adding a decolorizing solution, placing on a shaking table, and pouring out the decolorizing solution after the strips are clearly visible; the sample was photographed in a scanner.

Injecting Dsx dsRNA into female periplaneta americana on day 2 after eclosion for RNA interference, performing interference again on day 4, taking ovaries on day 5, extracting protein, performing SDS-PAGE gel electrophoresis and Coomassie brilliant blue staining. The content of Vg (100kD) in the ovary was significantly reduced after interfering with Dsx as shown in the results of SDS-PAGE gel electrophoresis (FIG. 7 a). As shown in fig. 7c, Vg was reduced 79.63% after Dsx interference compared to control. Vg RNA interference was once and three times post 48h on day 2, ovaries were removed on day 7 and protein was extracted and subjected to SDS-PAGE (FIG. 7 b). As a result, it was found that after Vg interference, vitellogenesis was blocked and Vg was not accumulated in the ovary at all times (fig. 7 d). The above results indicate that Dsx can promote Vg accumulation in the ovary by promoting Vg expression.

(5) Follicular cell and patent aperture number and diameter statistics

Taking out the cockroach on the 6 th day after treatment, dissecting the ovary after anesthesia, putting the cockroach into a 0.5mL centrifuge tube, adding 400 mu l of stationary liquid, and fixing for 40min on a shaking table at 25 ℃;

(2) sucking out the stationary liquid, adding 400 μ l of PBT for cleaning, pouring off the waste liquid, and repeatedly cleaning for 4 times;

(3) adding 400 mul PBT, and placing on a shaking table for fine washing for 1 hour at 25 ℃;

(4) sucking out PBT, adding 400 μ l PBT again, adding 1 μ l DAPI/phallodin (1:10000), wrapping the centrifuge tube with tinfoil, and dyeing on a shaking table in a dark place for 30 min;

(5) cleaning with PBT for 4 times, 400 mul each time;

(6) adding 400 mu l of PBT, and placing the mixture in a shaking table for fine washing for 1 hour at 25 ℃;

(7) and carrying out secondary dissection, taking out the tissues, placing the tissues on a glass slide, sucking the liquid, dripping a certain amount of 50% glycerol, dissecting out the required tissues, sealing the slide, observing under a confocal microscope and taking a picture.

Randomly pick a photograph of ovarian follicular cells taken at 3.3 times magnification under a confocal microscope at 40 x objective field. Counting the number of follicular cells and patent pores in the field of the photograph; the diameters of the nucleus and the patent aperture are measured separately, and the longest diameter and the shortest diameter are measured for each nucleus and the patent aperture, respectively, and the average value is taken as the actual diameter of the cell. Each process randomly selected 3 photo measurements.

Dsx RNA interference inhibited the development of ovarian follicular cells (as shown in fig. 8 a), with a significant increase in the number of patent wells per unit area and the number of follicular cells by 60.44% and 78%, respectively, compared to the control group, whereas there was no difference in the index of the ratio between the number of patent wells and the number of follicular cells (as shown in fig. 8 b); follicular cell development was inhibited following Dsx RNA interference, with significant reductions in patent aperture diameter and follicular cell nucleus diameter of 53.41% and 28.41%, respectively, and a significant reduction in the ratio of patent aperture diameter to follicular cell nucleus diameter of 34.83%, as compared to controls (as shown in fig. 8 c). The results indicate that Dsx can promote follicular cell development and Patency formation.

In conclusion, by targeted silencing of Dsx gene, female reproduction can be controlled, and the purpose of prevention and control is achieved.

The above description is only an embodiment of the present invention, and not intended to limit the scope of the present invention, and all modifications of equivalent structures and equivalent processes performed by the present specification and drawings, or directly or indirectly applied to other related technical fields, are included in the scope of the present invention.

Sequence listing

<110> extensive Meiyuan research and development center of China warrior insect developmental biology and application technology key laboratory in Meizhou city

South China Normal University

<120> dsRNA designed based on Dsx gene of periplaneta americana, preparation method, coding gene and application thereof

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

cgcccgcugu aggaaccacc gccucaagau aggccucaag ggccacaagc gcuacugcaa 60

guaccgguac ugcaacugcg acaagugcug ucugacggcg 100

<210> 2

<211> 954

<212> DNA

<213> Periplaneta americana

<400> 2

atgtctgaga acggtggcga gccagggcag gaaggcgccc ggccggacgt tgcggctact 60

agcagcagtt cgcagagtcc tcgtacgccc cccaattgcg cccgctgtag gaaccaccgc 120

ctcaagatag gcctcaaggg ccacaagcgc tactgcaagt accggtactg caactgcgac 180

aagtgctgtc tgacggcgga gcgccagcgg gtcatggcgc tgcagacggc gctgcgacgc 240

gcccaggcgc aggacgaggc ccgcctggcc ggccaggtcg gaggcctcag catcgagaac 300

ggcgtgcccg tcacccaaac gtccgccccc ggggagccac ccgcccccgg caccagcgcc 360

gccgccatcg tgtcccgttc catggaaggc agctgcgatt cgtcgtcctc gtcgccctgc 420

tccaccggcg gcagagcgct gtcctccgtc accagcgcgg gcggcgccgc cctacgcgcc 480

agggtgaatc ccccgcacac caactccgct actccagtcg aattccagcc gatgacagct 540

ggaacttccc tgaagtcttt cccatcactt tccttccagg attcttcccg ccaccactcc 600

gcgcatctcg ataatacatt ggacactatc aacgcccaag gagagagttc ggaagtttcc 660

ggcgaatctc tccagatgct gctggaaatg tttaggtttc ctccagtagc gctgcctcta 720

atctacgttg ttctacaagt ctcgcaatcg gatgtcaatg tggcatacaa tcgcatcata 780

cagggaaaaa tgtcgataat gtatattata tatgcaataa gaatatatca caaattttat 840

gtgaatatct ctaaagaaat aagttgcttg ttggaaaagg atatctttca aagtacatct 900

gtattttctg cagaatttca agtaattctg agtgcactga attcatatca gtag 954

<210> 3

<211> 100

<212> DNA

<213> Periplaneta americana

<400> 3

cgcccgctgt aggaaccacc gcctcaagat aggcctcaag ggccacaagc gctactgcaa 60

gtaccggtac tgcaactgcg acaagtgctg tctgacggcg 100

<210> 4

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cgcccgctgt aggaaccac 19

<210> 5

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cgccgtcaga cagcacttg 19

<210> 6

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

taatacgact cactataggc gcccgctgta ggaaccac 38

<210> 7

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

taatacgact cactataggc gccgtcagac agcacttg 38

<210> 8

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

aggaaccacc gcctcaagat ag 22

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ctccgccgtc agacagcact 20

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

catcctgcgt ttggatctgg 20

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

tttctcgttc ggcagtggtg 20

Claims

1. dsRNA designed based on Dsx gene of periplaneta americana is characterized in that: the dsRNA is double-stranded RNA which is composed of a nucleotide sequence shown as Seq ID No.1 as a sense strand and a nucleotide sequence which is reversely complementary with the nucleotide sequence shown as Seq ID No.1 as an antisense strand.

2. The method of making the dsRNA of claim 1, wherein: the method comprises the following steps: cloning a DNA fragment with a nucleotide sequence shown as Seq ID No.3 into a vector, designing a primer based on the cloned vector, carrying out PCR amplification, and transcribing and synthesizing a PCR amplification product to obtain the DNA fragment; specifically, the vector is pTOPO-Dsx, a primer group shown by Seq ID No.6 and Seq ID No.7 is obtained by adding a T7RNA polymerase promoter sequence to the 5' end of a forward primer and a reverse primer, a PCR product obtained by amplifying plasmid pTOPO-Dsx is used as a synthesized template, and in vitro transcription is carried out by a T7RiboMAX Express RNAi System kit to obtain dsRNA.

3. A gene encoding the dsRNA of claim 1.

4. An expression vector, expression cassette, transgenic cell line or host bacterium comprising the gene of claim 3.

5. Use of the dsRNA of claim 1 for the preparation of a product for controlling Periplaneta americana or controlling reproduction of Periplaneta americana female adults.

6. The dsRNA of claim 1, for use in controlling reproduction of Periplaneta americana.

7. A method for preventing and controlling American cockroaches is characterized in that: the method comprises the following steps: introducing the dsRNA of claim 1 into female Periplaneta americana.

8. The method for controlling periplaneta americana according to claim 7, wherein: the introduction is by way of injection.

9. The method of controlling periplaneta americana according to claim 8, wherein: the injection procedure is from the second body segment along the abdomen.

10. The method of controlling periplaneta americana according to claim 8, wherein: the introduction operation was performed by injecting dsRNA once on days 2, 4 and 6 after eclosion, respectively.