WO2014204405A1 - Procédé de modulation de la production de protéines recombinées - Google Patents

Procédé de modulation de la production de protéines recombinées Download PDF

Info

Publication number
WO2014204405A1
WO2014204405A1 PCT/SG2014/000289 SG2014000289W WO2014204405A1 WO 2014204405 A1 WO2014204405 A1 WO 2014204405A1 SG 2014000289 W SG2014000289 W SG 2014000289W WO 2014204405 A1 WO2014204405 A1 WO 2014204405A1
Authority
WO
WIPO (PCT)
Prior art keywords
mir
cell
mirna
molecule
recombinant protein
Prior art date
Application number
PCT/SG2014/000289
Other languages
English (en)
Inventor
Wan Ping LOH
Original Assignee
Agency For Science, Technology And Research
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Agency For Science, Technology And Research filed Critical Agency For Science, Technology And Research
Publication of WO2014204405A1 publication Critical patent/WO2014204405A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111—General methods applicable to biologically active non-coding nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C12N2310/141—MicroRNAs, miRNAs

Definitions

  • the invention relates generally to the field of biotechnology.
  • the present invention relates to methods for modulating recombinant protein production in a cell line, and a recombinant cell line producing said recombinant protein.
  • the present invention further relates to expression systems and kits for use in performing the methods as described herein.
  • mammalian cells such as Chinese hamster ovary (CHO) cells are the predominant host cells for the manufacture of recombinant proteins for pharmaceutical use, among others, and processes involving variants .
  • qP specific productivity
  • PDI protein disulfide isomerase
  • SRP14 signal receptor protein SRP14
  • XBP-1S X-box binding protein IS
  • MicroRNAs are short, non-coding RNAs which negatively regulate target gene expression at post- transcriptional levels, either by translational repression or destabilization and degradation of mRNA. It has been shown that miRNAs regulate expression of multiple , genes and thus affect multiple pathways in various cells.
  • miR-34 down-regulates expression of eye1in-dependent kinase 6 (CDK6) , E2F5 transcription factor, and anti-apoptotic factor BCL2 in SW480 cancer cell line, and miR-126 regulates vascular development and angiogenesis in endothelial cells by repressing expression of inhibitors of the VEGF pathway SPRED1, PIK3R2/p85 -beta, and VCAM-1.
  • CDK6 eye1in-dependent kinase 6
  • E2F5 transcription factor E2F5 transcription factor
  • anti-apoptotic factor BCL2 anti-apoptotic factor BCL2
  • miR-126 regulates vascular development and angiogenesis in endothelial cells by repressing expression of inhibitors of the VEGF pathway SPRED1, PIK3R2/p85 -beta, and VCAM-1.
  • MicroRNA sequencing has demonstrated that miRNAs are highly conserved between cell lines. For example, using microarray and next-generation sequencing (NGS) , several groups have profiled the miRNA-ome of commonly used parental CHO cell lines (Kl, DXB11 and DG44) and recombinant cell lines under normal culturing conditions and stress conditions such as media depletion, temperature shift, supplementation with sodium butyrate and MTX amplification. Some miRNAs identified in profiling studies were found to potentially affect culture processes and thus recombinant protein production.
  • NGS next-generation sequencing
  • a method for increasing expression of a recombinant protein of interest comprising, introducing at least one miRNA molecule selected from the group consisting of miR-17, mxR-19b, mxR- 20a, miR-92a, miR-18a and miR-19a into a cell or introducing a molecule comprising miR-17, mxR-19b, miR-20a, miR-92a, miR-18a and miR-19a into a cell; selecting a cell stably over- expressing said at least one miRNA molecule selected from the group consisting of miR-17, miR-19b, miR-20a, miR-92a, miR-18a and miR-19a or said molecule comprising miR-17, miR-19b, miR- 20a, miR-92a, miR-18a and miR-19a; and expressing said recombinant protein of interest in said cell, wherein said expression of said recombinant protein
  • a cell line for increasing expression of a recombinant protein of interest comprising at least one miRNA molecule selected from the group consisting of miR-17, miR- 19b, miR-20a, miR-92a, miR-18a and mxR-19a or a molecule comprising miR-17, mxR-19b, miR-2 a, miR-92a, mxR-18a and mxR- 19a.
  • an expression system for increasing the expression of a recombinant protein comprising a cell comprising at least one miRNA molecule selected from the group consisting of mxR- 17, miR-19b, miR-20a, miR-92a, mxR-18a and mxR-19a or a molecule comprising miR-17, mxR-19b, mxR-20a, mxR-92a, miR-18a and miR-19a.
  • kits for increasing expression of a recombinant protein comprising a cell comprising at least one miRNA molecule selected from the group consisting of miR-17, miR- 19b, miR-20a, miR-92a, miR-18a and miR-19a or a molecule comprising miR-17, miR-19b, miR-20a, miR-92a, miR-18a and miR- 19a.
  • Fig. 1 shows a schematic representation of the generation of stable cell lines.
  • Fig. 2 shows the effects of stable overexpression of miRs-17, -19b, -20a, -92a and miR-17-92 cluster on mAb productivity in single cell clones.
  • A-F Relative miRNA level, specific productivity (qP) and titer in clones isolated from pools stably transfected with (A) blank vector; (B) miR- 17; (C) miR-19b; (D) miR-20a ; (E) miR-92a and (F) miR-17-92 cluster.
  • FIG. 3 shows the, structure and distribution of N- glycans on IgG produced in highproducing clones. N-glycans were released from purified recombinant IgG, and either permethylated and analysed by MALDITOF MS or labelled with 2- aminobenzamide (2-AB) and analysed by UPLC-fluorescence .
  • A Distribution of N-glycan structures on IgG produced by the clones.
  • the glycan structures are categorized into the following species: sialylated, fucosylated, pauci-/oligo- mannose, GO (complex biantennary without terminal galactose), Gl (with 1 terminal galactose) and G2 (with 2 terminal galactose) . Relative abundance of glycan species were calculated by determining the heights of corresponding peaks. Each point represents the average and standard deviation obtained from biological duplicates. (B) UPLC chromatograms of the high-producing clones.
  • SH87 parental clone; 17-28, 19b- 36, 20a-17, 92a-31 and Clu-44: high producing clones isolated from pools stably transfected with miR-17, miR-19b, miR-20a, miR-92a and miR-17-92 cluster respectively.
  • recombinant protein is as commonly understood in the art and refers to a protein expressed from recombinant DNA inserted into a host cell.
  • the recombinant DNA permitting the production of the recombinant protein within the cell, under conditions sufficient to have the protein expressed within the cell.
  • microRNAs or a “microRNA” molecule refers to a short, non- coding RNA which can negatively regulate expression of one or more genes at post- transcriptional level.
  • the term "molecule” refers to a nucleic acid molecule. In the context of the present invention, both the “at least . one miRNA molecule” and the “molecule” comprising the miR As can be both referred to- as the "miRNA molecule”.
  • the molecule can include a polymeric form of nucleotides, with both sense and anti-sense strands of RNA, cDNA, genomic DNA, artificial chromosomes (ACEs) , and synthetic forms and mixed polymers of the foregoing.
  • a nucleotide refers to a ribonucleotide, deoxyribonucleotide, or a modified form of either type of nucleotide.
  • nucleic acid molecule is synonymous with “nucleic acid” and “polynucleotide.” The term includes single- and double- stranded forms of DNA or RNA.
  • a nucleic acid molecule may include either or both naturally-occurring and modified nucleotides linked together by naturally-occurring and/or non- naturally occurring nucleotide linkages .
  • the term "at least one" in the context of the miRNA molecule can include 1 or more miRNAs, and more specifically can be at least 2,- 3, 4, 5, 6, 1, 8, 9, 10 of the miRNA molecules as in Table 1.
  • the term "variant" in relation to a nucleic acid as disclosed herein may refer to alternative forms of the nucleic acid by a single nucleotide, or several nucleotides, and can include substitutions, deletions and insertions of nucleotides.
  • the variant may be an equivalent or mimic or in the context of an miRNA the variant may be an isomiR thereof comprising at least 6 of the 7 nucleotides present in a given seed sequence as identified in Table 1 and has at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identity oyer the whole miRNA sequence as identified in Table 1 (Table 1 shows representative precursor sequences of each of the miRNAs identified herein as SEQ ID NO: 1-86) .
  • insert sequences described herein may also be variants in alternative forms with one or several nucleotides alterations, that can include substitutions, deletions and insertions of nucleotides, and have a sequence identity of at least 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% of the sequences described herein in Tables 2 and 3.
  • the term "introduced” in relation to the miRNA being “introduced” into a cell refers to standard techniques known in the art that result in the direct uptake and incorporation of exogenous genetic material (for example, exogenous miRNA) from its surroundings and is taken up through the cell membrane (s) to cause a genetic alteration of the cell. These may include for example transfection, transformation or transduction techniques known in the art.
  • control cell refers to a cell that has not had the "at least one" miRNA molecule introduced into it such that there is no modulation of the expression of the recombinant protein or at least ' one miRNA.
  • control cell has not been genetically manipulated to alter any nucleic acid expression levels or regulatory mechanisms relative to the genetically altered variant .
  • transiently transfected or “transient transfection” refer to the transient, i.e. non- permanent expression of the gene of interest due to the episomal nature of the introduced nucleic acid.
  • RNA transfection or cytolytic viruses can only be used for transient expression.
  • Episomal nucleic acids including DNA (plasmids or vectors) , are degraded by the cells after two to four days, and hence the expression of the gene of interest ceases.
  • the term "stably transfected” or “stable transfection” refers to the permanent expression of the gene of interest due to the integration of the transfected DNA into the genome of the cell. Most if not all cells have the potential to incorporate episomal DNA into their genome albeit at a very low rate. However, sophisticated selection strategies are employed to expand those cells that have integrated the transfected DNA. To permit this to occur, the vector must contain at least one gene for a selection marker such as an antibiotic resistance gene, for example a hygromycin resistance gene.
  • a selection marker such as an antibiotic resistance gene, for example a hygromycin resistance gene.
  • the term “culturing” refers to the maintenance of cells/cell lines in vitro in a container with medium supporting their proliferation and gene expression. Thus, the culturing cause's accumulation of the expressed secreted proteins in the culture medium.
  • the medium normally contains supplements stabilizing the pH, as well as amino acids, lipids, trace elements, vitamins and other growth enhancing components .
  • the term "vector” refers to any genetic construct, such as a plasmid, phage, cosmid, etc., which is capable of replication when associated with the proper control elements, into which fragments of nucleic acids may be inserted or cloned,
  • a vector comprises unique restriction sites and may be capable of autonomous replication in a host cell.
  • the term includes cloning and expression vehicles.
  • the "vector” may further carry one or more further regulatory elements, said regulatory elements preferably being selected from splice sites, recombination sites, polyA sites, enhancers, multi-cloning site and prokaryotic plasmid sequences .
  • the terms “express”, “expressing” or “expression” refer to the transcription and translation of a gene encoding a protein.
  • the present disclosure and embodiments relate to methods for modulating the expression of one or more recombinant proteins in a host cell utilising microRNAs (miRNAs) .
  • miRNAs target multiple genes and pathways of said host cell and represent a cell engineering strategy for increased expression of one or more recombinant proteins.
  • the short non-coding nucleic acid miRNAs are involved in many cellular processes with multiple targets.
  • miRNAs have been identified and characterized in recombinant host cells to enable a deeper understanding of the regulation of gene expression and protein production in order to elucidate targets for enhancing productivity and growth of the cells.
  • expression of miRNAs may be increased to promote cell arrest.
  • This cell arrest is associated with accumulation of cells in the Gl (growth arrest) phase of the cell cycle and this is linked to increased productivity.
  • Gl growth arrest
  • productivity it is believed that the increase in the level of the miRNAs during the cell cycle, such as during the growth arrest phase results in the increased/enhanced productivity of the cells to produce the product through influencing one or more of the transcriptional, translational or post-translational mechanics of the cell cycle system.
  • the present invention and use of miRNAs find application in the growth and modification of host cells, for the production of recombinant proteins, especially recombinant biopharmaceutical proteins.
  • the present invention as described herein results in the increased yield of one or more recombinant proteins of interest.
  • the present invention as described herein is based on the identification of miRNAs that are differentially expressed between high- and low- recombinant protein production in a host cell using standard sequencing and quantitative analytical tools, as detailed in the working examples with regard to the profiling of miRNAs (See Table 1) .
  • the identified miRNAs were further investigated and stably oyerexpressed in a high- recombinant producing host cell either individually or in combination, in order to assess their regulatory effects on growth, productivity and product quality.
  • the differentially expressed miRNAs identified are any one of those listed in the below table 1.
  • miR- refers to the mature form of the miRNA
  • the production of a recombinant protein comprises the steps of introducing at least one of the differentially expressed miRNA molecules in to a cell; selecting a cell stably over- expressing said miRNA molecule; and expressing said recombinant protein in said cell, wherein said expression of said recombinant protein in said cell is greater than in a control cell.
  • the miRNA molecule may be one or more miRNAs as listed in the above Table 1, or variants thereof .
  • miRs-17, -.19b, -20a, and -92a belong to the miR- 17 -92 polycistron and have been previously shown to have complementary and overlapping oncogenic functions, wherein miRs-17 and -20a inhibits p21 (negative regulator of the cell cycle) to promote cell proliferation; miR-19b represses PTEN and miRs-19b, -20a and - 92a repress BIM to inhibit apoptosis; and miR- 92a "targets ITGA5 to promote angiogenesis.
  • the miRNA molecule may be selected from the group consisting of miR-17, miR-19b, miR-20a, miR-92a, miR-18a and miR-19a. In a further embodiment, the miRNA molecule may be selected from the group consisting of miR-17, miR-19b, miR-20a, and miR-92a.
  • a method for increasing expression of a recombinant protein of interest comprising introducing at least one miRNA molecule selected from the group consisting of miR-17, miR-19b, miR-20a, miR- 92a, miR-18a and miR-19a into a cell or introducing a molecule comprising miR-17, miR-19b, miR-20a, miR-92a, miR-18a and miR- 19a into a cell; selecting a cell stably over-expressing said at least one miRNA molecule selected from the group consisting of miR-17, miR-19b ⁇ miR-20a, miR-92a, miR-18a and miR-19a or said molecule comprising miR-17, miR-19b, miR-20a, miR-92a, miR-18a and miR-19a; and expressing said recombinant protein of interest in said cell, wherein said expression of said recombinant protein in said cell is greater than in a cell that is not over
  • the at least one miRNA molecule is selected from the group consisting of miR-17, miR-19b, miR- 20a and miR-92a.
  • the miRNA molecules may be miRNA precursor molecules, synthetic miRNA precursor molecules, primary miRNA or mature miRNA molecules.
  • the nucleic acid sequences of the primary, precursor and mature miRNAs molecules of Table 1 are available from the database of miRNA sequences, targets and gene nomenclature, IRBase, at http: microrna . Sanger .ac.uk.
  • the miRNA molecule is a precursor miRNA (pre-miRNA) molecule.
  • the miRNA molecule is a mature miRNA molecule.
  • the recombinant protein of the invention includes, but is not limited to a protein, a polypeptide, a mutant or modification thereof.
  • the recombinant protein may include a recombinant plasma protein, e.g.
  • a blood clotting factor for example, factor VIII, Factor Vll/VIIa, Factor V, factor IX, Factor XI, von Willebrand factor
  • a growth factor for example, erythropoietin
  • CSF colony-stimulating factor
  • G-CSF granulocyte stimulating factor
  • M- CSF macrophage CSF
  • G -CSF granulocyte-macrophage CSF
  • cytokines for example, interleukins including interleukin 3
  • a protease inhibitor for example, alpha-1-antitrypsin (A1AT) , chymotrypsin, etc.
  • a hormone for example, an inhibitory or regulatory acting protein, antigen binding protein and active fragments thereof, for example a monoclonal antibody.
  • the recombinant protein may be mutated or modified for better stability or an elongated half-life. Such modifications and mutations may
  • the recombinant protein is an antibody.
  • the antibody may be an immunoglobulin-like domain and includes monoclonal, recombinant, polyclonal, chimeric, humanised, human, bispecific, multispecific and heteroconjugate antibodies; a single variable domain, a domain antibody, antigen binding fragments, immunologically effective fragments, single chain Fv, diabodies, TandabsTM.
  • the antibody is a monoclonal antibody.
  • the cell may be any cell useful in the production of recombinant protein.
  • the cell may be a mammalian cell or a non-mammalian cell including insect, bacterial, yeast or viral cell.
  • the cell is a mammalian cell such as Chinese hamster ovary
  • CHO human Embryonic Kidney 293 (HEK-293) cell
  • murine myeloma NS0 Cell Sp2/o Myeloma cell or baby hamster kidney (BHK) cell.
  • the cell is a Chinese hamste ' r ovary (CHO) cell.
  • the cell may express the protein as a result of the cells natural endogenous expression system.
  • the cell may express the protein as a result of the artificial introduction of recombinant DNA encoding the protein into the cell.
  • the cell is a recombinant cell expressing a recombinant protein of interest .
  • the cell comprises a nucleic acid sequence encoding the recombinant protein or a functional homologue, fragment and/or derivative thereof.
  • the step of introducing the miRNAs into the cell is by transfection.
  • the transfection is carried out as known in the art using an expression system such as a vector to introduce genetic material into the cell.
  • the cell is transfected with an expression vector comprising a nucleic acid sequence coding for the at least one miRNA molecule or molecule comprising the miRNAs
  • the miRNA molecule may be under the control of a promoter
  • the nucleic acid sequence encodes for a precursor of a miRNA molecule, a primary miRNA or a mature miRNA.
  • the vector encodes a precursor version (pre-miRNA) of any of the miRNA molecules .
  • the nucleic acid sequence encodes a precursor of a miRNA molecule.
  • the expression vector may be a plasmid, or a linear nucleic acid construct such as a PCR product or a restriction fragment.
  • the miR As are introduced into the cell by transfection with an expression vector comprising a nucleic acid sequence coding for the miRNA molecule .
  • the nucleic acid sequence coding for the miRNA molecule is an insert sequence.
  • the insert sequence may comprise a nucleic acid sequence derived from the cell's genome.
  • the insert sequence comprises the miRNA sequence, or variant thereof, together with a flanking sequence comprising genomic DNA from a cloning site of a host cell, whereby the miRNA molecule has been isolated (cloned) from the genome of said cell together with the flanking genome sequences.
  • the genome sequence is at least 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 400 base pairs in length, and may be a contiguous sequence.
  • the flanking genomic DNA sequence may be positioned at either the 5/ or 3' end of the miRNA molecule or may be positioned at both the 5' and 3 ⁇ ' end of the miRNA molecule.
  • the insert sequence comprises a flanking genome sequence of the cell at least 50 base pairs that is flanking . both the 5' and 3' . end of the miRNA molecule.
  • the insert sequence is a product of vector construction and transfection techniques that are well known in the art and dependent upon the cell selected and miRNA molecule to be transfected.
  • the genome sequence is derived from a CHO cell genome and the insert sequence for each of miR-17, miR-19b, miR-20a and miR-92a is as defined in Table 2 below, or variants thereof .
  • TAGCA (SEQ ID NO: 98)
  • ACTTCCA SEQ CTTGCCCGCTCGCCCTTCACCCACTCAAA ID NO: 90
  • AAATCTATG (SEQ TTGTGTTTTCCTTTTCCTTTTTTTGACTAAT ID NO: 92) GCTGTGCTTTGGTTGTGTCGATTAGAGTC
  • GCATCC (SEQ TGACTGTGGTGGTGAAAAGTCTGTAGAAC ID NO: 94) AGTGAGGGAAAATCAAACCCCTTTCTACA CAGGCTGGGATGTTGCAATGCTGTGTTTC
  • the at least one miRNA molecule is miR-17 and the. insert sequence comprising miR-17 is CCCGTTGGGTGTAAGCTGAAATTTGTGTTTGTCACAGGTGCTAGGGCTTTGGGCTGCTGTTC TAATTATTTATTTCAAATTTAGCAGGAATGCAGAGCGCGTCACCTTGCGAGACTGGAGACTG ATGGTCAGGATAATGTCAAAGTGCTTAGAGTGCAGGTAGTGATATGCACATCTACTGCAGTG CAGGCACTTGTGGCATTATGGTGACAGCCGCCTCGCTCGGGAGCCACGGTGGGCGCGGAGTG ACAGCAGGCCGCCTGCTGGTGCTGAGTGCTTTTCTAAGGTGCATCTAGTGCAGATAGT GAAGTAGACTAGCA, or variants thereof .
  • the at least one miRNA molecule is miR-19b and the insert .
  • sequence comprising miR-19b is ACTGCATTACGAGCACTTCCAGTGCTGCCAGCTGGAGAGCCCCAGCCTCGCTCGCCCGCTTG ⁇ CCCGCTCGCCCTTCACCCACTCAAACGGTCCTGGTACTGAGCACTGGTCTATGGTTAGTTTT GCATTTGCATCCAGCTGTATAATACTCTGCTGTGCAAATCCATGCAAAACTGACTGTGGTGG TGAAAAGTCTGTAGAACAGTGAGGGAAAATCAAACCCCTTTCTACACAGGCTGGGATTTGTT GCAATCGTGTTTCTCGATGGTATTGCACTTGTCCCG, or variants thereof.
  • the at least one miRNA molecule is miR-20a and the insert sequence comprising miR-20a is GAATGCAGTTGTGCAAATCTATGCAAAACTGATGGTGGCCTGCTATTAACTTCAAGTGTTGT GTTTTCCTTTTCCTTTTTGACTAATGCTGTGCTTTGGTTGTGTCGATTAGAGTCTGCGTGGT GTGTGACAGACAGCTTCTGTGGCACTAAAGTGCTTATAGTGCAGGTAGTGTCCACTCATCTA CTGCATTACGAGCACTTCCAGTGCTGCCAGCTGGAGAGCCCCAGCCTCGCTCGCCCGCTTGC CCGCTGCCTTCACCCACTCAAACGGTCCTGGTACTGAGCACTGGTCTATGGTTAGTTTTGCA GGTTTGCATCCAGCTGTATAAT , or variants thereof.
  • the at least one miRNA molecule is miR-92a, and the insert sequence comprising.
  • miR-92a is AGTTTTGCAGGTTTGCATCCAGCTGTATAATACTCTGCTGTGCAAATCCATGCAAAACTGAC TGTGGTGGTGAAAAGTCTGTAGAACAGTGAGGGAAAATCAAACCCCTTTCTACACAGGCTGG GATGTTGCAATGCTGTGTTTCTCGATGGTATTGCACTTGTCCCGGCCTGTTGAGTTTGGTGG GGATTGTGACCAGAAGATGTGAAAATTAAATATTGCTGAAGATGCCATGCCGATTTCCATTG TAAAATTTATGGTGTACGAACTCGTTGTAACTTTTATTGCTTTCA, or variants thereof .
  • the genome sequence is derived from a CHO cell and the insert sequence for miR-18a is CTTGTGGCATTATGGTGACAGCCGCCTCGCTCGGGAGCCACGGTGGGCGCGGAGTGACAGCG AGGGCCGCCTGCTGGTGCTGAGTGCTTTTTGTTCTAAGGTGCATCTAGTGCAGATAGTGAAG TAGACTAGCATCTACTGCCCTAAGTGCTCCTTCTGGCATAAGAAGTTATGTCGTCACCTAAT GGAGTCGAGCAAGCGTGTAGGGGTCTCTTAATGGTCTCTGTCTGCAGCCCTCTGTTAGTTTT GCATACTTGCAC , or variants thereof .
  • the genome sequence is derived from a CHO cell and the insert sequence for miR-19a is TGCCCTAAGTGCTCCTTCTGGCATAAGAAGTTATGTCGTCACCTAATGGAGTCGAGCAAGCG TGTAGGGGTCTCTTAATGGTCTCTGTCTGGAGCCCTCTGTTAGTTTTGCATACTTGCACTAC AAGAAGAATGCAGTTGTGCAAATCTATGCAAAACTGATGGTGGCCTGCTATTAACTTGAAGT GTTGTGTTTTCGTTTTCCTTTTTGACTAATGCTGTGCTTTGGTTGTGTCGATTAGAGTCTGC GTGGTGTGTG or variants thereof .
  • the miRNA molecule may be introduced in to the cell with an expression vector comprising an insert sequence coding for a cluster of more than one miRNA.
  • an expression vector comprising an insert sequence coding for a cluster of more than one miRNA.
  • miRNAs of miR-17, miR-19b, miR- 20a, miR-92a, miR-18a and miR-19a may be introduced together in to a cell in an insert sequence.
  • the genome sequence is derived from a CHO cell and the insert sequence comprises miR-17, miR-19b, miR-20a, miR-92a, miR-18a and miR-19a as shown below in Table 3 or a variant thereof .
  • AAAAAAGCTAGC ATGCAGAGCGCGTCACCTTGAGACTGGAGACT CTTTTCTCCCGT GATGGAGTCAGGATAATGTCAAAGTGCTTACA
  • the insert sequence comprises the miRNA molecules of miR-17, miR-19b, miR-20a, miR-92a, miR-18a and miR-19a in a cluster that may be arranged in the following order of miR-17, miR-18a, miR-19a, miR-20a, miR-19b and miR- 92a, or any other conceivable combination.
  • the insert sequence for the molecule comprising miR-17, miR-19b, miR-20a, miR-92a, miR-18a and miR-19a is CTTTTCTCCCGTTGGGTGTAAGCTGAAATTTGTGTTTGTCACAGGTGCTAGGGCTTTGGGCT GCTGTTCTAATTATTTATTTCAAATTTAGCAGGAATGCAGAGCGCGTCACCTTGAGACTGGA GACTGATGGAGTCAGGATAATGTCAAAGTGCTTACAGTGCAGGTAGTGATATGCACATCTAC TGCAGTGCAGGCACTTGTGGCATTATGGTGACAGCCGCCTCGCTCGGGAGCCACGGGGCGCG GAGTGACAGCGAGGGCCGCCTGCTGGTGCTGAGTGCTTTTCTAAGGTGCATCTAGTGC AGATAGTGAAGTAGACTAGCATCTACTGCCCTAAGTGCTCCTTCTGGCATAAGAAGTTTGCG TCACCTAATGGAGTCGAGCAAGCGTGTAGGGGTCTCTTAATGGTCTCACCTAATGGAGTCGAGCAAGCGTGT
  • the transfection may be a stable or transient transfection.
  • the miRNA molecule is stably- incorporated into the genome of the cell and may be under the control of an inducible or constitutive promoter. It should be appreciated that a constitutive promoter may be used as an alternative to an inducible promoter, and that the modification of the methods and promoter that' is required to express the miRNA molecule is readily known and understood by the skilled person.
  • the transfection may be selected from chemical transfection such as lipid transfection; non-chemical transfection such as electroporation; particle based transfection and viral transfection. Suitable and specific methods of transfection are known to the skilled person such as, for example, chemical transfection mediated using calcium phosphate or nucleofection.
  • the step of transfecting the cells include culturing the cells in a suitable culture medium that is able to support the propagation and viability of the cells.
  • the cells may be treated in adherent culture, or in suspension culture medium supplemented with serum and/or growth factors . It is understood that every cell line has optimal culture conditions as outlined _ in the American Type Culture Collection [ATCC] web site, and the culture conditions for transfection and incubation are known in the art and can be readily adapted by the skilled artisan to each cell type.
  • ATCC American Type Culture Collection
  • the cell is transfected and cultured in serum-free and/or protein-free medium.
  • the transfection of the cell with an expression vector comprising a nucleic acid sequence results in a cell over-expressing the miRNA molecule when compared to a cell that has not. had the miRNA molecule introduced.
  • the methods and embodiments disclosed herein include the step of selecting a cell that stably over-expresses said miRNA molecule.
  • the transfected cells may be selected by culturing the cell in a selection medium and using a selection marker system, resulting in the survival of only those cells that have successfully been transfected with the expression vector, and whereby the cell culture is constantly exposed to the protein of the selection marker system.
  • the selection medium may be a protein- free medium or a serum- free medium.
  • the selection marker system may include hygromycin resistance, puromycin resistance, neomycin resistance, adenosine deaminase (ADA) resistance, aminoglycoside phosphotransferase (neo, G418, APH) resistance, bleomycin (phleo, bleo, zeocin) resistance, cytosine deaminase (CDA, CD) resistance, cytosine deaminase (CDA, CD) resistance, dihydrofolate reductase (DHFR) resistance, histidinol dehydrogenase (hisD) resistance, hygromycin-B- phosphotransferase (HPH) resistance, puromycin-N-acetyl transferase (PAC, puro) resistance, thymidine kinase (TK) resistance, and Xanthine-guanine phosphoribosyltransferase (XGPRT, gp
  • the cells are cultured in a selection medium and supplemented with the selective marker for a period of anywhere from at least 1 to 30 days, preferably for 10-20 days, whereby the selection medium may be exchanged every other day.
  • the limited dilution method is readily known by those skilled in the art as a procedure for obtaining " a monoclonal cell population from a polyclonal mass of cells.
  • the cell expressing said miRNA molecule is selected for single cell cloning.
  • the individual (single) cell clones are picked and transferred into separate culture containers for expansion of the cell (scaling up) with or without the selective marker described above.
  • Any culture container is suitably used including but not limited to 96-, 48-, 24-, 12- or 6-well plates with culture medium.
  • the expansion of cells comprise passaging cells in the selection medium for a period of anywhere from about 1 day to 5 weeks, preferably about 1 to 2 weeks and more preferably about 2 weeks, in order to generate stable pools of cells that have successfully introduced the miRNA molecule .
  • Additional selection criteria for scaled up culture cells may be applied, including but not limited to viability, cell morphology and aggregation. Accordingly, in one embodiment the - selection step may further include selecting cells based upon one or more of cell viability, cell morphology and aggregation all using standard techniques known , to those skilled in the art.
  • the step of expressing the recombinant protein comprises culturing the selected and scaled up cells, that have been successfully transfected with the miRNA molecule, under standard conditions that enable gene expression .of., the recombinant protein.
  • One or more prion removal steps may be included, such as protein precipitation, filtration, chromatography steps and affinity chromatography steps .
  • the step of expressing the recombinant protein can further include a step of quantifying the expression levels of the miRNAs and/or the protein. Methods for measuring and assessing expression of genes and/or proteins in cell cultures are known in the art. For.
  • such methods may include quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) , Northern blots, hybridization, immunoassays, Western blotting, the use of protein markers that are accessible in intact cells and flow cytometry analysis (FACS) .
  • qRT-PCR quantitative reverse transcriptase polymerase chain reaction
  • Northern blots Northern blots
  • hybridization immunoassays
  • Western blotting the use of protein markers that are accessible in intact cells and flow cytometry analysis (FACS) .
  • FACS flow cytometry analysis
  • the quantification of the expression level of the miRNA molecule and final protein may be performed using quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) .
  • qRT-PCR quantitative reverse transcriptase polymerase chain reaction
  • RNA extraction, cDNA synthesis and quantitative reverse transcriptase PCR (qRT-PCR) are performed according to standard procedures known to those skilled in the art. This step verifies the expression levels of the miRNA molecule and/or mRNA level of the final protein in comparison to a control cell that does not comprise the miRNA molecule.
  • the cell expresses said recombinant protein greater than .in a control cell that is not over-expressing the miRNA molecule.
  • the expression levels of the protein measured is representative of the specific productivity (qP) or final titer.
  • the expression levels of the protein relate to the relative specific productivity and/or relative titre as shown in Table 5 below.
  • the recombinant protein is expressed at least 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.2, 2.4, 2.5, 3, 4 or 5 fold higher than in comparison to a control cell.
  • the recombinant protein may be isolated from the cell culture and subjected to subsequent purification steps known in the art to maximize the yield of a pure product .
  • the final protein is purified using standard techniques such as immunoaffinity chromatography, anion exchange chromatography, size exclusion chromatography, high performance liquid chromatography (HPLC) , and. combinations thereof.
  • the purification techniques can easily be adapted to the specific requirements needed .to isolate the desired recombinant protein, whereby a person skilled in the art is familiar with purification procedures.
  • the final purified protein may be analysed to determine its quality and identify any structural modifications.
  • the analysis and profiling of the final protein is merely used as a qualifying step to confirm the effects of the method and that overexpressing the miRNAs has resulted in increased productivity of the cell without causing major changes in the protein quality.
  • Methods and techniques for structurally analysing proteins are known in the art and readily selected in consideration of the protein of interest that is purified.
  • the final protein may undergo glycan profiling.
  • Glycan profiling techniques are readily known in the art and may include matrix-assisted laser-desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) and ultra-high performance liquid chromatography (UPLC) .
  • the invention also relates to a cell line for modulating expression of a recombinant protein of interest comprising an miR A molecule.
  • the cell line comprises at least one or -more miRNAs as listed in the above Table 1, or variants thereof .
  • the cell line comprises at least one miRNA selected from the group consisting of miR-17, miR- 19b, miR-20a, miR ⁇ 92a, miR-18a and miR-19a or a molecule comprising mxR-17, miR-19b, miR-20a, mxR-92a, miR-18a and mxR- 19a.
  • the cell line comprises at least one miRNA molecule selected from the group consisting of mxR- 17, mxR-19b, mxR-20a and miR-92a.
  • the cell line is a stably transfected cell line.
  • the at least one miRNA is stably incorporated into the cell and may be under the control of an inducible or constitutive promoter.
  • the cell line of the invention may be genetically engineered to inducibly express the miRNA molecule at any time during the cell cycle, for example at a time before the growth arrest phase in order to generate an increased level of the miRNA molecules during the growth arrest phase.
  • the cell may be any cell useful in the production of recombinant protein.
  • the cell may be a mammalian cell or a non-mammalian cell including insect, bacterial, yeast or viral cell.
  • the cell may be a mammalian cell such as Chinese hamster ovary (CHO) cell, HeLa cell, Madin-Darby Canine Kidney (MDCK) cell, Human Embryonic Kidney 293 (HEK-293) cell, murine myeloma NS0 Cell, Sp2/o Myeloma cell or baby hamster kidney (BHK) cell or baby hamster kidney (BHK) cell.
  • the cell line is selected from the group consisting of Chinese Hamster Ovary (CHO) , HeLa, Madin-Darby Canine Kidney (MDCK) cells and baby hamster kidney (BHK) cell.
  • the cell line is Chinese Hamster Ovary (CHO). ;
  • the cell line expresses . a recombinant protein at a greater level than a cell that is not over-expressing the miRNA molecule.
  • the expression of the recombinant protein is measured as specific productivity or final titre.
  • the invention also provides an expression system that may be used for modulating the . expression of a recombinant protein, and more particularly increasing the expression of a recombinant protein.
  • the expression system is for increasing the expression of a recombinant protein comprising a cell comprising at least one miRNA molecule selected from the group consisting of miR-17, miR-19b, miR-20a, miR-92a, miR-18a and miR-19a or a molecule comprising miR-17, miR-19b, miR-20a, miR-92a, miR-18a and miR-19a.
  • the expression system comprises at least one miRNA selected from the group consisting of miR-17, miR-19b, miR-20a and miR-92a.
  • the invention also provides a kit useful for increasing expression of a recombinant protein comprising at least one miRNA.
  • the kit comprises at least one or more miRNA as listed in the above Table 1.
  • the kit comprises at least one miRNA selected from the group consisting of miR-17, miR- 19b, miR-20a, miR-92a, miR-18a and miR-19a or a molecule comprising miR-17, miR-19b, miR-20a; miR-92a, miR-18a and miR- 19a.
  • the kit comprises at least one miRNA selected from the group consisting of miR-17, miR- 19b, miR-20a and miR-92a.
  • 5' and ⁇ 3' adapters were ligated to lOOng of miRNA.
  • the ligated constructs were reversely transcribed and PCR amplified.
  • the purified PCR product was run on 10% PAGE gel for gel purification of ⁇ 120bp DNA to obtain cDNA library.
  • Concentrations of cDNA libraries were estimated using qPCR method. 8-10pM of each cDNA library was sequenced on a separate lane on a Genome Analyzer IIx (Illumina) . Adapter sequences were trimmed from sequence reads . Trimmed reads ⁇ 15bp. were aligned to mature miRNA sequences in the miRNA database miRBase version 17 (http://www.mirbase.org/, accessed Aug 2011). The number of reads in each clone with exact matches to each miRNA was counted and normalized to the total number of aligned reads for that clone.
  • miRNAs were then filtered to remove redundant miRNAs with identical sequences, sequence variants of lower abundance, and miRNAs with ⁇ 500 matches in either clone. Differential expression of remaining miRNAs was determined as ratio of normalized reads in SH87 to normalized reads in SH31. qRT-PCR for Analysis of miRNA Levels
  • qRT-PCR was done on iQ5 system (Bio-Rad, Hercules, CA) at 95 °C for 10 min, followed by 50 cycles of 95°C for 10s and 60°C for 30s.
  • Genomic DNA was extracted from SH87 using Gentra Puregene Kit (Qiagen, Valencia, CA) .
  • DNA elements containing individual miRNA stem-loop sequences of miRs-17, -19b, -20a, - 92a and miR-17-92 cluster were PCR-amplified and inserted into pcDNA3.
  • lHyg (+) vectors (Life Technologies) using Nhel and Hindlll restriction sites. Primer sequences are listed in Table 1. Restriction enzymes were purchased from New England Biolabs (NEB) , Ipswich, MA.
  • Trimmed sequencing reads ⁇ 15nt were aligned to mature miRNA sequences. The number of reads aligned to each miRNA was normalized to the total number of aligned reads in that clone. Fold difference in miRNA abundance between the clones is determined by calculating the ratio of normalized reads .
  • Stable pools were characterized in triplicates in 1L shake flasks while single cell clones were characterized in 125mL shake flasks.
  • Cells were seeded at a VCD of 3xl0 5 cells/mL and cultured in a humidified shaker incubator supplemented with 8% C02 at 37°C.
  • VCD and culture viability were monitored daily.
  • mAb titers were measured on day 3 and at the end of the culture. Relative quantification of miRNA levels was carried out using qRT-PCR on cells collected on day 3 of the culture.
  • IVCD (10 7 ceUsiiri-day) 2.72 ( ⁇ 0.17) 258 ( ⁇ 0.35) 2.81 ( ⁇ 0.28) 2.85 ( ⁇ 0.28) 2.84 ( ⁇ 0.32) 3.01 ( ⁇ 0.41) 2.79 ( ⁇ 0.28) Table 4. Effects of overexpression of itiiRs-17 .-19b, -20a, -92a and mxR-17-92 cluster ( ⁇ cluster') on productivity and growth in stably transfected pools.
  • Stable pools overexpressing miRNAs were generated by transfecting each miRNA into CHO Kl-mAb high-producing clone SH87 and selecting with Hygromycin B for stable . transfectants .
  • Blank pools were generated by transfection of SH87 with a blank pcDNA3.
  • lHyg (+) vector Each pool was cultured in shake flask batch culture until viability dropped below 50%.
  • Relative miRNA levels, specific mAb productivity (qP) and growth rate ( ⁇ ) were determined at day 3.
  • Final titre and integrated viable cell density (IVCD) were determined at the end of culture. Average and standard deviation obtained from biological triplicates are shown. Significant differences in stable pools relative to SH87 are indicated by * (paired Student's T-test, p ⁇ 0.05) and ** (p ⁇ 0.1) .
  • IgG in the supernatant was purified using protein A column on a GE AKTA explorer 100 (GE Healthcare, Uppsala, Sweden) and the aggregation of purified IgG was determined using size exclusion chromatography (SEC) coupled to a dynamic light scattering detector and a UV-visible detector as previously described.
  • SEC size exclusion chromatography
  • Glycosylation of purified IgG was characterized by two orthogonal techniques: matrix-assisted laser-desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) and ultra-high performance liquid chromatography with fluorescence detection (UPLC-fluorescence) .
  • MALDITOF MS of permethylated N- glycans was performed as previously described. Glycan structures were assigned to respective peaks ' based on matching mass -to-charge ration (m/z) and knowledge of N-glycan biosynthetic pathway in CHO cells. Graphical annotation was assisted by GlycoWorkBench software. Heights of peaks that correspond to glycan species were used for calculating relative abundance of glycans.
  • UPLC profiling of native N- glycans labeled with 2-aminobenzamide (2-AB) was carried out using GlykoPrep Plus rapid N-glycan preparation with 2-AB kit (Prozyme, Hayward, CA) on an AssayMap Bravo automation platform (Agilent Technologies, Santa Clara, CA) as per manufacturer's instructions. Briefly, purified IgG were diluted to lmg/mL and 105 L of each sample was aliquoted into a 96 -well PCR plate, denatured, and captured to immobilization tips. N-glycans were released by PNGase F treatment, dried by CentriVac device and labeled with 2-AB by reductive amidation.
  • 2-AB labeled glycans were purified with clean-up tips and eluted in 50 ⁇ 1. of ultrapure water.
  • UPLC- fluorescence glycan analysis was done on Ultimate 3000 RSLC system (ThermoFisher Scientific, Sunnyvale, CA) as per published methodologies with slight modifications.
  • Glycans were separated on an Accucore Amide-HILIC column (2.1mm internal diameter, 150mm length) (ThermoFisher Scientific) using 50mM ammonium formate (pH 4.5) (solvent A) and acetonitrile (solvent B) as a binary solvent system as follows: a linear gradient of solvent A from 20% to 50% over 40 min, an isocratic run of 50% solvent A for 5 min, then an isocratic run of 20% solvent A for 15 min. A 2-AB labeled dextran ladder (Ludger, Oxford, UK) was run as a calibrant for GU values. Peaks in chromatograms for IgG glycan samples were annotated based on GU values of glycan standards obtained under the same chromatographic conditions.
  • Clones 17-28, 19b-36, 20a-17, 92a-31 and Clu-44 isolated from the pools stably transfected with miR-17, miR-19b, miR-20a, miR-92a and miR-17-92 cluster respectively) were grown in duplicate cultures and the purified IgG produced by these clones were separated by SEC and detected using UV detectors and dynamic light scattering. Peaks were identified as aggregates and IgG monomers based on their average molecular weights determined by dynamic light scattering.
  • Glycan structures were identified using MALDI-TOF MS and categorized into the following species: sialylated, fucosylated, pauci-/oligo-mannose, GO (complex bi-antennary with no terminal galactose), Gl (1 terminal galactose) and G2 (2 terminal galactose). Overexpressing miRs-17, -19b, -20a, - 92a and miR-17-92 did not impact N-glycosylation strongly. For all purified IgG samples, majority of N-glycans are fucosylated, bi-antennary structures, with 0-2 terminal galactose residues in descending order of abundance (Fig.3A).
  • Terminal mannosylated and sialylated glycans represent small fractions of total N-glycan pool ( ⁇ 10% and 2% respectively), consistent with a normal CHO-produced recombinant human IgG glycan distribution pattern.
  • the present disclosure and data is illustrative of the relationship between the expression of miRNAs in cells and the cells growth and productivity.
  • the methods, expression system and cell lines provided demonstrate the significant advantage of targeting miRNAs for engineering of host cells for the enhancement of recombinant protein production.
  • miRNAs such as miR-17-92 are wide-ranging in various cell culture and biological systems, such as inhibition of apoptosis in hematopoietic stem cells and inhibition of differentiation in trophoblasts and myeloid leukemia cells, demonstrating the importance of cell type and context on the functions of these miRNAs ⁇
  • the disclosure herein demonstrate correlations between enhanced qP/titer and increased levels of miRNAs, and provides for the engineering of a stable recombinant cell lines with enhanced productivity predisposition for a desired recombinant protein. This having obvious advantageous utility in the biopharmaceutical industry or indeed the medical research industry in using miRNAs as cell engineering targets to modulate recombinant protein production in host cells.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

La présente invention concerne l'utilisation de micro-ARN (miR-17, miR-19b, miR-20a, miR-92a, miR-18a et miR-19a) dans la modulation de la production de protéines recombinées dans une lignée cellulaire dans le but d'augmenter la productivité et le titre d'une protéine recombinée. De plus, la présente invention concerne des systèmes d'expression et des kits de modulation de la production de protéines recombinées dans une lignée cellulaire.
PCT/SG2014/000289 2013-06-18 2014-06-18 Procédé de modulation de la production de protéines recombinées WO2014204405A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
SG201304716 2013-06-18
SG201304716-2 2013-06-18

Publications (1)

Publication Number Publication Date
WO2014204405A1 true WO2014204405A1 (fr) 2014-12-24

Family

ID=52104998

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/SG2014/000289 WO2014204405A1 (fr) 2013-06-18 2014-06-18 Procédé de modulation de la production de protéines recombinées

Country Status (1)

Country Link
WO (1) WO2014204405A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117535292A (zh) * 2023-11-01 2024-02-09 新乡医学院 let-7a在CHO细胞重组蛋白表达中的应用、表达系统

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008015662A1 (fr) * 2006-08-04 2008-02-07 Dublin City University Procédé d'obtention de produits biologiques recombinants

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008015662A1 (fr) * 2006-08-04 2008-02-07 Dublin City University Procédé d'obtention de produits biologiques recombinants

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
CLARKE, C. ET AL.: "Integrated miRNA, mRNA and protein expression analysis reveals the role of post-transcriptional regulation in controlling CHO cell growth rate", BMC GENOMICS, vol. 13, 2012, XP021134767, DOI: doi:10.1186/1471-2164-13-656 *
JADHAV, V. ET AL.: "A Screening Method to Assess Biological Effects of MicroRNA Overexpression in Chinese Hamster Ovary Cells", BIOTECHNOLOGY AND BIOENGINEERING, vol. 109, no. 6, 2012, pages 1376 - 1385, XP055094798, DOI: doi:10.1002/bit.24490 *
JADHAV, V. ET AL.: "Stable overexpression of miR-17 enhances recombinant protein production of CHO cells", JOURNAL OF BIOTECHNOLOGY, vol. 175, 8 February 2014 (2014-02-08), pages 38 - 44, XP028631072, DOI: doi:10.1016/j.jbiotec.2014.01.032 *
LIN, N. ET AL.: "Profiling Highly Conserved MicroRNA Expression in Recombinant IgG- Producing and Parental Chinese Hamster Ovary Cells", BIOTECHNOLOGY PROGRESS, vol. 27, no. 4, 2011, pages 1163 - 1171, XP055075805, DOI: doi:10.1002/btpr.556 *
LOH, W. P. ET AL.: "Overexpression of microRNAs enhances recombinant protein production in Chinese hamster ovary cells", BIOTECHNOLOGY JOURNAL, vol. 9, 13 May 2014 (2014-05-13), pages 1 - 12 *
LOH, W.P. ET AL.: "Profiling and engineering of microRNAs for enhancing recombinant protein productivity in Chinese hamster ovary cells", BMC PROCEEDINGS, vol. 7, no. SUPPLE, 2013, pages 102 *
MÜLLER, D. ET AL.: "MicroRNAs as targets for engineering of CHO cell factories", TRENDS IN BIOTECHNOLOGY, vol. 26, no. 7, 28 May 2008 (2008-05-28), pages 359 - 365, XP022757292, DOI: doi:10.1016/j.tibtech.2008.03.010 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117535292A (zh) * 2023-11-01 2024-02-09 新乡医学院 let-7a在CHO细胞重组蛋白表达中的应用、表达系统

Similar Documents

Publication Publication Date Title
Loh et al. Overexpression of microRNAs enhances recombinant protein production in Chinese hamster ovary cells
JP6445516B2 (ja) 組換えポリペプチドの生産
Jadhav et al. A screening method to assess biological effects of microRNA overexpression in Chinese hamster ovary cells
EP3665291B1 (fr) Des sites d'intégration dans des cellules cho
He et al. The role of long intergenic noncoding RNA p21 in vascular endothelial cells
EP3604331A1 (fr) Nouvelles cellules eucaryotes et procédés d expression de manière recombinante d'un produit d'intérêt
Li et al. Long non-coding RNA LINC00641 suppresses non-small-cell lung cancer by sponging miR-424-5p to upregulate PLSCR4
Pieper et al. Secretory pathway optimization of CHO producer cells by co-engineering of the mitosRNA-1978 target genes CerS2 and Tbc1D20
Attema et al. Identification of an enhancer that increases miR-200b~ 200a~ 429 gene expression in breast cancer cells
Idda et al. Cooperative translational control of polymorphic BAFF by NF90 and miR-15a
Mao et al. MiR-181b targets Six2 and inhibits the proliferation of metanephric mesenchymal cells in vitro
Xie et al. MDM4 regulation by the let-7 miRNA family in the DNA damage response of glioma cells
WO2013182553A2 (fr) Ingénierie cellulaire à l'aide d'arn
Wang et al. Identification of TLR2 and TLR4‑induced microRNAs in human mesenchymal stem cells and their possible roles in regulating TLR signals
EP3430138B1 (fr) Cellules de mammifères pour produire une protéine sécrétée
WO2014204405A1 (fr) Procédé de modulation de la production de protéines recombinées
AU2016240211B2 (en) Use of vitamins and vitamin metabolic genes and proteins for recombinant protein production in mammalian cells
KR101809594B1 (ko) 목적 단백질 생산을 위한 발현 벡터 및 이를 이용한 목적 단백질의 과발현 방법
Kang et al. A single-plasmid vector for transgene amplification using short hairpin RNA targeting the 3′-UTR of amplifiable dhfr
US20200224208A1 (en) Engineered cell lines for increased protein production
US20220228110A1 (en) Expression vectors, methods for screening host cells expressing target proteins, and methods for establishing cell lines stably expressing foreign recombinant genes
Lin et al. Overexpression of Serpinb1 in Chinese hamster ovary cells increases recombinant IgG productivity
Greenlees et al. Inhibition of microRNA-let-7a Increases the Specific Productivity of Antibody-Producing CHO Cell Lines
Loh Regulation of Protein Productivity by MicroRNAs in CHO Cells
US20240093259A1 (en) Methods to stabilize mammalian cells

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14812963

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 14812963

Country of ref document: EP

Kind code of ref document: A1