WO2014203133A1 - Bacterial hyaluronidase and process for its production - Google Patents

Bacterial hyaluronidase and process for its production Download PDF

Info

Publication number
WO2014203133A1
WO2014203133A1 PCT/IB2014/062193 IB2014062193W WO2014203133A1 WO 2014203133 A1 WO2014203133 A1 WO 2014203133A1 IB 2014062193 W IB2014062193 W IB 2014062193W WO 2014203133 A1 WO2014203133 A1 WO 2014203133A1
Authority
WO
WIPO (PCT)
Prior art keywords
hyaluronidase
seq
recombinant
protein
coli
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IB2014/062193
Other languages
French (fr)
Inventor
Luciano Messina
Luca MUSUMECI
Susanna Vaccaro
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Fidia Farmaceutici SpA
Original Assignee
Fidia Farmaceutici SpA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fidia Farmaceutici SpA filed Critical Fidia Farmaceutici SpA
Priority to EA201600026A priority Critical patent/EA035163B1/en
Priority to CN201480046815.1A priority patent/CN105473607B/en
Priority to ES14747982.8T priority patent/ES2643485T3/en
Priority to SI201430436T priority patent/SI3010932T1/en
Priority to CA2915253A priority patent/CA2915253C/en
Priority to EP14747982.8A priority patent/EP3010932B1/en
Priority to US14/899,219 priority patent/US9822351B2/en
Publication of WO2014203133A1 publication Critical patent/WO2014203133A1/en
Anticipated expiration legal-status Critical
Priority to US15/728,959 priority patent/US10400229B2/en
Ceased legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2474—Hyaluronoglucosaminidase (3.2.1.35), i.e. hyaluronidase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01035—Hyaluronoglucosaminidase (3.2.1.35), i.e. hyaluronidase
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • TITLE "BACTERIAL HYALURONIDASE AND PROCESS FOR ITS PRODUCTION"
  • the present invention relates to a hyaluronidase derived from S. koganeiensis, its applications and a method for the production thereof.
  • the hyaluronidase used in the clinical field is of animal origin. While this product is suitably purified, it contains a number of contaminants that can induce immunogenic or allergic responses.
  • Hyaluronic acid is an essential component of the extracellular matrix and a quantitatively significant constituent of the interstitial barrier.
  • Hyaluronidase is a hydrolytic enzyme that cleaves hyaluronic acid in D- glucuronic acid and N-acetyl glucosamine, increasing the permeability of the interstitial matrix. In a variable manner, it is also capable of degrading other acid mucopolysaccharides of the connective tissue.
  • High concentrations of hyaluronidase can be found, for example, in the oral apparatus of leeches, in poison of snakes, bees, scorpions and in the culture supernatant of pathogenic bacteria such as pneumococci, haemolytic streptococci and Staphylococcus aureus.
  • pathogenic bacteria such as pneumococci, haemolytic streptococci and Staphylococcus aureus.
  • hyaluronidase is found in cornea, in ciliary body, in spleen, in skin and in testicles.
  • High amounts of hyaluronidase are also found in spermatozoa, to which the enzyme allows to go beyond the barrier of hyaluronic acid that protects the ovule.
  • Hyaluronidase is used in medicine in the treatment of edema, local inflammation, hemorrhoids and chilblains. Furthermore, it is used in the pharmaceutical field to facilitate the transport and increase the dispersion and diffusion of certain high molecular weight active ingredients (antibodies, drug carrier nanoparticles, DNA for gene therapy, recombinant proteins) administered locally by subcutaneous injection, increasing the bioavailability thereof in amounts comparable to intravenous administration. [1] Previous studies have shown that nanoparticles with diameters up to 200 nm may undergo a strong increase in their transport through the interstitial space when administered concurrently or sequentially with the hyaluronidase enzyme [1].
  • nanoparticles are able to express, in vitro, their functions, thus showing great potential in the therapeutic and diagnostic fields.
  • the use of nanoparticle and hyaluronidase formulations could therefore represent an excellent and innovative starting point for the therapeutic and diagnostic future with the prospect that the drug carrier nanoparticles may finally be used in common clinical practice by local administration subcutaneously for treatment, for example, in oncology, ophthalmology and osteoarthritis.
  • HA hyaluronic acid
  • Hyaluronidase is also used in cosmetics for the treatment of granulomatous reactions or incorrect collocations, i.e. undesired, of hyaluronic acid, caused by fillers, and to dramatically improve the fibrosis condition present in cellulite.
  • Hyaluronidase by segmenting the fibrotic component of cellulite, makes it softer with reduction of the orange peel effect, thus giving a more natural and pleasing appearance to the portion of skin subjected to the treatment.
  • hyaluronidase is the only real treatment, with therapeutic or non-therapeutic purposes, that can fight cellulite with satisfactory results.
  • thermolabile inhibitor of bovine hyaluronidase [5,6].
  • the object of the present invention is to provide a bacterial recombinant hyaluronidase having high purity for pharmaceutical and/or cosmetic applications.
  • An object of the present invention is to provide an enzyme that is stable in an aqueous solution even for long times and in the presence of proteolytic enzymes, that is completely devoid of the risk of transmitting animal spongiform encephalopathy and that has a high hyaluronidase activity also in the bloodstream without possibility of inhibition or viral or bacterial contamination, so as to allow its use also intravenously.
  • Another object of the present invention is to provide a method for the preparation of hyaluronidase that is efficient, in a high yield and is applicable without difficulty on an industrial scale.
  • step b) subjecting the content of the bioreactor of step a) to fermentation at a pH between 6.7 and 7.1 in the presence of a nourishment solution;
  • step b) adding an inducer of the lac genes to the mixture of step b) ;
  • step b) subjecting the mixture of step b) to an induction period of between 8 and 24 hours;
  • step e centrifuging the bacterial cells obtained in step d) ; f) re-suspending the pellets obtained in step e) and subjecting the resulting suspension to osmotic shock;
  • step g) purifying the protein fraction having hyaluronidase enzymatic activity obtained in step g) by a sequence of: i. strong ion-exchange chromatography and isolation of the hyaluronidase enzymatic activity fraction;
  • the objects of the invention are also achieved by a hyaluronidase from Streptomyces koganeiensis ATCC 31394 comprising the sequence SEQ ID No: 21, obtainable by said method.
  • the objects of the invention have also been achieved by a hyaluronidase from Streptomyces koganeiensis ATCC 31394 in a purified form and comprising the amino acid sequence shown in SEQ. ID. No. 21.
  • the objects of the invention have also been achieved by a polynucleotide comprising the nucleotide sequence shown in SEQ. ID. No. 17, encoding a bacterial hyaluronidase comprising the amino acid sequence in SEQ. ID. No. 21.
  • the objects of the invention have also been achieved by a genetically engineered recombinant vector comprising said polynucleotide.
  • the objects of the invention have been achieved by a host cell comprising said genetically engineered recombinant vector .
  • composition suitable for pharmaceutical or cosmetic use comprising said hyaluronidase from Streptomyces koganeiensis ATCC 31394 in a purified form and comprising the N-terminal amino acid sequence shown in SEQ. ID. No. 21, said hyaluronidase for use in the treatment and/or prevention of a disorder or disease, optionally in combination with at least another active ingredient, and non-therapeutic use thereof for cosmetic applications and/or for improving the aesthetic appearance.
  • composition suitable for pharmaceutical or cosmetic use means a solid, semisolid or liquid preparation, such as suspension or solution, comprising at least one active ingredient and at least one excipient as is known to the man skilled in the art.
  • polypeptide sequence or “polynucleotide sequence” also includes sequences with a high degree of homology with the sequence indicated.
  • polypeptides that have at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identity with the sequence shown in SEQ. ID. NO: 21, polynucleotides that have at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identity with the sequence shown in SEQ. ID. NO: 17, and polynucleotides that have at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identity with the sequence shown in SEQ. ID. NO: 41.
  • hyaluronidase from Streptomyces koganeiensis ATCC 31394 it is meant hyaluronidase with a high degree of homology with the hyaluronidase originally isolated from the Streptomyces koganeiensis ATCC 31394 organism, that can be produced through biotechnological techniques also from micro-organisms other than Streptomyces koganeiensis ATCC 31394 (such as E. coli or B. subtilis) .
  • FIG. 1 production curve of hyaluronidase from supernatant of Streptomyces koganeiensis culture relative to the time interval (T) . Assay in 1% agarose gel of the profile of total RNA and DNA extracted from S. koganeiensis cells during the production step.
  • FIG. 2 sequence of the amplicon of about 550bp obtained with internal primers MesFor2 and MesRev2 and in silico translation of the nucleotide sequence obtained in protein sequence.
  • FIG. 3 diagram of the Inverse Polymerase Chain Reaction (IPCR) method used to identify the sequences flanking in 5' and 3' the internal region of the S. koganeiensis gene encoding the hyaluronidase.
  • IPCR Inverse Polymerase Chain Reaction
  • FIG. 4 complete identification of the entire nucleotide sequence of the gene encoding the CDS hyaluronidase portion of S. koganeiensis.
  • FIG. 5 sequence of the entire gene encoding the CDS hyaluronidase portion S. koganeiensis as cloned in the pCR-Bluntll-MOUSE vector (Invitrogen) .
  • FIG. 6 (A) BLAST assay for sequence homologies between the amino acid sequence determined by the S. koganeiensis ATCC 31394 hyaluronidase and the amino acid sequences reported in web database. The sequences highlighted by the rectangle describe a functional domain of the bacterial hyaluronidase family. (b) BLAST assay for sequence homologies between the nucleotide sequence determined by the S. koganeiensis ATCC 31394 hyaluronidase and the nucleotide sequences reported in web database.
  • FIG. 7 (a) functional characterization on the protein sequence of the hyaluronidase from S. koganeiensis. (b) functional characterization on the protein sequence of the hyaluronidase from Actinoplanes sp. SE 50/110, Streptomyces pristinaespiralis ATCC 25486, Streptomyces tsukubaensis NRRL18488.
  • FIG. 8 DNA fragment encoding hyaluronidase and expression plasmids thereof used for cloning were both cut with established restriction enzymes. The fragments obtained were analyzed in 1% agarose gel and stained with ethidium bromide. After staining, the gel was acquired by a laboratory image capturing device ImageQuant 300 TL (GE Healthcare) while (quantitative and qualitative) assays were performed using the image analysis software ImageQuant TL (GE Healthcare) .
  • FIG. 9 Screening by PCR and digestion with restriction enzymes, of the DNA fragment encoding the hyaluronidase cloned into expression plasmids.
  • the fragments obtained were analyzed in 1% agarose gel with the image analysis software ImageQuant TL (GE Healthcare) after staining with ethidium bromide and acquisition.
  • FIG. 10 the figure shows the map of the pHTsk_HYAL plasmid: Pgrac promoter, lacl gene (lacl repressor) , Amp R gene for resistance to ampicillin, Cm R gene for resistance to chloramphenicol, ColEl origin of replication of E. coli, SamyQ signal peptide of amyQ and hyaluronidase gene encoding the S. koganeiensis hyaluronidase, BamHI and Xbal unique restriction sites used for cloning hyaluronidase.
  • FIG. 11 the figure shows the map of the pHyal_sk plasmid: ori origin of replication of E. coli, Ap gene for ampicillin resistance, T7 promoter, lacl gene (lacl repressor) , pelB signal peptide, hyaluronidase gene encoding the S. koganeiensis hyaluronidase, Ncol and EcoRI unique restriction sites used for cloning the hyaluronidase .
  • FIG. 12 the figure shows the map of the pHyal_sk_SL plasmid: ori origin of replication of E. coli, Ap gene for ampicillin resistance, T7 promoter, lacl gene (lacl repressor) , hyaluronidase gene encoding the S. koganeiensis hyaluronidase , Ndel and EcoRI unique restriction sites used for cloning the hyaluronidase.
  • FIG. 13 (a) the figure shows the nucleotide sequence of the Open Reading Frame (ORF) encoding the hyaluronidase protein of S. koganeiensis cloned into vector pHT43 (MOBITEC) . (b) the figure shows the nucleotide sequence of the ORF encoding the hyaluronidase protein of S. koganeiensis cloned into vector pET22b(+) (Novagen) . (c) the figure shows the nucleotide sequence of the ORF encoding the hyaluronidase protein of S. koganeiensis cloned into vector pET21b(+) (Novagen) .
  • ORF Open Reading Frame
  • FIG. 14 assessment in SDS-PAGE at 12% of the expression of the hyaluronidase recombinant ⁇ E. coli, BL21 (DE3) containing plasmid pHyal_sk) after induction with 1 mM IPTG compared to the protein profile of the pre-induced sample .
  • FIG. 15 assessment in SDS-PAGE at 12% of the expression of the hyaluronidase recombinant (E. coli, BL21 (DE3) containing plasmid pHyal_sk_SL) after induction with 1 mM IPTG compared to the protein profile of the pre-induced sample .
  • FIG. 16 protein profile in SDS-PAGE at 12% of the fractions obtained after each purification step according to the invention.
  • FIG. 17 (a) comparison of spectra at the circular dichroism of autologous and recombinant hyaluronidase. (b) the respective UV spectra for the purified recombinant are shown. The UV spectra were analyzed before (upper line) and after (lower line) centrifugation in order to remove any aggregates present.
  • FIG. 18 molecular weight determination by mass spectrometry of the recombinant hyaluronidase obtained according to invention.
  • FIG. 19 determination of the isoelectric point of the recombinant hyaluronidase obtained according to the invention .
  • FIG. 20 capillary electrophoresis electropherogram of the sample of purified recombinant hyaluronidase according to the invention. The calculated concentration was approximately 1 mg/ml with 100% purity.
  • FIG. 21 analysis of the purity of the purified recombinant hyaluronidase according to the invention by means of (a) HPLC on gel filtration column Bio-Sil SEC, (b) RP-HPLC on a hydrophobic phase (reversed) column.
  • FIG. 22 SDS-PAGE 12% - the recombinant hyaluronidase produced and purified according to invention was charged with 1000, 500, 250, 100, and 50 units per lane and compared with 50, 25 and 10 units per lane of hyaluronidase from bovine testicles.
  • Western blot analysis on the preparation of 25 units of the bovine hyaluronidase using the anti-hyaluronidase polyclonal antibody (Abnova) that revealed a single immunoreactive hyaluronidase band.
  • FIG. 23 electrophoresis in 1% agarose gel shows the depolymerization of the hyaluronic acid purified with 1 unit of recombinant hyaluronidase produced according to the invention at the times indicated ranging from 5 minutes to 24 hours.
  • FIG. 24 Stability of the recombinant hyaluronidase produced according to the invention and of the hyaluronidase from bovine testicles, against proteolytic enzymes.
  • FIG. 25 in vitro evaluation of the inhibition effect that the human and animal serum has on the enzyme activity of hyaluronidase (recombinant produced according to this invention and bovine hyaluronidase) .
  • the present invention relates to a method for the production of hyaluronidase isolated from Streptomyces koganeiensis ATCC 31394 comprising the amino acid sequence shown in SEQ. ID. No. 21 comprising the following steps:
  • step b) subjecting the content of the bioreactor of step a) to fermentation at a pH between 6.7 and 7.1 in the presence of a nourishment solution;
  • step b) adding an inducer of the lac genes to the mixture of step b) ;
  • step b) subjecting the mixture of step b) to an induction period of between 8 and 24 hours;
  • step e centrifuging the bacterial cells obtained in step d) ; f) re-suspending the pellets obtained in step e) and subjecting the resulting suspension to osmotic shock;
  • step g) purifying the protein fraction having hyaluronidase enzymatic activity obtained in step g) by a sequence of: i. strong ion-exchange chromatography and isolation of the hyaluronidase enzymatic activity fraction; ii. weak cation-exchange chromatography and isolation of the hyaluronidase enzymatic activity fraction; and iii. aromatic hydrophobic interaction chromatography and isolation of the hyaluronidase enzymatic activity fraction.
  • the isolated and characterized hyaluronidase from the original bacterial strain in [9] was produced in recombinant form using a non-pathogenic bacterial strain as a host cell defined as Generally Regarded as Safe (GRAS) .
  • GRAS Generally Regarded as Safe
  • the production of the bacterial recombinant from the "GRAS" micro-organism retains efficacy comparable to that of autologous hyaluronidase but with a higher amount of production per liter and with a substantially better profile of purity and safety, including the complete absence of the risk of viral transmission.
  • the method of the present invention allows to obtain high amounts of a high quality recombinant bacterial hyaluronidase for pharmaceutical applications.
  • the high production of recombinant hyaluronidase in non-pathogenic microorganisms has the same efficacy as the traditional hyaluronidase but with a significantly better safety and profile, including the complete absence of the risk of transmitting animal spongiform encephalopathy.
  • the present invention describes the isolation of the entire gene encoding the hyaluronidase from the gram- positive bacterium Streptomyces koganeiensis, with the subsequent cloning and expression of the CDS fragment (encoding sequence, SEQ ID NO: 22) . Furthermore, the present invention provides a method for the preparation in the fermenter, the purification and characterization of the recombinant hyaluronidase encoded and secreted in the periplasmic cell portion in a soluble form.
  • the recombinant protein thus obtained has a high hyaluronidase activity and has a high stability to proteolytic enzymes, . is able to perform the total activity with its maximum bioavailability in the bloodstream without possibility of inhibition and bacterial and viral contamination.
  • it proves to be effective for use in applications not only for the preparation of pharmaceutical compositions in facilitating the subcutaneous administration of active ingredients or injectable fluids but also in therapeutic applications, for example in the treatment of pathologies such as hypertension, myocardial infarction, thrombotic events, cardio- and cerebro-vascular events and tumors, since it is unique with the features described by the invention with reference to all other hyaluronidases available to date .
  • hyaluronidase originates from animal sources having a high risk of transmitting animal spongiform encephalopathy; due to this risk, and to the high instability of the animal-derived hyaluronidase, a bacterial strain is researched, selected and isolated capable of producing a hyaluronidase with a high enzyme activity.
  • the present invention relates to the isolation of the entire gene encoding the bacterial hyaluronidase (SEQ ID NO: 17) having amino acid sequence SEQ ID NO: 21, coming from the gram-positive bacterium S. koganeiensis, the consequent cloning and expression of the nucleotide sequence SEQ ID NO: 22 encoding the mature protein having the sequence SEQ ID NO: 21 in a specific bacterial host (e.g. E. coli) , recognized to be an organism selected for the expression of recombinant proteins used in therapeutic, diagnostic and industrial applications.
  • a specific bacterial host e.g. E. coli
  • the invention describes the production of the protein using the fed-batch method for obtaining, in a fermenter, a high amount of recombinant hyaluronidase secreted in the periplasmic cell portion in a soluble form.
  • the recombinant hyaluronidase thus produced is subjected to purification using three reproducible chromatographic steps (two ion exchange and one hydrophobic exchange) .
  • the enzyme is an innovative suitably purified soluble recombinant bacterial enzyme with a high hyaluronidase activity produced by fermentation of safe bacteria without the use of animal- derived cells and raw materials.
  • the enzyme according to this invention is characterized by a sequence of 217 amino acids, by an isoelectric point (pi) of 5.2 ⁇ 0.5, by a high stability to proteolytic enzymes, by in vitro stability towards animal and human blood, by a high degree of purity and safety, and by the complete absence of the possibility of viral contamination.
  • the hyaluronidase according to the invention can be obtained as- follows: initially, the strain of S. koganeiensis was subjected to fermentation and the extracellular material was obtained from bacterium cells as previously described [9]. During the fermentation process, cell fractions are collected every 3-4 hours to assess the levels of DNA and RNA produced by standard methods (Fig. 1) , while the other part of the fraction is stored at -80 °C in RNAprotectTM Bacteria Reagent (Qiagen) , after being analyzed. At the end of fermentation, the . supernatant containing the hyaluronidase was clarified, concentrated, dialyzed, purified and then enriched with the sole hyaluronidase component as previously described [9] .
  • Hyaluronidase from S. koganeiensis thus isolated was digested with proteolytic enzymes (trypsin, chymotrypsin, Glu-C) and the fragments obtained after digestion were separated by HPLC. In this way, the information concerning the primary structure of the isolated hyaluronidase was obtained by sequencing the N-terminal portion of the fragments obtained after enzymatic digestion.
  • proteolytic enzymes trypsin, chymotrypsin, Glu-C
  • the pellets of bacterial cells from fermentation [9] in the period of exponential production of hyaluronidase (Fig. 1) were treated for extraction and purification of DNA and RNA.
  • the products thus obtained are analyzed qualitatively using a spectrophotometer and quantitatively by electrophoresis in agarose gels [12].
  • the identified and identical amino acid regions between S. koganeiensis and S. pristinaespiralis served for designing the oligonucleotides used to isolate an internal portion of the gene encoding the hyaluronidase from the genomic DNA used as template, yielding a PCR product with a single specific band of approximately 550 bp.
  • the nucleotide sequencing of the fragment provided the sequence (SEQ ID NO: 8) shown in Fig. 2.
  • the inverse PCR technique was developed and performed to identify the nucleotide regions flanking the gene sequence thus identified (Fig. 3) .
  • the IPCR method using the pair of primers SEQ ID NO: 11 and SEQ ID NO: 12 allowed obtaining PCR products, respectively of about 700 and 1400 bp, which, once sequenced, provided accurate information on the entire gene encoding the hyaluronidase of S. koganeiensis .
  • the identification of the nucleotide sequence of interest SEQ ID NO: 13
  • FIG. 4 the identification of the nucleotide sequence of interest
  • a pair of primers designed on the non-coding sequences (SEQ ID NO: 14 and SEQ ID NO: 15) and flanking the entire gene encoding the hyaluronidase are used for the amplification of the entire gene (SEQ ID NO: 16) and the PCR product (fig. 5) was cloned directly into the pCR®- Bluntll-TOPO® (Invitrogen) vector in of E. coli cells. From the results obtained from the bioinformatics analysis it was observed that the entire length of the gene encoding the hyaluronidase from S.
  • koganeiensis was of 744 bp (SEQ ID NO: 17) and that the length of the peptide sequence was estimated to be 247 amino acids (SEQ ID NO: 18) .
  • the gene contains a putative domain (SEQ ID NO: 19) of proteins belonging to the hyaluronidase family (Hyaluronidase_l) , as evidenced by the search for homologies on a database.
  • the analysis of the sequence (SEQ ID NO: 18) using a specific tool indicated the presence of a signal sequence (signal peptide) of 30 amino acids (amino acids 1 to 30 (SEQ ID NO: 47), with the cleavage site between amino acid 30 and 31) .
  • the mature protein (SEQ ID NO: 21) therefore is 217 amino acids long (corresponding nucleotide sequence 651bp (SEQ ID NO: 22)) and its predicted molecular weight
  • BLAST analysis shows a partial homology between the determined amino acid sequence from hyaluronidase from S. koganeiensis ATCC 31394 (SEQ ID NO: 18) with some of the amino acid sequences of hypothetical proteins belonging to the Aactinobacteria phylum reported in web database.
  • sequence homology between a region of the sequence (SEQ ID NO: 27 and SEQ ID NO: 52) of the hyaluronidase from S. koganeiensis (according to the invention) and one of the modules present in the amino acid domain of murine CD44 that binds the hyaluronic acid
  • cDNA encoding hyaluronidase from S. koganeiensis according to the invention was amplified by PCR starting from the plasmid pCR-BluntII-TOPO [sk_HYAL] and ligated, after being digested with restriction enzymes, in the different plasmids used according to this invention, for example: Vector Primers used Restriction Length Plasmid enzymes nucleotide obtained cloned from
  • pHT43 SEQ ID NO:28 BamHI 672bp pHTsk_HYAL
  • the vector pHTsk_HYAL is transformed into cells, made competent, of Bacillus subtilis (WB800N-MOBITEC) while vectors pHyal_sk, pHyal_sk_SL and pRH_sk are transformed into cells, made competent, of E. coli, strain BL21 (DE3) and/or MG1655. All transformations were carried, out by chemical processing [13].
  • subtilis and of E.coli found to be positive for the presence of vectors containing the nucleotide fragment of hyaluronidase having the genetically correct cloned sequence (SEQ ID NO: 41) are tested for the ability to express the recombinant hyaluronidase in 500 ml cultures (example: 10.11) .
  • the recombinant cell of step a) is selected from a cell of Escherichia coli and one of Bacillus subtilis .
  • Hyaluronidase according to the invention can be produced in large amounts starting from small fermenters using both Batch (example 13) and Fed-Batch (example 14) culture methods as described in this invention (table 1) .
  • Table 1 Plasmids and cloning strategies used in the present invention Strain Plasmide Plasmide description/ Protein Production of
  • a glycerol solution was preferably given as feed.
  • E.coli generates acetic acid
  • acetate as an undesirable by-product that has numerous negative effects on the production of recombinant proteins.
  • the amount of acetate which is formed during the fermentation phase is directly related to the amount of glucose consumed by the growing E. coli cells [15].
  • glycerol as a carbon source (non-fermentable low cost carbon source) instead of glucose, an approximately 3- fold increase is obtained in the fed-batch production process for the production of recombinant hyaluronidase.
  • the feed can be provided 6 hours after inoculation up to the nineteenth hour
  • induction time with an exponential addition ratio.
  • IPTG Isopropyl ⁇ -D-l- thiogalactopyranoside
  • lmM final solution the feed can be administered to the culture every hour and in the same amount as the last addition for 5 hours.
  • the induction takes place 24 hours after inoculation and continues for 8-24 hours, typically 12 hours.
  • the bacterial cells are collected after the the induction period, by centrifugation, and stored at -80 °C.
  • the cells of E.coli BL21 (DE3) transformed with the vector pHyal_sk_SL produce the recombinant form in the cell periplasm with a maximum concentration reached of about 2 g per liter of culture and an enzymatic activity greater than 87000 U/ml of culture (7.5 xlO 7 - 8.7 X10 7 IU/1 of culture) obtained after 12 hours of induction with ImM IPTG at 37 °C (Table 2) .
  • the amount of hyaluronidase produced according to this invention was about 670-750 times higher than the autologous hyaluronidase produced in the fermenter as described in the previous patent [9].
  • the recombinant protein expressed by E. coli in the different fermentation parameters, was analyzed by electrophoresis run in SDS-PAGE (12%) after staining with Coomassie Brilliant Blue G-250 (BIO-RAD, 161-0406) having a molecular weight of 24kDa, while the enzymatic activity was analyzed by turbidimetric assay [ 16] .
  • Recombinant hyaluronidase produced in the fermenter by the fed-batch method can be purified by a process comprising at least three chromatographic steps.
  • pellets stored at -80 °C (coming from the fed-batch fermentation of E.coli BL21 (DE3) transformed with the vector pHyal_sk_SL) are placed in an amount equivalent to 0.6 liters of fermentation product (approximately equivalent to the range of 80-90g of cellular pellets reflecting approximately a production of 1-1.2 g/L of recombinant hyaluronidase) to equilibrate for 45 minutes at room temperature.
  • pellets were treated with a fresh solution (5 °C) for the dispersion of the pellet.
  • the resuspended pellets were treated with a solution for osmotic shock to favour the extraction of periplasmic proteins.
  • the product obtained was centrifuged and . the . resulting supernatant, once homogenised, is brought to pH 8 and filtered by gravity filters with 0.65 ⁇ filters.
  • the concentration of the extracted hyaluronidase was evaluated in SDS-PAGE resulting to be about 75.0-900mg/total (16-22% of the total periplasmic proteins) .
  • the activity of the extracted recombinant hyaluronidase was instead assessed by Dorfman's turbidimetric method.
  • the protein fraction with hyaluronidase enzymatic activity thus obtained is subjected to strong anion exchange chromatography (example: Q sepharose XL).
  • the protein fraction with hyaluronidase enzymatic activity thus obtained is concentrated to 100ml using Polyethersulfone (PES) filters with cut-off 5kDa and diluted 10 times with 50 mM sodium acetate buffer at pH 4.
  • PES Polyethersulfone
  • the protein fraction with hyaluronidase enzymatic activity thus obtained was subjected to weak cation exchange chromatography (example: CM-Sepharose® Fast Flow) .
  • the protein fraction with hyaluronidase enzymatic activity thus obtained was concentrated to 100ml using Polyethersulfone (PES) filters with cut-off 5kDa and diluted 10 times with 50.
  • PES Polyethersulfone
  • phenylsepharose HP phenylsepharose HP
  • the eluted proteins from this last chromatographic step were collected in a single fraction having a volume of about 730 ml and subjected to hyaluronidase activity assay.
  • the eluted fraction was subjected to ultrafiltration and dialysis with 10 volumes of PBS lx (Sigma-P4417 ) brought to a concentration of approximately lmg/ml and filtered with 0.2 ⁇ filters, the protein concentration is determined by BCA Protein Assay Reagent Kit (PIERCE) .
  • the enzymatic potential of the hyaluronidase produced according to the invention ⁇ E.coli transformed with the vector pHyal_sk_SL) was evaluated by comparison with the enzyme activity of autologous hyaluronidase [9], using the enzymatic assay described [9] and the activity value was reported to be in both cases greater than 4xl0 4 IU/mg protein .
  • the overlay files black line (autologous hyaluronidase [9]) and ray line (heterologous hyaluronidase according to the invention) have a comparable profile, confirming the same protein structure for both samples (Fig. 17-a) .
  • hyaluronidase of bacterial origin from a strain of E.coli well characterized as safe, rather than from Streptomyces koganeiensis, by recombinant technology (in place of that by extractive way) suitable for the production on an industrial scale, with production in the periplasm (in place of in extracellular matrix) ;
  • the present invention relates to a hyaluronidase from Streptomyces koganeiensis ATCC 31394 in a purified form and comprising the amino acid sequence shown in SEQ. ID. No. 21.
  • the protein of the present invention can be isolated and produced from Streptomyces koganeiensis or recombinantly produced, for example, from cultures of E. coli or Bacillus subtilis .
  • the enzyme of the present invention has:
  • the hyaluronidase according to the present invention is a product derived from genetic engineering; so far, there was no availability of the entire protein-encoding gene, since there was no genomic or protein bank of the S. koganeiensis strain. Only with the method developed by the inventors described herein the nucleotide sequence encoding the protein has been identified and isolated. This nucleotide fragment is the first ever isolated and documented DNA sequence from this bacterial strain. At the industrial level, the possibility of being able to obtain the entire sequence of the gene encoding this hyaluronidase with a high enzymatic activity allows its use in different systems such as: vectors, systems of genomic integration and in cells, advantageous for the production and use of the enzyme in the pharmaceutical industry.
  • a further surprising result of the present invention is the very high yield of the process claimed, which was developed through a complex screening activity with different expression vectors, different types of insertion of the nucleotide fragment encoding the protein into the expression vector (i.e. the insertion of the fragment with some restriction sites with respect to others) and screening of the production in different cell lines.
  • This activity made even more complex since the nucleotide sequence encoding the protein was not available therefore not allowing to apply what was known to the man skilled in the art, has permitted the identification of the most suitable type of cloning, type of vector and expression cells for obtaining a production so unexpectedly high.
  • the expression and production model for the recombinant protein according to the invention allows to obtain, at the end of the purification process, a pure protein with an endotoxin level of ⁇ 0.5 U/mg of protein, using only three chromatographic steps instead of 5 as is in the known process (endotoxins >0.5 U/mg protein) [9] .
  • the suitably purified enzyme is characterized by the assays whose results are listed in table 4.
  • Hyaluronidase according to the present invention has those activity and high purity features that are necessary for its use in industrial, diagnostic and therapeutic applications. Furthermore, compared to other hyaluronidases known so far, the hyaluronidase produced according to the present invention has proved to be an enzyme that is able to hydrolyse the hyaluronic acid present in the interstitial matrix, increasing the permeability of the connective tissue and favoring the diffusion and dispersion of the drug, locally administered subcutaneously, into the surrounding tissues with extreme stability without the possibility of being digested by proteolytic enzymes present in the connective tissue, which could easily degrade it, once injected, thus inhibiting its action (figure 24).
  • bovine hyaluronidase bovine PH20
  • human PH20 bovine PH20
  • the recombinant hyaluronidase of the invention (produced according to the method above or from S. koganeiensis) has a high hyaluronidase activity, has a high stability to proteolytic enzymes and is able to perform with its maximum bioavailability the total activity in the bloodstream without possibility of bacterial and viral infections. Therefore, it may find use, alone or in combination with other active principles, in the preparation of pharmaceutical or veterinary . compositions destined to the treatment of pathologies where it is necessary or advantageous to degrade the hyaluronic acid present in the organ or tissue affected by the pathology.
  • the hyaluronidase of the invention can also be formulated in the form of water based compositions such as solutions, hydrophilic creams, hydrogels, as well as in the form of lipophilic products such as ointments or oily creams.
  • the present invention relates to a polynucleotide comprising the nucleotide sequence shown in SEQ. ID. No. 17 which encodes the bacterial hyaluronidase from Streptomyces koganeiensis ATCC 31394 comprising the amino acid sequence shown in SEQ. ID. No. 21.
  • the present invention relates to a genetically engineered recombinant vector comprising said polynucleotide comprising the nucleotide sequence shown in SEQ. ID. No. 17.
  • said vector is a plasmid.
  • the present invention provides a host cell comprising said vector.
  • the present invention relates to a composition suitable for pharmaceutical or cosmetic use comprising the hyaluronidase from Streptomyces koganeiensis ATCC 31394 in a purified form and comprising the amino acid sequence shown in SEQ. ID. No. 21, obtainable from the above method or by extraction from Streptomyces koganeiensis .
  • the present invention relates to the hyaluronidase from Streptomyces koganeiensis ATCC 31394 in a purified form and comprising the amino acid sequence shown in SEQ. ID. No. 21, obtainable by the above method or by extraction from Streptomyces koganeiensis, for use in the treatment and/or prevention of a disease or disorder, optionally in combination with at least another active principle.
  • hyaluronidase of the present invention can be applied both in the medical field and in the veterinary field.
  • hyaluronidase according to the invention is for use in the treatment and/or prevention of at least one among oedemas, inflammatory conditions, chilblains, solid tumors, IgE-mediated allergies, diseases of the oral cavity, spontaneous vitreous haemorrhages, arteriosclerosis, blood pressure disorders, cardio- cerebro vascular disorders such as brain arterial stenosis or stroke or bovine mastitis.
  • the hyaluronidase of the invention can be used for the preparation of pharmaceutical compositions intended for the treatment of edemas, in particular edemas on a traumatic basis, or inflammatory conditions such as the haemorrhoid syndrome; moreover, it can be used for the preparation of compositions intended for the treatment of chilblains.
  • the hyaluronidase of the invention can also be used in combination with other drugs of which it is necessary or advantageous to increase the bioavailability.
  • combinations of the hyaluronidase according to the invention with anticoagulant and/or fibrinolytic agents are particularly advantageous.
  • Such combinations may also possibly contain one or more steroidal or non-steroidal anti-inflammatory agents.
  • these compositions may be advantageously associated with sulphated hyaluronic acid, which is known to have, in addition to anti-inflammatory properties, also antithrombotic and anticoagulant properties.
  • associations of the hyaluronidase according to the invention with other active principles are advantageous also in the case of injectable preparations containing active principles with a particularly high molecular weight, for example monoclonal antibodies, cytokines, enzymes, DNA and drug carrier nanoparticles which are usually administered intravenously; this hyaluronidase allows the administration thereo subcutaneously, according to the so-called EASI (Enzymatically-Augmented Subcutaneous Infusion) procedure, that is used especially for the replacement of fluids in terminal patients, so as to restrict or avoid the nursing care.
  • EASI Enzymatically-Augmented Subcutaneous Infusion
  • Hyaluronidase according to the invention can also be used for the preparation of pharmaceutical compositions intended for the treatment of resistant solid tumors.
  • a further aspect of the invention relates to pharmaceutical compositions containing hyaluronidase in combination with one or more anticancer active ingredients, such as Vinca alkaloids (vinblastine, vincristine, vinorelbine) and taxanes (Paclitaxel) .
  • a further therapeutic use of hyaluronidase according to the invention relates to the use in the treatment of IgE- mediated allergic forms with EPD (Enzyme Potentiated Desensitization) , which consists in the administration of very low doses of allergens to desensitize individuals sensitive to them.
  • EPD Enzyme Potentiated Desensitization
  • a further object of the invention consists in pharmaceutical compositions containing hyaluronidase in association with one or more allergens that induce IgE-mediated allergic reactions.
  • Hyaluronidase is also used as a factor of diffusion of drugs for dental use in the treatment of oral diseases, such as local anaesthetics and antibiotics; therefore, according to a further aspect, the invention relates to pharmaceutical compositions containing hyaluronidase according to the invention in association with one or more local anesthetics or antibiotics.
  • hyaluronidase allows to greatly accelerate the treatment of spontaneous vitreous hemorrhages and can be used, alone or in combination with other active ingredients, in the preparation of pharmaceutical forms for ophthalmic use such as solutions, suspensions, gels, creams and ointments, intended for the treatment of such hemorrhages.
  • a disease that can be effectively treated with the hyaluronidase of the invention is bovine mastitis; in this case, the hyaluronidase can be administered in combination with antibiotics, such as Penicillin G, I-IV generation cephalosporins and enhanced amminopenicilline. Thanks to its stability in aqueous solution, the hyaluronidase according to the invention can be formulated in aqueous-based products; the choice between an aqueous-based formulation and an oil-based formulation can be made by a man. skilled in the art on the basis of common knowledge in the field of pharmaceutical technology, based on the other ingredients in the composition .
  • the present invention relates to the non-therapeutic use of hyaluronidase in a purified form and comprising the amino acid sequence shown in SEQ. ID. No. 21 or obtainable from Streptomyces koganeiensis ATCC 31394 or by the method above for cosmetic applications and/or for improving the aesthetic appearance.
  • Hyaluronidase is also used in cosmetics for the treatment of granulomatus reactions or incorrect, undesired collocations of hyaluronic acid, caused by fillers.
  • hyaluronidase a product based on hyaluronidase which can dramatically improve the fibrosis condition present in cellulite.
  • Hyaluronidase by segmenting the fibrotic component of cellulite, makes it softer with reduction of the orange peel effect, thus giving a more natural and pleasing appearance to the portion of skin treated.
  • hyaluronidase is appropriate for all those people who suffer from cellulite or with little presence of fat mass. And to date, it is the only real therapy capable of opposing cellulite with satisfactory results in aesthetic and/or therapeutic terms.
  • the present invention includes hyaluronidase as described above for the treatment and/or prevention of cellulite for both therapeutic and non-therapeutic purposes.
  • hyaluronidase according to the invention can be used as a reagent in biochemical assays for the qualitative/quantitative determination of hyaluronic
  • An embodiment of the present invention is described below in an example given for illustrative and not limiting purpose .
  • Example 1 Bacterial strain and culture conditions
  • the S. koganeiensis strain was obtained from American Type Culture Collection (ATCC 31394) .
  • the extracellular material was obtained from cells of the bacterium as previously described [9]. Briefly, a colony of the microorganism was transferred from ISP Medium 2 agar plates and grown in 500 ml of culture medium [ (20 g/1 of yeast extract (Organotechnie) and 5 g/1 of soya peptone (Solabia), at pH 6.9)] at 30 °C, STIRRING at 150 rpm for about 16 hours.
  • the culture' was used to inoculate a 20 liter fermenter (Biostat U, B.BRAUN) containing 10 liters of special soil [(10 g/1 of yeast extract (Organotechnie) , 5 g/1 peptone soybean (Solabia) , 3 g/1 of malt extract (Constantine) , 3 g/1 of dextrin type I (Sigma), 0.2 g/1 of antifoam (Sigma)].
  • yeast extract Organotechnie
  • Solabia peptone soybean
  • malt extract Constantine
  • dextrin type I Sigma
  • antifoam antifoam
  • the pH was brought to 7.0 with NaOH; during the fermentation, the pH was monitored but not controlled, and the temperature was maintained at 30 °C throughout the fermentation, while stirring was maintained at 300 rpm, with aeration of 1.6 VVM (liters of air/liter of fermentation medium/min) .
  • the fermentation had a duration of 48 h, time which coincided with the maximum production of hyaluronidase enzyme activity in the culture supernatant.
  • the culture was sampled daily to assess the growth, viability and concentration of the hyaluronidase produced in the culture supernatant by determination of the enzymatic activity by the Dorfman's method [10].
  • the cell density was determined by counting under a microscope, measuring the optical density at 600 nm and by counting the colonies on plates of ISP Medium 2 agar (Difco) .
  • RNA and DNA RNA and DNA
  • the culture was centrifuged at 5000rpm for 30 minutes at 4 °C (Sorvall Evolution RC) and filtered with 0.2 ⁇ tangential flow polyethersulfone filters so as to eliminate the biomass of Streptomyces oganeiensis (which was in the form of rounded hyphal aggregates of 1-4 mm diameter) and to obtain a clarified supernatant containing hyaluronidase . Subsequently, the supernatant was concentrated and dialyzed by tangential filtration as previously described [9] .
  • Example 2 Isolation in FPLC of autologous hyaluronidase
  • the concentrated and dialyzed supernatant was purified and enriched with hyaluronidase alone as previously described [9].
  • the isolation and characterization of the protein occurred using a proteomic approach supported by a process based on the use of a combination of ion-exchange chromatography columns (GE Healthcare), in sequence: CM-Sepharose FF, HiTrap Q XL and HiTrap SP FF, Resource Q.
  • the individual fractions eluted from the chromatographic columns were tested for their highest hyaluronidase activity using an enzymatic dosage and analyzed in parallel for their protein content by SDS-PAGE.
  • the hyaluronidase activity was measured with the modified Dorfman's method [10]. Briefly, the product obtained by the chromatographic process was diluted in 0.03M phosphate buffer, 0.82% NaCl, pH 6.3 and 1ml of the thus obtained solution was mixed with 1ml substrate buffer (0.03M phosphate buffer, NaCl 10.82%, pH 6.3) containing 0.5mg hyaluronic acid. The enzymatic digestion was carried out at 37 °C for 30 minutes and at the end of the incubation process, turbidity was generated by adding a 4ml horse serum-based acidic solution (SIGMA) .
  • SIGMA horse serum-based acidic solution
  • the optical density at 640 nm was measured exactly 30 minutes after the addition of the horse serum acidic solution.
  • a standard of hyaluronidase from mammal testicles (EDQM, FIP Hyaluronidase, H1115000) containing 328 IU/mg was used to construct a standard curve and the activity (in units) of the samples was calculated using this curve. Electrophoresis and analysis in SDS-PAGE.
  • the electrophoretic assays on polyacrylamide gel in the presence of sodium dodecyl sulfate (SDS-PAGE) were carried out using Laemmli's. method [11] on 12% polyacrylamide gel, using a Mini-PROTEAN 3 (BIO-RAD) according to the manufacturer's instructions.
  • the molecular weight of the purified protein was assessed by comparison with standard low molecular weight proteins (BIO-RAD) .
  • the N-terminal amino acid sequencing was carried out according to Edman's degradation method using an automated protein sequencer in pulsed liquid phase (ABI- Perkin Elmer Mod. ' 477A) .
  • the searches for homology were performed using the BLAST software (National Center for Biotechnology Information at the National Library of Medicine (Bethesda, MD) [28], the search server Broad Institute (http://www.broadinstitute.org/) and the ClustalW software (http://www.ebi.ac.uk/clustalw/).
  • the signalP http : //www . cbs . dtu . dk/services/SignalP-2.0/
  • Interproscan http : //www. ebi.ac.uk/Tools/pfa/iprscan/ ) were respectively used to conduct analysis of the signal peptide cleavage site and for the analysis of the protein domain .
  • the information concerning the primary structure of the isolated hyaluronidase were determined by sequencing the N-terminal portion of the entire protein and fragments obtained after digestion with trypsin, chymotrypsin, Glu- C and separation of the fragments produced by HPLC.
  • Example 4 Identification of the novel hyaluronidase gene
  • the gene encoding the hyaluronidase was isolated from the DNA from bacterial cells of Streptomyces koganeiensis. Briefly, the pellets of the bacterial cells from the fermentation in the period of exponential production of hyaluronidase (Fig. 1), are treated for the extraction and purification of genomic DNA using DNeasy Tissue Kit
  • RNA was extracted with RNeasy Mini Kit (Qiagen) .
  • a cDNA library was obtained starting from total RNA using MICROBExpress kit and Poly (A) Tailing kit (Applied Biosystems) to isolate mRNA (messenger RNA) from total RNA and the SMART RACE cDNA Amplification Kit
  • PCR products were analyzed by electrophoresis in agarose gel. Given the homology between the nucleotide sequences of S. koganeiensis and S.pristinaespiralis, attention was paid to the non-coding regions flanking the gene being analyzed.
  • oligonucleotides used are the following:
  • a pair of primers designed on the non-coding sequences forward: 5 1 -accattcggagttgatcgttg-3 ' (SEQ ID NO: 14) Reverse: 5' -gtcaactgcactgttctctc-3 ' (SEQ ID NO: 15)
  • flanking the entire gene encoding the hyaluronidase are used for the amplification of the entire gene.
  • the PCR product obtained whose sequence obtained after sequencing (SEQ ID NO: 16) is shown in (fig.
  • BLAST software was used for conducting homology searches on the GenBank database. While the software ExPASy Translate Tool, available on the web, was used to allow the translation in silico of the nucleotide sequence of the isolated gene encoding the hyaluronidase from S. koganeiensis in the protein sequence. Finally, the conserved domain for the hyaluronidase activity was verified by the InterProScan software available on the website (http://www.ebi.ac.uk/Tools/InterProScan/) (Fig. 7 (a) ) . From the results obtained it was observed that the entire length of the gene encoding the hyaluronidase from S.
  • koganeiensis was of 744 bp (SEQ ID NO: 17) and the length of the peptide sequence was estimated to be 247 amino acids (SEQ ID NO: 18) .
  • the gene contains a putative domain (SEQ ID NO: 19) of proteins belonging to hyaluronidase family (Hyaluronidase_l ) , as evidenced by the search for homologies on the Pfam database.
  • dk/services/SignalP-1.1/ indicated the presence of a signal sequence (signal peptide) of 30 amino acids (amino acids 1 to 30 (SEQ ID NO: 47), with the cleavage site between amino acid 30 and 31) .
  • the mature protein (SEQ ID NO: 21) then is 217 amino acids long (corresponding to the nucleotide sequence 651bp (SEQ ID NO: 22)) and its molecular weight is predicted (using the tools available on the site http://web.expasy.org/compute_pi/) is 21679.96 Da.
  • BLAST analysis for sequence homologies shows homology between the amino acid sequence determined for the hyaluronidase S.
  • a sequence homology was present between a region of the sequence (SEQ ID NO: 27 and SEQ ID NO: 52) of hyaluronidase from S. koganeiensis according to the invention and one of the modules present in the amino acid domain of murine Cd44 that binds hyaluronic acid
  • the cDNA encoding the hyaluronidase from S. koganeiensis was amplified by PCR starting from the plasmid pCR-Bluntll-TOPO [sk_HYAL] extracted and purified from cells of E.coli with DNA Purification System Wizard Plus SV Minipreps and using the following primers: sense
  • the PCR cycles performed for the amplification were: initial denaturation 96 °C for 5 minutes; 30 cycles of annealing 55 °C for 30 seconds, extension at 72 °C for 1 minute, and following denaturation 96 °C for 40 seconds.
  • the Taq DNA polymerase used for the amplification was DyNAzyme II DNA Polymerase
  • the colonies obtained were analyzed to verify the correct ligase occurred between the hyaluronidase gene fragment and the vector by PCR (initial denaturation at 94 °C for 5 minutes, for 30 cycles: annealing at 55 °C for 30 seconds, extension at 72 °C for 60 seconds, and following denaturation at 94 °C for 1 minute) , thanks to the aid of vector-specific primers (Forward: 5'- TGTGGAATTGTGAGCGGATA -3' (SEQ ID NO: 30), Reverse: 5'- TTTCAACCATTTGTTCCAGGT - 3' (SEQ. ID NO:31)).
  • the sequence of the PCR product is sequenced.
  • the nucleotide sequence obtained (SEQ ID NO: 38) after sequencing (Fig. 13, a) is analyzed using bioinformatics tools such as ClustalW, Traslate (ExPASy) and Chromas life.
  • the cDNA encoding the hyaluronidase from S. koganeiensis was amplified by PCR starting from the plasmid pCR-Bluntll-TOPO [sk_HYAL] extracted and purified from cells of E.coli with DNA Purification System Wizard Plus SV Minipreps and using the following primers: sense (5'- tggCCATGGCCGGGGAGAACGGCGCGACGACGA-3' (SEQ ID NO: 32)); antisense (5'- ctcGAATTCtcaCGCCGGTGCGATCGTCGTGACC- 3' (SEQ ID NO : 33)).
  • PCR cycles performed for the amplification were: initial denaturation at 96 °C for 5 minutes; 30 cycles of annealing at 55 °C for 30 seconds, extension at 72 °C for 1 minute, and following denaturation at 96 °C for 40 seconds.
  • the Taq DNA polymerase used for the amplification was DyNAzyme II DNA Polymerase (Finnzymes) (Fig. 8).
  • the amplified product (671bp) was purified by the Kit Wizard SV Gel and PCR Clean-Up System (Promega) , digested with Ncol (BioLabs) and EcoRI (BioLabs) , and ligated using T4 ligase (Ambion) with the vector pET22b (+) previously digested with Ncol and EcoRI(Fig. 8). Once the ligase took place, the vector was transformed into E. coli strain DH5a cells
  • the cDNA encoding the hyaluronidase from S. koganeiensis was amplified by PCR starting from the plasmid pCR-BluntII-TOPO [sk_HYAL] extracted and purified from cells of E.coli with DNA Purification System Wizard Plus SV Minipreps and using the following primers: sense (5 ' -ataCATATGGCCGGGGAGAACGGCGCGACGACGA-3' (SEQ ID NO:36)); antisense (5' -ctcGAATTCtcaCGCCGGTGCGATCGTCGTGACC-3 ' (SEQ ID NO : 37)).
  • PCR cycles performed for the amplification were: initial denaturation at 96 °C for 5 minutes; 30 cycles of annealing at 55 °C for 30 seconds, extension at 72 °C for 1 minute, and following denaturation 96 °C for
  • the Taq DNA polymerase used for the amplification was DyNAzymeTM II DNA Polymerase (FINNZYME) (Fig. 8).
  • the amplified product (672bp) was purified by the Kit Wizard SV Gel and PCR Clean-Up System (Promega), digested with Ndel (BioLabs) and EcoRI (BioLabs) , and ligated using T4 ligase (Ambion) with the vector pET21b (+) (Novagen) previously digested with Ndel and EcoRI (Fig. 8) . Once the ligase took place, the vector was transformed inside E. coli strain DH5a cells (Invitrogen code 12297-016) by chemical processing.
  • the cells after transformation are plated in LB agar containing ampicillin (50 g/ml) and incubated at 37 °C for 16h.
  • the colonies obtained were analyzed to verify the correct ligase occurred between the hyaluronidase gene fragment and the vector by PCR (initial denaturation at 94 °C for
  • Example 8 Host bacterial strains used for cloning and the expression of the hyaluronidase gene from S. koganeiensis.
  • Escherichia coli strain DH5a (Invitrogen, Genotype: F- cp801acZAM15 ⁇ (lacZYA-argF) U169 recAl endAl hsdRl7 (rk-, mk+) phoA supE44 thi-1 gyrA96 relAl tonA (confers resistance to phage Tl) [22], was used as host for the plasmid amplification of the cloning system. This strain is provided by Invitrogen (One Shot Max Efficiency DH5a- T1R chemically competent E.coli, 12297-016).
  • the cells were thawed and cultured in solid medium LB agar (lOg/1 peptone from casein, 5g/l yeast extract, lOg/1 NaCl, 15g/l bacteriological agar) containing 10 mM MgS04 and grown for 18h at 37 °C. From the resulting culture, a single colony is taken and grown in TYM broth (tryptone 20g/l, Yeast Extract 5g/l, 20ml 5M NaCl, 1 mM MgS04) at 37 °C. From the culture, the resulting cells are chemically treated to obtain chemically competent cells. The cells obtained are portioned and stored at -80 °C in an appropriate storage buffer containing 15% glycerol. The transformations are carried out on this stock of aliquots .
  • B.subtilis WB800N (Genotype: nprE aprE epr bpr mpr :: ble nprB :: bsr . vpr wprA :: hyg cm :: neo; NeoR [23]), provided by MOBITEC, is a gram-positive bacterial strain characterized by a deficit of eight proteases, as a result it is a bacterial strain that is used for the production of secreted heterologous proteins.
  • the neomycin resistance gene was also inserted in this gene, taking the nomenclature of WB800N.
  • the cells of this bacterial strain after an appropriate production were made competent, portioned and stored at -80 °C in an appropriate storage buffer containing 15% glycerol. The transformations are carried out on this stock of aliquots .
  • Escherichia coli strain MG1655 (ATCC number: 12297-016, Genotype: F-lambda- [24 , 25] ) , was used as a host in the expression system of the hyaluronidase gene from S. koganeiensis .
  • the bacterial strain is provided by the American Type Culture Collection (ATCC) .
  • the freeze-dried cells were first cultured in few ml of liquid medium and then in solid medium LB agar (lOg/1 peptone from casein, 5g/l yeast extract, lOg/1 NaCl) containing 10 mM MgS04 and grown for 18h at 37 °C.
  • a single colony is taken and grown in TYM broth at 37 °C.
  • the resulting cells are chemically treated to obtain chemically competent cells.
  • the cells obtained are portioned and stored at -80 °C in an appropriate storage buffer containing 15% glycerol. The transformations are carried out on this stock of aliquots .
  • Escherichia coli strain BL21 (DE3) (E. coli BF-dcm ompT HSDS (rB - mB-) gal ⁇ (DE3) [26, 27]), was used as host for the expression system of the gene encoding the hyaluronidase from S. koganeiensis .
  • the bacterial strain is provided by Novagen with code 69450-3. The cells were first cultured in few ml of liquid medium and then in solid medium LB agar (lOg/1 peptone from casein, 5g/l yeast extract, lOg/1 NaCl) containing 10 mM MgS04 and grown for 18h at 37 °C.
  • a single colony is taken and grown in TYM broth at 37 °C.
  • the resulting cells are chemically treated to obtain chemically competent cells.
  • the cells obtained are portioned and stored at -80 °C in an appropriate storage buffer containing 15% glycerol. The transformations are carried out on this stock of aliquots .
  • Example 9 Transformation of plasmids pHTsk_HYAL, pHyal_sk and pHyal_sk_SL in expression cells.
  • DH5a cells respectively containing the vectors pHTsk_HYAL, pHyal_sk and pHyal_sk_SL were put in culture in about 6ml of LB broth with ampicillin (50 ⁇ g/ml) and. grown for 16-18h. The respective cultures after the growth of the engineered cells are centrifuged at approximately 5000g for 10 minutes.
  • the respective plasmids pHTsk_HYAL, pHyal_sk and pHyal_sk_SL were extracted and purified from the pellet obtained using the kit Wizard Plus SV minipreps DNA Purification System (Promega).
  • the purified vectors pHTsk_HYAL, pHyal_sk and pHyal_sk_SL are separately transformed in expression cells.
  • the first vector is transformed into cells, made competent, of Bacillus subtilis (WB800N- OBITEC) while the other two vectors are transformed into cells, made competent, of E. coli, strain BL21 (DE3) and/or MG1655. All transformations were carried out by chemical processing [13].
  • the cells of B.subtilis and E.coli after transformation, respectively, are plated in LB agar containing chloramphenicol ( ⁇ ) plus neomycin ( ⁇ ), and in LB agar containing ampicillin (5C ⁇ g/ml) to develop resistance to the antibiotic, and incubated at 37 °C for 16h.
  • the sequence of the PCR products is sequenced.
  • the nucleotide sequence obtained after sequencing is analyzed using bioinformatics tools such as Vector NTI Advance 9 ( Invitrogen) , ClustalW, Traslate (ExPASy) and Chromas life. (Fig. 13 a,b,c).
  • Example 10 Assessment of the expression level of the recombinant hyaluronidase .
  • the clones of B.subtilis found to be positive for the presence of vectors containing the nucleotide fragment of hyaluronidase found genetically with the frame sequence for correct expression (SEQ ID NO: 41) are tested for the expression level, and then the cells thus engineered are inoculated into flasks containing 500 ml. of LB broth with chloramphenicol (10 ⁇ , Sigma) and neomycin (10 ⁇ , Sigma) , and incubated at 37 °C at 250 rpm. When the cell growth value reaches OD600nm 0.8, they are brought with IPTG (Sigma, 16758) to a final concentration of ImM. After 12 hours of induction, the bacterial culture is centrifuged at 7500 rpm for 10 minutes and the culture supernatant is collected to evaluate the expression in B. subtilis .
  • the expressed recombinant had a molecular weight of about 24 kDa with the maximum expression after induction with 1 mM IPTG at OD600nm 0.8 after 12 hours at 37 °C.
  • Example 11 Assessment of the expression level of recombinant hyaluronidase in E.coli
  • the clones of E.coli found to be positive for the respective presence of vectors containing the nucleotide fragment of hyaluronidase found genetically with the frame sequence (SEQ ID NO: 41) for the correct expression (SEQ ID NO: 21) are tested for the expression level, inoculated into flasks containing 500 ml of LB broth with ampicillin (50 g/ml, Sigma) and incubated at 37 °C at 250 rpm. When the cell growth value reaches OD600nm 0.8, they are brought with IPTG (Sigma, 16758) to a final concentration of ImM. The bacterial cells are harvested after. 3-4 hours of induction, by centrifugation at 7500 rpm for 10 minutes. After centrifugation, the bacterial pellet is collected for the assessment of the expression in engineered cells of E. coli and to verify in what portion of the cell the recombinant is produced.
  • E.coli BL21 (DE3) containing pHyal_sk.
  • the expressed recombinant has a molecular weight of about 24 kDa, constituting about 40% of the total bacterial proteins after induction at OD600nm 0.8 with ImM IPTG for 3-4 hours at 37 °C.
  • 18% only 18.2% overall
  • the periplasmic soluble portion turns out to be present at a maximum concentration of 52 ⁇ g/ml culture, with an enzymatic activity equal to about 2100 U/ml culture.
  • E.coli BL21 (DE3) containing pHyal_sk_SL.
  • the expressed recombinant has a molecular weight of about 24 kDa, constituting about 15% of the total bacterial proteins after induction at OD 600 nm 0.8 with lm IPTG for 3-4 hours at 37 °C.
  • all the expressed protein is present in soluble form in the periplasm.
  • the periplasmic soluble portion turned out to be present at a concentration of about 125pg/ml culture, with an enzymatic activity greater than 5000 U/ml culture.
  • MBC Master Cell Bank
  • strain B. subtilis WB800N-MoBitec
  • strain E.coli DH5a
  • strain E.coli DH5a
  • strain E.coli DH5
  • E.coli BL21 (DE3)
  • strain E.coli DH5a
  • E.coli BL21 ( DE3)
  • strain E.coli DH5a
  • E.coli BL21 ( DE3)
  • strain E.coli DH5a
  • E.coli BL21 ( DE3 )
  • strain E.coli (DH5a) and E.coli BL21 ( DE3 )
  • strain E. ( DH5a) and E.coli BL21 ( DE3 )
  • strain E. ( DH5a) and E.coli BL21 (DE3)
  • plasmid engineered with pRH_sk plasmid engineered with pRH_sk (clone 600) .
  • strain B. subtilis (WB800N-MoBitec) containing the plasmid engineered with pHTsk_HYAL (rhyaluronidase clone 105)
  • E.coli BL21 (DE3)
  • pHyal_sk hyaluronidase clone 413
  • Example 13 Batch fermentations of recombinant hyaluronidase .
  • the inoculum is prepared by inoculating a vial (from the working cell bank stored at -80 °C) in 400 ml of fresh LB medium (ratio 1/20 with respect to the fermentation volume) containing 5C ⁇ g/ml ampicillin and incubated at 37 °C at 150 rpm for 16-18 hours.
  • the clones from the respective inocula (E.coli BL21 ( DE3 ) -pHyal_sk and BL21 (DE3) - pHyal_sk_SL) , were separately grown in the fermenter on a minimum culture medium whose composition per liter was given by: 2g Na 2 HP0 4 *2H 2 0, 2 g KH2PO4, 4g K2HPO4, 3.8 g citric acid, 3.3g (NH 4 ) 2 SC>4, 40 ml glycerol, 0.6 ml PPG 2000 antifoam (Fluka Code 81380).
  • the pH was corrected after sterilization at 121 °C to 6.8 with a 25% solution of ammonium hydroxide % (SIGMA) , and only adding the following components per liter of medium, sterilized by filtration through 0.2pm filters: 0.49 g MgS0 4 *7H 2 0, 0.0147g CaCl 2 , 1ml FeC12 (0.2M), 2ml trace elements (trace elements per liter: 0.96g citric acid, 0.25g CoC12*6H20, 1.5g MnCl 2 *4H 2 0, 0.15g CuCl 2 *2H 2 0, 1.5 g H3BO3, 0.25g Na 2 Mo0 4 *2H20, 1.3 g Zn (CH3COO) 2 *2H 2 0) , O.Olg thiamine, 5g glucose, 3g yeast extract.
  • SIGMA ammonium hydroxide %
  • IPTG Isopropyl ⁇ -D-l-thiogalactopyranoside
  • the bacterial cells are harvested after the induction period of about 16 hours by centrifugation at 7500 rpm for 25 minutes. After collection, the bacterial cells are stored at -80 °C, ready to be used for the extraction and purification o recombinant hyaluronidase.
  • the recombinant protein expressed by E. coli, in the different fermentation parameters, is analyzed by electrophoresis run in SDS-PAGE (12%) after staining with Cooraassie Brilliant Blue G-250 (BIO-RAD, 161-0406), while the enzyme activity is analyzed by turbidimetric assay [ 16] .
  • the cells of E.coli BL21 (DE3) transformed with the vector pHyal_sk are induced to express the soluble heterologous protein in the periplasm, in the fermenter with 8L of medium.
  • the expressed recombinant had a molecular weight of about 24 kDa and an amount of protein expressed in the cell periplasm of about 0.1 - 0.15 g/L of culture, the maximum quantity reached after 16 hours of induction with ImM IPTG at 37 °C.
  • the cells of E.coli BL21 (DE3) transformed with the vector pHyal_sk_SL are induced to express the soluble heterologous protein in the periplasm, in the fermenter with 8L of medium.
  • the periplasmic soluble portion turned out to be present at a concentration of about 0.35-0.5g/L culture, with an enzymatic activity greater than 15050- 21495 U/ml culture.
  • the recombinant expressed had a molecular weight of about 24 kDa, constituting about 18% of the total bacterial proteins, after induction with ImM IPTG at the sixteenth hour at 37 °C.
  • the stability of the plasmid during fermentation was found to be 100% (Table 2) .
  • the stability of the plasmid is monitored until the end of the fermentation by screening with the replica plating technique [29] which allows replication of the colonies on plates containing the antibiotic.
  • Example 14 Fed-batch fermentations of recombinant hyaluronidase .
  • the ability of clones of E.coli BL21 (DE3) - pHyal_sk and BL21 (DE3)- pHyal_sk_SL to produce the recombinant hyaluronidase was evaluated by growth in fermenters by fed-batch culture.
  • the inoculum is prepared by inoculating a vial (from the working cell bank stored at -80 °C) in 500 ml of fresh LB medium (ratio 1/20 with respect to the fermentation volume) containing 50 ⁇ g/ml ampicillin and incubated at 37 °C at 150 rpm for 16-18 hours.
  • the clones from the respective inocula E.coli BL21 ( DE3 ) -pHyal_sk and BL21 (DE3) - pHyal_sk_SL) , were separately .
  • the pH was corrected after sterilization at 121 ⁇ °C to 6.8 with a 25% solution of ammonium hydroxide % (SIGMA), and., only after having added the following components per liter of medium, sterilized, by filtration through 0.2 ⁇ filters: 0.49g MgS0 4 *7H 2 0, 0.0147g CaCl 2 , 1ml FeCl 2 (0.2M), 2ml trace elements (trace elements per liter: 0.96g citric acid, 0.25g CoCl 2 *6H20, 1.5g MnCl 2 *4H 2 0, 0.15g CuCl 2 *2H 2 0, 1.5g H3BO3, 0.25g N.a 2 Mo0 4 *2H 2 0, 1.3g Zn (CH3COO) 2*2H 2 0) , O.Olg thiamine, 5g glucose, 3g yeast extract.
  • SIGMA ammonium hydroxide %
  • the feed is given 6 hours after inoculation until the nineteenth hour with an exponential ratio of addition.
  • the choice to use glycerol as a carbon source is due to the fact that the expression cells of E. coli used generate acetic acid (acetate) as an undesired by-product that has numerous adverse effects on the production of recombinant proteins [14].
  • the cells of E.coli produce acetic acid as an extracellular co-product of the aerobic fermentation, the rate of formation of acetate is directly related to the rate at which the cells grow or to the rate at which they consume the solid substrate as a carbon source, glucose.
  • the growth rate of the culture is determined by the speed of feeding of the "glucose” limiting nutrient resulting in cell growth above the threshold which leads to a consequent production of acetate and thus to a reduction of expression of recombinant proteins.
  • the glycerol can be given to fermentation also after induction with IPTG, allowing the reduction not only of the formation of acetate but also the increase of the soluble formation of recombinant hyaluronidase. Furthermore, the low cost of glycerol compared with glucose makes it preferential as a carbon source for the fermentation of E. coli, in the industrial field.
  • IPTG Isopropyl ⁇ -D-l- thiogalactopyranoside
  • IPTG Isopropyl ⁇ -D-l- thiogalactopyranoside
  • IPTG Isopropyl ⁇ -D-l- thiogalactopyranoside
  • IPTG Isopropyl ⁇ -D-l- thiogalactopyranoside
  • the induction started 24 hours after inoculation and continued for 12 hours.
  • the fermentation parameters developed are as follows: temperature 37 °C, agitation 600rpm, .air flow 5-10 liters air per minute and head pressure of about 0.8 bar.
  • the bacterial cells are harvested after the induction period of 12 hours by centrifugation at 7500 rpm for 25 minutes. After collection, the bacterial cells are stored at -80 °C, ready to be used for the extraction and purification of the recombinant hyaluronidase.
  • the recombinant protein expressed by E. coli, in the different fermentation parameters, is analyzed by electrophoresis run in SDS-PAGE (12%) after staining with Coomassie Brilliant Blue G-250 (BIO-RAD, 161-0406), while the enzyme activity is analyzed by turbidimetric assay [ 16] . .
  • the cells of E.coli BL21 (DE3) transformed with the vector pHyal_sk are induced to express the soluble heterologous protein in the periplasm, in the fermenter with 10L of medium.
  • the recombinant expressed had a molecular weight of about 24 kDa and an amount of protein expressed in the periplasm of about 0.4 g/L of culture, the maximum quantity reached after 6 hours of induction with ImM IPTG at 37 °C ( Figure 14).
  • the cells of E.coli BL21 (DE3). transformed with the vector pHyal_sk_SL are induced to express the soluble heterologous protein in the periplasm, in the fermenter with 10L of medium.
  • the periplasmic soluble portion turned out to be present at a concentration of about 1.2 g/L culture, with an enzymatic activity greater than 48000U/ml culture.
  • the recombinant expressed had a molecular weight of about 24 kDa, constituting about 16-18% of the total bacterial proteins, after induction with ImM IPTG at the twelfth hour at 37 °C ( Figure 15 ) .
  • Example 15 Fedbatch fermentation of E.coli BL21 (DE3) transformed with the vector pHyal_sk_SL on 20L medium. Briefly, the cells of E.coli BL21 (DE3) transformed with the vector pHyal_sk_SL are induced to express the soluble heterologous protein in the periplasm, in the fermenter with 20L of medium. The periplasmic soluble portion was found to be present at a concentration of about 2g/L of culture (Table 2) with an enzymatic activity greater than 87000U/ml culture (7.5 xl07-8, 7x107 IU/1 of culture), approximately 670-750 times higher compared to the autologous hyaluronidase produced in the fermenter as described in the above patent [9].
  • the expressed recombinant had a molecular weight of about 24 kDa, constituting about 16-18% of the total bacterial proteins, after induction with lmM IPTG at the twelfth hour at 37 °C.
  • the stability of the plasmid is monitored until the end of the fermentation by screening with the replica plating technique [29] which allows replication of the colonies on plates containing the antibiotic .
  • Example 16 Analysis of recombinant hyaluronidase activity in the fermentation broth
  • the pellet was obtained after centrifugation at 7500 RPM centrifuge (Eppendorf centrifuge 5402, rotor F-45-18-11) for 10 minutes.
  • the cell pellet was resuspended in 500 ⁇ 1 of B-PER Bacterial Protein Extraction Reagent (PIERCE) and mixed by vortexing (Heidolph Reax top) at maximum speed for about 1 minute or until complete resuspension of the pellet.
  • the suitably resuspended pellet was centrifuged at 13000 RPM for 10 minutes to separate the soluble proteins from insoluble proteins.
  • the collected supernatant (soluble proteins) was tested for the presence of hyaluronidase activity using the turbidimetric method described by Di Ferrante [16] modified for analysis on 96-well plates. Briefly, for single well, 31 ⁇ 1 of incubation buffer [17], 8 ⁇ 1 of BSA (0.2 mg/ml) , 8 ⁇ 1 of hyaluronic acid (2mg/ml) , 13 ⁇ 1 of H2O and ⁇ of the supernatant (soluble proteins) diluted 10, 100 and 1000 times with lx PBS (Sigma-P4417 ) , were set up. The plate is incubated at 37 °C for an hour.
  • CTAB alkaline solution (2.5% (w/v) in 0.5 M NaOH) were added to each well to precipitate the undigested hyaluronic acid and the plate is incubated for 20 minutes at room temperature. The extent of precipitation was measured at an optical density of 640nm.
  • a Hyaluronidase standard (FIP) was used to construct a standard curve and the activity of the recombinant hyaluronidase in the periplasmic portion was calculated using this curve.
  • the pellet is resuspended, with the dispersion solution, under magnetic stirring for 15 minutes at room temperature and subsequently for about 1 hour at 5°C, using a magnetic stirrer Heidolph type MR2002 at a speed of 500rpm.
  • the resuspended pellet is added cold in a 4.5L solution for osmotic shock (1.2g/L TRIS, 4ml/L HC1 2N, 0. lg/L MgC12) for the extraction of the periplasmic protein.
  • the mixture obtained is stirred for 4 hours at 4°C, using a magnetic stirrer Heidolph type MR2002 at a speed of 500rpm.
  • the product obtained containing the dispersed E.coli cells was centrifuged at 5°C for 45 minutes at speeds of about 7500rpm using a Sorval Evolution Rc centrifuge with SLC-6000 rotor. After centrifugation, the supernatant is collected while the pellet is eliminated. At this point, the supernatant was homogenized using the "Ultra Turrax" system with speed level 2 for 15 seconds.
  • Second method Once equilibrated, the pellet was treated with the 500 ml B-PER Bacterial Protein Extraction Reagent ( PIERCE) solution for the release of the periplasmatic proteins in the medium.
  • the pellet is resuspended, with the B-PER solution, under magnetic stirring for 30 minutes at room temperature and subsequently for further 30 minutes at 5°C, using a magnetic stirrer Heidolph type MR2002 at a speed of lOOOrpm. After about 1 hour the resuspended pellet is centrifuged at 5°C for 45 minutes at a speed of about ll,000rpm using a Sorval Rc-5B centrifuge with Sorvall rotor.
  • PIERCE Bacterial Protein Extraction Reagent
  • the resins and the chromatographic columns were purchased from GE Healthcare Life Sciences and maintained according to the manufacturer's specifications. The balance and elution steps were carried out with a Fast Performance Liquid Chromatography (FPLC; AKTA explorer 100, GE Healthcare) system at a flow of 40-50ml/min for all 3 chromatographies. At the end of each chromatographic step the hyaluronidase activity was controlled with the modified Dorfman's assay described [9]. Once the soluble fraction is extracted from the periplasmic portion, it is loaded on the first strong ion-exchange chromatography. Strong ion-exchange chromatography (Q sepharose XL) :
  • the filtered extract brought to 50mM Tris-HCl and pH 8 was loaded on 500ml-600ml Q sepharose XL resin (GE Healthcare) packed in a XK-50 (GE Healthcare) column and equilibrated with 8 bed volumes (BVs) of Tris-HCl buffer at pH 8. After loading, the column was washed, first with 3 BVs of the same buffer and subsequently with 8 BVs of Tris-HCl buffer at pH 8 with 40mM NaCl, then the bound proteins were eluted with 5 BVs of a Tris-HCl buffer solution at pH 8 with llOmM NaCl . The eluted proteins were collected in a single fraction having a volume of about 950 ml and subjected to hyaluronidase activity assay.
  • CM- Sepharose® Fast Flow Diafiltration and weak ion-exchange chromatography
  • the fraction obtained is concentrated to 100ml using the tangential ultrafiltration Labscale TFF System (Millipore) and using Polyethersulfone (PES) filters with cut-off comprised between 3 and 8kDA, preferably of 5kDa.
  • the sample is diluted 10 times with 50mM sodium acetate buffer at pH 4.
  • the fraction thus obtained was loaded on 300ml-400ml CM-Sepharose® Fast Flow resin (GE Healthcare) , packed on a XK-50 column (GE Healthcare) and equilibrated with 6 bed volumes (BVs) of 50mM sodium acetate buffer at pH 4.0.
  • the column was washed with 3 BVs of the same buffer, then the bound proteins were eluted with 8 BVs of a 50mM sodium acetate buffer solution at pH 4.5.
  • the eluted proteins were collected in a single fraction having a volume of about 380 ml and subjected to hyaluronidase activity assay. Diafiltration and aromatic hydrophobic interaction chromatography ( Phenyl-Sepharose HP) .
  • the fraction obtained and positive to the enzymatic dosage is concentrated to 100ml using the tangential ultrafiltration Labscale TFF System (Millipore) and using Polyethersulfone (PES) filters with cut-off comprised between 3 and 8kDA, preferably of 5kDa.
  • the sample is diluted 10 times with 50mM sodium phosphate buffer with 1.5M ammonium sulphate, pH 7.
  • the fraction thus obtained was loaded on 300ml-400ml Phenyl-Sepharose HP resin (GE Healthcare) , packed on a XK-50 column (GE Healthcare) and balanced with 8 bed volumes (BVs) of 50mM sodium phosphate buffer with 1.5M ammonium sulphate, pH 7.
  • the column was washed with 3 BVs of the same buffer, then the bound proteins were eluted with 5 BVs of a 50mM sodium phosphate buffer solution with 0.8M ammonium sulphate, pH 7.
  • the eluted proteins were collected in a single fraction having a volume of about 730 ml and subjected to hyaluronidase activity assay.
  • the eluted fraction was subjected to ultrafiltration and dialysis with 10 volume lx PBS (SIGMA-P4417) , using Polyethersulfone (PES) filters with cut-off comprised between 3 and 8kDA, preferably of 5kDa, brought to a concentration of about lmg/ml and filtered with 0.2 ⁇ filters (protein concentration is determined by BCA Protein Assay Reagent Kit, PIERCE).
  • PES Polyethersulfone
  • the hyaluronidase activity was measured with the modified Dorfman's method [10]. Briefly, the product obtained by the different steps of the process was diluted in 0.03M phosphate buffer, 0.82% NaCl, pH 6.3 and 1ml of the thus obtained solution was mixed with 1ml substrate buffer (0.03M phosphate buffer, NaCl 10.82%, pH 6.3) containing 0.5mg hyaluronic acid. The enzymatic digestion was carried out at 37 °C for 30 minutes and at the end of the incubation process, turbidity was generated by adding a 4ml horse serum-based acidic solution (SIGMA). The optical density at 640 nm was measured exactly 30 minutes after the addition of the horse serum acidic solution.
  • SIGMA horse serum-based acidic solution
  • the electrophoretic assays on polyacrylamide gel in the presence of sodium dodecyl sulfate (SDS-PAGE) were carried out using Laemmli's method [11] on 12% polyacrylamide gel, using a Mini-PROTEAN 3 (BIO-RAD) according to the manufacturer's instructions.
  • concentration and the molecular weight of the hyaluronidase in the fermentation product and in different purification steps were estimated by comparison with standard low molecular weight proteins (GE Healthcare) .
  • the N-terminal amino acid sequencing was carried out according to Edman's degradation method using an automated protein sequencer in pulsed liquid phase (ABI- Perkin Elmer Mod. 477A) .
  • BLAST software [18] was used to conduct homology research in the GenBank database and in that of the human genome project of the Streptomyces species available on the web.
  • the fractions, obtained by the purifications of the E.coli strain transformed with the pHyal_sk vector and the E.coli strain transformed with the pHyal_sk_SL vector according to the invention, were subjected to SDS-PAGE electrophoresis on 12% gel, as described above, then to blotting on polyvinylidene difluoride membrane (BIO-RAD) and stained according to the manufacturer's instructions.
  • the band relating to hyaluronidase for both productions was separated with a scalpel, trying to obtain a piece as small-sized as possible (3mm x 10mm) and was loaded in the reaction chamber of the sequencer
  • the sequencing of the N-terminal end allows to determine that the two recombinant hyaluronidases produced and coming from two used different genetic engineering and expression systems, contain differences in the N-terminal amino acid sequence.
  • the assay provided chromatograms in which a single N-terminal amino acid sequence was significantly present, allowing to reconstruct the test sequence reported hereinafter: AGENGA (SEQ ID NO: 42).
  • AGENGA SEQ ID NO: 42.
  • the above-mentioned experimentally determined sequence corresponds to the N- terminus of the protein isolated in its autologous form described by [9] free from methionine at position 1.
  • the assay instead detected the presence of at least two N-terminal amino acid sequences, reported hereinafter is the listing of the N-terminal amino acids detected by the sequencing: Most represented sequence MAGENGA (SEQ ID NO: 43) which corresponds to the N-terminus of the mature protein with methionine at position 1, and a less represented sequence AQPAMAMAGENGA (SEQ ID NO: 44) which corresponds to the partially mature protein (contains sequence AQPAMAM (SEQ ID NO: 45) belonging to the signal peptide apparently not totally deprived of the protein by the cell system) .
  • the enzymatic potential of the hyaluronidase according to the invention was assessed by comparison with the enzymatic activity of the autologous hyaluronidase [9], using the enzymatic assay described [9] and the activity value is reported to be in both cases greater than 4xl0 4 IU/mg (the protein concentration was determined by BCA Protein Assay Reagent Kit, PIERCE) .
  • hyaluronidase according to the invention in particular of the form coming from the E.coli strain engineered * with the pHyal_sk_SL plasmid, has the same activity as the autologous form.
  • Circular dichroism (CD) experiments Spectra at the Far- UV circular dichroism were collected at room temperature on a Jasco spectropolarimeter J-715 model, with quartz cell having path length of 1 millimeter. Other test settings were: scan speed, lOnm/min, sensitivity, 50 MDEG, time constant:, 16s, bandwidth, 3nm.
  • the circular dichroism measurements were conducted on protein solutions (autologous hyaluronidase, recombinant hyaluronidase according to the invention) at concentration of 2,10 ⁇ 6 M. All the samples were diluted at a final concentration of 2,10 ⁇ 6 M using ultra-pure water.
  • the CD spectra were collected at 260-195nm blank corrected and adjusted for dilution.
  • the circular dichroism spectra are reported in Figure 17.
  • the overlay files match: the lower , line corresponds to the autologous hyaluronidase [9] and the upper one corresponds to the heterologous hyaluronidase according to the invention.
  • the two spectra have a superposable profile, confirming the same structure for both the samples (Fig. 17-a) .
  • the small difference which is noted may be attributed to the not perfect coincidence of the concentrations of the two solutions.
  • the recombinant hyaluronidase sample does not show aggregation. From this study it may be inferred that the preparation according to the invention has a secondary structure very similar to that of the autologous hyaluronidase [9] and that the protein produced according to the present invention does not show aggregation (Fig. 17-b) .
  • the mass spectrometry assays for determining the molecular weight were conducted using Quattro micro mass spectrometer (Waters), while the assay of peptide mapping to confirm the identity of the primary structure of the recombinant portion was carried out using the accurate mass values of the peptides determined by means of the MALDI-MS Voyager DE-PRO system (Applied Biosystems, Firmingham MA, USA) after separation in RP-HPLC.
  • the fraction obtained after purification of recombinant hyaluronidase according to the invention was subjected to digestion with trypsin, after separation in RP-HPLC, the peptide mixture produced for each sample was analyzed by MALDI-MS in reflector mode.
  • the study and interpretation of the MALDI spectra acquired therefore respectively allowed verifying 97% identity of the primary structure of the reference amino acid sequence [9] and over 94% identity of the primary structure of the theoretical amino acid sequence according to the invention (peptide sequence predicted by http://web.expasy.org/translate/) with the amino acid sequence of the sample produced according to the invention (SEQ ID NO: 21) .
  • the protein fraction to be analyzed (recombinant hyaluronidase obtained according to the invention) is mixed in a suitable loading buffer and loaded onto IPG strips at pH 3-10 (ReadyStrips 7cm, BIO-RAD) ; incubation is performed at 25°C until absorption of the sample and the strip is loaded onto the PROTEAN IEF Cell (BIO-RAD) for isoelectric focusing (IEF) .
  • the strip is stained with IEF Gel Staining solution (BIO-RAD) for 45 minutes and then destained. with Destain solution (BIO-RAD) .
  • the destained IPG strips were acquired by a laboratory image capturing device ImageQuant 300 TL (GE Healthcare) while (quantitative and qualitative) assays were performed using the image analysis software ImageQuant TL (GE Healthcare) .
  • the isoelectric point of the sample was determined by comparison with the isoelectric points of the reference standards (IEF Marker pH 3-10, SERVA) .
  • the result of the assay is reported in Figure 19.
  • the qualitative-quantitative assay of the protein fraction to be analyzed was performed by BIOTEKNET (Napoli, Italy) by means of capillary electrophoresis with a P/ACE MDQ Beckman-Coulter instrument equipped with diode-array detector and UV lamp, using a capillary of fused silica (50cm actual length, 60.2cm total length, 50 ⁇ inner diameter) and a 20mM sodium citrate buffer, at pH 2.5, applying an e.p.d. of 25kV (ensuring a greater stability in the electrophoretic separation process and of the current used) for 15 min and detecting the absorption at 200nm.
  • the BSA bovine serum albumin
  • the research work on the determination of the molar extinction coefficient of the recombinant hyaluronidase may be divided into four experimental moments: 1. Densitometric assay of the hyaluronidase samples of the invention, 2. Spectrophotometric assay of the hyaluronidase samples of the invention, 3. Identification of theoretical absorbance, 4. Identification of the molar extinction coefficient .
  • A el* 1 * ' C
  • el is referred to as molar absorption coefficient
  • C is the molar concentration of the solution
  • 1 is the optical path.
  • the electrophoretic assays on polyacrylamide gel in the presence of sodium dodecyl sulfate (SDS-PAGE) were carried out using ' Laemmli ' s method [11] on 12% polyacrylamide gel, using a Mini-PROTEAN 3 (BIO-RAD) according to the manufacturer's instructions.
  • concentration and the molecular weight of the hyaluronidase in the fermentation product and in different purification steps were estimated by comparison with standard low molecular weight proteins (GE Healthcare) .
  • the polyacrylamide gels suitably stained with Coomassie (BIO_RAD) after the electrophoretic run, were acquired by a laboratory image capturing device ImageQuant 300 TL (GE Healthcare) , while (quantitative and qualitative) assays were performed using the image analysis software ImageQuant TL (GE Healthcare) .
  • the proteins were fractioned in SDS-PAGE at 12% and transferred to nitrocellulose membranes.
  • the proteins of interest were then identified by incubation with a 1:2000 dilution of anti-hyaluronidase antibody (Abnova) in 10% dry milk/PBS for 12 hours, and the specific reaction was highlighted by means of the addition for 1 hour of mouse anti-IgGs secondary antibodies conjugated with alkaline phosphatase, followed by detection with the BCIP/NBT substrate (BUF045A, SEROTEC) .
  • the recombinant protein produced according to the invention had a level of purity 100 times higher than that of the hyaluronidase standard from mammal testicles (EDQM, FIP Hyaluronidase, H1115000) as shown in Figure 22. While recombinant hyaluronidase purified according to the invention .
  • the Limulus Amebocyte Lysate Tes.t (LAL) , which uses the reagent prepared from blood of limulus Poliphemus, showed to be the most sensitive and specific test to detect and measure the level of . bacterial endotoxins in raw materials used in the production and for the "in-process" monitoring of endotoxin levels. Endotoxins, more commonly known as pyrogens, cause from fever to irreversible shock, from difficulties in blood and tissue exchanges to lethal consequences.
  • a standard calibration curve (CSE, lot.104, art.17078, PBI S.p.A - Italy) was built which shows the linear correlation between the "start time” log and the log of standard endotoxin concentration.
  • the maximum range between the endotoxin concentrations of the standard curve is 0.005EU/ml-50EU/ml.
  • the sensitivity [19] of the test was defined from the lowest concentration of endotoxin used to build the standard curve. The maximum sensitivity of this test is 0.005EU/ml.
  • the endotoxin concentration for the corresponding "start time” of the hyaluronidase sample was read from the standard curve which is. a log-log diagram deriving from the scores obtained calculating the "start times" versus standard concentrations.
  • the estimated value of endotoxins in the hyaluronidase sample produced according to the invention was calculated by the Gen5 software (BioTek) resulting to be very low, that is lower than 0.5 endotoxin units per milligram of recombinant hyaluronidase (Table 4).
  • the ELISA method was used, in particular, the Enzyme Immuno Assay kit "E.coli HCP" from Cygnus technologies (F010).
  • the assay is based on the sandwiched use of affinity-purified antibodies directed to a mixture of 6 E.coli strains commonly used for cloning and expression of recombinant proteins.
  • the test was performed according to the manufacturer's instructions, on the purified sample of recombinant hyaluronidase, the concentration of proteins deriving from E.coli (host strain) is directly proportional to the development of color caused by enzymatic reaction of alkaline phosphatase conjugated to the antibody.
  • the concentration of proteins deriving from the host strain towards the standard concentrations was estimated (calculation and calibration of the curve were performed by the GEN 5 software, BioTek) in the sample of hyaluronidase produced according to the invention to be lower than lOppm as shown in Table 4 (the limit approved by the competent authorities is below lOOppm) .
  • the determination of the quantity of DNA from the host strain of E.coli was carried out in the sample of recombinant hyaluronidase (produced according to the invention) , using the DNA Threshold method.
  • Example 20 Assay on agarose gel of hyaluronic acid depolymerization
  • hyaluronidase produced according to the invention, of depolymerizing hyaluronic acid (Hyalgan®; Fidia S.p.A., Italy) in its primary constituents N- acetylglucosamine and glucuronic acid
  • the electrophoretic assay method in agarose gel [20] was used after hyaluronic acid is digested with 1 unit of recombinant hyaluronidase within the indicated times from 5 minutes to 24 hours.
  • the hyaluronic acid samples (500kD-730kD) , after reacting with recombinant hyaluronidase within the indicated times (from 5 minutes to 24 hours) were separated using the Sub-CellGT electrophoresis system (BIO-RAD) and gels with 1% agarose (25cm in length) .
  • the samples were migrated in. electrophoresis for about 12 hours at a temperature of about 16°C with a constant voltage of 50 Volts. Staining is carried out as described in previous studies [20].
  • Hyaluronidase is an enzyme hydrolyzing hyaluronic acid, therefore increasing the permeability of connective tissue enhancing the diffusion and dispersion of the drug, that is administered locally subcutaneously, in the surrounding tissues.
  • hyaluronidase is administered in low doses (the typical dose used is 15 units), to reduce the damages caused by the leakage of antibiotics, hyperosmotic solutions, acid or basic solutions, or the correction of hyaluronic acid-based fillers to avoid allergic and anaphylactic reactions. Therefore, it is fundamental for the hyaluronidase to be stable at these doses towards the proteolytic enzymes present in connective tissue, which may easy degrade it once injected, inhibiting its action. In order to test and compare the resistance of recombinant hyaluronidase with respect to the bovine one currently used in the market, against proteolytic enzymes, a turbidimetric model for in vitro assays was provided.
  • Example 22 Effect of human and animal serum on hyaluronidase activity
  • bovine hyaluronidase bovine PH20
  • Fig. 25 The method used to assess, in this invention, inhibition of hyaluronidase activity by (animal/human) blood was previously described by Albert DORFMAN, et al [21] .
  • the two concentrations of recombinant hyaluronidase produced according to the invention (40 units, 400 units), and bovine hyaluronidase (40 units, 400 units), were separately and respectively treated with serum coming from animal blood and serum coming from human blood in a sulphate buffer solution (pH 7.0) mixed with substrate buffer containing 0.5 mg hyaluronic acid.
  • the mixture thus obtained was placed at 37 °C for 30 minutes, 1 hour and 6 hours.
  • the relative enzymatic activity of the two concentrations of enzymes treated with the sera was measured at the end of each established time interval after having generated turbidity by adding a 4ml horse serum-based acid solution and continuing as per the Dorfman's method previously described.
  • the development of turbidity due to the addition of the serum was corrected by the blank containing all the reagents, except for hyaluronidase.
  • McClean D The in-vivo decapsulation of streptococci by hyaluronidase. J Pathol Bacterid 54: 284, 1942.
  • Escherichia coli K-12 strain MG1655 and comparative analysis of other strains. J. Mol. Biol. 232: 419-445, 1993.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a hyaluronidase from S. koganeiensis, applications thereof and a method for the production thereof.

Description

TITLE: "BACTERIAL HYALURONIDASE AND PROCESS FOR ITS PRODUCTION"
DESCRIPTION
The present invention relates to a hyaluronidase derived from S. koganeiensis, its applications and a method for the production thereof.
Currently, the hyaluronidase used in the clinical field is of animal origin. While this product is suitably purified, it contains a number of contaminants that can induce immunogenic or allergic responses.
Hyaluronic acid is an essential component of the extracellular matrix and a quantitatively significant constituent of the interstitial barrier. Hyaluronidase is a hydrolytic enzyme that cleaves hyaluronic acid in D- glucuronic acid and N-acetyl glucosamine, increasing the permeability of the interstitial matrix. In a variable manner, it is also capable of degrading other acid mucopolysaccharides of the connective tissue. High concentrations of hyaluronidase can be found, for example, in the oral apparatus of leeches, in poison of snakes, bees, scorpions and in the culture supernatant of pathogenic bacteria such as pneumococci, haemolytic streptococci and Staphylococcus aureus. In human body, hyaluronidase is found in cornea, in ciliary body, in spleen, in skin and in testicles. High amounts of hyaluronidase are also found in spermatozoa, to which the enzyme allows to go beyond the barrier of hyaluronic acid that protects the ovule.
Hyaluronidase is used in medicine in the treatment of edema, local inflammation, hemorrhoids and chilblains. Furthermore, it is used in the pharmaceutical field to facilitate the transport and increase the dispersion and diffusion of certain high molecular weight active ingredients (antibodies, drug carrier nanoparticles, DNA for gene therapy, recombinant proteins) administered locally by subcutaneous injection, increasing the bioavailability thereof in amounts comparable to intravenous administration. [1] Previous studies have shown that nanoparticles with diameters up to 200 nm may undergo a strong increase in their transport through the interstitial space when administered concurrently or sequentially with the hyaluronidase enzyme [1]. The studies so far considered show how nanoparticles are able to express, in vitro, their functions, thus showing great potential in the therapeutic and diagnostic fields. However, one should consider, in vivo, the ability of nanoparticles to go beyond barriers due to the type of administration to be used in clinical practice (subcutaneous or gastrointestinal administration or toxicity by intravenous administration) , their volume of distribution and their toxicity. The use of nanoparticle and hyaluronidase formulations could therefore represent an excellent and innovative starting point for the therapeutic and diagnostic future with the prospect that the drug carrier nanoparticles may finally be used in common clinical practice by local administration subcutaneously for treatment, for example, in oncology, ophthalmology and osteoarthritis.
Some types of cancer, including pancreas, breast, colon and prostate cancer, have been shown to accumulate high levels of hyaluronic acid (HA) . This accumulation of HA in an abnormal way generates a protection network that surrounds certain types of cancers and supports them. This pathological accumulation of HA with other components of the matrix also increases the pressure of the interstitial fluid of the tumor, tumor vessel constriction, and creates a unique microenvironment that favors the growth of cancer cells as compared to normal cells. These mechanisms generate obstacles to the administration of drugs, inhibiting the potential effectiveness of many anti-cancer agents. By dismantling the HA component that determines the architecture of the tumor, hyaluronidase destroys this tumor microenvironment by opening previously restricted vessels that increase the blood flow to the tumor. This can allow anticancer therapeutic agents to be transported more efficiently to the tumor target, increasing their therapeutic efficacy. Hyaluronidase is also used in cosmetics for the treatment of granulomatous reactions or incorrect collocations, i.e. undesired, of hyaluronic acid, caused by fillers, and to dramatically improve the fibrosis condition present in cellulite.
Hyaluronidase, by segmenting the fibrotic component of cellulite, makes it softer with reduction of the orange peel effect, thus giving a more natural and pleasing appearance to the portion of skin subjected to the treatment. To date, hyaluronidase is the only real treatment, with therapeutic or non-therapeutic purposes, that can fight cellulite with satisfactory results.
Previous studies have shown the efficacy of hyaluronidase in the treatment of cardiovascular diseases such as atherosclerosis [2], but the potential that hyaluronidase can have on blood pressure was unknown so far [3].
Clinical studies have demonstrated with electrocardiographic tests that these applications are scientifically supported, leading to study the effects that the human serum has on the activity of Wydase, a bovine testicular hyaluronidase that has been widely used in many clinical studies.
The following conclusions emerged from these clinical studies :
Only the use of a highly purified hyaluronidase has a high clinical value for the reduction of the extent of myocardial infarction [4].
Many groups have demonstrated that human blood contains a thermolabile inhibitor of bovine hyaluronidase [5,6].
These conclusions, despite the clinical studies have demonstrated the efficacy of hyaluronidase, have not led so far to the development of a hyaluronidase and/or new therapeutic agents based on hyaluronidase capable of ensuring an intravenous administration for the management of cardio- cerebrovascular diseases, limiting the use to some cardiovascular therapies, due to the high value of impurities, with those already available on the market. In the veterinary field, hyaluronidase is used in solutions comprising antibiotic substances for the treatment of animal diseases, such as bovine mastitis. To date, the production of bacterial or animal hyaluronidase on an industrial scale has been difficult, both for the low production and for the fact that the enzyme becomes unstable in aqueous solution and loses activity following purification.
In addition, many of the hyaluronidases produced industrially come from animal extracts (from bovine and ovine testicles) with a high risk of transmitting animal spongiform encephalopathy (the so-called "Mad Cow Disease"). Other industrial productions have produced hyaluronidase (human PH20) in soluble recombinant form starting from mammalian cells, improving the purity and reducing the risk of viral infections. [7] The object of the present invention is to provide a bacterial recombinant hyaluronidase having high purity for pharmaceutical and/or cosmetic applications.
An object of the present invention is to provide an enzyme that is stable in an aqueous solution even for long times and in the presence of proteolytic enzymes, that is completely devoid of the risk of transmitting animal spongiform encephalopathy and that has a high hyaluronidase activity also in the bloodstream without possibility of inhibition or viral or bacterial contamination, so as to allow its use also intravenously. Another object of the present invention is to provide a method for the preparation of hyaluronidase that is efficient, in a high yield and is applicable without difficulty on an industrial scale.
According to the present invention, these objects and others that will be better apparent hereinafter, are achieved by a method for the production of hyaluronidase isolated from Streptomyces koganeiensis ATCC 31394 comprising the amino acid sequence shown in SEQ. ID. No. 21 comprising the following steps:
a) inoculating a bacterial culture medium in a bioreactor with a inoculum of recombinant cells that contain at least one vector comprising the sequence shown as SEQ ID No . 41;
b) subjecting the content of the bioreactor of step a) to fermentation at a pH between 6.7 and 7.1 in the presence of a nourishment solution;
c) adding an inducer of the lac genes to the mixture of step b) ;
d) subjecting the mixture of step b) to an induction period of between 8 and 24 hours;
e) centrifuging the bacterial cells obtained in step d) ; f) re-suspending the pellets obtained in step e) and subjecting the resulting suspension to osmotic shock;
g) extracting the periplasmic proteins by centrifugation of the suspension of step f) ;
h) purifying the protein fraction having hyaluronidase enzymatic activity obtained in step g) by a sequence of: i. strong ion-exchange chromatography and isolation of the hyaluronidase enzymatic activity fraction;
ii. weak cation-exchange chromatography and isolation of the hyaluronidase enzymatic activity fraction; and iii. aromatic hydrophobic interaction chromatography and isolation of the hyaluronidase enzymatic activity fraction.
The objects of the invention are also achieved by a hyaluronidase from Streptomyces koganeiensis ATCC 31394 comprising the sequence SEQ ID No: 21, obtainable by said method.
The objects of the invention have also been achieved by a hyaluronidase from Streptomyces koganeiensis ATCC 31394 in a purified form and comprising the amino acid sequence shown in SEQ. ID. No. 21.
The objects of the invention have also been achieved by a polynucleotide comprising the nucleotide sequence shown in SEQ. ID. No. 17, encoding a bacterial hyaluronidase comprising the amino acid sequence in SEQ. ID. No. 21. The objects of the invention have also been achieved by a genetically engineered recombinant vector comprising said polynucleotide.
The objects of the invention have been achieved by a host cell comprising said genetically engineered recombinant vector .
The objects of the invention are also achieved by a composition suitable for pharmaceutical or cosmetic use comprising said hyaluronidase from Streptomyces koganeiensis ATCC 31394 in a purified form and comprising the N-terminal amino acid sequence shown in SEQ. ID. No. 21, said hyaluronidase for use in the treatment and/or prevention of a disorder or disease, optionally in combination with at least another active ingredient, and non-therapeutic use thereof for cosmetic applications and/or for improving the aesthetic appearance.
Within the scope of the present invention, by "composition suitable for pharmaceutical or cosmetic use" means a solid, semisolid or liquid preparation, such as suspension or solution, comprising at least one active ingredient and at least one excipient as is known to the man skilled in the art.
Within the scope of the present invention, the definition of "polypeptide sequence" or "polynucleotide sequence" also includes sequences with a high degree of homology with the sequence indicated. As non-limiting examples, included within the scope of the invention are polypeptides that have at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identity with the sequence shown in SEQ. ID. NO: 21, polynucleotides that have at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identity with the sequence shown in SEQ. ID. NO: 17, and polynucleotides that have at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identity with the sequence shown in SEQ. ID. NO: 41.
Within the scope of the present invention, by "hyaluronidase from Streptomyces koganeiensis ATCC 31394" it is meant hyaluronidase with a high degree of homology with the hyaluronidase originally isolated from the Streptomyces koganeiensis ATCC 31394 organism, that can be produced through biotechnological techniques also from micro-organisms other than Streptomyces koganeiensis ATCC 31394 (such as E. coli or B. subtilis) .
If not otherwise stated, within the scope of the present invention the percentages are referred to the weight of a component on the total weight of the composition.
The following figures are provided to better describe the invention, without intending to limit the scope thereof. Figures .
FIG. 1: production curve of hyaluronidase from supernatant of Streptomyces koganeiensis culture relative to the time interval (T) . Assay in 1% agarose gel of the profile of total RNA and DNA extracted from S. koganeiensis cells during the production step.
FIG. 2: sequence of the amplicon of about 550bp obtained with internal primers MesFor2 and MesRev2 and in silico translation of the nucleotide sequence obtained in protein sequence.
FIG. 3: diagram of the Inverse Polymerase Chain Reaction (IPCR) method used to identify the sequences flanking in 5' and 3' the internal region of the S. koganeiensis gene encoding the hyaluronidase.
FIG. 4: complete identification of the entire nucleotide sequence of the gene encoding the CDS hyaluronidase portion of S. koganeiensis.
FIG. 5: sequence of the entire gene encoding the CDS hyaluronidase portion S. koganeiensis as cloned in the pCR-Bluntll-MOUSE vector (Invitrogen) .
FIG. 6: (A) BLAST assay for sequence homologies between the amino acid sequence determined by the S. koganeiensis ATCC 31394 hyaluronidase and the amino acid sequences reported in web database. The sequences highlighted by the rectangle describe a functional domain of the bacterial hyaluronidase family. (b) BLAST assay for sequence homologies between the nucleotide sequence determined by the S. koganeiensis ATCC 31394 hyaluronidase and the nucleotide sequences reported in web database.
FIG. 7: (a) functional characterization on the protein sequence of the hyaluronidase from S. koganeiensis. (b) functional characterization on the protein sequence of the hyaluronidase from Actinoplanes sp. SE 50/110, Streptomyces pristinaespiralis ATCC 25486, Streptomyces tsukubaensis NRRL18488.
FIG. 8: DNA fragment encoding hyaluronidase and expression plasmids thereof used for cloning were both cut with established restriction enzymes. The fragments obtained were analyzed in 1% agarose gel and stained with ethidium bromide. After staining, the gel was acquired by a laboratory image capturing device ImageQuant 300 TL (GE Healthcare) while (quantitative and qualitative) assays were performed using the image analysis software ImageQuant TL (GE Healthcare) .
FIG. 9: Screening by PCR and digestion with restriction enzymes, of the DNA fragment encoding the hyaluronidase cloned into expression plasmids. The fragments obtained were analyzed in 1% agarose gel with the image analysis software ImageQuant TL (GE Healthcare) after staining with ethidium bromide and acquisition.
FIG. 10: the figure shows the map of the pHTsk_HYAL plasmid: Pgrac promoter, lacl gene (lacl repressor) , AmpR gene for resistance to ampicillin, CmR gene for resistance to chloramphenicol, ColEl origin of replication of E. coli, SamyQ signal peptide of amyQ and hyaluronidase gene encoding the S. koganeiensis hyaluronidase, BamHI and Xbal unique restriction sites used for cloning hyaluronidase.
FIG. 11: the figure shows the map of the pHyal_sk plasmid: ori origin of replication of E. coli, Ap gene for ampicillin resistance, T7 promoter, lacl gene (lacl repressor) , pelB signal peptide, hyaluronidase gene encoding the S. koganeiensis hyaluronidase, Ncol and EcoRI unique restriction sites used for cloning the hyaluronidase .
FIG. 12: the figure shows the map of the pHyal_sk_SL plasmid: ori origin of replication of E. coli, Ap gene for ampicillin resistance, T7 promoter, lacl gene (lacl repressor) , hyaluronidase gene encoding the S. koganeiensis hyaluronidase , Ndel and EcoRI unique restriction sites used for cloning the hyaluronidase.
FIG. 13: (a) the figure shows the nucleotide sequence of the Open Reading Frame (ORF) encoding the hyaluronidase protein of S. koganeiensis cloned into vector pHT43 (MOBITEC) . (b) the figure shows the nucleotide sequence of the ORF encoding the hyaluronidase protein of S. koganeiensis cloned into vector pET22b(+) (Novagen) . (c) the figure shows the nucleotide sequence of the ORF encoding the hyaluronidase protein of S. koganeiensis cloned into vector pET21b(+) (Novagen) .
FIG. 14: assessment in SDS-PAGE at 12% of the expression of the hyaluronidase recombinant {E. coli, BL21 (DE3) containing plasmid pHyal_sk) after induction with 1 mM IPTG compared to the protein profile of the pre-induced sample .
FIG. 15: assessment in SDS-PAGE at 12% of the expression of the hyaluronidase recombinant (E. coli, BL21 (DE3) containing plasmid pHyal_sk_SL) after induction with 1 mM IPTG compared to the protein profile of the pre-induced sample .
FIG. 16: protein profile in SDS-PAGE at 12% of the fractions obtained after each purification step according to the invention.
FIG. 17: (a) comparison of spectra at the circular dichroism of autologous and recombinant hyaluronidase. (b) the respective UV spectra for the purified recombinant are shown. The UV spectra were analyzed before (upper line) and after (lower line) centrifugation in order to remove any aggregates present.
FIG. 18: molecular weight determination by mass spectrometry of the recombinant hyaluronidase obtained according to invention.
FIG. 19: determination of the isoelectric point of the recombinant hyaluronidase obtained according to the invention .
FIG. 20: capillary electrophoresis electropherogram of the sample of purified recombinant hyaluronidase according to the invention. The calculated concentration was approximately 1 mg/ml with 100% purity.
FIG. 21: analysis of the purity of the purified recombinant hyaluronidase according to the invention by means of (a) HPLC on gel filtration column Bio-Sil SEC, (b) RP-HPLC on a hydrophobic phase (reversed) column.
FIG. 22: SDS-PAGE 12% - the recombinant hyaluronidase produced and purified according to invention was charged with 1000, 500, 250, 100, and 50 units per lane and compared with 50, 25 and 10 units per lane of hyaluronidase from bovine testicles. Western blot analysis on the preparation of 25 units of the bovine hyaluronidase using the anti-hyaluronidase polyclonal antibody (Abnova) , that revealed a single immunoreactive hyaluronidase band.
FIG. 23: electrophoresis in 1% agarose gel shows the depolymerization of the hyaluronic acid purified with 1 unit of recombinant hyaluronidase produced according to the invention at the times indicated ranging from 5 minutes to 24 hours.
FIG. 24: Stability of the recombinant hyaluronidase produced according to the invention and of the hyaluronidase from bovine testicles, against proteolytic enzymes.
FIG. 25: in vitro evaluation of the inhibition effect that the human and animal serum has on the enzyme activity of hyaluronidase (recombinant produced according to this invention and bovine hyaluronidase) .
In one embodiment, the present invention relates to a method for the production of hyaluronidase isolated from Streptomyces koganeiensis ATCC 31394 comprising the amino acid sequence shown in SEQ. ID. No. 21 comprising the following steps:
a) inoculating a bacterial culture medium in a bioreactor with an inoculum of recombinant cells that contain at least one vector comprising the sequence shown as SEQ ID No . 41;
b) subjecting the content of the bioreactor of step a) to fermentation at a pH between 6.7 and 7.1 in the presence of a nourishment solution;
c) adding an inducer of the lac genes to the mixture of step b) ;
d) subjecting the mixture of step b) to an induction period of between 8 and 24 hours;
e) centrifuging the bacterial cells obtained in step d) ; f) re-suspending the pellets obtained in step e) and subjecting the resulting suspension to osmotic shock;
g) extracting the periplasmic proteins by centrifugation of the suspension of step f) ;
h) purifying the protein fraction having hyaluronidase enzymatic activity obtained in step g) by a sequence of: i. strong ion-exchange chromatography and isolation of the hyaluronidase enzymatic activity fraction; ii. weak cation-exchange chromatography and isolation of the hyaluronidase enzymatic activity fraction; and iii. aromatic hydrophobic interaction chromatography and isolation of the hyaluronidase enzymatic activity fraction.
To completely eliminate the risk of tranmission of animal spongiform encephalopathy, and since limited sources of hyaluronidase of a microbial origin are available, a bacterial strain was selected and isolated in previous studies capable of producing a high hyaluronidase enzyme activity [ 8 ] .
The same bacterial strain was successfully used ([9]) for the production of hyaluronidase having all of the peculiar enzymatic features, but above all a degree of purity (> 98%) much higher than that described in [8]. Comparative studies have in fact shown that what is obtained from [8] is actually a mixture of 68 different fractions, of which only one has a hyaluronidase activity. The higher purity of [9] is accompanied by a greater enzymatic activity, evaluated at the same concentration and values of T and pH.
Moreover, additional comparative studies have shown that the hyaluronidase described in [9], in contrast to what described in [8], retains its stability over time up to 24 months, even at different temperatures (5 °C and -20 °C ) , and is virtually unaffected by the activity of proteolytic enzymes with which it comes in contact after administration .
In order to ensure a better safety in the use of this bacterial enzyme in pharmaceutical applications, the isolated and characterized hyaluronidase from the original bacterial strain in [9] was produced in recombinant form using a non-pathogenic bacterial strain as a host cell defined as Generally Regarded as Safe (GRAS) . The production of the bacterial recombinant from the "GRAS" micro-organism retains efficacy comparable to that of autologous hyaluronidase but with a higher amount of production per liter and with a substantially better profile of purity and safety, including the complete absence of the risk of viral transmission.
The method of the present invention allows to obtain high amounts of a high quality recombinant bacterial hyaluronidase for pharmaceutical applications. The high production of recombinant hyaluronidase in non-pathogenic microorganisms has the same efficacy as the traditional hyaluronidase but with a significantly better safety and profile, including the complete absence of the risk of transmitting animal spongiform encephalopathy.
The present invention describes the isolation of the entire gene encoding the hyaluronidase from the gram- positive bacterium Streptomyces koganeiensis, with the subsequent cloning and expression of the CDS fragment (encoding sequence, SEQ ID NO: 22) . Furthermore, the present invention provides a method for the preparation in the fermenter, the purification and characterization of the recombinant hyaluronidase encoded and secreted in the periplasmic cell portion in a soluble form.
The recombinant protein thus obtained has a high hyaluronidase activity and has a high stability to proteolytic enzymes, . is able to perform the total activity with its maximum bioavailability in the bloodstream without possibility of inhibition and bacterial and viral contamination. In its recombinant soluble form, it proves to be effective for use in applications not only for the preparation of pharmaceutical compositions in facilitating the subcutaneous administration of active ingredients or injectable fluids but also in therapeutic applications, for example in the treatment of pathologies such as hypertension, myocardial infarction, thrombotic events, cardio- and cerebro-vascular events and tumors, since it is unique with the features described by the invention with reference to all other hyaluronidases available to date .
The productions of known hyaluronidase originate from animal sources having a high risk of transmitting animal spongiform encephalopathy; due to this risk, and to the high instability of the animal-derived hyaluronidase, a bacterial strain is researched, selected and isolated capable of producing a hyaluronidase with a high enzyme activity.
In one aspect, the present invention relates to the isolation of the entire gene encoding the bacterial hyaluronidase (SEQ ID NO: 17) having amino acid sequence SEQ ID NO: 21, coming from the gram-positive bacterium S. koganeiensis, the consequent cloning and expression of the nucleotide sequence SEQ ID NO: 22 encoding the mature protein having the sequence SEQ ID NO: 21 in a specific bacterial host (e.g. E. coli) , recognized to be an organism selected for the expression of recombinant proteins used in therapeutic, diagnostic and industrial applications. The invention describes the production of the protein using the fed-batch method for obtaining, in a fermenter, a high amount of recombinant hyaluronidase secreted in the periplasmic cell portion in a soluble form. The recombinant hyaluronidase thus produced is subjected to purification using three reproducible chromatographic steps (two ion exchange and one hydrophobic exchange) . The enzyme is an innovative suitably purified soluble recombinant bacterial enzyme with a high hyaluronidase activity produced by fermentation of safe bacteria without the use of animal- derived cells and raw materials. Furthermore, the enzyme according to this invention is characterized by a sequence of 217 amino acids, by an isoelectric point (pi) of 5.2 ± 0.5, by a high stability to proteolytic enzymes, by in vitro stability towards animal and human blood, by a high degree of purity and safety, and by the complete absence of the possibility of viral contamination.
The hyaluronidase according to the invention can be obtained as- follows: initially, the strain of S. koganeiensis was subjected to fermentation and the extracellular material was obtained from bacterium cells as previously described [9]. During the fermentation process, cell fractions are collected every 3-4 hours to assess the levels of DNA and RNA produced by standard methods (Fig. 1) , while the other part of the fraction is stored at -80 °C in RNAprotect™ Bacteria Reagent (Qiagen) , after being analyzed. At the end of fermentation, the . supernatant containing the hyaluronidase was clarified, concentrated, dialyzed, purified and then enriched with the sole hyaluronidase component as previously described [9] .
Hyaluronidase from S. koganeiensis thus isolated was digested with proteolytic enzymes (trypsin, chymotrypsin, Glu-C) and the fragments obtained after digestion were separated by HPLC. In this way, the information concerning the primary structure of the isolated hyaluronidase was obtained by sequencing the N-terminal portion of the fragments obtained after enzymatic digestion.
The following amino acid sequences were obtained from the N-terminal sequencing performed:
- AGENGATTTFDGPVA (SEQ ID NO:l)
- RFSADTTIEAAFIKTTSETIHAATIYK (SEQ ID NO: 2)
- GYADGSDKDAAALSLDLR (SEQ ID NO: 3)
- AQVHIVQR (SEQ ID NO: 4)
- IGNAATVPTSVDSSGGG (SEQ ID NO: 5)
From the research done in a database, the homology of hyaluronidase from S. koganeiensis ATCC 31394 with an aforesaid protein (protein_id = ZP_06911952.1 ) of Streptomyces pristinaespiralis ATCC 25486 was identified. On the basis of the N-terminal sequence of the peptides obtained from the isolated protein according to this invention, it was possible to synthesize the corresponding oligonucleotides, that served to isolate the gene encoding hyaluronidase from the genome of S. koganeiensis.
The pellets of bacterial cells from fermentation [9] in the period of exponential production of hyaluronidase (Fig. 1) were treated for extraction and purification of DNA and RNA. The products thus obtained are analyzed qualitatively using a spectrophotometer and quantitatively by electrophoresis in agarose gels [12]. The identified and identical amino acid regions between S. koganeiensis and S. pristinaespiralis served for designing the oligonucleotides used to isolate an internal portion of the gene encoding the hyaluronidase from the genomic DNA used as template, yielding a PCR product with a single specific band of approximately 550 bp. The nucleotide sequencing of the fragment provided the sequence (SEQ ID NO: 8) shown in Fig. 2.
The inverse PCR technique (IPCR) was developed and performed to identify the nucleotide regions flanking the gene sequence thus identified (Fig. 3) . The IPCR method using the pair of primers SEQ ID NO: 11 and SEQ ID NO: 12 allowed obtaining PCR products, respectively of about 700 and 1400 bp, which, once sequenced, provided accurate information on the entire gene encoding the hyaluronidase of S. koganeiensis . With this step, the identification of the nucleotide sequence of interest (SEQ ID NO: 13) , shown in (fig. 4) is completed.
A pair of primers designed on the non-coding sequences (SEQ ID NO: 14 and SEQ ID NO: 15) and flanking the entire gene encoding the hyaluronidase are used for the amplification of the entire gene (SEQ ID NO: 16) and the PCR product (fig. 5) was cloned directly into the pCR®- Bluntll-TOPO® (Invitrogen) vector in of E. coli cells. From the results obtained from the bioinformatics analysis it was observed that the entire length of the gene encoding the hyaluronidase from S. koganeiensis was of 744 bp (SEQ ID NO: 17) and that the length of the peptide sequence was estimated to be 247 amino acids (SEQ ID NO: 18) . The gene contains a putative domain (SEQ ID NO: 19) of proteins belonging to the hyaluronidase family (Hyaluronidase_l) , as evidenced by the search for homologies on a database. Moreover, the analysis of the sequence (SEQ ID NO: 18) using a specific tool indicated the presence of a signal sequence (signal peptide) of 30 amino acids (amino acids 1 to 30 (SEQ ID NO: 47), with the cleavage site between amino acid 30 and 31) . The mature protein (SEQ ID NO: 21) therefore is 217 amino acids long (corresponding nucleotide sequence 651bp (SEQ ID NO: 22)) and its predicted molecular weight
(http://web.expasy.org/compute_pi/) is 21679.96Da.
Finally, BLAST analysis . for sequence homologies shows a partial homology between the determined amino acid sequence from hyaluronidase from S. koganeiensis ATCC 31394 (SEQ ID NO: 18) with some of the amino acid sequences of hypothetical proteins belonging to the Aactinobacteria phylum reported in web database.
There is sequence homology between a region of the sequence (SEQ ID NO: 27 and SEQ ID NO: 52) of the hyaluronidase from S. koganeiensis (according to the invention) and one of the modules present in the amino acid domain of murine CD44 that binds the hyaluronic acid
(Fig. 7 (a) ) .
cDNA encoding hyaluronidase from S. koganeiensis according to the invention (SEQ ID NO: 41) was amplified by PCR starting from the plasmid pCR-BluntII-TOPO [sk_HYAL] and ligated, after being digested with restriction enzymes, in the different plasmids used according to this invention, for example: Vector Primers used Restriction Length Plasmid enzymes nucleotide obtained cloned from
(SEQ ID NO:
41)
pHT43 SEQ ID NO:28 BamHI 672bp pHTsk_HYAL
5 ' -gtaGGATCCGCCGGG (Fig. 13a)
GAAACGGCGCGACGACGA-3 '
SEQ ID NO:29 Xbal
5' -gacTCTAGATCACGCC
GGTGCGATCGTCGTGACC-3'
pET22b SEQ ID NO: 32 Ncol 671bp pHyal sk ( + ) 5 ' -tggCCATGGCCGGGG (Fig.13, b)
AGAACGGCGCGACGACGA+3'
SEQ ID NO: 33 EcoRI
5' -ctcGAATTCtcaCGCC
GGTGCGATCGTCGTGACC-3'
pET21b (SEQ ID NO:36) Ndel 672bp pHyal sk ( + ) 5 ' -ataCATATGGCCGGGGA SL
GAACGGCGCGACGACGA-3' (Fig.13, c)
(SEQ ID NO:37) EcoRI
5' -ctcGAATTCtcaCGCCGG
TGCGATCGTCGTGACC-3 '
pET24b (SEQ ID NO:36) Ndel 672bp pRH_sk ( + ) 5 ' -ataCATATGGCCGGGGA
GAACGGCGCGACGACGA-3'
(SEQ ID NO:37) EcoRI
5' -ctcGAATTCtcaCGCCGG
TGCGATCGTCGTGACC-3 '
After cloning and amplification in cells of E. coli strain DH5a, the genetically engineered vectors were extracted and purified to be separately transformed into bacterial expression cells. The vector pHTsk_HYAL is transformed into cells, made competent, of Bacillus subtilis (WB800N-MOBITEC) while vectors pHyal_sk, pHyal_sk_SL and pRH_sk are transformed into cells, made competent, of E. coli, strain BL21 (DE3) and/or MG1655. All transformations were carried, out by chemical processing [13]. The clones, both of B. subtilis and of E.coli, found to be positive for the presence of vectors containing the nucleotide fragment of hyaluronidase having the genetically correct cloned sequence (SEQ ID NO: 41) are tested for the ability to express the recombinant hyaluronidase in 500 ml cultures (example: 10.11) .
Preferably, in the method according to the present invention the recombinant cell of step a) is selected from a cell of Escherichia coli and one of Bacillus subtilis .
Master Cell Bank and Working Cell Bank was developed on the producer recombinant strains and the aliquots of these 2ml clones with 15% glycerol were introduced into cryogenic vials immediately stored at -80 °C.
Hyaluronidase according to the invention can be produced in large amounts starting from small fermenters using both Batch (example 13) and Fed-Batch (example 14) culture methods as described in this invention (table 1) . Table 1: Plasmids and cloning strategies used in the present invention Strain Plasmide Plasmide description/ Protein Production of
Cloning Strategy Localization soluble
Hyaluronidase
(g/L)
B. subtilis pHTsk_HYAL pHT43 (+) SamyQ- Supernatant N.D.
WB800N (BamHI/XBal) - Hyaluronidase
E. Coli pHyal sk pET22b (+) -pelB- Cellular -0.1
BL21DE3 (NcoI/EcoRI) - periplasma
Hyaluronidase
E.Coli pHyal sk_SL pET21b (+ ) - Cellular > 2
BL21DE3 (Ndel/EcoRI) - periplasma
Hyaluronidase
E. Coli pETsk Hyal pET21b (+) - Included <0.001 BL21DE3 {BamHI/Hindlll) - bodies
Hyaluronidase-His
E. Coli pET22Hyal pET22b (+) -pelB- Cellular -0.35
BL21DE3 (MscI/EcoRI) - periplasma
Hyaluronidasecellular
periplasma
E.Coli PHyal sk pET22b (+) -pelB- Cellular N.D.
MG1655 (NcoI/EcoRI) - periplasma
Hyaluronidase
However the best results in terms of production, stability and repeatability, were found using fermentations with the fed-batch method. Ampicillin, neomycin, kanamycin or chloramphenicol may be used as antibiotic according to the features of the specific vectors . For example, the clone of E. coli "BL21 (DE3)- pHyal_sk_SL" was inoculated starting from a vial (coming from the working cell bank stored at -80 °C) in fresh LB Miller culture medium (ratio 1/20 with respect to the fermentation volume) containing 50 g/ml ampicillin and incubated at 37 °C at 150 rpm for 16-18 hours. The clone coming from the inoculum was grown in the fermenter on a minimum culture medium at pH 6.8.
A glycerol solution was preferably given as feed. During the fermentation process, E.coli generates acetic acid
(acetate) as an undesirable by-product that has numerous negative effects on the production of recombinant proteins. The amount of acetate which is formed during the fermentation phase is directly related to the amount of glucose consumed by the growing E. coli cells [15]. In the present invention, it was found that by using glycerol as a carbon source (non-fermentable low cost carbon source) instead of glucose, an approximately 3- fold increase is obtained in the fed-batch production process for the production of recombinant hyaluronidase. As a non-limiting example, the feed can be provided 6 hours after inoculation up to the nineteenth hour
(induction time) with an exponential addition ratio. After induction with Isopropyl β-D-l- thiogalactopyranoside (IPTG), lmM final solution, the feed can be administered to the culture every hour and in the same amount as the last addition for 5 hours. The induction takes place 24 hours after inoculation and continues for 8-24 hours, typically 12 hours. The bacterial cells are collected after the the induction period, by centrifugation, and stored at -80 °C. The cells of E.coli BL21 (DE3) transformed with the vector pHyal_sk_SL produce the recombinant form in the cell periplasm with a maximum concentration reached of about 2 g per liter of culture and an enzymatic activity greater than 87000 U/ml of culture (7.5 xlO7 - 8.7 X107 IU/1 of culture) obtained after 12 hours of induction with ImM IPTG at 37 °C (Table 2) .
Table 2: Result of the fermentation batches of clone rHyal_Sk, carried out for the present invention
Batch 5C11 7C11 9C11 10C11 11C12
Fermentation Batch Fed- Fed- Fed- Fed- method batch batch batch batch
Hyaluronidase 0.5 1 1.5 1.2 2.1 produced at the
end of
fermentation
(g/L)
Final Biomass 32.7 42 51.6 64 55
(O.D.600nm)
Fermentation 8 10 10 10 10 volume
Cellular Pellets 81.2 83 116 115 149
(g/L)
Inoculum volume 0.4 0.5 0.5 0.5 1
Inoculum 3 3 3 2 2.2
Biomass (O.D. eooim)
Feed volume (L) 0 1.5 1.5 1.5 2.5 Feed Start (h) / 6 6 6 6
Induction time 16 12 12 12 12 ( )
Plasmide 100 95 100 100 100 stability at the
end of
fermentation (%)
Total duration -22 36 36 36 36 of fermentation
(h)
The amount of hyaluronidase produced according to this invention was about 670-750 times higher than the autologous hyaluronidase produced in the fermenter as described in the previous patent [9].
The recombinant protein expressed by E. coli, in the different fermentation parameters, was analyzed by electrophoresis run in SDS-PAGE (12%) after staining with Coomassie Brilliant Blue G-250 (BIO-RAD, 161-0406) having a molecular weight of 24kDa, while the enzymatic activity was analyzed by turbidimetric assay [ 16] .
Recombinant hyaluronidase produced in the fermenter by the fed-batch method can be purified by a process comprising at least three chromatographic steps.
In the preparation of the first purification, pellets stored at -80 °C (coming from the fed-batch fermentation of E.coli BL21 (DE3) transformed with the vector pHyal_sk_SL) are placed in an amount equivalent to 0.6 liters of fermentation product (approximately equivalent to the range of 80-90g of cellular pellets reflecting approximately a production of 1-1.2 g/L of recombinant hyaluronidase) to equilibrate for 45 minutes at room temperature.
Once equilibrated, pellets were treated with a fresh solution (5 °C) for the dispersion of the pellet. The resuspended pellets were treated with a solution for osmotic shock to favour the extraction of periplasmic proteins. After the osmotic shock step, the product obtained was centrifuged and . the . resulting supernatant, once homogenised, is brought to pH 8 and filtered by gravity filters with 0.65μιη filters. The concentration of the extracted hyaluronidase was evaluated in SDS-PAGE resulting to be about 75.0-900mg/total (16-22% of the total periplasmic proteins) . The activity of the extracted recombinant hyaluronidase was instead assessed by Dorfman's turbidimetric method.
The protein fraction with hyaluronidase enzymatic activity thus obtained is subjected to strong anion exchange chromatography (example: Q sepharose XL).
The protein fraction with hyaluronidase enzymatic activity thus obtained is concentrated to 100ml using Polyethersulfone (PES) filters with cut-off 5kDa and diluted 10 times with 50 mM sodium acetate buffer at pH 4.
The protein fraction with hyaluronidase enzymatic activity thus obtained was subjected to weak cation exchange chromatography (example: CM-Sepharose® Fast Flow) .
The protein fraction with hyaluronidase enzymatic activity thus obtained was concentrated to 100ml using Polyethersulfone (PES) filters with cut-off 5kDa and diluted 10 times with 50. mM sodium phosphate buffer with 1.5 mM ammonium sulphate, pH 7.
The protein fraction with hyaluronidase enzymatic activity thus obtained is subjected to aromatic hydrophobic interaction chromatography (example:
phenylsepharose HP) and the eluted proteins from this last chromatographic step were collected in a single fraction having a volume of about 730 ml and subjected to hyaluronidase activity assay. After the analysis of the enzymatic activity, the eluted fraction was subjected to ultrafiltration and dialysis with 10 volumes of PBS lx (Sigma-P4417 ) brought to a concentration of approximately lmg/ml and filtered with 0.2 μπι filters, the protein concentration is determined by BCA Protein Assay Reagent Kit (PIERCE) .
At the end of the purification process applied on approximately 1L of the fermentation product, approximately 600-650 mg of recombinant hyaluronidase and an enzymatic activity greater than 2.6 xlO7 U per liter of purified product from fermentation were obtained (Table 3) .
Table 3: Result of the purified recombinant hyaluronidase according to the present invention
Sample Hyaluronidase Volume Hyaluronidase Production Hyaluronidase
(U/ml) (ml) (total O) (%) Total mg
Fermentation Load 48000 600 4.8xl07 100 1000
Product
Periplasmic Eluted 7600 5000 3.8 xlO7 80 800 extraction
Q-Sepharose® Load 7600 5000 3.8 xlO7 100 800
XL Eluted 23100 950 2.2 xlO7 57.8 462
CM- Sepharose® Load 23100 1000 2.2 xlO7 100 462 Fast Flow
Eluted 57900 380 2.2 xlO7 100 462
Phenyl Load 22000 1000 2.2 xlO7 100 462
Sepharose® HP
Eluted 26000 730 1.9 xlO7 88.8 410
DIA/Filtration Load 26000 730 1.9 xlO7 100 410
Cone . 48570 350 1.7 xlO7 93 381 and
DIA/
Filtr.
DIA/Filtration Load 45300 375 1.7 xlO7 100 381 5k
0.22μπι Filtr. Eluted 45000 375 1.69 xlO7 99.5 378
Total production per culture litre 35
(%)
Total amounts per culture litre (IU) 2.8 xlO7
Total amounts per culture litre (mg) 630
Total amounts per pellets gram (IU) 2.1 xlO7
Total amounts per pellets gram (mg) 4.8
In all fractions with hyaluronidase activity there was a marked protein band at about 24 kDa (Fig. 16), the band was subjected to SDS-PAGE electrophoresis on 12% gel and then to blotting on polyvinylidene difluoride membrane (BIO-RAD) and stained according to the instructions provided by the supplier. The hyaluronidase band was cleaved with a scalpel and loaded into the reaction chamber of the sequencer. The sequencing of the N-terminal end thus carried out allowed establishing that the recombinant hyaluronidase produced according to the invention from the sample of E.coli transformed with the vector pHyal_sk_SL according to the invention provided chromatograms wherein a single N-terminal amino acid sequence was significantly present, allowing reconstructing the experimental sequence shown below: AGENGA (SEQ ID NO: 42) .
The enzymatic potential of the hyaluronidase produced according to the invention {E.coli transformed with the vector pHyal_sk_SL) was evaluated by comparison with the enzyme activity of autologous hyaluronidase [9], using the enzymatic assay described [9] and the activity value was reported to be in both cases greater than 4xl04 IU/mg protein .
In addition, in the analysis carried out by circular dichroism (CD) , the overlay files black line (autologous hyaluronidase [9]) and ray line (heterologous hyaluronidase according to the invention) have a comparable profile, confirming the same protein structure for both samples (Fig. 17-a) .
Compared to the prior art [9], the method according to the present invention allows:
obtaining hyaluronidase of bacterial origin from a strain of E.coli well characterized as safe, rather than from Streptomyces koganeiensis, by recombinant technology (in place of that by extractive way) suitable for the production on an industrial scale, with production in the periplasm (in place of in extracellular matrix) ;
reaching a surprisingly high maximum hyaluronidase activity, higher than 80000 U per milliliter of culture, against, for example, 130 U per milliliter of culture supernatant in the method of [9] and, in any case, clearly higher than those obtainable with other known processes ;
- obtaining high-purity (>99%) hyaluronidase with only 3 chromatographic steps (instead of 5) , with significant economic benefits and reduced processing times.
In another aspect, the present invention relates to a hyaluronidase from Streptomyces koganeiensis ATCC 31394 in a purified form and comprising the amino acid sequence shown in SEQ. ID. No. 21.
The protein of the present invention can be isolated and produced from Streptomyces koganeiensis or recombinantly produced, for example, from cultures of E. coli or Bacillus subtilis .
It was surprisingly found that, compared to the known protein from Streptomyces koganeiensis [9], the enzyme of the present invention has:
• a higher level of purity (99% versus 98%)
• a lower level of endotoxins (<0.5 U/mg instead of >0.5 U/mg) ;
• presence of the entire peptide sequence (and the corresponding nucleotide sequence) , which does not have cysteine (thus reducing the possibility of yielding aggregates) ;
• greater stability in solution at 5 °C (100% stability at 24 months versus 94% at 24 months of the protein [ 9] ) ;
• excellent stability at 20 °C (100% at 24 months), at pH 3-11.5 (tested up to 24 hours) ;
• maximum activity at physiological pH (around 7) and body temperature (about 37 °C) ;
• stability in the blood greater than 90%.
The hyaluronidase according to the present invention is a product derived from genetic engineering; so far, there was no availability of the entire protein-encoding gene, since there was no genomic or protein bank of the S. koganeiensis strain. Only with the method developed by the inventors described herein the nucleotide sequence encoding the protein has been identified and isolated. This nucleotide fragment is the first ever isolated and documented DNA sequence from this bacterial strain. At the industrial level, the possibility of being able to obtain the entire sequence of the gene encoding this hyaluronidase with a high enzymatic activity allows its use in different systems such as: vectors, systems of genomic integration and in cells, advantageous for the production and use of the enzyme in the pharmaceutical industry.
A further surprising result of the present invention is the very high yield of the process claimed, which was developed through a complex screening activity with different expression vectors, different types of insertion of the nucleotide fragment encoding the protein into the expression vector (i.e. the insertion of the fragment with some restriction sites with respect to others) and screening of the production in different cell lines. This activity, made even more complex since the nucleotide sequence encoding the protein was not available therefore not allowing to apply what was known to the man skilled in the art, has permitted the identification of the most suitable type of cloning, type of vector and expression cells for obtaining a production so unexpectedly high. The expression and production model for the recombinant protein according to the invention allows to obtain, at the end of the purification process, a pure protein with an endotoxin level of <0.5 U/mg of protein, using only three chromatographic steps instead of 5 as is in the known process (endotoxins >0.5 U/mg protein) [9] .
The suitably purified enzyme is characterized by the assays whose results are listed in table 4.
Table 4. Result of the characterization assays of the recombinant hyaluronidase produced according to the present invention from clone rHyal_Sk.
Analysis Recombinant hyaluronidase
N-terminal Sequencing lmg/ml AGENGA
Protein Assay
(Lowry/BCA) Method
lSDS-Page >99%
Isoelectric Focusing 90% (I. P.5.2+0.4)
Theoretical I. P.5.5
SEC-HPLC 100%
RP-HPLC >99%
Peptide Mapping (by LC-MS) 94% (<90%)
Identity with reference
aminoacid sequence
Proprietary HCP Assays for 6.5-8.8ppm
E.coli Limit <100ppm
Threshold System 19pg/mg
(Proprietary DNA assays for
E.coli Limit<300pg/mg Chromo-LAL <0.5 U/mg
Molar Extinction 12383 L*mol-l*cm-l ABS 280 Coefficient (=lg/l) 0.570
Mass Spectrometry of 21679.98±0.82
Proteins Theoretical M
21679.96
In Capillary (Zone) Purity 100%
Electrophoresis
Molecular Aggregates (UV250- No aggregate
350 nm analysis)
Solution pH in (lx PBS) -7.5
Hyaluronidase according to the present invention has those activity and high purity features that are necessary for its use in industrial, diagnostic and therapeutic applications. Furthermore, compared to other hyaluronidases known so far, the hyaluronidase produced according to the present invention has proved to be an enzyme that is able to hydrolyse the hyaluronic acid present in the interstitial matrix, increasing the permeability of the connective tissue and favoring the diffusion and dispersion of the drug, locally administered subcutaneously, into the surrounding tissues with extreme stability without the possibility of being digested by proteolytic enzymes present in the connective tissue, which could easily degrade it, once injected, thus inhibiting its action (figure 24).
In this invention, thanks to the provision of an in vitro experimental model using the turbidimetric method, what had already emerged from previous clinical studies was confirmed, that is, the enzymatic activity of bovine hyaluronidase (bovine PH20) is inhibited by human and/or animal blood, but it was however found that human and/or animal blood does not inhibit hyaluronidase from recombinant S . koganeiensis (Fig. 25).
Therefore, from the studies presented here it was found that the recombinant hyaluronidase of the invention (produced according to the method above or from S. koganeiensis) has a high hyaluronidase activity, has a high stability to proteolytic enzymes and is able to perform with its maximum bioavailability the total activity in the bloodstream without possibility of bacterial and viral infections. Therefore, it may find use, alone or in combination with other active principles, in the preparation of pharmaceutical or veterinary . compositions destined to the treatment of pathologies where it is necessary or advantageous to degrade the hyaluronic acid present in the organ or tissue affected by the pathology.
Thanks to its high stability in aqueous solution, the hyaluronidase of the invention can also be formulated in the form of water based compositions such as solutions, hydrophilic creams, hydrogels, as well as in the form of lipophilic products such as ointments or oily creams.
In one aspect, the present invention relates to a polynucleotide comprising the nucleotide sequence shown in SEQ. ID. No. 17 which encodes the bacterial hyaluronidase from Streptomyces koganeiensis ATCC 31394 comprising the amino acid sequence shown in SEQ. ID. No. 21.
In another embodiment, the present invention relates to a genetically engineered recombinant vector comprising said polynucleotide comprising the nucleotide sequence shown in SEQ. ID. No. 17.
Preferably, said vector is a plasmid.
In another embodiment, the present invention provides a host cell comprising said vector.
In another aspect, the present invention relates to a composition suitable for pharmaceutical or cosmetic use comprising the hyaluronidase from Streptomyces koganeiensis ATCC 31394 in a purified form and comprising the amino acid sequence shown in SEQ. ID. No. 21, obtainable from the above method or by extraction from Streptomyces koganeiensis .
In a further embodiment, the present invention relates to the hyaluronidase from Streptomyces koganeiensis ATCC 31394 in a purified form and comprising the amino acid sequence shown in SEQ. ID. No. 21, obtainable by the above method or by extraction from Streptomyces koganeiensis, for use in the treatment and/or prevention of a disease or disorder, optionally in combination with at least another active principle.
The hyaluronidase of the present invention can be applied both in the medical field and in the veterinary field. Preferably, hyaluronidase according to the invention is for use in the treatment and/or prevention of at least one among oedemas, inflammatory conditions, chilblains, solid tumors, IgE-mediated allergies, diseases of the oral cavity, spontaneous vitreous haemorrhages, arteriosclerosis, blood pressure disorders, cardio- cerebro vascular disorders such as brain arterial stenosis or stroke or bovine mastitis.
As regards the human use, without intending to be limited to it, the hyaluronidase of the invention can be used for the preparation of pharmaceutical compositions intended for the treatment of edemas, in particular edemas on a traumatic basis, or inflammatory conditions such as the haemorrhoid syndrome; moreover, it can be used for the preparation of compositions intended for the treatment of chilblains. The hyaluronidase of the invention can also be used in combination with other drugs of which it is necessary or advantageous to increase the bioavailability.
For example, for the treatment of oedemas on a traumatic basis, combinations of the hyaluronidase according to the invention with anticoagulant and/or fibrinolytic agents are particularly advantageous. Such combinations may also possibly contain one or more steroidal or non-steroidal anti-inflammatory agents. Moreover, these compositions may be advantageously associated with sulphated hyaluronic acid, which is known to have, in addition to anti-inflammatory properties, also antithrombotic and anticoagulant properties. Associations of the hyaluronidase according to the invention with other active principles are advantageous also in the case of injectable preparations containing active principles with a particularly high molecular weight, for example monoclonal antibodies, cytokines, enzymes, DNA and drug carrier nanoparticles which are usually administered intravenously; this hyaluronidase allows the administration thereo subcutaneously, according to the so-called EASI (Enzymatically-Augmented Subcutaneous Infusion) procedure, that is used especially for the replacement of fluids in terminal patients, so as to restrict or avoid the nursing care. Hyaluronidase according to the invention can also be used for the preparation of pharmaceutical compositions intended for the treatment of resistant solid tumors. In fact, by degrading the hyaluronic acid, it lowers the pressure of the interstitial fluids into the tumor mass, thus increasing the blood flow to the tumor and thus increasing the efficiency of transport of therapeutic agents towards their target which slow down or inhibit the tumor growth in a more effective way. For the same reason, it also increases the effectiveness of anticancer active ingredients possibly associated thereto. Therefore, a further aspect of the invention relates to pharmaceutical compositions containing hyaluronidase in combination with one or more anticancer active ingredients, such as Vinca alkaloids (vinblastine, vincristine, vinorelbine) and taxanes (Paclitaxel) .
A further therapeutic use of hyaluronidase according to the invention relates to the use in the treatment of IgE- mediated allergic forms with EPD (Enzyme Potentiated Desensitization) , which consists in the administration of very low doses of allergens to desensitize individuals sensitive to them. By associating hyaluronidase with an allergen it is possible to increase the effectiveness of the treatment, since the allergen more easily reaches the site of action. Therefore, a further object of the invention consists in pharmaceutical compositions containing hyaluronidase in association with one or more allergens that induce IgE-mediated allergic reactions. Hyaluronidase is also used as a factor of diffusion of drugs for dental use in the treatment of oral diseases, such as local anaesthetics and antibiotics; therefore, according to a further aspect, the invention relates to pharmaceutical compositions containing hyaluronidase according to the invention in association with one or more local anesthetics or antibiotics.
In ophthalmology, hyaluronidase allows to greatly accelerate the treatment of spontaneous vitreous hemorrhages and can be used, alone or in combination with other active ingredients, in the preparation of pharmaceutical forms for ophthalmic use such as solutions, suspensions, gels, creams and ointments, intended for the treatment of such hemorrhages.
Previous studies have shown the efficacy of hyaluronidase in the treatment of cardiovascular diseases such as atherosclerosis [2] and in the management of blood pressure [3] . Moreover, thanks to the ability of hyaluronidase, produced according to this invention, to perform the total activity in the bloodstream without being inhibited, it can be used also for cardio-cerebro- vascular therapies.
On the other hand, as regards the veterinary use, a disease that can be effectively treated with the hyaluronidase of the invention is bovine mastitis; in this case, the hyaluronidase can be administered in combination with antibiotics, such as Penicillin G, I-IV generation cephalosporins and enhanced amminopenicilline. Thanks to its stability in aqueous solution, the hyaluronidase according to the invention can be formulated in aqueous-based products; the choice between an aqueous-based formulation and an oil-based formulation can be made by a man. skilled in the art on the basis of common knowledge in the field of pharmaceutical technology, based on the other ingredients in the composition .
In one embodiment, the present invention relates to the non-therapeutic use of hyaluronidase in a purified form and comprising the amino acid sequence shown in SEQ. ID. No. 21 or obtainable from Streptomyces koganeiensis ATCC 31394 or by the method above for cosmetic applications and/or for improving the aesthetic appearance.
Hyaluronidase is also used in cosmetics for the treatment of granulomatus reactions or incorrect, undesired collocations of hyaluronic acid, caused by fillers.
Moreover, today, after studies and investigations, an injectable product based on hyaluronidase has been developed which can dramatically improve the fibrosis condition present in cellulite. Hyaluronidase, by segmenting the fibrotic component of cellulite, makes it softer with reduction of the orange peel effect, thus giving a more natural and pleasing appearance to the portion of skin treated. In this case, hyaluronidase is appropriate for all those people who suffer from cellulite or with little presence of fat mass. And to date, it is the only real therapy capable of opposing cellulite with satisfactory results in aesthetic and/or therapeutic terms.
The present invention includes hyaluronidase as described above for the treatment and/or prevention of cellulite for both therapeutic and non-therapeutic purposes.
Finally, the hyaluronidase according to the invention can be used as a reagent in biochemical assays for the qualitative/quantitative determination of hyaluronic An embodiment of the present invention is described below in an example given for illustrative and not limiting purpose .
Example 1: Bacterial strain and culture conditions
The S. koganeiensis strain was obtained from American Type Culture Collection (ATCC 31394) . The extracellular material was obtained from cells of the bacterium as previously described [9]. Briefly, a colony of the microorganism was transferred from ISP Medium 2 agar plates and grown in 500 ml of culture medium [ (20 g/1 of yeast extract (Organotechnie) and 5 g/1 of soya peptone (Solabia), at pH 6.9)] at 30 °C, STIRRING at 150 rpm for about 16 hours. After growth, the culture' was used to inoculate a 20 liter fermenter (Biostat U, B.BRAUN) containing 10 liters of special soil [(10 g/1 of yeast extract (Organotechnie) , 5 g/1 peptone soybean (Solabia) , 3 g/1 of malt extract (Constantine) , 3 g/1 of dextrin type I (Sigma), 0.2 g/1 of antifoam (Sigma)]. Before carrying out the inoculation, the pH was brought to 7.0 with NaOH; during the fermentation, the pH was monitored but not controlled, and the temperature was maintained at 30 °C throughout the fermentation, while stirring was maintained at 300 rpm, with aeration of 1.6 VVM (liters of air/liter of fermentation medium/min) . The fermentation had a duration of 48 h, time which coincided with the maximum production of hyaluronidase enzyme activity in the culture supernatant. The culture was sampled daily to assess the growth, viability and concentration of the hyaluronidase produced in the culture supernatant by determination of the enzymatic activity by the Dorfman's method [10]. At various steps, the cell density was determined by counting under a microscope, measuring the optical density at 600 nm and by counting the colonies on plates of ISP Medium 2 agar (Difco) .
Cellular fractions are collected every 3-4 hours, where a part is used to assess the levels of RNA and DNA (Fig. 1) by standard methods, using the spectrophotometer T60 UV- Vis (PG Instruments), the other part of the fraction is stored at -80 °C in RNAprotect Bacteria Reagent (Qiagen) . At the end of the fermentation, the culture was centrifuged at 5000rpm for 30 minutes at 4 °C (Sorvall Evolution RC) and filtered with 0.2μπι tangential flow polyethersulfone filters so as to eliminate the biomass of Streptomyces oganeiensis (which was in the form of rounded hyphal aggregates of 1-4 mm diameter) and to obtain a clarified supernatant containing hyaluronidase . Subsequently, the supernatant was concentrated and dialyzed by tangential filtration as previously described [9] .
Example 2: Isolation in FPLC of autologous hyaluronidase The concentrated and dialyzed supernatant was purified and enriched with hyaluronidase alone as previously described [9]. Briefly, the isolation and characterization of the protein occurred using a proteomic approach supported by a process based on the use of a combination of ion-exchange chromatography columns (GE Healthcare), in sequence: CM-Sepharose FF, HiTrap Q XL and HiTrap SP FF, Resource Q. The individual fractions eluted from the chromatographic columns were tested for their highest hyaluronidase activity using an enzymatic dosage and analyzed in parallel for their protein content by SDS-PAGE.
Determination of the hyaluronidase activity. The hyaluronidase activity was measured with the modified Dorfman's method [10]. Briefly, the product obtained by the chromatographic process was diluted in 0.03M phosphate buffer, 0.82% NaCl, pH 6.3 and 1ml of the thus obtained solution was mixed with 1ml substrate buffer (0.03M phosphate buffer, NaCl 10.82%, pH 6.3) containing 0.5mg hyaluronic acid. The enzymatic digestion was carried out at 37 °C for 30 minutes and at the end of the incubation process, turbidity was generated by adding a 4ml horse serum-based acidic solution (SIGMA) . The optical density at 640 nm was measured exactly 30 minutes after the addition of the horse serum acidic solution. A standard of hyaluronidase from mammal testicles (EDQM, FIP Hyaluronidase, H1115000) containing 328 IU/mg was used to construct a standard curve and the activity (in units) of the samples was calculated using this curve. Electrophoresis and analysis in SDS-PAGE.
The electrophoretic assays on polyacrylamide gel in the presence of sodium dodecyl sulfate (SDS-PAGE) were carried out using Laemmli's. method [11] on 12% polyacrylamide gel, using a Mini-PROTEAN 3 (BIO-RAD) according to the manufacturer's instructions. The molecular weight of the purified protein was assessed by comparison with standard low molecular weight proteins (BIO-RAD) . The polyacrylamide gels suitably stained with Silver Stain Plus (BIO_RAD) or Coomassie (BIO-RAD) after the electrophoretic run, were acquired by a laboratory image capturing device ImageQuant 300 TL (GE Healthcare) , while (quantitative and qualitative) assays were performed using the image analysis software ImageQuant TL (GE Healthcare) .
Example 3: N-terminal sequencing of internal protein fragments
The N-terminal amino acid sequencing was carried out according to Edman's degradation method using an automated protein sequencer in pulsed liquid phase (ABI- Perkin Elmer Mod.' 477A) . The searches for homology were performed using the BLAST software (National Center for Biotechnology Information at the National Library of Medicine (Bethesda, MD) [28], the search server Broad Institute (http://www.broadinstitute.org/) and the ClustalW software (http://www.ebi.ac.uk/clustalw/). The signalP (http : //www . cbs . dtu . dk/services/SignalP-2.0/ ) and Interproscan (http : //www. ebi.ac.uk/Tools/pfa/iprscan/ ) were respectively used to conduct analysis of the signal peptide cleavage site and for the analysis of the protein domain .
The information concerning the primary structure of the isolated hyaluronidase were determined by sequencing the N-terminal portion of the entire protein and fragments obtained after digestion with trypsin, chymotrypsin, Glu- C and separation of the fragments produced by HPLC.
From the N-terminal sequencing carried out, the N- terminal amino acid sequence and the amino acid sequence of internal fragments were identified, and they are shown hereafter in a sequence:
- AGENGATTTFDGPVA (SEQ ID N0:1)
- RFSADTTIEAAFIKTTSETIHAATIYK (SEQ ID NO: 2)
- GYADGSDKDAAALSLDLR (SEQ ID NO: 3)
- AQVHIVQR (SEQ ID NO: 4) - IGNAATVPTSVDSSGGG (SEQ ID NO: 5)
A search was performed in the database with the sequences identified and the homology of hyaluronidase from S. koganeiensis ATCC 31394 with a predicted protein (protein_id = ZP_06911952.1) of Streptomyces pristinaespiralis ATCC 25486 was identified. On the basis of the N-terminal sequence of the peptides obtained from the isolated protein according to this invention, it was possible to synthesize the corresponding oligonucleotides , that served to isolate the gene encoding hyaluronidase from S. koganeiensis genome.
Example 4: Identification of the novel hyaluronidase gene The gene encoding the hyaluronidase was isolated from the DNA from bacterial cells of Streptomyces koganeiensis. Briefly, the pellets of the bacterial cells from the fermentation in the period of exponential production of hyaluronidase (Fig. 1), are treated for the extraction and purification of genomic DNA using DNeasy Tissue Kit
(Qiagen) > while the RNA was extracted with RNeasy Mini Kit (Qiagen) . A cDNA library was obtained starting from total RNA using MICROBExpress kit and Poly (A) Tailing kit (Applied Biosystems) to isolate mRNA (messenger RNA) from total RNA and the SMART RACE cDNA Amplification Kit
(Clontech) according to the manufacturer's instrutions. The products thus obtained are analyzed quantitatively using a spectrophotometer T60 UV-Vis (PG Instruments) and qualitatively by electrophoresis in agarose gels [12] . As described in the previous paragraph, the identical amino acid regions between S. koganeiensis and S.pristinaespiralis were identified; the following oligonucleotides were designed on nucleotide regions encoding these identical amino acid residues by the use of online tools and a generic bacterial usage codon: MesFor2 ( 5 ' -GGAGAACGGGGCGACGACGACGTTCG-31 ( SEQ ID NO: 6)) corresponding to the peptide present in the N-terminal area (ENGATTTF) , the antisense MesRev2 (5'- GTCGGCACCGTCGCCGCGTTCCCGAT-3 ' (SEQ ID NO: 7)) corresponding to the peptide present in the C-terminal area ( IGNAATVP) .
With these two oligonucleotides, and only on genomic DNA as template, several PCR reactions were performed with KOD polymerase (Toyobo) , experimenting different conditions of temperature and using or not DMSO at 4%. At the end of the various processing steps, a specific PCR product was obtained (conditions: initial denaturation 95 °C 5 min, 96 °C 40 sec, 55 °C, 30 sec annealing, 72 °C 1 min extension, for 40 cycles and 72 °C 10 min) , in fact, the PCR only amplifies a specific band of approximately 550 bp. The contiguous of the two sequencing processes of the fragment gave the sequence (SEQ ID NO: 8) shown in Fig. 2. The PCR products were analyzed by electrophoresis in agarose gel. Given the homology between the nucleotide sequences of S. koganeiensis and S.pristinaespiralis, attention was paid to the non-coding regions flanking the gene being analyzed.
From the online source http://www.broadinstitute.org/ annotation/genome/streptomyces_group/GenomeDescriptions . h tml, the flanking regions of the S. pristinaespiralis gene were identified, on which two oligonucleotides were designed (MesExrF: 5 ' -cgggagaagggtgaacgc-3 ' ( SEQ ID NO: 9) and MesExtR: 5 ' -ctccgcgaccagttcttcg-31 (SEQ ID NO: 10)) to be used in PCR on the genomic DNA template of S. koganeiensis . The PCR conditions were defined from the previous step, maintaining a higher denaturation temperature (96 °C) due to the high GC content of the bacterial genomes.
Given the non-specific results, it was decided to try to use these oligonucleotides . in combination with MesFor2
(SEQ ID NO: 6) and MesRev2 (SEQ ID NO: 7) used previously and which gave the expected PCR product. It was found that only the amplification with the oligo MesFor2 and MesExtR gave a clear product of the expected size; by sequencing it with the two primers used in the amplification, the region 3' of the gene being analyzed was identified. The inverse PCR technique (IPCR) was developed and performed, to identify the nucleotide regions upstream of the gene sequence identified to date
(fig. 3). The IPCR method was performed by the following processing steps:
a) Digestion of the genomic DNA with restriction enzymes. Three different reactions of enzymatic digestion were set up with the enzymes Kpnl NARI, and NotI, of approximately 100 ng of genomic DNA of S. koganeiensis.
b) Ligation of the digested DNA. .
c) Amplification by PCR using the ligation reactions as template, with oligonucleotides that anneal within the region known to date encoding the hyaluronidase of S. koganeiensis .
The oligonucleotides used are the following:
MesINTf (5' -GGCATCTACGTCACGGCGACGAAC-3 ' (SEQ ID NO:ll)) and the antisense MesINTr (5' -CGTACCCGCGGTGGGTGATCTTCAG-3 ' (SEQ ID NO: 12) ) . The preparations digested with Kpnl and Nari gave PCR products, respectively, of about 700 and 1400 bp, which once sequenced provided accurate information on the region 5' flanking the gene of hyaluronidase of S. koganeiensis . With this step, the identification of the nucleotide sequence of interest (SEQ ID NO: 13) , shown in (fig. 4) is completed.
A pair of primers designed on the non-coding sequences (forward: 51 -accattcggagttgatcgttg-3 ' (SEQ ID NO: 14) Reverse: 5' -gtcaactgcactgttctctcc-3 ' (SEQ ID NO: 15)) and flanking the entire gene encoding the hyaluronidase are used for the amplification of the entire gene. The PCR product obtained whose sequence obtained after sequencing (SEQ ID NO: 16) is shown in (fig. 5), is cleaved from the gel after electrophoresis run, purified using the Wizard SV Gel and PCR Clean-Up System (Promega) and cloned directly into the vector pCR®-BluntII-TOPO® (Invitrogen) in E.coli cells. Subsequently, the clones which were found to be positive (pCR-Bluntll-TOPO [skJHYAL] ) at PCR for the presence of the plasmid containing the hyaluronidase gene were analyzed by sequencing.
Analysis of the deduced protein sequence.
BLAST software was used for conducting homology searches on the GenBank database. While the software ExPASy Translate Tool, available on the web, was used to allow the translation in silico of the nucleotide sequence of the isolated gene encoding the hyaluronidase from S. koganeiensis in the protein sequence. Finally, the conserved domain for the hyaluronidase activity was verified by the InterProScan software available on the website (http://www.ebi.ac.uk/Tools/InterProScan/) (Fig. 7 (a) ) . From the results obtained it was observed that the entire length of the gene encoding the hyaluronidase from S. koganeiensis was of 744 bp (SEQ ID NO: 17) and the length of the peptide sequence was estimated to be 247 amino acids (SEQ ID NO: 18) . The gene contains a putative domain (SEQ ID NO: 19) of proteins belonging to hyaluronidase family (Hyaluronidase_l ) , as evidenced by the search for homologies on the Pfam database. Moreover, the analysis of the sequence (SEQ ID NO: 18) using the specific tool http: //www. cbs . dtu. dk/services/SignalP-1.1/ indicated the presence of a signal sequence (signal peptide) of 30 amino acids (amino acids 1 to 30 (SEQ ID NO: 47), with the cleavage site between amino acid 30 and 31) . The mature protein (SEQ ID NO: 21) then is 217 amino acids long (corresponding to the nucleotide sequence 651bp (SEQ ID NO: 22)) and its molecular weight is predicted (using the tools available on the site http://web.expasy.org/compute_pi/) is 21679.96 Da. Finally, BLAST analysis for sequence homologies shows homology between the amino acid sequence determined for the hyaluronidase S. koganeiensis ATCC 31394 (SEQ ID NO: 18) and the amino acid sequences reported in the database on the web: homology with the amino acid sequence of the protein Hyaluronoglucosaminidase (predicted from the analysis of the open reading frames starting from the genomic locus described on the web with code YP_006266806.1) from Actinoplanes sp. showing .68% identity/78% similarity, homology with the amino acid sequence of the predicted protein ZP_06911952.1 (predicted by the analysis of the open reading frames starting from the genomic locus described on the web code ZP_06911952.1) of Streptomyces pristinaespiralis ATCC 25486 with 66% identity/77% similarity (SEQ ID NO: 23 and SEQ ID NO: 48) and homology with the amino acid sequence of the hypothetical protein STSU_30255 (predicted from the analysis of the open reading frames starting from the genomic locus described on the web with code ZP_10072726.1) of Streptomyces tsukubaensis NRRL18488
(SEQ ID NO: 24 and SEQ ID NO: 49) with 66% identity/80% similarity (Fig. 6 a,b) . Given the significant similarity of the functional domain (SEQ ID NO: 25 and SEQ ID NO: 50, SEQ ID NO: 26 and SEQ ID NO: 51) observed with hyaluronidase described by this invention (SEQ ID NO: 19) , the entire CDS nucleotide sequence encoding these proteins, which are defined on the web with the terminology of "hypothetical or "predicted", was isolated from the original genomic locus and characterized, permitting to identify them, for the first time, in this invention as hyaluronidase (fig. 7 (b) ) . However, none of these analyses found the entire exact nucleotide sequence and the amino acid sequence of the hyaluronidase isolated according to the patent reported in the literature.
A sequence homology was present between a region of the sequence (SEQ ID NO: 27 and SEQ ID NO: 52) of hyaluronidase from S. koganeiensis according to the invention and one of the modules present in the amino acid domain of murine Cd44 that binds hyaluronic acid
(Fig.7 (a)).
Example 5: Cloning of gene encoding hyaluronidase in pHT43 (+)
The cDNA encoding the hyaluronidase from S. koganeiensis (SEQ ID NO: 41) was amplified by PCR starting from the plasmid pCR-Bluntll-TOPO [sk_HYAL] extracted and purified from cells of E.coli with DNA Purification System Wizard Plus SV Minipreps and using the following primers: sense
(5 ' -gtaGGATCCGCCGGGGAGAACGGCGCGACGACGA-3 ' SEQ ID NO: 28); antisense (5 ' -gacTCTAGATCACGCCGGTGCGATCGTCGTGACC-31 SEQ ID NO: 29) . The PCR cycles performed for the amplification were: initial denaturation 96 °C for 5 minutes; 30 cycles of annealing 55 °C for 30 seconds, extension at 72 °C for 1 minute, and following denaturation 96 °C for 40 seconds. The Taq DNA polymerase used for the amplification was DyNAzyme II DNA Polymerase
(Finnzymes) (Fig. 8). The amplified product (672bp) was purified by the Kit Wizard SV Gel and PCR Clean-Up System
(Promega) , digested with BamHI (BioLabs) and Xbal
(BioLabs) , and ligated using T4 ligase (Ambion) with the vector pHT43 (+) previously digested with BamHI and Xbal
(Fig. 8) . Once the ligase took place, the vector was transformed inside E. coli strain DH5a cells (Invitrogen code 12297-016) by chemical processing. The cells after transformation are plated in LB agar containing ampicillin (50μς/ιη1) and incubated at 37 °C for 16h. The colonies obtained were analyzed to verify the correct ligase occurred between the hyaluronidase gene fragment and the vector by PCR (initial denaturation at 94 °C for 5 minutes, for 30 cycles: annealing at 55 °C for 30 seconds, extension at 72 °C for 60 seconds, and following denaturation at 94 °C for 1 minute) , thanks to the aid of vector-specific primers (Forward: 5'- TGTGGAATTGTGAGCGGATA -3' (SEQ ID NO: 30), Reverse: 5'- TTTCAACCATTTGTTCCAGGT - 3' (SEQ. ID NO:31)). The PCR product obtained (927bp) together with the products obtained by digestion of the vector pHTsk_HYAL [vector with insert] (Fig. 10) with restriction enzymes (BamHI, Xbal), was analyzed by electrophoresis in 1% agarose gel (Fig. 9), using the reference standards for the molecular weight (ΦΧ174 DNA and ADNA/Hindlll of Fermentas) . For the analysis of the correct frame of the gene encoding the hyaluronidase after being ligated with the vector, the sequence of the PCR product is sequenced. The nucleotide sequence obtained (SEQ ID NO: 38) after sequencing (Fig. 13, a) is analyzed using bioinformatics tools such as ClustalW, Traslate (ExPASy) and Chromas life.
Example 6: Cloning of the gene encoding the hyaluronidase in pET22b ( +)
The cDNA encoding the hyaluronidase from S. koganeiensis (SEQ ID NO: 41) was amplified by PCR starting from the plasmid pCR-Bluntll-TOPO [sk_HYAL] extracted and purified from cells of E.coli with DNA Purification System Wizard Plus SV Minipreps and using the following primers: sense (5'- tggCCATGGCCGGGGAGAACGGCGCGACGACGA-3' (SEQ ID NO: 32)); antisense (5'- ctcGAATTCtcaCGCCGGTGCGATCGTCGTGACC- 3' (SEQ ID NO : 33)). PCR cycles performed for the amplification were: initial denaturation at 96 °C for 5 minutes; 30 cycles of annealing at 55 °C for 30 seconds, extension at 72 °C for 1 minute, and following denaturation at 96 °C for 40 seconds. The Taq DNA polymerase used for the amplification was DyNAzyme II DNA Polymerase (Finnzymes) (Fig. 8). The amplified product (671bp) was purified by the Kit Wizard SV Gel and PCR Clean-Up System (Promega) , digested with Ncol (BioLabs) and EcoRI (BioLabs) , and ligated using T4 ligase (Ambion) with the vector pET22b (+) previously digested with Ncol and EcoRI(Fig. 8). Once the ligase took place, the vector was transformed into E. coli strain DH5a cells
(Invitrogen code 12297-016) by chemical processing. The cells after transformation are plated in LB agar containing ampicillin (5C^g/ml) and incubated at 37 °C for 16h. The colonies obtained were analyzed to verify the correct ligase occurred between the hyaluronidase gene fragment and the vector by PCR (initial denaturation at 94 °C for 5 minutes, for 30 cycles: annealing at 55 °C for 30 seconds, extension at 72 °C for 60 seconds, and following denaturation 94 °C for 1 minute) , thanks to the aid of vector-specific primers (T7-promoter : 5'- TAATACGACTCACTATAGGG-3' (SEQ ID NO : 34), T7-terminator : 5 ' -GCTAGTTATTGCTCAGCGG-3 ' (SEQ ID NO : .35)). PCR product obtained (940bp) together with the products obtained by digestion of the vector pHyal_sk [vector with insert]
(Fig. 11) with restriction enzymes (Ncol, EcoRI), was analyzed by electrophoresis in 1% agarose gel (Fig. 9), using the reference standards for the molecular weight
(ΦΧ174 DNA and ADNA/Hindlll of Fermentas) . For the analysis of the correct frame of the gene encoding the hyaluronidase after being ligated with the vector, the sequence of the PCR product is sequenced. The nucleotide sequence obtained (SEQ ID NO: 39) after sequencing (Fig. 13, b) is analyzed using bioinformatics tools such as ClustalW, Traslate (ExPASy) and Chromas life.
Example 7: Cloning of the gene encoding the hyaluronidase in pET21b+
The cDNA encoding the hyaluronidase from S. koganeiensis (SEQ ID NO: 41) was amplified by PCR starting from the plasmid pCR-BluntII-TOPO [sk_HYAL] extracted and purified from cells of E.coli with DNA Purification System Wizard Plus SV Minipreps and using the following primers: sense (5 ' -ataCATATGGCCGGGGAGAACGGCGCGACGACGA-3' (SEQ ID NO:36)); antisense (5' -ctcGAATTCtcaCGCCGGTGCGATCGTCGTGACC-3 ' (SEQ ID NO : 37)). PCR cycles performed for the amplification were: initial denaturation at 96 °C for 5 minutes; 30 cycles of annealing at 55 °C for 30 seconds, extension at 72 °C for 1 minute, and following denaturation 96 °C for
40 seconds. The Taq DNA polymerase used for the amplification was DyNAzyme™ II DNA Polymerase (FINNZYME) (Fig. 8). The amplified product (672bp) was purified by the Kit Wizard SV Gel and PCR Clean-Up System (Promega), digested with Ndel (BioLabs) and EcoRI (BioLabs) , and ligated using T4 ligase (Ambion) with the vector pET21b (+) (Novagen) previously digested with Ndel and EcoRI (Fig. 8) . Once the ligase took place, the vector was transformed inside E. coli strain DH5a cells (Invitrogen code 12297-016) by chemical processing. The cells after transformation are plated in LB agar containing ampicillin (50 g/ml) and incubated at 37 °C for 16h. The colonies obtained were analyzed to verify the correct ligase occurred between the hyaluronidase gene fragment and the vector by PCR (initial denaturation at 94 °C for
5 minutes, for 30 cycles: annealing at 55 °C for 30 seconds, extension at 72 °C for 60 seconds, and following denaturation at 94 °C for 1 minute) , thanks to the aid of vector-specific primers (T7-promoter : 5'- TAATACGACTCACTATAGGG-3' (SEQ ID O:34), T7-terminator : 5'- GCTAGTTATTGCTCAGCGG-3 ' (SEQ ID NO: 35)).' The PCR product obtained (874bp) together with the products obtained by digestion of the vector pHyal_sk_SL [vector with insert] (Fig. 12) with restriction enzymes (Ndel, EcoRI), was analyzed by electrophoresis in 1% agarose gel (Fig. 9), using the reference standards for the molecular weight
(ΦΧ174 DNA and ADNA/Hindlll of Fermentas) . For the analysis of the correct frame of the gene encoding the hyaluronidase after being ligated with the vector, the sequence of the PCR product is sequenced. The nucleotide sequence obtained (SEQ ID NO: 40) after sequencing (Fig. 13, c) is analyzed using bioinformatics tools such as ClustalW, Traslate (ExPASy) and Chromas life.
Example 8: Host bacterial strains used for cloning and the expression of the hyaluronidase gene from S. koganeiensis.
Escherichia coli strain DH5a (Invitrogen, Genotype: F- cp801acZAM15 Δ (lacZYA-argF) U169 recAl endAl hsdRl7 (rk-, mk+) phoA supE44 thi-1 gyrA96 relAl tonA (confers resistance to phage Tl) [22], was used as host for the plasmid amplification of the cloning system. This strain is provided by Invitrogen (One Shot Max Efficiency DH5a- T1R chemically competent E.coli, 12297-016). The cells were thawed and cultured in solid medium LB agar (lOg/1 peptone from casein, 5g/l yeast extract, lOg/1 NaCl, 15g/l bacteriological agar) containing 10 mM MgS04 and grown for 18h at 37 °C. From the resulting culture, a single colony is taken and grown in TYM broth (tryptone 20g/l, Yeast Extract 5g/l, 20ml 5M NaCl, 1 mM MgS04) at 37 °C. From the culture, the resulting cells are chemically treated to obtain chemically competent cells. The cells obtained are portioned and stored at -80 °C in an appropriate storage buffer containing 15% glycerol. The transformations are carried out on this stock of aliquots .
B.subtilis WB800N (Genotype: nprE aprE epr bpr mpr :: ble nprB :: bsr . vpr wprA :: hyg cm :: neo; NeoR [23]), provided by MOBITEC, is a gram-positive bacterial strain characterized by a deficit of eight proteases, as a result it is a bacterial strain that is used for the production of secreted heterologous proteins. The neomycin resistance gene was also inserted in this gene, taking the nomenclature of WB800N. The cells of this bacterial strain after an appropriate production were made competent, portioned and stored at -80 °C in an appropriate storage buffer containing 15% glycerol. The transformations are carried out on this stock of aliquots .
Escherichia coli strain MG1655 (ATCC number: 12297-016, Genotype: F-lambda- [24 , 25] ) , was used as a host in the expression system of the hyaluronidase gene from S. koganeiensis . The bacterial strain is provided by the American Type Culture Collection (ATCC) . The freeze-dried cells were first cultured in few ml of liquid medium and then in solid medium LB agar (lOg/1 peptone from casein, 5g/l yeast extract, lOg/1 NaCl) containing 10 mM MgS04 and grown for 18h at 37 °C. From the resulting culture, a single colony is taken and grown in TYM broth at 37 °C. From the culture, the resulting cells are chemically treated to obtain chemically competent cells. The cells obtained are portioned and stored at -80 °C in an appropriate storage buffer containing 15% glycerol. The transformations are carried out on this stock of aliquots .
Escherichia coli strain BL21 (DE3) (E. coli BF-dcm ompT HSDS (rB - mB-) gal λ (DE3) [26, 27]), was used as host for the expression system of the gene encoding the hyaluronidase from S. koganeiensis . The bacterial strain is provided by Novagen with code 69450-3. The cells were first cultured in few ml of liquid medium and then in solid medium LB agar (lOg/1 peptone from casein, 5g/l yeast extract, lOg/1 NaCl) containing 10 mM MgS04 and grown for 18h at 37 °C. From the resulting culture, a single colony is taken and grown in TYM broth at 37 °C. From the culture, the resulting cells are chemically treated to obtain chemically competent cells. The cells obtained are portioned and stored at -80 °C in an appropriate storage buffer containing 15% glycerol. The transformations are carried out on this stock of aliquots .
Example 9: Transformation of plasmids pHTsk_HYAL, pHyal_sk and pHyal_sk_SL in expression cells.
DH5a cells respectively containing the vectors pHTsk_HYAL, pHyal_sk and pHyal_sk_SL were put in culture in about 6ml of LB broth with ampicillin (50μg/ml) and. grown for 16-18h. The respective cultures after the growth of the engineered cells are centrifuged at approximately 5000g for 10 minutes. The respective plasmids pHTsk_HYAL, pHyal_sk and pHyal_sk_SL were extracted and purified from the pellet obtained using the kit Wizard Plus SV minipreps DNA Purification System (Promega). The purified vectors pHTsk_HYAL, pHyal_sk and pHyal_sk_SL are separately transformed in expression cells. The first vector is transformed into cells, made competent, of Bacillus subtilis (WB800N- OBITEC) while the other two vectors are transformed into cells, made competent, of E. coli, strain BL21 (DE3) and/or MG1655. All transformations were carried out by chemical processing [13]. The cells of B.subtilis and E.coli after transformation, respectively, are plated in LB agar containing chloramphenicol (ΙΟμΜ) plus neomycin (ΙΟμΜ), and in LB agar containing ampicillin (5C^g/ml) to develop resistance to the antibiotic, and incubated at 37 °C for 16h. The colonies obtained after the respective transformations were analyzed to verify the presence of the correct plasmid within the expression cells, by PCR (initial denaturation at 94 °C for 5 minutes, for 30 cycles: annealing at 55 °C for 30 seconds, extension at 72 °C for 60 seconds and following denaturation at 94 °C for 1 minute) , thanks to the aid of species-specific primers (Forward: 5 ' -TGTGGAATTGTGAGCGGATA-3 ' (SEQ ID NO:
30) , Reverse: 5' TTTCAACCATTTGTTCCAGGT -3' (SEQ ID NO:
31) ) for the analysis of the successful transformation into B.subtilis and to verify the successful transformation in E.coli. (T7-promoter : 5'- TAATACGACTCACTATAGGG-3' (SEQ ID NO:34), T7-terminator : 5'- GCTAGTTATTGCTCAGCGG-3 '(SEQ ID NO: 35)) The PCR products obtained for the cells transformed with pHTsk_HYAL (927bp), pHyal_sk (940bp) and pHyal_sk_SL (874bp) were analyzed by electrophoresis in 1% agarose gel using reference standards for the molecular weight (ΦΧ174 DNA and ADNA/Hindlll by Fermentas) . For the analysis of the correct frame of the gene encoding the hyaluronidase after being bound to the vector, the sequence of the PCR products is sequenced. The nucleotide sequence obtained after sequencing is analyzed using bioinformatics tools such as Vector NTI Advance 9 ( Invitrogen) , ClustalW, Traslate (ExPASy) and Chromas life. (Fig. 13 a,b,c).
Example 10: Assessment of the expression level of the recombinant hyaluronidase .
The clones of B.subtilis found to be positive for the presence of vectors containing the nucleotide fragment of hyaluronidase found genetically with the frame sequence for correct expression (SEQ ID NO: 41) , are tested for the expression level, and then the cells thus engineered are inoculated into flasks containing 500 ml. of LB broth with chloramphenicol (10μΜ, Sigma) and neomycin (10μΜ, Sigma) , and incubated at 37 °C at 250 rpm. When the cell growth value reaches OD600nm 0.8, they are brought with IPTG (Sigma, 16758) to a final concentration of ImM. After 12 hours of induction, the bacterial culture is centrifuged at 7500 rpm for 10 minutes and the culture supernatant is collected to evaluate the expression in B. subtilis .
Subsequently, the supernatant from the expression tests in B.subtilis was concentrated (20 times) and dialyzed in phosphate buffer lx by ultrafiltration on special polyethersulfone filters with cut-off of 5kD.
In SDS-PAGE, the expressed recombinant had a molecular weight of about 24 kDa with the maximum expression after induction with 1 mM IPTG at OD600nm 0.8 after 12 hours at 37 °C.
The expression and localization of the expression of hyaluronidase in the cells of B.subtilis (SEQ ID NO: 21), in the different clones analyzed, was determined by electrophoresis in SDS-PAGE (12%) after staining with Coomassie Brilliant Blue G-250 (BIO-RAD, 161-0406) and with an appropriate enzyme assay, for example Dorfman's assay.
Example 11: Assessment of the expression level of recombinant hyaluronidase in E.coli
The clones of E.coli found to be positive for the respective presence of vectors containing the nucleotide fragment of hyaluronidase found genetically with the frame sequence (SEQ ID NO: 41) for the correct expression (SEQ ID NO: 21) are tested for the expression level, inoculated into flasks containing 500 ml of LB broth with ampicillin (50 g/ml, Sigma) and incubated at 37 °C at 250 rpm. When the cell growth value reaches OD600nm 0.8, they are brought with IPTG (Sigma, 16758) to a final concentration of ImM. The bacterial cells are harvested after. 3-4 hours of induction, by centrifugation at 7500 rpm for 10 minutes. After centrifugation, the bacterial pellet is collected for the assessment of the expression in engineered cells of E. coli and to verify in what portion of the cell the recombinant is produced.
Subsequently, the pellets coming from the E. coli cells induced with IPTG were treated with B-PER Bacterial Protein (PIERCE) according to the instructions provided by the supplier, to assess the expression of hyaluronidase in the periplasmic and/or cytoplasmic portion and/or forming inclusion bodies. Both clones of E.coli respectively containing the plasmids pHyal_sk and pHyal_sk_SL expressed the recombinant in soluble form in the periplasmic portion:
E.coli BL21 (DE3) containing pHyal_sk. In SDS-PAGE, the expressed recombinant has a molecular weight of about 24 kDa, constituting about 40% of the total bacterial proteins after induction at OD600nm 0.8 with ImM IPTG for 3-4 hours at 37 °C. However, of the amount of expressed recombinant, only 18% (only 7.2% overall) is present in soluble form in the periplasm, the remaining 82% has inclusion bodies (only 32.8% overall). The periplasmic soluble portion turns out to be present at a maximum concentration of 52 μg/ml culture, with an enzymatic activity equal to about 2100 U/ml culture.
E.coli BL21 (DE3) containing pHyal_sk_SL. In SDS-PAGE, the expressed recombinant has a molecular weight of about 24 kDa, constituting about 15% of the total bacterial proteins after induction at OD 600 nm 0.8 with lm IPTG for 3-4 hours at 37 °C. Moreover, all the expressed protein is present in soluble form in the periplasm. The periplasmic soluble portion turned out to be present at a concentration of about 125pg/ml culture, with an enzymatic activity greater than 5000 U/ml culture.
Both the expression and localization of the expression of hyaluronidase in the cells of E. coli in the different clones analyzed, was determined by electrophoresis in SDS-PAGE (12%) after staining with Coomassie Brilliant Blue G-250 (BIO-RAD, 161-0406) and with an appropriate enzyme assay, for example Dorfman's assay.
Example 12: Development of the Master Cell Bank and Working Cell Bank of recombinant strains
Master Cell Bank (MCB)
Under sterility, a single colony was taken from from the colonies belonging to the producer strain and resuspended in a sterile flask containing 10ml of liquid medium (LB broth with chloramphenicol (10μΜ, Sigma) and neomycin (10μΜ, Sigma) as regards the recombinant cells of B.subtilis and LB broth with ampicillin (50yg/ml, Sigma) as regards the recombinant cells of E.coli) and incubated at 200rpm at 37 °C for about 16 hours. After the incubation period and after suitable checks on the sterility of the culture, 10ml of each culture were respectively transferred in 100ml of liquid medium (LB broth with chloramphenicol (10μΜ, Sigma) and neomycin (10μΜ, Sigma) as regards the recombinant cells of B. subtilis and LB broth with ampicillin (50μg/ml, Sigma) as regards the recombinant cells of E.coli) and incubated for 5-6 hours at 37 °C at 200rpm. Again, after the incubation period and after appropriate checks on the sterility of the culture, an amount of sterile glycerol was added cold to each culture until reaching a final concentration of glycerol equal to 15%. The mixture is stirred and 2ml aliquots are introduced into cryogenic vials (CORNING, 430659) which are immediately placed at - 80 °C.
The development of the Master Cell Bank was performed under sterile conditions for strains: strain B. subtilis (WB800N-MoBitec) containing the plasmid engineered with pHTsk_HYAL (clone 105), strain E.coli (DH5a) containing the plasmid engineered with pHTsk_HYAL (clone 105), strain E.coli (DH5 ) and E.coli (BL21 (DE3)) containing the plasmid engineered with pHyal_sk (clone 413) , strain E.coli (DH5a) and E.coli (BL21 ( DE3 ) ) containing the plasmid engineered with pHyal_sk_SL (clone 225) and strain E. ( DH5a) and E.coli (BL21 (DE3) ) containing the plasmid engineered with pRH_sk (clone 600) .
Working Cell Bank (WCB)
Under sterility, an aliquot was taken from a vial from the Master Cell Bank and tested in solid medium LB broth with chloramphenicol (ΙΟμΜ, Sigma) and neomycin (ΙΟμΜ, Sigma) as regards the recombinant cells of B.subtilis and LB broth with ampicillin (5C^g/ml, Sigma) or' kanamycin
(3C^g/ml, SIGMA) as regards the recombinant cells of E.coli) and incubated at 200rpm at 37 °C for about 18 hours. Under sterile hood, a single colony was taken from the colonies belonging to the producer strain and resuspended in a sterile flask containing 10ml of liquid medium (LB broth with chloramphenicol (ΙΟμΜ, Sigma) and neomycin (ΙΟμΜ, Sigma) as regards the recombinant cells of B.subtilis and LB broth with ampicillin (5C^g/ml, Sigma) or kanamycin (30pg/ml, SIGMA) as regards the recombinant cells of E.coli) and incubated at 200rpm at 37 °C for about 16 hours. After the incubation period and after suitable checks on the sterility of the culture, 10ml of each culture were respectively transferred in 100ml of liquid medium (LB broth with chloramphenicol
(10μΜ, Sigma) and neomycin (10μΜ, Sigma) as regards the recombinant cells of B.subtilis and LB broth with ampicillin (50μg/ml, Sigma) or kanamycin (30μg/ml, SIGMA) as regards the recombinant cells of E.coli) and incubated for 5-6 hours at 37 °C at 200rpm. Again, after the incubation period and after appropriate checks on the sterility of the culture, an amount of sterile glycerol was added cold to each culture until reaching a final concentration of glycerol equal to 15%. The mixture is stirred and 2ml aliquots are introduced into cryogenic vials (CORNING, 430659) which are immediately placed at - 80 °C.
The development of Working Cell Bank was carried out under maximum sterility and for the strains: strain B. subtilis (WB800N-MoBitec) containing the plasmid engineered with pHTsk_HYAL (rhyaluronidase clone 105), E.coli (BL21 (DE3)) containing the plasmid engineered with pHyal_sk (hyaluronidase clone 413), strain E.coli
(BL21 (DE3) containing the plasmid engineered with pHyal_sk_SL (clone rHyal_Sk) and for strain E.coli (BL21
(DE3) containing the plasmid engineered with pRH_sk
(clone rH_sk) .
The following tests were performed both on MCB and on WCB to assess their purity: assessment of the number of copies of the plasmid from the cells of MCB and WCB, analysis of the plasmid by restriction enzymes and separation of the digested fragments by 1% agarose gel, assessment of the conservation of glycerol in cells containing the expression plasmid in the MCB and WCB, evaluation of the stability of the cells containing the expression plasmid in the MCB and WCB, viability of recombinant cells in LB plates, identity of the strains E.coli, purity of the culture, Coli phage assay, evaluation of the expression product in SDS-PAGE, sequencing of the region encoding the recombinant protein .
Example 13: Batch fermentations of recombinant hyaluronidase .
The ability of clones of E.coli BL21 (DE3) - pHyal_sk and BL21 (DE3)- pHyal_sk_SL to produce the recombinant hyaluronidase was evaluated by growth in fermenters by batch culture.
The inoculum is prepared by inoculating a vial (from the working cell bank stored at -80 °C) in 400 ml of fresh LB medium (ratio 1/20 with respect to the fermentation volume) containing 5C^g/ml ampicillin and incubated at 37 °C at 150 rpm for 16-18 hours. The clones from the respective inocula (E.coli BL21 ( DE3 ) -pHyal_sk and BL21 (DE3) - pHyal_sk_SL) , were separately grown in the fermenter on a minimum culture medium whose composition per liter was given by: 2g Na2HP04*2H20, 2 g KH2PO4, 4g K2HPO4, 3.8 g citric acid, 3.3g (NH4)2SC>4, 40 ml glycerol, 0.6 ml PPG 2000 antifoam (Fluka Code 81380). The pH was corrected after sterilization at 121 °C to 6.8 with a 25% solution of ammonium hydroxide % (SIGMA) , and only adding the following components per liter of medium, sterilized by filtration through 0.2pm filters: 0.49 g MgS04*7H20, 0.0147g CaCl2, 1ml FeC12 (0.2M), 2ml trace elements (trace elements per liter: 0.96g citric acid, 0.25g CoC12*6H20, 1.5g MnCl2*4H20, 0.15g CuCl2*2H20, 1.5 g H3BO3, 0.25g Na2Mo04*2H20, 1.3 g Zn (CH3COO) 2*2H20) , O.Olg thiamine, 5g glucose, 3g yeast extract.
The induction with . Isopropyl β-D-l-thiogalactopyranoside (IPTG) occurs 4-6 hours after inoculation and continued for about 16-18 hours. The fermentation parameters developed were as follows: temperature 37 °C, agitation 600rpm, air flow 5-10 liters air per minute and head pressure of about 0.8 bar.
The bacterial cells are harvested after the induction period of about 16 hours by centrifugation at 7500 rpm for 25 minutes. After collection, the bacterial cells are stored at -80 °C, ready to be used for the extraction and purification o recombinant hyaluronidase. The recombinant protein expressed by E. coli, in the different fermentation parameters, is analyzed by electrophoresis run in SDS-PAGE (12%) after staining with Cooraassie Brilliant Blue G-250 (BIO-RAD, 161-0406), while the enzyme activity is analyzed by turbidimetric assay [ 16] . The cells of E.coli BL21 (DE3) transformed with the vector pHyal_sk are induced to express the soluble heterologous protein in the periplasm, in the fermenter with 8L of medium. In SDS-PAGE, the expressed recombinant had a molecular weight of about 24 kDa and an amount of protein expressed in the cell periplasm of about 0.1 - 0.15 g/L of culture, the maximum quantity reached after 16 hours of induction with ImM IPTG at 37 °C.
The cells of E.coli BL21 (DE3) transformed with the vector pHyal_sk_SL are induced to express the soluble heterologous protein in the periplasm, in the fermenter with 8L of medium. The periplasmic soluble portion turned out to be present at a concentration of about 0.35-0.5g/L culture, with an enzymatic activity greater than 15050- 21495 U/ml culture. . In SDS-PAGE, the recombinant expressed had a molecular weight of about 24 kDa, constituting about 18% of the total bacterial proteins, after induction with ImM IPTG at the sixteenth hour at 37 °C.
For both clones, the stability of the plasmid during fermentation was found to be 100% (Table 2) . The stability of the plasmid is monitored until the end of the fermentation by screening with the replica plating technique [29] which allows replication of the colonies on plates containing the antibiotic.
Example 14: Fed-batch fermentations of recombinant hyaluronidase . The ability of clones of E.coli BL21 (DE3) - pHyal_sk and BL21 (DE3)- pHyal_sk_SL to produce the recombinant hyaluronidase was evaluated by growth in fermenters by fed-batch culture.
The inoculum is prepared by inoculating a vial (from the working cell bank stored at -80 °C) in 500 ml of fresh LB medium (ratio 1/20 with respect to the fermentation volume) containing 50μg/ml ampicillin and incubated at 37 °C at 150 rpm for 16-18 hours. The clones from the respective inocula (E.coli BL21 ( DE3 ) -pHyal_sk and BL21 (DE3) - pHyal_sk_SL) , were separately . grown in the fermenter on a minimum culture medium whose composition per liter was given by: 2 g Na2HP04*2H20, 2 g KH2P04, 4 g K2HPO4, 3.8 g citric acid, 3.3 g (NH4)2S04, 0.6 ml PPG 2000 antifoam (Fluka Code 81380) .. The pH was corrected after sterilization at 121· °C to 6.8 with a 25% solution of ammonium hydroxide % (SIGMA), and., only after having added the following components per liter of medium, sterilized, by filtration through 0.2μπι filters: 0.49g MgS04*7H20, 0.0147g CaCl2, 1ml FeCl2 (0.2M), 2ml trace elements (trace elements per liter: 0.96g citric acid, 0.25g CoCl2*6H20, 1.5g MnCl2*4H20, 0.15g CuCl2*2H20, 1.5g H3BO3, 0.25g N.a2Mo04*2H20, 1.3g Zn (CH3COO) 2*2H20) , O.Olg thiamine, 5g glucose, 3g yeast extract.
A. solution of glycerol (-1.2 kg per, 1.0L fermentation) sterilized in an autoclave was given as a feed and the following components, previously filtered with 0.2 μπι filters, were then added per liter of feed: 2 g Na2HP0 *2H20, 3 g KH2P04, 5.4 g K2HP04, 3.8 g citric acid, 4 g (NH4)2S04, 9 g MgS04*7H20, 0.047 g CaCl2, 1 ml FeCl2 (solution 0.2M), 2 ml- trace elements (trace elements per liter: 0.96 g citric acid, 0.25 g CoCl2*6H20, 1.5 g MnCl2*4H20, 0.15 g CuCl2*2H20, 1.5 g H3BO3, 0.25 g Na2Mo04*2H20, 1.3 g Zn (CH3COO) 2 *2H20) and O.Olg thiamine. The feed is given 6 hours after inoculation until the nineteenth hour with an exponential ratio of addition. The choice to use glycerol as a carbon source is due to the fact that the expression cells of E. coli used generate acetic acid (acetate) as an undesired by-product that has numerous adverse effects on the production of recombinant proteins [14]. In particular, the cells of E.coli produce acetic acid as an extracellular co-product of the aerobic fermentation, the rate of formation of acetate is directly related to the rate at which the cells grow or to the rate at which they consume the solid substrate as a carbon source, glucose. In common fed- batch fermentation systems, the growth rate of the culture is determined by the speed of feeding of the "glucose" limiting nutrient resulting in cell growth above the threshold which leads to a consequent production of acetate and thus to a reduction of expression of recombinant proteins.
In this invention, various strategies have been developed to limit the accumulation of acetate in order to reduce the negative effects and increase the productivity of the recombinant protein. A strategy that has allowed us to obtain excellent results was to use glycerol as a carbon source. Glycerol, unlike glucose, is not fermented to acetic acid. The results obtained showed that the use of glycerol, rather than glucose, in the fed-batch fermentation process developed in this invention has improved the yield of the soluble recombinant protein hyaluronidase of about 2 - 3 times [15] . Moreover, unlike glucose which has an inhibitory effect on the promoter that regulates the synthesis of the recombinant protein of this invention, the glycerol can be given to fermentation also after induction with IPTG, allowing the reduction not only of the formation of acetate but also the increase of the soluble formation of recombinant hyaluronidase. Furthermore, the low cost of glycerol compared with glucose makes it preferential as a carbon source for the fermentation of E. coli, in the industrial field.
After induction with Isopropyl β-D-l- thiogalactopyranoside (IPTG), ImM final solution, the feed is administered to the culture every hour and in the same amount as the last addition for 5 hours. The induction started 24 hours after inoculation and continued for 12 hours. The fermentation parameters developed are as follows: temperature 37 °C, agitation 600rpm, .air flow 5-10 liters air per minute and head pressure of about 0.8 bar.
The bacterial cells are harvested after the induction period of 12 hours by centrifugation at 7500 rpm for 25 minutes. After collection, the bacterial cells are stored at -80 °C, ready to be used for the extraction and purification of the recombinant hyaluronidase. The recombinant protein expressed by E. coli, in the different fermentation parameters, is analyzed by electrophoresis run in SDS-PAGE (12%) after staining with Coomassie Brilliant Blue G-250 (BIO-RAD, 161-0406), while the enzyme activity is analyzed by turbidimetric assay [ 16] . . The cells of E.coli BL21 (DE3) transformed with the vector pHyal_sk are induced to express the soluble heterologous protein in the periplasm, in the fermenter with 10L of medium. In SDS-PAGE, the recombinant expressed had a molecular weight of about 24 kDa and an amount of protein expressed in the periplasm of about 0.4 g/L of culture, the maximum quantity reached after 6 hours of induction with ImM IPTG at 37 °C (Figure 14). The cells of E.coli BL21 (DE3). transformed with the vector pHyal_sk_SL are induced to express the soluble heterologous protein in the periplasm, in the fermenter with 10L of medium. The periplasmic soluble portion turned out to be present at a concentration of about 1.2 g/L culture, with an enzymatic activity greater than 48000U/ml culture. In SDS-PAGE, the recombinant expressed had a molecular weight of about 24 kDa, constituting about 16-18% of the total bacterial proteins, after induction with ImM IPTG at the twelfth hour at 37 °C ( Figure 15 ) .
Example 15: Fedbatch fermentation of E.coli BL21 (DE3) transformed with the vector pHyal_sk_SL on 20L medium. Briefly, the cells of E.coli BL21 (DE3) transformed with the vector pHyal_sk_SL are induced to express the soluble heterologous protein in the periplasm, in the fermenter with 20L of medium. The periplasmic soluble portion was found to be present at a concentration of about 2g/L of culture (Table 2) with an enzymatic activity greater than 87000U/ml culture (7.5 xl07-8, 7x107 IU/1 of culture), approximately 670-750 times higher compared to the autologous hyaluronidase produced in the fermenter as described in the above patent [9]. In SDS-PAGE, the expressed recombinant had a molecular weight of about 24 kDa, constituting about 16-18% of the total bacterial proteins, after induction with lmM IPTG at the twelfth hour at 37 °C.
The stability of the plasmid during the fermentation phase, for all clones tested with the fed-batch method, was 100% (Table 2) . The stability of the plasmid is monitored until the end of the fermentation by screening with the replica plating technique [29] which allows replication of the colonies on plates containing the antibiotic .
Finally, clones genetically engineered in a different way,, were tested for their capacity to produce, in the fermenter, the recombinant hyaluronidase encoded by the gene isolated according to this invention. The results are summarised in Table 1.
Example 16: Analysis of recombinant hyaluronidase activity in the fermentation broth
From 0.1 ml of culture from specific induction times or from the final product, the pellet was obtained after centrifugation at 7500 RPM centrifuge (Eppendorf centrifuge 5402, rotor F-45-18-11) for 10 minutes. The cell pellet was resuspended in 500μ1 of B-PER Bacterial Protein Extraction Reagent (PIERCE) and mixed by vortexing (Heidolph Reax top) at maximum speed for about 1 minute or until complete resuspension of the pellet. The suitably resuspended pellet was centrifuged at 13000 RPM for 10 minutes to separate the soluble proteins from insoluble proteins. The collected supernatant (soluble proteins) was tested for the presence of hyaluronidase activity using the turbidimetric method described by Di Ferrante [16] modified for analysis on 96-well plates. Briefly, for single well, 31μ1 of incubation buffer [17], 8μ1 of BSA (0.2 mg/ml) , 8μ1 of hyaluronic acid (2mg/ml) , 13μ1 of H2O and ΙΟμΙ of the supernatant (soluble proteins) diluted 10, 100 and 1000 times with lx PBS (Sigma-P4417 ) , were set up. The plate is incubated at 37 °C for an hour. After one hour of incubation, 200μ1 of CTAB alkaline solution (2.5% (w/v) in 0.5 M NaOH) were added to each well to precipitate the undigested hyaluronic acid and the plate is incubated for 20 minutes at room temperature. The extent of precipitation was measured at an optical density of 640nm.
Subsequently, the activity per ml of recombinant protein in the culture broth was obtained using the following calculation: activity of ml obtained from the test/2 x dilution factor x 10 = activity on ml of product from fermentation .
A Hyaluronidase standard (FIP) was used to construct a standard curve and the activity of the recombinant hyaluronidase in the periplasmic portion was calculated using this curve.
Example 17: Large-scale extraction of the soluble fraction
From pellet stored at -80°C (deriving from the fermentation of E.coli BL21 (DE3) transformed with the pHyal_sk_SL vector) an amount equivalent to 0.6 liters of fermentation product (approximately equivalent to the range of 80-90g cell pellet, reflecting approximately a production of 1-1.2 g/L recombinant hyalurodinase ) is placed to equilibrate for 45 minutes at room temperature. First method: Once equilibrated, the pellet was treated with 210 ml fresh solution (5°C) for the dispersion of pellet (205.2g/L glucose, 5.6g/L EDTA) . The pellet is resuspended, with the dispersion solution, under magnetic stirring for 15 minutes at room temperature and subsequently for about 1 hour at 5°C, using a magnetic stirrer Heidolph type MR2002 at a speed of 500rpm. After about 1 hour the resuspended pellet is added cold in a 4.5L solution for osmotic shock (1.2g/L TRIS, 4ml/L HC1 2N, 0. lg/L MgC12) for the extraction of the periplasmic protein. The mixture obtained is stirred for 4 hours at 4°C, using a magnetic stirrer Heidolph type MR2002 at a speed of 500rpm.
After the osmotic shock step, the product obtained containing the dispersed E.coli cells was centrifuged at 5°C for 45 minutes at speeds of about 7500rpm using a Sorval Evolution Rc centrifuge with SLC-6000 rotor. After centrifugation, the supernatant is collected while the pellet is eliminated. At this point, the supernatant was homogenized using the "Ultra Turrax" system with speed level 2 for 15 seconds.
The supernatant, after treatment with "Ultra Turrax", was brought to pH 8 and filtered by gravity with 0.65pm filters. After filtration, the concentration of Tris in the filtrate was brought from lOmM to 50mM with a 3M Tris-HCl solution and later brought to pH 8. The concentration of the extracted hyaluronidase was assessed in SDS-PAGE and found to be of about 750-850mg/total (22- 24% of total periplasmatic proteins) . The activity of the extracted recombinant hyaluronidase is instead assessed by Dorfman's turbidimetric method.
Second method: Once equilibrated, the pellet was treated with the 500 ml B-PER Bacterial Protein Extraction Reagent ( PIERCE) solution for the release of the periplasmatic proteins in the medium. The pellet is resuspended, with the B-PER solution, under magnetic stirring for 30 minutes at room temperature and subsequently for further 30 minutes at 5°C, using a magnetic stirrer Heidolph type MR2002 at a speed of lOOOrpm. After about 1 hour the resuspended pellet is centrifuged at 5°C for 45 minutes at a speed of about ll,000rpm using a Sorval Rc-5B centrifuge with Sorvall rotor. After centrifugation, the resulting supernatant was added cold in a 5L 50mM Tris-HCl solution, pH 8. The solution obtained is stirred for 10 minutes at 4°C, using a magnetic stirrer Heidolph type MR2002 at a speed of 200rpm. After stirring, the solution was homogenized using the "Ultra Turrax" system with speed level 2 for 15 seconds. The supernatant, after treatment with "Ultra Turrax", was brought to pH 8 and filtered by gravity with 0.65ym filters. The concentration of the extracted hyaluronidase was assessed in SDS-PAGE and found to be of about 0.9-1. lg/total (16%-18% of total periplasmic proteins) . The activity of the extracted recombinant hyaluronidase is instead assessed by Dorfman's turbidimetric method.
Example 18: Recombinant purification
The resins and the chromatographic columns were purchased from GE Healthcare Life Sciences and maintained according to the manufacturer's specifications. The balance and elution steps were carried out with a Fast Performance Liquid Chromatography (FPLC; AKTA explorer 100, GE Healthcare) system at a flow of 40-50ml/min for all 3 chromatographies. At the end of each chromatographic step the hyaluronidase activity was controlled with the modified Dorfman's assay described [9]. Once the soluble fraction is extracted from the periplasmic portion, it is loaded on the first strong ion-exchange chromatography. Strong ion-exchange chromatography (Q sepharose XL) :
The filtered extract brought to 50mM Tris-HCl and pH 8 was loaded on 500ml-600ml Q sepharose XL resin (GE Healthcare) packed in a XK-50 (GE Healthcare) column and equilibrated with 8 bed volumes (BVs) of Tris-HCl buffer at pH 8. After loading, the column was washed, first with 3 BVs of the same buffer and subsequently with 8 BVs of Tris-HCl buffer at pH 8 with 40mM NaCl, then the bound proteins were eluted with 5 BVs of a Tris-HCl buffer solution at pH 8 with llOmM NaCl . The eluted proteins were collected in a single fraction having a volume of about 950 ml and subjected to hyaluronidase activity assay.
Diafiltration and weak ion-exchange chromatography (CM- Sepharose® Fast Flow) :
The fraction obtained is concentrated to 100ml using the tangential ultrafiltration Labscale TFF System (Millipore) and using Polyethersulfone (PES) filters with cut-off comprised between 3 and 8kDA, preferably of 5kDa. After concentration, the sample is diluted 10 times with 50mM sodium acetate buffer at pH 4. The fraction thus obtained was loaded on 300ml-400ml CM-Sepharose® Fast Flow resin (GE Healthcare) , packed on a XK-50 column (GE Healthcare) and equilibrated with 6 bed volumes (BVs) of 50mM sodium acetate buffer at pH 4.0. After loading (preferably at a temperature of 4-5°C), the column was washed with 3 BVs of the same buffer, then the bound proteins were eluted with 8 BVs of a 50mM sodium acetate buffer solution at pH 4.5. The eluted proteins were collected in a single fraction having a volume of about 380 ml and subjected to hyaluronidase activity assay. Diafiltration and aromatic hydrophobic interaction chromatography ( Phenyl-Sepharose HP) .
The fraction obtained and positive to the enzymatic dosage is concentrated to 100ml using the tangential ultrafiltration Labscale TFF System (Millipore) and using Polyethersulfone (PES) filters with cut-off comprised between 3 and 8kDA, preferably of 5kDa. After concentration, the sample is diluted 10 times with 50mM sodium phosphate buffer with 1.5M ammonium sulphate, pH 7. The fraction thus obtained was loaded on 300ml-400ml Phenyl-Sepharose HP resin (GE Healthcare) , packed on a XK-50 column (GE Healthcare) and balanced with 8 bed volumes (BVs) of 50mM sodium phosphate buffer with 1.5M ammonium sulphate, pH 7. After loading, the column was washed with 3 BVs of the same buffer, then the bound proteins were eluted with 5 BVs of a 50mM sodium phosphate buffer solution with 0.8M ammonium sulphate, pH 7. The eluted proteins were collected in a single fraction having a volume of about 730 ml and subjected to hyaluronidase activity assay. After the enzymatic activity assay, the eluted fraction was subjected to ultrafiltration and dialysis with 10 volume lx PBS (SIGMA-P4417) , using Polyethersulfone (PES) filters with cut-off comprised between 3 and 8kDA, preferably of 5kDa, brought to a concentration of about lmg/ml and filtered with 0.2μιη filters (protein concentration is determined by BCA Protein Assay Reagent Kit, PIERCE). During the purification steps to obtain a good recovery of the purified product, the recombinant portion is loaded on the chromatographic columns with a maximum ratio of 1.5mg hyaluronidase per ml of resin. All the eluted protein fractions, both those enzymatically active, and those inactive or poorly active, were then analyzed by SDS-PAGE at 12% and then stained with silver stain according to the manufacturer's instructions; in all the fractions having hyaluronidase activity there was a marked protein band of about 24kDa (Fig. 16) . In the different steps of purification, the protein concentration of the recombinant portion was . estimated as previously described in SDS-PAGE (12%) and found to be of total 0.45-0.5g/L in the first chromatography (Q sepharose XL), total 0.45- 0.50g/L in the second chromatography (CM-Sepharose® Fast Flow), total 0.4-0.45g/L in the third chromatography (Phenyl-Sepharose HP) and total 0.35-0.4g/L after DIA- filtration. At the end of the purification process applied on about 1L of fermentation product, about 600- 650mg (Enzymatic activity greater than 2.6xl07U/L purified fermentation product) of recombinant hyaluronidase (Table 3) were obtained.
Example 19: Analysis and characterization
Determination of hyaluronidase activity
The hyaluronidase activity was measured with the modified Dorfman's method [10]. Briefly, the product obtained by the different steps of the process was diluted in 0.03M phosphate buffer, 0.82% NaCl, pH 6.3 and 1ml of the thus obtained solution was mixed with 1ml substrate buffer (0.03M phosphate buffer, NaCl 10.82%, pH 6.3) containing 0.5mg hyaluronic acid. The enzymatic digestion was carried out at 37 °C for 30 minutes and at the end of the incubation process, turbidity was generated by adding a 4ml horse serum-based acidic solution (SIGMA). The optical density at 640 nm was measured exactly 30 minutes after the addition of the horse serum acidic solution. A standard of hyaluronidase from mammal testicles (EDQM, FIP Hyaluronidase, H1115000) containing 328 IU/mg was used to construct a standard curve and the activity (in units) of the samples was calculated using this curve. SDS-PAGE electrophoresis
The electrophoretic assays on polyacrylamide gel in the presence of sodium dodecyl sulfate (SDS-PAGE) were carried out using Laemmli's method [11] on 12% polyacrylamide gel, using a Mini-PROTEAN 3 (BIO-RAD) according to the manufacturer's instructions. The concentration and the molecular weight of the hyaluronidase in the fermentation product and in different purification steps were estimated by comparison with standard low molecular weight proteins (GE Healthcare) .
The polyacrylamide gels suitably stained with Coomassie (BIO_RAD) after the electrophoretic run, were acquired by a laboratory image capturing device ImageQuant™ 300 TL (GE Healthcare) , while (quantitative and qualitative) assays were performed using the image analysis software ImageQuant TL (GE Healthcare) .
N-terminal end sequencing
The N-terminal amino acid sequencing was carried out according to Edman's degradation method using an automated protein sequencer in pulsed liquid phase (ABI- Perkin Elmer Mod. 477A) . BLAST software [18] was used to conduct homology research in the GenBank database and in that of the human genome project of the Streptomyces species available on the web. The fractions, obtained by the purifications of the E.coli strain transformed with the pHyal_sk vector and the E.coli strain transformed with the pHyal_sk_SL vector according to the invention, were subjected to SDS-PAGE electrophoresis on 12% gel, as described above, then to blotting on polyvinylidene difluoride membrane (BIO-RAD) and stained according to the manufacturer's instructions. The band relating to hyaluronidase for both productions was separated with a scalpel, trying to obtain a piece as small-sized as possible (3mm x 10mm) and was loaded in the reaction chamber of the sequencer.
The sequencing of the N-terminal end, conducted as described hereinbefore, allows to determine that the two recombinant hyaluronidases produced and coming from two used different genetic engineering and expression systems, contain differences in the N-terminal amino acid sequence. In case of E.coli sample transformed with the pHyal_sk_SL vector according to the invention, the assay provided chromatograms in which a single N-terminal amino acid sequence was significantly present, allowing to reconstruct the test sequence reported hereinafter: AGENGA (SEQ ID NO: 42). The above-mentioned experimentally determined sequence corresponds to the N- terminus of the protein isolated in its autologous form described by [9] free from methionine at position 1. In case of the E.coli sample transformed with the pHyal_sk vector according to the invention, the assay instead detected the presence of at least two N-terminal amino acid sequences, reported hereinafter is the listing of the N-terminal amino acids detected by the sequencing: Most represented sequence MAGENGA (SEQ ID NO: 43) which corresponds to the N-terminus of the mature protein with methionine at position 1, and a less represented sequence AQPAMAMAGENGA (SEQ ID NO: 44) which corresponds to the partially mature protein (contains sequence AQPAMAM (SEQ ID NO: 45) belonging to the signal peptide apparently not totally deprived of the protein by the cell system) .
Comparison of hyaluronidase activity between the heterologous and autologous form.
The enzymatic potential of the hyaluronidase according to the invention (E.coli transformed with the pHyal_sk_SL vector) was assessed by comparison with the enzymatic activity of the autologous hyaluronidase [9], using the enzymatic assay described [9] and the activity value is reported to be in both cases greater than 4xl04IU/mg (the protein concentration was determined by BCA Protein Assay Reagent Kit, PIERCE) .
The result of this assay shows that hyaluronidase according to the invention, in particular of the form coming from the E.coli strain engineered* with the pHyal_sk_SL plasmid, has the same activity as the autologous form. However, by means of the production and purification methods described in the invention it was possible to accurately assess the value of the enzymatic activity of the recombinant hyaluronidase according to the invention, which was found to be greater than 40, OOOU/mg protein.
UV spectra analysis and comparison of spectra of circular Dichroism of the heterologous and the autologous forms. Circular dichroism (CD) experiments: Spectra at the Far- UV circular dichroism were collected at room temperature on a Jasco spectropolarimeter J-715 model, with quartz cell having path length of 1 millimeter. Other test settings were: scan speed, lOnm/min, sensitivity, 50 MDEG, time constant:, 16s, bandwidth, 3nm. The circular dichroism measurements were conducted on protein solutions (autologous hyaluronidase, recombinant hyaluronidase according to the invention) at concentration of 2,10~6 M. All the samples were diluted at a final concentration of 2,10~6 M using ultra-pure water. The CD spectra were collected at 260-195nm blank corrected and adjusted for dilution.
The circular dichroism spectra are reported in Figure 17. The overlay files match: the lower, line corresponds to the autologous hyaluronidase [9] and the upper one corresponds to the heterologous hyaluronidase according to the invention. The two spectra have a superposable profile, confirming the same structure for both the samples (Fig. 17-a) . The small difference which is noted may be attributed to the not perfect coincidence of the concentrations of the two solutions.
From the UV spectra, the recombinant hyaluronidase sample does not show aggregation. From this study it may be inferred that the preparation according to the invention has a secondary structure very similar to that of the autologous hyaluronidase [9] and that the protein produced according to the present invention does not show aggregation (Fig. 17-b) .
Mass spectrometry
The mass spectrometry assays for determining the molecular weight were conducted using Quattro micro mass spectrometer (Waters), while the assay of peptide mapping to confirm the identity of the primary structure of the recombinant portion was carried out using the accurate mass values of the peptides determined by means of the MALDI-MS Voyager DE-PRO system (Applied Biosystems, Firmingham MA, USA) after separation in RP-HPLC.
The fraction obtained after purification of recombinant hyaluronidase according to the invention was subjected to digestion with trypsin, after separation in RP-HPLC, the peptide mixture produced for each sample was analyzed by MALDI-MS in reflector mode. The study and interpretation of the MALDI spectra acquired therefore respectively allowed verifying 97% identity of the primary structure of the reference amino acid sequence [9] and over 94% identity of the primary structure of the theoretical amino acid sequence according to the invention (peptide sequence predicted by http://web.expasy.org/translate/) with the amino acid sequence of the sample produced according to the invention (SEQ ID NO: 21) .
Furthermore, the fraction obtained after purification of the recombinant hyaluronidase according to the invention was subjected to determination of molecular weight of the protein by means of mass spectrometry and the result of the assay is reported in Figure 18.
Isoelectric focusing
The protein fraction to be analyzed (recombinant hyaluronidase obtained according to the invention) is mixed in a suitable loading buffer and loaded onto IPG strips at pH 3-10 (ReadyStrips 7cm, BIO-RAD) ; incubation is performed at 25°C until absorption of the sample and the strip is loaded onto the PROTEAN IEF Cell (BIO-RAD) for isoelectric focusing (IEF) . At the end of the isoelectric focusing run the strip is stained with IEF Gel Staining solution (BIO-RAD) for 45 minutes and then destained. with Destain solution (BIO-RAD) . The destained IPG strips were acquired by a laboratory image capturing device ImageQuant 300 TL (GE Healthcare) while (quantitative and qualitative) assays were performed using the image analysis software ImageQuant TL (GE Healthcare) .
The isoelectric point of the sample was determined by comparison with the isoelectric points of the reference standards (IEF Marker pH 3-10, SERVA) . The result of the assay is reported in Figure 19.
Characterization by capillary electrophoresis of the recombinant hyaluronidase and determination of the molar extinction coefficient.
The qualitative-quantitative assay of the protein fraction to be analyzed (recombinant hyaluronidase obtained according to the invention) was performed by BIOTEKNET (Napoli, Italy) by means of capillary electrophoresis with a P/ACE MDQ Beckman-Coulter instrument equipped with diode-array detector and UV lamp, using a capillary of fused silica (50cm actual length, 60.2cm total length, 50μπι inner diameter) and a 20mM sodium citrate buffer, at pH 2.5, applying an e.p.d. of 25kV (ensuring a greater stability in the electrophoretic separation process and of the current used) for 15 min and detecting the absorption at 200nm. Before proceeding with the sample assay, the BSA (bovine serum albumin) was suitably analyzed at three different concentrations (lmg/mL; 0.8mg/mL; 0.4mg/mL), using the above-mentioned method and thereby obtaining a calibration straight line. The assay was carried out on the same sample twice diluted (Fig. 20) . In both electropherograms it is possible to identify the presence of a single peak (Purity 100%) having migration time of 7.7 ± 0.9 min and the protein quantification, although affected by a calibration with external standard (BSA) , therefore not with the same protein, returns a high purity, and a quantification superimposable to the expected one (~lmg/ml) . The research work on the determination of the molar extinction coefficient of the recombinant hyaluronidase may be divided into four experimental moments: 1. Densitometric assay of the hyaluronidase samples of the invention, 2. Spectrophotometric assay of the hyaluronidase samples of the invention, 3. Identification of theoretical absorbance, 4. Identification of the molar extinction coefficient .
At this point, once collected the information in the preceding steps, the Beer-Lambert law is applied: A = el* 1 * ' C where el is referred to as molar absorption coefficient, C is the molar concentration of the solution and 1 is the optical path. Based on this formula and on our obtained information, the molar absorption coefficient, at a wavelength of 280nm, is as follows: 12383 L*mol-l*cm-l . Abs 0.1%(=lg/L) 0.570 (Molar extinction coefficient of hyaluronidase produced according to the present invention) .
HPLC assay by means of gel filtration
For the assays by means of gel filtration the LC-10AD HPLC instrument (SHIMADZU) was used with a Bio-Sil SEC column (BIO-RAD) , eluting with 0.05M NaH2P04, 0.05M Na2HP04, 0.15M NaCl, pH 6.6, at lml/min. The absorption wavelength used was 214nm (SPD-10A, SHIMADZU) . The purity of the protein was determined using the software LC solution 1:21 SP1. The fraction obtained after purification of recombinant hyaluronidase as described in the invention was subjected to gel filtration column HPLC as described above. The result of the assay on purity of the recombinant portion is reported by the chromatogram in Figure 21-a and is of 100%.
Determination of the level of purity by means of RP-HPLC. For the purity assays by means of Reversed-Phase HPLC the LC-10AD HPLC instrument (SHIMADZU) was used with a Vydac 214ATP54 C4 (Grace Davison Discovery Sciences) column, eluting with 50mM Tris pH 7.5 with 1-propanol, at 0.5ml/min. The absorption wavelength used was 220 nm (SPD-10A, SHIMADZU) . The purity of the protein was determined using the software LC solution 1:21 SP1. The fraction obtained after purification of the recombinant hyaluronidase as described by the invention was subjected to RP-HPLC on a (reversed) hydrophobic-phase column as described above. The result of the assay on purity of the recombinant portion is reported by the chromatogram in Figure 21-b and is very close to 100%.
Characterization of the bacterial recombinant hyaluronidase by means of electrophoresis on polyacrylamide gel.
The electrophoretic assays on polyacrylamide gel in the presence of sodium dodecyl sulfate (SDS-PAGE) were carried out using' Laemmli ' s method [11] on 12% polyacrylamide gel, using a Mini-PROTEAN 3 (BIO-RAD) according to the manufacturer's instructions. The concentration and the molecular weight of the hyaluronidase in the fermentation product and in different purification steps were estimated by comparison with standard low molecular weight proteins (GE Healthcare) .
The polyacrylamide gels, suitably stained with Coomassie (BIO_RAD) after the electrophoretic run, were acquired by a laboratory image capturing device ImageQuant 300 TL (GE Healthcare) , while (quantitative and qualitative) assays were performed using the image analysis software ImageQuant TL (GE Healthcare) .
On the other hand, for the Western Blot assay, the proteins were fractioned in SDS-PAGE at 12% and transferred to nitrocellulose membranes. The proteins of interest were then identified by incubation with a 1:2000 dilution of anti-hyaluronidase antibody (Abnova) in 10% dry milk/PBS for 12 hours, and the specific reaction was highlighted by means of the addition for 1 hour of mouse anti-IgGs secondary antibodies conjugated with alkaline phosphatase, followed by detection with the BCIP/NBT substrate (BUF045A, SEROTEC) .
The production of recombinant hyaluronidase according to the invention from E.coli BL21(DE3) engineered cells and therefore without the presence of animal derivatives allowed producing the protein with a high specific enzymatic activity (>40000 Units/mg of protein) . The recombinant protein produced according to the invention had a level of purity 100 times higher than that of the hyaluronidase standard from mammal testicles (EDQM, FIP Hyaluronidase, H1115000) as shown in Figure 22. While recombinant hyaluronidase purified according to the invention . after migration on 12% SDS-PAGE gel and GelMate Blue (EuroClone) coomassie staining had a single band, the bovine hyaluronidase, available on the market, showed several impurities. A smaller band (at about 75-80kDa) in the smear of proteins of the bovine hyaluronidase reacted with an anti-hyaluronidase polyclonal antibody (Abnova) by Western Blotting, confirming that enzyme hyaluronidase is a smaller component of hyaluronidase preparations derived from animals (Fig. 22).
Endotoxin detection
The Limulus Amebocyte Lysate Tes.t (LAL) ,. which uses the reagent prepared from blood of limulus Poliphemus, showed to be the most sensitive and specific test to detect and measure the level of . bacterial endotoxins in raw materials used in the production and for the "in-process" monitoring of endotoxin levels. Endotoxins, more commonly known as pyrogens, cause from fever to irreversible shock, from difficulties in blood and tissue exchanges to lethal consequences.
With the recombinant hyaluronidase being produced according to the invention in E.coli cells, it was essential to assess the level of endotoxins in the final product. To this end, we used the method of "Chromo-LAL" , a kinetic chromogenic test for the quantitative detection of endotoxins produced by Gram-negative bacteria. Briefly, in the "Chromo LAL (art 32427, PBI S.p.A - Italy)" test, the lysate and the chromogenic reagent substrate co-freeze-dried were mixed with the hyaluronidase sample (produced according to the invention) in a multiwell micro-plate (96 wells) and incubated at 37±1°C in a suitable reader (ELX 808 IU, BioTek) . The absorbance values read were collected and analyzed by a dedicated software. The time required for hyaluronidase sample to reach a specific absorbance value (optical density) was calculated. Furthermore, a standard calibration curve (CSE, lot.104, art.17078, PBI S.p.A - Italy) was built which shows the linear correlation between the "start time" log and the log of standard endotoxin concentration.. The maximum range between the endotoxin concentrations of the standard curve is 0.005EU/ml-50EU/ml. The sensitivity [19] of the test was defined from the lowest concentration of endotoxin used to build the standard curve. The maximum sensitivity of this test is 0.005EU/ml.
The endotoxin concentration for the corresponding "start time" of the hyaluronidase sample was read from the standard curve which is. a log-log diagram deriving from the scores obtained calculating the "start times" versus standard concentrations.
At the end, the estimated value of endotoxins in the hyaluronidase sample produced according to the invention was calculated by the Gen5 software (BioTek) resulting to be very low, that is lower than 0.5 endotoxin units per milligram of recombinant hyaluronidase (Table 4).
Determination of proteins and DNA deriving from host cells, As regards the determination of proteins deriving from E.coli host cells used for the heterologous expression of recombinant hyaluronidase (as described by the present invention) the ELISA method was used, in particular, the Enzyme Immuno Assay kit "E.coli HCP" from Cygnus technologies (F010). The assay is based on the sandwiched use of affinity-purified antibodies directed to a mixture of 6 E.coli strains commonly used for cloning and expression of recombinant proteins.
The test was performed according to the manufacturer's instructions, on the purified sample of recombinant hyaluronidase, the concentration of proteins deriving from E.coli (host strain) is directly proportional to the development of color caused by enzymatic reaction of alkaline phosphatase conjugated to the antibody.
The concentration of proteins deriving from the host strain towards the standard concentrations was estimated (calculation and calibration of the curve were performed by the GEN 5 software, BioTek) in the sample of hyaluronidase produced according to the invention to be lower than lOppm as shown in Table 4 (the limit approved by the competent authorities is below lOOppm) .
On the other hand, the determination of the quantity of DNA from the host strain of E.coli was carried out in the sample of recombinant hyaluronidase (produced according to the invention) , using the DNA Threshold method.
This assay was performed at the Charles River Biopharmaceutical services GmbH laboratories, Germany. The studies indicated with the code M1/F07/12 and M2/F07/12 gave as a final result a very low level of DNA deriving from the cell host, calculated to be lower than 20pg (the limit approved by the competent authorities is lower than or equal to 300pg/mg of protein) per milligram of recombinant hyaluronidase (Table 4).
Example 20: Assay on agarose gel of hyaluronic acid depolymerization
For the in vitro assessment of the capability of recombinant hyaluronidase, produced according to the invention, of depolymerizing hyaluronic acid (Hyalgan®; Fidia S.p.A., Italy) in its primary constituents N- acetylglucosamine and glucuronic acid, the electrophoretic assay method in agarose gel [20] was used after hyaluronic acid is digested with 1 unit of recombinant hyaluronidase within the indicated times from 5 minutes to 24 hours.
Briefly, the hyaluronic acid samples (500kD-730kD) , after reacting with recombinant hyaluronidase within the indicated times (from 5 minutes to 24 hours) were separated using the Sub-CellGT electrophoresis system (BIO-RAD) and gels with 1% agarose (25cm in length) . The samples were migrated in. electrophoresis for about 12 hours at a temperature of about 16°C with a constant voltage of 50 Volts. Staining is carried out as described in previous studies [20].
The results shown in Figure 23 indicated that the recombinant hyaluronidase, produced according to the invention, is capable of completely digesting the substrate until reaching undetectable levels of hyaluronic acid before 24 hours.
Example 21: Stability against proteolytic enzymes
Hyaluronidase is an enzyme hydrolyzing hyaluronic acid, therefore increasing the permeability of connective tissue enhancing the diffusion and dispersion of the drug, that is administered locally subcutaneously, in the surrounding tissues.
In some treatments, hyaluronidase is administered in low doses (the typical dose used is 15 units), to reduce the damages caused by the leakage of antibiotics, hyperosmotic solutions, acid or basic solutions, or the correction of hyaluronic acid-based fillers to avoid allergic and anaphylactic reactions. Therefore, it is fundamental for the hyaluronidase to be stable at these doses towards the proteolytic enzymes present in connective tissue, which may easy degrade it once injected, inhibiting its action. In order to test and compare the resistance of recombinant hyaluronidase with respect to the bovine one currently used in the market, against proteolytic enzymes, a turbidimetric model for in vitro assays was provided. Briefly, recombinant hyaluronidase (prepared according to the invention) at the concentration of 10U (<250ng) and the bovine hyaluronidase 100.U (300 g) were treated separately with two different doses of Pronase E (200 g and 500 g) in a phosphate buffer solution (pH 7.0) at 37 °C for 1 hour, 24 hours and 48 hours. The residual enzymatic activity (expressed as percentage) of the two concentrations of enzymes treated and not treated with Pronase E was measured according to Dorfman's method as described in the patent. The results obtained are placed in a diagram and shown in Figure 24.
Example 22: Effect of human and animal serum on hyaluronidase activity In this invention, thanks to the provision of an in vitro test model using the turbidimetric model, what had already emerged from previous clinical studies was confirmed, that is, enzymatic activity of bovine hyaluronidase (bovine PH20) is inhibited by human and/or animal blood, but it was however found that human and/or animal blood does not inhibit hyaluronidase from recombinant S . koganeiensis (Fig. 25). The method used to assess, in this invention, inhibition of hyaluronidase activity by (animal/human) blood was previously described by Albert DORFMAN, et al [21] . Briefly, the two concentrations of recombinant hyaluronidase produced according to the invention (40 units, 400 units), and bovine hyaluronidase (40 units, 400 units), were separately and respectively treated with serum coming from animal blood and serum coming from human blood in a sulphate buffer solution (pH 7.0) mixed with substrate buffer containing 0.5 mg hyaluronic acid. The mixture thus obtained was placed at 37 °C for 30 minutes, 1 hour and 6 hours. The relative enzymatic activity of the two concentrations of enzymes treated with the sera was measured at the end of each established time interval after having generated turbidity by adding a 4ml horse serum-based acid solution and continuing as per the Dorfman's method previously described. The development of turbidity due to the addition of the serum was corrected by the blank containing all the reagents, except for hyaluronidase.
Therefore, these latter studies show that the recombinant hyaluronidase produced according to the invention, which has a high hyaluronidase activity and high stability versus proteolytic enzymes, is capable of performing, with its maximum bioavailability, the total activity in bloodstream without the possibility of detecting bacterial or viral infections, proving to be effective also for cardio- and cerebro-vascular therapies.
Bibliographic references
[I] L.H. Bookbinder,. et al, Journal of Control Release. 2006 Aug 28 ; 11 ( 2 ) : 230-41. Epub 2006 Jun 7.
[2] Bratisl Lek Listy 2009; 110(1).
[3] US 2008/0124316 Al .
[4] Acta Med Scand. 1984 ; 216 (2) : 209-13.
[5] Dorfman A, Ott ML, Whitney R: The hyaluronidase inhibitor of human blood. J Biol Chem 174: 621, 1948.
[6] McClean D: The in-vivo decapsulation of streptococci by hyaluronidase. J Pathol Bacterid 54: 284, 1942.
[7] US 2011/0053247 Al .
[8] US 4,258,134.
[9] WO 2010/130810 Al .
[10] Dorfman A. 1955.
[II] Laemmli, U.K. 1970.
[12] Sambrook J, Russel DW (2001) .
[13] Peter B. Kaufman, William Wu, Donghern Kim, Leland Cseke 1995; Sambrook and Russell (2001) .
[14] Sarensen, H.P. and Mortensen, K.K. (2005). Advanced strategies for recombinant protein expression in Escherichia coli. J. Biotechnol. 115, 113-128.
[15]Luo, Q. et al. (2006) Optimization of culture on the overproduction of TRAIL in high-cell-density culture by recombinant Escherichia coli. Appl. Microbiol. Biotechnol. 71, 184-191.
[16] Di Ferrante 1956. [17] Mcllvaine's buffer, Mcllvaine 1921.
[18] Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller , Lipman DJ. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402.
[19] Ebner, C, D.Kraft, F. Prasch, R. Steiner, and H. Ebner. Type 1 allergy induced by LYMULUS Amebocyte Lysate (LAL) . Clinical and Experimental Allergy 22:417-419 (1992).
[20] Lee, H. G., and Cowman, M. K. (1994) Anal. Biochem. 219,278-287.
[21] Albert DORFMAN, MELVIN L. OTT, e Richard WHITNEY, Febbraio 20, 1948.
[22] Killmann, H., Benz, R. , and Braun, V. (1996). Properties of the FhuA channel in the Escherichia coli outer membrane after deletion of FhuA portions within and outside the predicted gating loop. J Bacteriol 178, 6913- 20.
[23] The Bacillus subtilis centred wiki SubtiWiki: A community curated consensual annotation that is continuously updated. SubtiPathways is a model of B. subtilis metabolism and regulation in SBML/SBGN
(Systems Biology Markup Language/ Graphical Notation) .
[24] Perkins JD, et al. Xbal and Blnl genomic cleavage maps of
Escherichia coli K-12 strain MG1655 and comparative analysis of other strains. J. Mol. Biol. 232: 419-445, 1993.
[25] Heath JD, et al . Notl genomic cleavage map of Escherichia coli K-12 strain MG1655. J. Bacteriol .174 : 558- 567, 1992. [26] Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
[27] Weiner, M. P., Anderson, C, Jerpseth, B., Wells, S. , Johnson-Browne, B. et al. (1994) Strategies 7(2) :41- 43.
[28] Altschul et al., 1997.
[29] Lederberg, J and Lederberg, EM (1952) Replica plating and indirect selection of bacterial mutants. J Bacteriol. 63: 399-406.

Claims

1. Method for the production of hyaluronidase from Streptomyces koganeiensis ATCC 31394 comprising the amino acid sequence shown in SEQ. ID. No. 21 comprising the following steps:
a) inoculating a bacterial culture medium in a bioreactor with an inoculum of recombinant cells that contain at least one vector comprising the sequence shown as SEQ ID No. 41;
b) subjecting the content of the bioreactor of step a) to fermentation at a pH between 6.7 and 7.1 in the presence of a nourishment solution;
c) adding an inducer of the lac genes to the mixture of step b) ;
d) subjecting the mixture of step c) to an induction period of 'between 8 and 24 hours;
e) centrifuging the bacterial cells obtained in step d) ; f) re-suspending the pellets obtained in step e) and subjecting the resulting suspension to osmotic shock;
g) extracting the periplasmic proteins by centrifugation of the suspension of step f) ;
h) purifying the protein fraction having hyaluronidase enzymatic activity obtained in step g) by a sequence of: i. strong ion-exchange chromatography and isolation of the hyaluronidase enzymatic activity fraction; ii. weak cation-exchange chromatography and isolation of the hyaluronidase enzymatic activity fraction; and
iii. aromatic hydrophobic interaction chromatography and isolation of the hyaluronidase enzymatic activity fraction.
2. Method according to claim 1, wherein the recombinant cell of step a) is selected from a cell of Escherichia coli and one of Bacillus subtilis .
3. Method according to one of the preceding claims, wherein in step b) , a glycerol solution is used as nourishment solution.
4. Hyaluronidase from Streptomyces koganeiensis ATCC 31394 in purified form and comprising the amino acid sequence in SEQ. ID. No. 21.
5. A polynucleotide comprising the nucleotide sequence shown in SEQ. ID. No. 17 encoding a bacterial hyaluronidase comprising the amino acid sequence in SEQ. ID. No. 21.
6. A genetically engineered recombinant vector comprising the polynucleotide according to claim 5.
7. A vector according to claim 6, wherein the vector is a plasmid.
8. A host cell comprising the vector according to one of claims 6 or 7.
9. A composition suitable for pharmaceutical or cosmetic use comprising the hyaluronidase according to claim .
10. The hyaluronidase according to claim 4, or obtainable by the method of claim 1, for use in the treatment and/or prevention of a disease or disorder, optionally in combination with at least another active principle.
11. The hyaluronidase for use according to claim 10, wherein the disorder or disease are at least one selected among oedemas, inflammatory conditions, chilblains, solid tumors, IgE-mediated allergies, diseases of the oral cavity, spontaneous vitreous haemorrhages, arteriosclerosis, blood pressure disorders, cardio- cerebro vascular disorders such as brain arterial stenosis or stroke or bovine mastitis.
12. Non-therapeutic use of the hyaluronidase according to claim 4, or obtainable by the method of claim 1, for cosmetic applications and/or to improve the aesthetic appearance.
13. A hyaluronidase from Streptomyces koganeiensis ATCC 31394 comprising the amino acid sequence in SEQ. ID. No. 21 obtainable by the method of claim 1-3.
PCT/IB2014/062193 2013-06-17 2014-06-13 Bacterial hyaluronidase and process for its production Ceased WO2014203133A1 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
EA201600026A EA035163B1 (en) 2013-06-17 2014-06-13 Purified recombinant hyaluronidase preparation, process for its production and compositions comprising same
CN201480046815.1A CN105473607B (en) 2013-06-17 2014-06-13 Bacterial hyaluronidase and preparation method thereof
ES14747982.8T ES2643485T3 (en) 2013-06-17 2014-06-13 Bacterial hyaluronidase and process for its production
SI201430436T SI3010932T1 (en) 2013-06-17 2014-06-13 Bacterial hyaluronidase and process for its production
CA2915253A CA2915253C (en) 2013-06-17 2014-06-13 Bacterial hyaluronidase and process for its production
EP14747982.8A EP3010932B1 (en) 2013-06-17 2014-06-13 Bacterial hyaluronidase and process for its production
US14/899,219 US9822351B2 (en) 2013-06-17 2014-06-13 Bacterial hyaluronidase and process for its production
US15/728,959 US10400229B2 (en) 2013-06-17 2017-10-10 Bacterial hyaluronidase and process for its production

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
IT000992A ITMI20130992A1 (en) 2013-06-17 2013-06-17 IALURONIDASI BACTERIA AND METHOD FOR ITS PRODUCTION
ITMI2013A000992 2013-06-17

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US14/899,219 A-371-Of-International US9822351B2 (en) 2013-06-17 2014-06-13 Bacterial hyaluronidase and process for its production
US15/728,959 Division US10400229B2 (en) 2013-06-17 2017-10-10 Bacterial hyaluronidase and process for its production

Publications (1)

Publication Number Publication Date
WO2014203133A1 true WO2014203133A1 (en) 2014-12-24

Family

ID=49035695

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2014/062193 Ceased WO2014203133A1 (en) 2013-06-17 2014-06-13 Bacterial hyaluronidase and process for its production

Country Status (9)

Country Link
US (2) US9822351B2 (en)
EP (1) EP3010932B1 (en)
CN (1) CN105473607B (en)
CA (1) CA2915253C (en)
EA (1) EA035163B1 (en)
ES (1) ES2643485T3 (en)
IT (1) ITMI20130992A1 (en)
SI (1) SI3010932T1 (en)
WO (1) WO2014203133A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3355968B1 (en) * 2015-10-02 2021-05-12 F. Hoffmann-La Roche AG Multi chamber syringe unit
US11510995B2 (en) * 2015-12-21 2022-11-29 Fidia Farmaceutici S.P.A. Nanosystems for controlled transport of active molecules for diagnostic, prognostic and therapeutic purposes

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ITMI20130992A1 (en) * 2013-06-17 2014-12-18 Fidia Farmaceutici IALURONIDASI BACTERIA AND METHOD FOR ITS PRODUCTION
WO2018105982A1 (en) * 2016-12-05 2018-06-14 한미약품 주식회사 Improved purification method of recombinant protein
CN109238995B (en) * 2018-08-30 2021-05-04 华熙生物科技股份有限公司 Method for measuring in-vitro enzymolysis performance of cross-linked hyaluronic acid gel
WO2021108751A1 (en) * 2019-11-26 2021-06-03 Standard Of Care Corporation Hyaluronidase compositions and methods of using same to treat cellulite
EP4189104A1 (en) * 2020-07-28 2023-06-07 Basf Se Industrial fermentation process for bacillus using partial harvest
CN112522125B (en) * 2020-12-28 2022-10-11 河北省微生物研究所有限公司 A kind of hyaluronidase engineering bacteria and its construction method and application
CN114457061A (en) * 2022-02-21 2022-05-10 中国海洋大学 A kind of hyaluronan lyase and its application
CN116200371B (en) * 2022-12-27 2023-11-07 山东丰金美业科技有限公司 Hyaluronidase mutant, mutant gene and application thereof in preparation of oligomeric hyaluronic acid
CN115820694B (en) * 2022-12-30 2024-06-18 天津科技大学 Novel hyaluronidase coding gene, high-yield engineering bacterium thereof, construction method and application

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0005751A1 (en) * 1978-05-11 1979-12-12 Fujisawa Pharmaceutical Co., Ltd. Hyaluronidase and its production
US20080124316A1 (en) 2000-05-29 2008-05-29 Gunther Burgard Use of hyaluronidase for prevention and treatment of cardiovascular diseases
WO2009037566A2 (en) * 2007-06-19 2009-03-26 Uvarkina Tamara P Hyaluronidase and method of use thereof
WO2009111066A1 (en) * 2008-03-06 2009-09-11 Halozyme, Inc. Large-scale production of soluble hyaluronidase
CN101633931A (en) * 2008-07-25 2010-01-27 山东省生物药物研究院 Hyaluronidase expression vector and application thereof
WO2010130810A1 (en) 2009-05-14 2010-11-18 Fidia Farmaceutici S.P.A. Extracellular yaluronidase from streptomyces koganeiensis

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5643758A (en) * 1987-03-10 1997-07-01 New England Biolabs, Inc. Production and purification of a protein fused to a binding protein
CN102367437A (en) * 2011-10-25 2012-03-07 江南大学 Method for producing pectinase by fermentation of recombinant Escherichia coli
ITMI20130992A1 (en) * 2013-06-17 2014-12-18 Fidia Farmaceutici IALURONIDASI BACTERIA AND METHOD FOR ITS PRODUCTION

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0005751A1 (en) * 1978-05-11 1979-12-12 Fujisawa Pharmaceutical Co., Ltd. Hyaluronidase and its production
US4258134A (en) 1978-05-11 1981-03-24 Fujisawa Pharmaceutical Co., Ltd. Novel hyaluronidase BMP-8231 and production thereof
US20080124316A1 (en) 2000-05-29 2008-05-29 Gunther Burgard Use of hyaluronidase for prevention and treatment of cardiovascular diseases
WO2009037566A2 (en) * 2007-06-19 2009-03-26 Uvarkina Tamara P Hyaluronidase and method of use thereof
WO2009111066A1 (en) * 2008-03-06 2009-09-11 Halozyme, Inc. Large-scale production of soluble hyaluronidase
US20110053247A1 (en) 2008-03-06 2011-03-03 David Baker Large-scale production of soluble hyaluronidase
CN101633931A (en) * 2008-07-25 2010-01-27 山东省生物药物研究院 Hyaluronidase expression vector and application thereof
WO2010130810A1 (en) 2009-05-14 2010-11-18 Fidia Farmaceutici S.P.A. Extracellular yaluronidase from streptomyces koganeiensis

Non-Patent Citations (17)

* Cited by examiner, † Cited by third party
Title
ACTA MED SCAND., vol. 216, no. 2, 1984, pages 209 - 13
ALTSCHUL SF; MADDEN TL; SCHAFFER AA; ZHANG J; ZHANG Z; MILLER W; LIPMAN DJ: "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", NUCLEIC ACIDS RES., vol. 25, 1997, pages 3389 - 3402, XP002905950, DOI: doi:10.1093/nar/25.17.3389
BRATISL LEK LISTY, vol. 110, no. 1, 2009
DORFMAN A; OTT ML; WHITNEY R: "The hyaluronidase inhibitor of human blood", J BIOL CHEM, vol. 174, 1948, pages 621
EBNER, C.; D.KRAFT; F. PRASCH; R. STEINER; H. EBNER: "Type 1 allergy induced by LYMULUS Amebocyte Lysate (LAL", CLINICAL AND EXPERIMENTAL ALLERGY, vol. 22, 1992, pages 417 - 419
HEATH JD ET AL.: "NotI genomic cleavage map of Escherichia coli K-12 strain MG1655", J.BACTERIOL., vol. 174, 1992, pages 558 - 567
HYNES WAYNE L ET AL: "Hyaluronidases of Gram-positive bacteria", FEMS MICROBIOLOGY LETTERS, WILEY-BLACKWELL PUBLISHING LTD, GB, vol. 183, no. 2, 15 February 2000 (2000-02-15), pages 201 - 207, XP002538530, ISSN: 0378-1097, DOI: 10.1111/J.1574-6968.2000.TB08958.X *
KILLMANN, H.; BENZ, R.; BRAUN, V.: "Properties of the FhuA channel in the Escherichia coli outer membrane after deletion of FhuA portions within and outside the predicted gating loop", J BACTERIOL, vol. 178, 1996, pages 6913 - 20
L.H. BOOKBINDER, JOURNAL OF CONTROL RELEASE, vol. 114, no. 2, 7 June 2006 (2006-06-07), pages 230 - 41
LEDERBERG, J; LEDERBERG, EM: "Replica plating and indirect selection of bacterial mutants", J BACTERIOL., vol. 63, 1952, pages 399 - 406
LEE, H. G.; COWMAN, M. K., ANAL. BIOCHEM., vol. 219, 1994, pages 278 - 287
LUO, Q. ET AL.: "Optimization of culture on the overproduction of TRAIL in high-cell-density culture by recombinant Escherichia coli", APPL. MICROBIOL. BIOTECHNOL., vol. 71, 2006, pages 184 - 191, XP019421886
MCCLEAN D: "The in-vivo decapsulation of streptococci by hyaluronidase", J PATHOL BACTERIOL, vol. 54, 1942, pages 284
PERKINS JD ET AL.: "XbaI and BlnI genomic cleavage maps of Escherichia coli K-12 strain MG1655 and comparative analysis of other strains", J. MOL. BIOL., vol. 232, 1993, pages 419 - 445, XP024008917, DOI: doi:10.1006/jmbi.1993.1401
SAMBROOK, J.; FRITSCH, E. F.; MANIATIS, T.: "Molecular Cloning: A Laboratory Manual.", 1989, COLD SPRING HARBOR LABORATORY PRESS
SSARENSEN, H.P.; MORTENSEN, K.K.: "Advanced strategies for recombinant protein expression in Escherichia coli", J. BIOTECHNOL., vol. 115, 2005, pages 113 - 128
WEINER, M. P.; ANDERSON, C.; JERPSETH, B.; WELLS, S.; JOHNSON-BROWNE, B. ET AL., STRATEGIES, vol. 7, no. 2, 1994, pages 41 - 43

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3355968B1 (en) * 2015-10-02 2021-05-12 F. Hoffmann-La Roche AG Multi chamber syringe unit
US11510995B2 (en) * 2015-12-21 2022-11-29 Fidia Farmaceutici S.P.A. Nanosystems for controlled transport of active molecules for diagnostic, prognostic and therapeutic purposes
US12115229B2 (en) 2015-12-21 2024-10-15 Fidia Farmaceutici S.P.A. Nanosystems for controlled transport of active molecules for diagnostic, prognostic and therapeutic purposes

Also Published As

Publication number Publication date
ES2643485T3 (en) 2017-11-23
US20160168554A1 (en) 2016-06-16
US10400229B2 (en) 2019-09-03
SI3010932T1 (en) 2017-12-29
US20180362949A1 (en) 2018-12-20
CN105473607B (en) 2019-10-29
CA2915253A1 (en) 2014-12-24
CN105473607A (en) 2016-04-06
EA035163B1 (en) 2020-05-08
EP3010932A1 (en) 2016-04-27
EA201600026A1 (en) 2016-08-31
US9822351B2 (en) 2017-11-21
CA2915253C (en) 2018-01-02
ITMI20130992A1 (en) 2014-12-18
EP3010932B1 (en) 2017-07-19

Similar Documents

Publication Publication Date Title
US10400229B2 (en) Bacterial hyaluronidase and process for its production
CN102666396B (en) Methods and systems for purifying non-complexed botulinum neurotoxin
CN109311951B (en) Novel streptococcal proteases
JP4913074B2 (en) Animal-free product-free method and method for purifying botulinum toxin
EP2432874B1 (en) Extracellular yaluronidase from streptomyces koganeiensis
JP4348194B2 (en) A truncated lysostaphin molecule with enhanced staphylococcal lytic activity
CN118773179B (en) Production and application of antibacterial protein of targeted propionibacterium acnes
Reitinger et al. High-yield recombinant expression of the extremophile enzyme, bee hyaluronidase in Pichia pastoris
CN101948865B (en) Dual-promoter inducible secretable shuttle plasmid and construction method thereof
Manuvera et al. Generation of recombinant destabilase-lysozyme from medicinal leeches in three different expression systems
CN106967740B (en) A kind of Escherichia coli fusion expression pectin, its preparation method and application
CN106574273A (en) E. coli-based production of beta-lactamase
CN116143903A (en) Peptidoglycan recognition protein-3, preparation method and application thereof
López-Cano et al. SOLUBLE VS SOLUBILIZED RECOMBINANT PROTEINS, THE PURIFICATION PROTOCOL MATTERS

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 201480046815.1

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14747982

Country of ref document: EP

Kind code of ref document: A1

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
ENP Entry into the national phase

Ref document number: 2915253

Country of ref document: CA

REEP Request for entry into the european phase

Ref document number: 2014747982

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2014747982

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 14899219

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 201600026

Country of ref document: EA