WO2014192822A1 - Bee-silk-protein aqueous solution, and production method therefor - Google Patents

Abstract

The purpose of the present invention is to acquire a high-quality aqueous solution which is rich in bee-silk protein, and which is capable of being employed for various uses, e.g. as a film starting material. Accordingly, a production method for a silk protein-containing dialyzed aqueous solution is employed, said production method including a step in which dialysis is performed using: as a dialysis inner solution, an inorganic salt aqueous solution including bee-silk protein; and, as a dialysis outer solution, an aqueous solution having a pH of at least 9.0.

Description

Aqueous solution of bee silk protein and production method thereof

The present invention relates to an aqueous solution of bee silk protein and a method for producing the same.

繭 Insects made of insects contain abundant fibrous proteins, and due to their unique properties, research is being conducted in fields such as clothing, medical use, and cosmetics. For example, cocoon cocoons are commonly used as natural fibers for clothing. Silk protein contained in silkworms has been studied as a medical biomaterial. For example, Patent Document 1 describes the use of silkworm silk protein as a raw material for cell scaffold materials for regenerative medicine.

In addition, bee silk protein has been studied as a new material for use in medicine and the like because it differs in amino acid composition and properties from silkworm silk protein (for example, Patent Document 2). Since most of the beehives are generally discarded, research on bee silk protein is also important from the viewpoint of effective use of resources.

Patent Document 2 describes a technique related to a method for extracting a silk protein derived from a honeycomb. Specifically, (1) The honeycomb was dissolved in an aqueous solution containing an inorganic salt (inorganic salt aqueous solution) to dissolve the silk protein contained in the nest. (2) The solution was dialyzed with distilled water. (3) The silk protein in the dialysis membrane was solidified by dialysis, (4) The solidified component was removed with a filter, and (5) The dialysis internal solution after removing the solidified component The film piece was cast on a petri dish, and after drying, part of the surface of the petri dish was forcibly removed to obtain a film piece.

Patent Document 3 describes a technique relating to a method for producing a protein film containing bee silk protein. Specifically, (1) the silkworm contained in the cocoon was dissolved by dissolving the cocoon taken out of the beehive in an inorganic salt aqueous solution, (2) the solution was dialyzed with distilled water, and inorganic It is described that the salt has been removed, (3) the silk protein in the dialysis membrane has gelled by dialysis, and (4) the dialysis membrane containing the gel has been compression-dried to create a film. .

WO2011 / 021712 JP2006-045076 JP2008-173312

The inventors of the present application considered that there is room for improvement with respect to the above-described Patent Documents 2 and 3 in the following points.
Patent Document 2 describes that a film piece was obtained, but silk protein was solidified in the dialysis process. Therefore, the silk protein finally remaining in the film piece is limited to some kinds of silk protein. Therefore, a film piece having sufficient mechanical properties or flexibility could not be obtained. In addition, the method of Patent Document 2 has a room for improvement in terms of operability because it requires a step of removing the solidified component with a filter.

On the other hand, if the inorganic salt is not removed by dialysis, the inorganic salt remains in the material when the silk protein solution is dried and solidified to produce a solid material. If it does so, it will cause the fall of the transparency of a solid-state material, and the fall of a mechanical physical property.

Note that Patent Document 2 also describes an example in which a halogenated organic solvent is used in place of the inorganic salt aqueous solution, and a film is produced without dialysis. However, all halogenated organic solvents are expensive, and the components remaining in the film are harmful. In addition, there is a problem that the gas and waste liquid generated in the molding process have a great influence on the human body and the environment. Patent Document 2 also describes that the halogenated organic solvent was replaced with water by solvent replacement, but at this time the silk protein was precipitated and a film was not formed.

Further, in the method for producing a film of Patent Document 3, the gel in the dialysis tube is used instead of using an aqueous solution as in Patent Document 2. For this reason, there is room for improvement in that the size and shape of the film that can be produced depend on the shape and size of the dialysis tube.

In the case of silkworm silk protein, it does not solidify even when dialyzed with distilled water. That is, the above-mentioned solidification problem is a problem peculiar to bee silk protein.

The present invention has been made in view of the above circumstances, and an object of the present invention is to provide a high-quality aqueous solution that can be used in various applications such as film raw materials and is rich in bee silk protein. Or it aims at providing the production method of the aqueous solution. Another object of the present invention is to provide a hardened material rich in bee silk protein obtained by curing the aqueous solution.

According to one aspect of the present invention, there is provided a method for producing a dialyzed aqueous solution containing silk protein, wherein an inorganic salt aqueous solution containing bee silk protein is used as a dialysate internal solution, and a pH of 9.0 or more is used as an external dialysate solution. A production method is provided comprising the step of dialysis using an aqueous solution. In this production method, the dialysis internal solution can maintain an aqueous solution state even after dialysis. In addition, this production method can reduce the concentration of inorganic salt in the dialyzed solution. Therefore, by using this production method, it is possible to obtain a high-quality aqueous solution that can be used for various uses such as film raw materials and is rich in bee silk protein. Moreover, by hardening this aqueous solution in a mold such as a petri dish, a cured material containing bee silk protein having excellent mechanical properties, transparency, or flexibility can be obtained. In addition, from the viewpoint of producing a particularly good quality curable material, the aqueous solution of pH 9.0 or higher used in this production method is preferably an aqueous solution containing a volatile basic substance.

Moreover, according to one aspect of the present invention, a dialyzed aqueous solution obtained through the above production method is provided. Moreover, according to 1 aspect of this invention, the hardening material obtained through the process of hardening the said dialyzed aqueous solution is provided. Further, according to one aspect of the present invention, there is provided a method for producing a curable material, wherein an inorganic salt aqueous solution containing bee silk protein is used as a dialysis internal solution, and an aqueous solution having a pH of 9.0 or more is used as an external dialysis solution There is provided a production method including a step of recovering the dialysis internal solution after the dialysis step from the dialysis membrane, and a step of curing the recovered dialysis internal solution. According to one embodiment of the present invention, a dialyzed aqueous solution containing 0.1 wt% or more of bee silk protein, 0.0001N to 14.8N of a volatile base substance, and 20 ° C. or less is provided. According to another aspect of the present invention, there is provided a method for producing a silk protein aqueous solution, comprising the step of dissolving bee silk protein in a 3 to 6 mol / L calcium chloride aqueous solution.

According to the present invention, a high quality aqueous solution rich in bee silk protein can be obtained. Alternatively, according to the present invention, a cured material containing bee silk protein having excellent mechanical properties, transparency, or flexibility can be obtained.

FIG. 1 is a diagram showing the result of observing the state in a dialysis membrane when a LiBr aqueous solution in which a hornet silk protein is dissolved is dialyzed with an aqueous solution having a pH of 6 to 11. FIG. 2 is a diagram showing the results of examining the relationship between the ammonia concentration of the aqueous solution and the pH. Figure 3 is a plot of the hornet silk protein concentration of the dialyzed aqueous solution measured by thermogravimetric analysis (TG) against the feed concentration (weight of mg dissolved per mL of 9MLiBr aqueous solution). is there. Figure 4 shows the dialysis of the hornet silk concentration (wt%) of the aqueous solution after dialysis when the aqueous solution of LiBr in which the hornet silk protein is dissolved is dialyzed against aqueous ammonia at 5 ° C. It is the figure plotted with respect to the concentration (N) of used ammonia water. L and S in the figure indicate a region where the aqueous solution state is maintained after dialysis and a region solidified after dialysis, respectively. FIG. 5 shows the hornet silk concentration of the aqueous solution after dialysis when the aqueous solution of LiBr in which the hornet silk protein is dissolved is dialyzed with 0.01N, 0.1N, or 0.5N ammonia water and the aqueous solution state is maintained after dialysis ( wt%) is plotted against temperature during dialysis (° C.). FIG. 6 is a diagram showing an electrophoresis pattern of a protein obtained by dialyzing a LiBr aqueous solution in which a hornet silk protein is dissolved with pure water at 5 ° C. to 37 ° C. In the figure, M is a marker, and C is a migration pattern of a moth wasp for comparison. FIG. 7 is a diagram showing an electrophoresis pattern of a protein obtained by dialysis of an aqueous solution of LiBr in which a hornet silk protein is dissolved at 0.05 N or 0.01 N. FIG. 8 is a diagram showing the time until the dialyzed aqueous solution solidifies. FIG. 9 is a diagram showing the results of CD measurement. FIG. 10 is a photograph of the dialyzed aqueous solution being poured into a petri dish and dried. FIG. 11 is a photograph of a film obtained by drying a dialyzed aqueous solution and peeling it off from a petri dish. FIG. 12 shows a solid state NMR spectrum of the film. FIG. 13 is a diagram showing an FT-IR spectrum of a cast film. FIG. 14 is a diagram showing results of attempts to create a film at a plurality of types of drying temperatures. FIG. 15 is a photograph when the film is folded. FIG. 16 is a diagram in which electric capacitance values (pF) at test signal frequencies of 100 Hz, 1 kHz, and 10 kHz are plotted with respect to film thickness (mm). FIG. 17 is a photograph showing the results when the soot was dissolved in a LiBr aqueous solution, dialyzed with an aqueous solution adjusted to pH with Na ₂ CO ₃ and then dried. FIG. 18 is a photograph of a film obtained by dissolving soot in an aqueous LiBr solution, dialyzing with an aqueous solution prepared with diethylamine, and then performing a drying process. FIG. 19 is a photograph of a film obtained by dissolving soot in an aqueous calcium chloride solution, followed by dialysis with ammonia water and a drying process. Fig. 20 shows the concentration of calcium chloride when immersed in 10 mL of calcium chloride aqueous solution at 50, 60, and 70 ° C, and the concentration of calcium chloride, 30 minutes and 60 minutes after shaking. It is the figure which plotted dissolution rate (%). FIG. 21 shows that when 20 mg of giant hornet was soaked in 10 mL of 4.5 M and 3.6 M calcium chloride aqueous solution and shaken at each temperature in the range of 20 to 70 ° C., 30 minutes after shaking, and 60 It is the figure which plotted the dissolution rate after a minute with respect to temperature. Figure 22 shows the change in dissolution rate when 20 mg of giant hornet moth was immersed in 10 mL of 4.5 M and 3.6 M calcium chloride aqueous solution and shaken at 20 ° C, 30 ° C and 50 ° C. FIG. FIG. 23 is a photograph of a film obtained by dissolving cross-beetle cocoons in a LiBr aqueous solution, followed by dialysis with ammonia water and a drying process. FIG. 24 is a photograph of a film obtained through a drying process after dialysis of an aqueous silk fibroin solution with ammonia water. FIG. 25 is a photograph of a film produced using a formwork in which the surface of a stainless steel petri dish is processed with fluorine. FIG. 26 is a diagram showing the results of measuring the viscosity of a LiBr aqueous solution in which the obtained hornet silk protein is dissolved after the film is dissolved in the LiBr aqueous solution. FIG. 27 is a photograph of a film regenerated after dissolving the film in an aqueous LiBr solution.

Hereinafter, embodiments of the present invention will be described in detail. In addition, in order to avoid the repetition complexity about the same content, description is abbreviate | omitted suitably.

(1) Method for producing dialyzed aqueous solution containing silk protein One embodiment of the present invention is a method for producing a dialyzed aqueous solution containing a silk protein. This production method is, for example, a production method including a step of dialysis using an aqueous solution of an inorganic salt containing bee silk protein as a dialysis internal solution and a high pH aqueous solution as an external dialysis solution. In this production method, the dialysis internal solution can maintain an aqueous solution state even after dialysis. In addition, this production method can reduce the concentration of inorganic salt in the dialyzed solution. Therefore, according to this production method, it is possible to obtain a high-quality aqueous solution rich in bee silk protein that can be used for various uses such as film raw materials from the dialyzed internal solution.

By curing the dialyzed aqueous solution obtained by this method, a cured material excellent in mechanical properties, transparency, or flexibility can be obtained. Alternatively, a cured material having an α helix structure can be obtained by curing the dialyzed aqueous solution obtained by this method. Examples of the curable material include films, fibers, nonwoven fabrics, sponges, tubes, and blocks. The dialyzed aqueous solution and the curable material can be used, for example, for medical products, cosmetics, electronic devices, or textile products. In addition, from the viewpoint of producing a particularly good quality curable material, the high pH aqueous solution used in this production method is preferably an aqueous solution containing a volatile basic substance.

The method for producing a dialyzed aqueous solution containing silk protein may further include a step of recovering the dialyzed internal solution after dialysis from the dialysis membrane. The step of collecting the dialysis internal solution from the dialysis membrane may include, for example, a step of recovering the dialysis internal solution from the dialysis tube or the container having the dialysis membrane. Collecting includes taking out. The method for producing a dialyzed aqueous solution containing silk protein further includes a step of recovering cocoons from the honeycomb, a step of dissolving cocoons in an aqueous inorganic salt solution, or a step of removing insoluble components from an aqueous inorganic salt solution in which cocoons are dissolved. May be included.

The dialyzed aqueous solution obtained by this production method is, for example, a dialyzed aqueous solution containing at least 0.1 wt% of bee silk protein, 0.0001 N to 14.8 N of volatile basic substance, and 20 ° C. or less. The storage period of the dialyzed aqueous solution is, for example, 0.5, 1, 2, 3, 4, 5, 10, 14, 15, 20, 25, 30, 40, or 50 days or less, or a range of any two of them. It may be within.

A method for producing a dialyzed aqueous solution containing silk protein is a production method including a step of dialysis using an aqueous salt solution containing silk protein as a dialysis internal solution and a high pH aqueous solution as an external dialysis solution. Also good. The dialyzed aqueous solution obtained through this production method can maintain the aqueous solution state even after being stored for a long period of time. For example, in the examples described later, it has been demonstrated that a dialyzed aqueous solution containing a bee or cocoon silk protein maintains an aqueous solution state even after about one month. Therefore, a cured material can be obtained by curing the dialyzed aqueous solution after long-term storage. The long period may be, for example, 15, 20, 25, 30, or 35 days or more, and may be in the range of any two of them.

(2) Method for Producing Cured Material Containing Silk Protein One embodiment of the present invention is a method for producing a cured material containing a silk protein. This production method is, for example, a production method including a step of dialysis using an aqueous inorganic salt solution containing bee silk protein as an internal dialysis solution and an aqueous solution having a pH of 9.0 or more as an external dialysis solution. This production method may further include a step of recovering the dialyzed internal solution after the dialysis step from the dialysis membrane and a step of curing the recovered dialyzed internal solution. The cured material obtained through this production method is excellent in mechanical properties, transparency, or flexibility. Alternatively, the cured material obtained through this production method has an α helix structure.

The method for producing a dialyzed aqueous solution or a hardening material containing silk protein may further include a step of dissolving the honeycomb or the cocoon in the inorganic salt aqueous solution. Furthermore, you may include the process of processing the inorganic salt aqueous solution after dissolving a honeycomb or a cocoon with a filter. Thereby, even if substances other than silk adhere to the honeycomb or the cocoon, they can be removed.

The step of curing the dialyzed aqueous solution may include a step of drying the dialyzed aqueous solution. Alternatively, a step of pouring the dialyzed aqueous solution into a mold and drying it may be included. For the mold, for example, a container such as a petri dish or an instrument having a concave portion may be used. From the viewpoint of facilitating peeling of the film, the mold is preferably a fluorine-treated mold. The equipment to be subjected to fluorine processing is preferably a metal material from the viewpoint of being resistant to heat during fluorine processing and from the viewpoint of easily producing a mold having an arbitrary shape. The metal material may be stainless steel, for example. The mold is preferably a petri dish other than a glass petri dish (for example, a polystyrene petri dish, a Teflon petri dish, a stainless petri dish, etc.) from the viewpoint of facilitating peeling of the film.

The above drying temperature is preferably less than 29 ° C., preferably 28 ° C. or less, and more preferably 27 ° C. or less from the viewpoint of preparing a cured material having excellent mechanical properties or flexibility. This temperature may be, for example, 0, 5, 10, 15, 20, 25, 27, 29, 30, 35, 36, or 40 ° C., and may be within the range of any two of them. Good.

The drying time is preferably within 72 hours, and more preferably within 48 hours, from the viewpoint of preparing a cured material having excellent mechanical properties or flexibility. This time may be, for example, 24, 36, 48, 60, 72, 84, 96, or 120 hours, provided that the cured material has sufficient mechanical properties or flexibility, either of which 2 It may be within a range of two values.

The film may be a film. The thickness of the film is preferably 5 μm or more, more preferably 25 μm or more, from the viewpoint of increasing mechanical properties. This thickness may be, for example, 1, 5, 10, 30, 50, 100, 150, 200, 300, 1000, or 5000 μm or more, or within a range of any two of these values. The Young's modulus of the film may be, for example, 2.0, 2.4, 2.8, 3.5, or 4.0 GPa or more, or within a range of any two values thereof. The tensile strength of the film may be, for example, 55, 60, 65, 68, 70, 75, 80, 85 MPa or more, or any two values thereof. The elongation at break of the film may be, for example, 2.5, 3.0, 3.4, 3.8, 4.0, 5.0, 6.0% or more, or within a range of any two of them. The film includes a film-like solid or gel.

The above-mentioned curable material can be further dissolved and used. In this embodiment, the step of dissolving the curable material in an inorganic salt aqueous solution, an inorganic salt aqueous solution in which the curable material is dissolved as a dialysis internal solution, and dialysis using an aqueous solution having a pH of 9.0 or more as an external dialysis solution A production method including a process. According to this method, as demonstrated in the examples described later, it is possible to obtain a high-quality aqueous solution that can be used for various applications such as film raw materials and is rich in bee silk protein. And if this aqueous solution is hardened, a hardening material can be obtained again.

(3) Method for Improving Stability of Aqueous Solution Containing Silk Protein One embodiment of the present invention is a method for improving the stability of an aqueous solution containing silk protein and having a pH of less than 9.0. This method includes, for example, a step of dialysis using an aqueous solution having a pH of 9.0 or higher against an aqueous solution having a pH of less than 9.0 containing silk protein. According to this method, since the stability of the dialyzed aqueous solution can be improved, the dialyzed aqueous solution containing silk protein can be used for medical products and the like even after long-term storage. In addition, improving stability includes suppressing solidification.

(4) Dialysis conditions The pH of the dialysis external solution is preferably 9.0 or more, more preferably 10.0 or more, from the viewpoint of further suppressing the solidification of the silk protein. The pH may be, for example, 9.0, 9.5, 10, 10.5, 11.0, 11.5, 12.0, 12.5, 13.0, 13.5, or 14 or more, or a range of any two of them.

The temperature at the time of dialysis is preferably 28 ° C. or less from the viewpoint of further suppressing the solidification of the silk protein. Further, from the viewpoint of suppressing a decrease in the molecular weight of the silk protein, it is preferably 20 ° C or lower, more preferably 15 ° C or lower, and further preferably 5.5 ° C or lower. Further, from the viewpoint of increasing the dialysis efficiency or reducing the running cost, 2 ° C. or higher is preferable, and 4 ° C. or higher is more preferable. The dialysis temperature is not particularly limited as long as the dialysis internal solution and the dialysis external solution are not frozen. Dialysis temperature is, for example, -5, 0, 1, 2, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 8, 9, 10, 12, 15, 20, 25, 28, 30 , 35, 38, or 40 ° C. or less, or any two values thereof.

The number of dialysis is preferably 4 times or more from the viewpoint of preparing a cured material having excellent mechanical properties, transparency, or flexibility. This number of times may be, for example, 1, 2, 3, 4, 5, 6, or 10 times, and may be within the range of any two values thereof. The dialysis membrane may be, for example, a cellulose membrane or a synthetic polymer membrane. The fractional molecular weight of the dialysis membrane may be, for example, 500, 1000, 5000, 10000, 12000, 14000, 16000, 18000, 20000, 50000, or 100,000, and is within the range of any two of them. Also good.

The dialyzed aqueous solution may be an aqueous solution in which the concentration of inorganic salt contained in the dialysis internal solution before dialysis is reduced compared to the dialysis internal solution before dialysis. The dialysis is preferably performed so that the concentration of the inorganic salt contained in the dialyzed aqueous solution before dialysis in the dialyzed aqueous solution is reduced as compared with the dialyzed internal solution before dialysis. When the inorganic salt concentration of the dialysis external solution before dialysis is lower than the inorganic salt concentration of the dialysis internal solution before dialysis, the inorganic salt concentration of the dialysis internal solution can be reduced. The amount of inorganic salt removed from the dialyzed solution by dialysis may be, for example, 70, 80, 90, 95, 97, 99, 100% or more, or a range of any two of them.

Dialysis can be performed so that the internal solution of the dialysis is maintained in an aqueous solution by appropriately adjusting the component concentration, pH, temperature, or the like during dialysis from the above dialysis conditions. The most preferable dialysis conditions for obtaining a high-quality dialyzed aqueous solution rich in silk protein are an aqueous solution containing 2 to 3 wt% silk protein in the dialysis inner solution and 0.1 to 0.5 N ammonia water in the outer dialysis solution. This is the condition for dialysis at a temperature of 4 to 5.5 ° C. Further, the most preferable conditions for stably forming a film from the dialyzed aqueous solution are the conditions in which the drying temperature is set to 27 ° C. or lower and the dialyzed aqueous solution is dried within 2 days. In addition, as an index for evaluating the dialyzed aqueous solution as high quality, for example, the silk protein concentration is high, it can be stored for a long period of time, the silk protein is in a state that is not easily decomposed, the toxicity is low, Excellent mechanical properties, flexibility, or transparency when made into a curable material, α-helix structure when made into a curable material, and volatile basic substance remaining when made into a curable material It is difficult to do it, or it can be reused.

(5) Dialysis internal solution The concentration of silk protein in the above dialysis internal solution before dialysis is preferably 140 mg / mL or less, more preferably 52 mg / mL or less, from the viewpoint of further suppressing the solidification of the silk protein during dialysis. In addition, from the viewpoint of producing a cured material containing abundant silk protein and excellent in mechanical properties or flexibility, it is preferably 15 mg / mL or more, more preferably 35 mg / mL or more. Thus, if the silk protein concentration in the dialysis internal solution is high, there is an effect that the drying time at the time of preparing the curable material can be saved. If the drying time can be saved, protein denaturation during the drying time can be suppressed, so that a film having desired physical properties can be obtained more efficiently. Further, if the drying time can be saved, labor is reduced and the productivity of the cured material is improved. The concentration of silk protein in the dialysis internal fluid is, for example, 1, 3, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 80, 90, 100, It may be 110, 120, 130, 140, 150, 160, or 180 mg / mL, and may be within the range of any two of them.

The concentration of the silk protein in the dialyzed internal solution after dialysis or the dialyzed aqueous solution is preferably 6.5 wt% or less, more preferably 3.0 wt% or less from the viewpoint of further suppressing the solidification of the silk protein. Further, from the viewpoint of producing a cured material containing abundant silk protein and having excellent mechanical properties or flexibility, 1.0 wt% or more is preferable, and 2.0 wt% or more is more preferable. Thus, if the silk protein concentration in the dialysis internal solution is high, there is an effect that the drying time at the time of preparing the curable material can be saved. If the drying time can be saved, protein denaturation during the drying time can be suppressed, so that a film having desired physical properties can be obtained more efficiently. Further, if the drying time can be saved, labor is reduced and the productivity of the cured material is improved. This concentration is, for example, 0.1, 0.5, 0.75, 1.0, 1.25, 1.5, 2.0, 2.5, 2.75, 3.0, 3.25, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.25, 6.5, 7.0, 8.0, 9.0, Alternatively, it may be 10.0 wt%, and may be within the range of any two of them.

The volume of the dialysis internal solution may be, for example, 0.1, 0.5, 1, 2, 5, 10, 20, 100, 500, or 1000 mL, or may be within the range of any two of them. . The pH of the dialyzed solution may be, for example, less than 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, or 9.0, or a range of any two of them.

(6) Dialysis External Solution The dialysis external solution is preferably an aqueous solution containing a volatile basic substance from the viewpoint of obtaining a cured material having excellent mechanical properties, transparency, or flexibility. As the volatile base substance, for example, a volatile compound having an amino group may be used. Examples of the volatile compound having an amino group include ammonia, diethylamine, and trimethylamine. The volatile base substance is preferably ammonia from the viewpoint of suppressing the solidification of silk protein under a wide range of dialysis conditions. When diethylamine is used, it is preferable to take measures to prevent corrosion during the drying process to obtain a film. Triethylamine is hardly soluble in water below 18.7 ° C. Therefore, when triethylamine is used, it is preferable to perform dialysis or casting at a high temperature of 20 ° C. or higher. The pH of the dialysis external solution may be adjusted by adjusting the concentration of the volatile basic substance. “Volatile” includes the property of being easily vaporized. That is, volatility includes vaporization. When an aqueous solution containing a basic substance is cured, if the basic substance does not remain in the cured material, it may be regarded as volatile. If the volatile basic substance remains in a small amount in the cured material, the residual ratio is preferably as low as possible, for example, it may be 0.5, 0.1, 0.01, 0.001, or 0%. It may be within the range.

The concentration of the volatile basic substance in the dialysis external solution is preferably more than 0.0001N, more preferably 0.01 or more, and further preferably 0.1N or more from the viewpoint of further suppressing the solidification of the silk protein. This concentration may be, for example, 0.0001, 0.0005, 0.001, 0.005, 0.01, 0.05, 0.1, 0.5, 1.0, 2.0, 5.0, 7.0, 8.0, 10.0, 12.0, or 14.8N, any two of them It may be within the range of values. When ammonia is used as a volatile base substance, if the concentration of aqueous ammonia becomes too high, the odor of ammonia becomes too strong, which may affect the human body and cause problems in terms of environment and cost. From these viewpoints, the ammonia concentration is preferably less than 14.8N, and more preferably 12.0N or less. In order to transfer volatile basic substances from the external dialysis solution to the internal dialysis solution by dialysis, the concentration of volatile basic substances in the external dialysis solution before dialysis is the same as the concentration of volatile basic substances in the internal dialysis solution before dialysis. Set higher than. The pH of the external dialysis solution before dialysis may be set higher than the pH of the dialysis internal solution before dialysis.

The amount of the external dialysis solution may be, for example, 5, 10, 20, 100, 500, 1000, 5000, 10000, or 50000 mL, or may be in the range of any two of them. From the viewpoint of increasing the dialysis efficiency, the volume of the external dialysis solution is preferably larger than the volume of the dialysis internal solution.

(7) Silk protein In one embodiment of the present invention, the silk protein is, for example, a protein contained in cocoons. Spiders can be obtained, for example, from a nest. For example, bee larvae spun from the inside of the nest to make a cocoon on the cap before it becomes a cocoon. The cocoon on the cap thus made can be obtained from the inside of the beehive. The bee silk protein may be, for example, a fibrous protein. The bee silk protein includes, for example, a protein extracted from a bee cocoon, or a protein obtained from a genetically modified organism having a gene encoding the protein (ie, a recombinant protein). The bee silk protein may contain, for example, fibroin such as Silk1, 2, 3, 4, 5, or 6. When the bee is a hornet bee, the silk protein may contain, for example, fibroin such as VsSilk1, 2, 3, 4, 5, or 6. Instead of silk protein extracted from bee cocoons, a protein obtained by introducing a bee silk protein gene into a host by genetic recombination technology can be used to prepare a dialyzed aqueous solution under the same dialysis conditions as above. It is possible to obtain. The recombinant protein is, for example, a step of introducing a gene encoding a protein extracted from bee cocoons (for example, a gene encoding fibroin) into a host by a gene recombination technique, the gene is expressed, and the recombinant protein And a step of extracting the recombinant protein from the host. The host may be, for example, an eubacterial host (for example, E. coli or the like), an archaebacterial host, or a eukaryotic host (for example, a yeast, a plant, an animal (for example, a goat) or the like). The recombinant protein may also be a protein having 90% or more amino acid homology with one or more of the proteins constituting the cocoon. The 90% or more may be, for example, 95% or more, 98% or more, or 100%. The homology can be expressed as a value measured by NCBI BLAST. Blastp can be used as the default algorithm for comparing amino acid sequences with BLAST. Although the measurement result is quantified as Positives or Identities, Identities is preferably adopted in an embodiment of the present invention.

The silk protein may be, for example, a silk protein of an organism classified as a bee, a butterfly, or a spider. In the order of bees, the subordinate class is not particularly limited, and examples include bees, wasps and ants. In addition, in the hornet family, the subfamily which is a subordinate classification thereof is not particularly limited, and examples thereof include the hornet subfamily and the wasp subfamily. Furthermore, the genus which is a subordinate classification in the vespidae subfamily is not particularly limited, and examples thereof include genus wasp, genus hornet, genus hornet, or genus Provespa. Examples of the genus Vespa include Vespa simillima xanthoptera, giant hornet, hornet wasp, hornet, hornet, chiros hornet, and hornet hornet. Among them, the silk protein of Kirosuzu wasp can be procured relatively easily. Examples of the genus Cross wasp include cross wasp and fern cross wasp. In one embodiment of the present invention, the “bee” may be an organism classified as a bee. In one embodiment of the present invention, “bee silk protein” includes, for example, silk protein of a bee family, wasp family, or ant family organism. In one embodiment of the present invention, the “hornet” may be an organism classified into the wasp subfamily. In one embodiment of the present invention, the “hornet silk” may be a fibrous material that constitutes a cocoon of a living organism classified into the wasp subfamily. In one embodiment of the present invention, the “hornet silk protein” may be a silk protein of an organism classified into the wasp subfamily. Since the silk of organisms classified as social bees (swords (honeybees, bumblebees, wasps, cross wasps, ants)), like hornets, has a protein composition similar to hornet silk, dialysis In the process, it is considered to show the same behavior as Hornet silk.

In the Lepidoptera, there are no particular restrictions on the subordinate classes, and examples thereof include the silkworm family, the scallop family, the lobster family, the lobster family, and the scorpion family. Among them, silkworm silk protein of the silkworm family can be procured relatively easily. In the silkworm family, the subfamily that is a subordinate classification thereof is not particularly limited, and examples thereof include the silkworm family. Moreover, in the silkworm subfamily, the genus which is a subordinate classification thereof is not particularly limited, and examples thereof include the silkworm genus. Examples of the silkworm genus include silkworm (Bombyx mori) and mulberry. In one embodiment of the present invention, “蚕” may be a living organism classified into the silkworm family. The silkworm may be, for example, a genetically modified silkworm, a rabbit, or a sericin silkworm.

(8) Inorganic salt aqueous solution In one embodiment of the present invention, the inorganic salt aqueous solution may be, for example, an aqueous solution of a weak acid salt or a neutral salt. The inorganic salt aqueous solution may be an aqueous solution in which a halide is dissolved in a solvent. The halide may be, for example, lithium halide or calcium halide. The inorganic salt aqueous solution may be, for example, an aqueous solution in which lithium bromide, calcium chloride, copper ethylenediamine, sodium thiocyanate, lithium thiocyanate, magnesium nitrate, or the like is dissolved in a solvent. The solvent may be, for example, distilled water or a buffer solution. The inorganic salt aqueous solution is preferably an aqueous solution in which lithium bromide or calcium chloride is dissolved in water from the viewpoint of more efficiently dissolving the silk protein. The concentration of the salt in the inorganic salt aqueous solution is not particularly limited.For example, 0.5, 1, 2, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10 , 10.5, 11, 11.5, or 12 mol / L, or any of these two values. This concentration is preferably 2 mol / L or more, more preferably 4 mol / L or more, from the viewpoint of improving the dissolution rate of silk protein. In Example 1 described later, a 9M LiBr aqueous solution was used as the inorganic salt aqueous solution, but the present inventor has confirmed that a 7.2M LiBr aqueous solution also exhibits the same solubility. In the step of dissolving the silk protein in the aqueous inorganic salt solution, the temperature may be any temperature at which the silk protein is dissolved, for example, 5, 10, 15, 20, 25, 30, 35, 37, 40, 45, It may be within the range of 50, 60, 70, or 80 ° C. or less, or any two values thereof. The temperature of this dissolution step is preferably 40 ° C. or lower, more preferably 30 ° C. or lower, and further preferably 25 ° C. or lower from the viewpoint of particularly suppressing the molecular degradation of silk protein. The dissolution time may be, for example, 2, 5, 10, 15, 20, 25, 30, 60, 120, 200, 500, 1000 minutes or more, or a range of any two of them. When the silk protein is dissolved in the calcium chloride aqueous solution, the calcium chloride concentration is preferably 3 to 6 mol / L from the viewpoint that the dissolution rate of the silk protein is particularly fast and the saturation dissolution amount of the silk protein is particularly large. ~ 5 mol / L is more preferred. In addition, when dissolving silk protein in an aqueous calcium chloride solution, the temperature of the dissolution process is preferably 15 to 40 ° C. from a comprehensive viewpoint regarding the speed of dissolution of the silk protein, the amount of dissolution, and the suppression of degradation. 20 to 35 ° C is more preferable, and 25 to 33 ° C is more preferable.

One embodiment of the present invention is a method for producing a silk protein aqueous solution, comprising the step of dissolving bee silk protein in a 3 to 6 mol / L calcium chloride aqueous solution. In this production method, since the silk protein has a high dissolution rate, an aqueous silk protein solution can be produced particularly efficiently. In addition, since the silk protein has a large amount of saturated dissolution, a particularly high concentration silk protein aqueous solution can be produced. Moreover, since the silk protein aqueous solution can be produced even at low temperatures, the degradation of the silk protein can be particularly suppressed. Further, a curable material can be produced through a step of dialyzing the silk protein aqueous solution obtained through this production method to prepare a dialyzed aqueous solution and a step of curing the dialyzed aqueous solution.

(9) Applications A dialyzed aqueous solution and a curable material according to an embodiment of the present invention are natural materials and have high biocompatibility, so that they can be particularly suitably used as raw materials for medical products and cosmetics. Moreover, it can be said that it is suitable as a raw material for medical products and cosmetics because it can be produced without using an organic solvent. For example, it can be used as an aqueous solution in which a dialyzed aqueous solution is applied to the outer surface of a human body. In particular, since the higher order structure of the wasp silk protein is similar to the higher order structure of keratin, it can be suitably used as a keratin site (site made of keratin) or as a protective agent. Examples of keratin sites include nails or hair. Therefore, the dialyzed aqueous solution can be used as a repairing or protecting agent for the damaged part of the nail. When the curable material is used for a medical product, for example, it can be used as a medical film, a cell scaffold material, an artificial cornea material, or the like. The dialyzed aqueous solution can be used as a permanent solution, for example. This permanent liquid functions as a hair protecting agent.

The curable material according to one embodiment of the present invention has electrical characteristics such as insulation and low relative dielectric constant. These electrical characteristics can be exhibited even under high voltage. The cured material also has strength against bending and tension, can withstand high temperatures (for example, near 200 ° C.), and the film thickness can be controlled to about 10 μm. Since the curable material which concerns on one Embodiment of this invention has such a property, it can be used conveniently as an insulating film used in an electronic device, for example.

The dialyzed aqueous solution according to one embodiment of the present invention can be made into a textile product using a method such as an electrospinning method. As a form of a textile product, a nonwoven fabric can be mentioned, for example. This nonwoven fabric can be used as, for example, a filter or a cell scaffold. In electrospinning, the mixing ratio of a dialyzed aqueous solution and a solution of polyethylene oxide is, for example, 1.2, 1.5, 2, 3, 4, 5, or 10 times the amount of the dialyzed aqueous solution relative to a solution of polyethylene oxide or the like. The ratio may include a solid content, or may be within the range of any two of them.

The dialyzed aqueous solution according to one embodiment of the present invention may be a sol or gel depending on the dialysis temperature, the pH of the external dialysate, or the silk protein concentration. The sol or gel obtained at this time is highly transparent and is different from the cloudy sol or gel obtained when dialyzed with pure water. This highly transparent sol or gel can be used, for example, for gel cosmetics.

(10) Explanation of Terms In one embodiment of the present invention, “used” may be used for a dedicated or combined use. In one embodiment of the present invention, the “material” may be, for example, a substance used as a component, raw material, or component of a product or an intermediate. This material may contain one or more substances. The shape and material of this material are not particularly limited. In one embodiment of the present invention, “curing” includes a phenomenon in which water in an aqueous solution evaporates or vaporizes into a solid or semi-solid state. This curing includes the phenomenon of solidification, solidification, or semi-solidification. This curing may be a phenomenon accompanying evaporation or vaporization of moisture, or a phenomenon accompanying crosslinking of the polymer component. Solidification includes gelation or solification. In one embodiment of the present invention, the “curing material” is not particularly limited as long as it is not in an aqueous solution state, and may be, for example, solid, gel, or sol. In one embodiment of the present invention, the “dialyzed aqueous solution” includes an aqueous solution after undergoing a dialysis operation. The dialyzed aqueous solution may be, for example, an aqueous solution after collecting the dialyzed internal solution after the dialysis step from the dialysis membrane. At this time, the dialysis time, the component concentration of the dialysis internal solution after dialysis, or the container in which the dialyzed aqueous solution is accommodated is not particularly limited. The dialyzed aqueous solution may be in an aqueous solution state, and its viscosity (15 ° C.) is, for example, 100, 50, 25, 10, 5, 1, or 0.1 cp or less, or within the range of any two of them. There may be.

In this specification, “or” is used when “at least one” of the items listed in the text can be adopted. The same applies to “or”. In this specification, when “in the range of two values” is specified, the range includes the two values themselves.

As mentioned above, although embodiment of this invention was described, these are illustrations of this invention and various structures other than the above can also be employ | adopted. Moreover, it is also possible to adopt a combination of the configurations described in the above embodiments.

Hereinafter, the present invention will be further described with reference to examples, but the present invention is not limited thereto.

<Test Example 1> When pure water was used as an external solution for dialysis 62.5 mg of moth wasp was dissolved in 2.5 ml of 9M LiBr aqueous solution within 20 minutes at 37 ° C. and then poured into a dialysis membrane. As the dialysis membrane, a cellulose tube for dialysis (dialysis membrane 8/32, plane width 10 mm) manufactured by Adia Co., Ltd. was used. 500 ml of pure water was used as an external solution for dialysis. The dialysis temperature was set to 5 ° C., and the external liquid was changed once a day, and the total was changed four times. As a result, the dialysis internal solution gelled.

Whether the aqueous solution state was maintained after dialysis or whether it was solidified (gelled or sol) was determined by the falling behavior of the three beads previously sealed in the dialysis tube. That is, the dialysis tube was turned upside down, and it was determined that the solution was solid if the beads dropped and moved in the dialysis tube, and solidified if the beads remained above the dialysis tube without falling. As beads, YTZ balls made by Nikkato were used.

Furthermore, whether the solidified product was judged to be gelled or solylated was determined as follows. When it was taken out from the tube while maintaining the columnar structure, it was judged as a gel. When the cylindrical shape was not maintained and it was fluid, it was judged as a sol.

<Example 1> When an aqueous solution containing a volatile base substance was used as an external solution for dialysis 62.5 mg of moth wasp was dissolved in 2.5 ml of 9M LiBr aqueous solution within 20 minutes at 37 ° C and then poured into a dialysis membrane. As the dialysis membrane, a cellulose tube for dialysis (dialysis membrane 8/32, plane width 10 mm) manufactured by Adia Co., Ltd. was used. 500 ml of 0.1N aqueous ammonia was used as the external dialysis solution. The dialysis temperature was set to 5 ° C., and the external liquid was changed once a day, and the total was changed four times. As a result, the dialysis internal solution maintained an aqueous solution state.

<Example 2> Examination of pH In order to examine the influence of the pH of the dialysis external solution on the solidification of the hornet silk protein during the dialysis process, aqueous solutions in the range of pH 6 to pH 11 with various types of buffer solutions and aqueous ammonia are used. These were prepared and dialyzed using these as external solutions.

6 62.5 mg of killer whale moth was dissolved in 2.5 ml of 9M LiBr aqueous solution at 37 ° C within 20-30 minutes, and then poured into a dialysis membrane. As the dialysis membrane, a cellulose tube for dialysis (dialysis membrane 8/32, plane width 10 mm) manufactured by Adia Co., Ltd. was used. The dialysis external solution was 500 ml, the dialysis temperature was fixed between 5 ° C. and 37 ° C., and the external solution was changed once a day for a total of 4 times. The types and preparation methods of the external dialysis solution used are as follows.

The phosphate buffer was prepared by mixing 0.2 M sodium dihydrogen phosphate and 0.2 M disodium hydrogen phosphate. Tris-hydrochloric acid buffer was prepared by mixing 0.1M tris (hydroxymethyl) aminomethane and 0.1M hydrochloric acid. The glycine-sodium hydroxide buffer was prepared by mixing 0.1 M glycine and 0.1 M sodium hydroxide. The carbonate-bicarbonate buffer was prepared by mixing 0.1M sodium carbonate and 0.1M sodium bicarbonate. The final concentration of all buffers was 0.1 mol / L. Further, 0.1N ammonia water was prepared. Dialysis was performed using these buffer solution and aqueous ammonia as an external solution for dialysis.

Figure 1 shows the results of the study. In the figure, the case where the aqueous solution state was maintained even after dialysis (◯) and the case where the solution was solidified (gel; ●, sol; ■) were shown separately. As a result, an aqueous solution was obtained when the dialysis temperature was less than 30 ° C. and the pH was 9.0 or more. However, at pH 9 to 10, solidification may occur depending on the type of buffer solution. An aqueous solution was obtained in the carbonate-bicarbonate buffer solution system, but solidified in the glycine-sodium hydroxide system. An aqueous solution was obtained after the pH exceeded 10 regardless of the type of buffer.

<Example 3> Examination of ammonia concentration and silk protein concentration In order to grasp in advance how the state of the dialysis external solution changes by changing the concentration of ammonia water, the relationship between ammonia concentration and pH was examined ( Figure 2). From this figure, the pH of the external dialysis solution was dependent on the ammonia concentration, and varied in the range of pH 8.5 to pH 11.6 in the range of 0.0001N to 0.7N. It is considered that the change in ammonia concentration in the dialysis solution and the pH change accompanying the change in ammonia concentration contribute to the stability of the hornet silk protein during dissolution.

When preparing solutions with various hornet silk protein concentrations, weigh out a certain amount of sputum, dissolve it in an aqueous solution of lithium bromide, and dialyze. At this time, the pressure in the dialysis tube increases during dialysis, and the external solution flows into the tube. Since it penetrates into the inside, the silk protein concentration in the solution inside the tube after dialysis is lower than the concentration before dialysis. For this reason, it is preferable to re-measure the hornet silk protein concentration of the solution after completion of dialysis. For this re-measurement, thermogravimetric analysis (TG method) was used to determine the concentration. (The TG method measures the change in weight when the aqueous solution is heated to evaporate all the water. The ratio of weight of silk to weight (method of obtaining weight%)).

Hornet silk protein `` concentration after dialysis (wt%) '' determined by the TG method after dialysis is the amount (mg) of Kirosuzubachi koji dissolved in 1 mL of 9M lithium bromide aqueous solution before dialysis `` feeding concentration (mg / mL) ”(FIG. 3). From this figure, it can be seen that there is a linear relationship between the charged concentration (mg / mL) and the solution concentration after dialysis (wt%). By utilizing this linear relationship, it is possible to roughly approximate the charge concentration required to obtain an aqueous solution having a certain concentration after dialysis. In this example, a dialysis membrane (8/32) manufactured by Edia Co., Ltd. (former Sanko Junyaku) was used as the dialysis tube. Before use, the dialysis membrane had a planar width of 10 mm and a diameter of 6 mm. The plot data in this figure was obtained at a dialysis temperature of 5 ° C., and was plotted regardless of whether the state after dialysis was an aqueous solution or gel.

After conducting the above preliminary study, under the constant dialysis temperature (5 ° C), the “dialysis aqueous ammonia concentration” and the “dissolved hornet silk protein concentration” indicate the state of the aqueous solution after dialysis. We examined the effect of this.
A pre-dialysis aqueous solution in which 3 mg to 150 mg of Hornet silk protein was dissolved per 1 mL of 9M LiBr aqueous solution was prepared, dialyzed at 5 ° C., and the presence or absence of solidification was observed from the dropping behavior of beads similar to Example 2. FIG. 4 shows the results of TG measurement performed on the sample in which the aqueous solution was maintained after dialysis, the concentration was determined, and plotted against the ammonia water concentration used for dialysis.

It can be seen that the region where the aqueous solution is obtained and the region that solidifies (sol or gel) during dialysis are bounded by the dotted line in the figure. The L side separated by a dotted line is a region where an aqueous solution is obtained, and the S side is a region solidified during dialysis. By preparing under the conditions of region L, an aqueous solution of hornet silk protein can be obtained.

From this figure, it can be seen that the concentration range of the hornet silk protein from which the aqueous solution is obtained increases as the ammonia water concentration increases. When the ammonia water concentration was 0.0001 N, an aqueous solution could not be obtained in the entire concentration range tested. When the hornet silk protein concentration was 140 mg or less (6.44 wt% or less after dialysis), the dialysis internal solution was kept in an aqueous solution state at any ammonia water concentration. In this study, the ammonia concentration was limited to 0.5 N, but it is thought that the concentration limit of the hornet silk protein aqueous solution will increase if the concentration is further increased. By the way, the concentration of commercial ammonia water is 28%, which corresponds to 14.8N, so it can be increased to 14.8N using commercial ammonia water.

Example 4 Examination of Temperature, Ammonia Concentration, and Silk Protein Concentration Under the constant concentration of ammonia water in the dialysis external solution, “dissolved hornet silk protein concentration” and “dialysis temperature” are the values after dialysis. The effect on the state of the aqueous solution was examined.
Various samples with different concentrations were prepared by dissolving 3 mg to 150 mg of moth wasp in 1 mL of 9M lithium bromide aqueous solution. This lithium bromide aqueous solution was dialyzed under the conditions of three kinds of external dialysis solutions having different ammonia concentrations and different dialysis temperatures of 5 ° C to 37 ° C. The concentration was determined by performing TG measurement on a sample that remained in an aqueous solution state after dialysis without solidifying during dialysis. FIG. 5 shows the result of plotting the determined concentration of each sample against the temperature set during dialysis.

It can be seen that the region where the aqueous solution is obtained and the region that solidifies (sol or gel) during dialysis are bordered by the dotted line in the figure. The L side separated by a dotted line is a region where an aqueous solution is obtained, and the S side is a region that solidifies during dialysis. From this figure, the relationship of “hornet silk protein concentration”, “dialysis temperature”, and “dialysis aqueous ammonia water concentration” from which an aqueous solution of hornet silk can be obtained can be seen. It suggests that an aqueous solution can be obtained if prepared under conditions in the L region.

In this figure, the ammonia water concentration is examined in the range of 0.01 to 0.5N. At concentrations lower than 0.01N, an aqueous solution was obtained at a dialysis temperature of 5 ° C even at 0.0005N. On the other hand, at a concentration higher than 0.5N, the stabilization region of the aqueous solution expands with increasing concentration, and a high-concentration hornet silk protein aqueous solution can be obtained. Commercial ammonia water has a concentration of 28% and corresponds to 14.8N. Therefore, the concentration of ammonia water used for dialysis can be arbitrarily set in the range of 0.0005N to 14.8N using commercially available ammonia water. However, in reality, if the concentration of the ammonia water becomes too high, the smell of ammonia becomes too strong, which may cause problems not only for the human body but also for the environment and cost.

<Example 5> Examination of decrease in molecular weight It is known that a protein is hydrolyzed in a highly alkaline aqueous solution. The decrease in molecular weight due to hydrolysis causes a decrease in the mechanical properties of the film obtained after drying (casting). Therefore, in order to investigate the presence or absence of molecular weight reduction due to ammonia water dialysis, electrophoretic measurement was performed. For comparison, the hornet silk protein (gel state) after dialysis when dialyzed with pure water was also dissolved in a lithium bromide aqueous solution and then subjected to electrophoresis.

(1) In the case of dialyzing with pure water 50 mg of the killer whale moth was dissolved in 2 ml of 9M LiBr aqueous solution at room temperature and dialyzed in pure water at 5 ° C to 37 ° C. The dialyzed external solution was 500 ml, and the external solution was changed once a day for a total of 4 times. The solution gelled during dialysis. The gel after dialysis was frozen at −30 ° C., lyophilized, and the resulting dried sample was electrophoresed. The results are shown in Fig. 6 (pure water 5-37). For comparison, the result of electrophoresis of the moth wasp is also shown ((C) in FIG. 6).

(C) in Fig. 6 clearly shows the bands of the four major proteins that make up the cocoon. Similarly, in the sample after dialysis with pure water, bands of four kinds of main constituent proteins are clearly observed, but a plurality of bands derived from other than the main proteins are also observed. This is considered to be due to the fact that some degree of degradation progressed in the process of dialysis in pure water and that some proteins contained in the nests attached to the sputum were dissolved when the sputum was dissolved. . When compared at the dialysis temperature, it appears that the density of the low-molecular band increases with increasing temperature. From this, it is considered that the band on the low molecular side is not derived from the soot adhesion component but derived from the soot decomposition component. However, the difference due to dialysis temperature is small, suggesting that the degree of degradation is small.

(2) When Dialyzed with Ammonia Water FIG. 7 shows the results of measuring the difference in electrophoretic pattern of protein after dialysis according to the dialysis temperature when dialyzed with ammonia water with respect to each ammonia water concentration.

In all results, the lower the dialysis temperature, the more the decomposition was suppressed. However, protein degradation is significant when dialyzed at 37 ° C with 0.5N ammonia concentration. From this result, it can be seen that when dialysis is performed in ammonia water, the influence of the dialysis temperature on the protein molecular chain is increased, but decomposition can be suppressed by performing at low temperature. Furthermore, in dialysis at a high temperature, the decomposition can be suppressed as the ammonia water concentration is reduced.

Especially, it can be seen that the results of dialysis at 20 ° C. or lower show almost no degradation of molecular chains in any ammonia concentration. When the molecular chain is decomposed, the physical properties of a film obtained by drying an aqueous solution described later are significantly reduced. From the above results, it can be said that the aqueous solution prepared in this example is preferably an aqueous solution obtained at a dialysis temperature of 20 ° C. or less and having almost no molecular chain decomposition.

<Example 6> Examination of long-term stability (1) Examination of long-term stability and ammonia concentration In order to examine the long-term stability of the aqueous solution obtained in the above examples, the period from dialysis to solidification was examined. It was.
First, per 1 mL of 9M LiBr aqueous solution, 6.7-150 mg of Kirosuzubee was 6.7, 16.7, 25.0, 37.5, 45.8, 54.6, 58.3, 72.9, 87.5, 100, 110, 120, 125, 130, 140, 150 mg) was dissolved in a pre-dialysis aqueous solution and dialyzed at 5 ° C. In addition, seven types of ammonia water of 0.0005, 0.001, 0.005, 0.01, 0.05, 0.1, and 0.5N were used as the external dialysis solution. In dialysis, the external solution was changed once a day, and the dialysis was changed four times in total.

Next, the aqueous solution after dialysis (dialysis internal solution) was left in a refrigerator at 5 ° C., and the time until solidification was examined. The results are shown in FIG. The figure shows that it solidified within 2 days for more than 1 day (<2d), solidified within 14 days for more than 2 days (<14d), solidified within 1 month for more than 14 days (<1m), even after 1 month The aqueous solution is shown as being maintained (> 1m).

It was found that the higher the ammonia concentration, the better the stability of the aqueous solution, and at 0.05 N or higher, it can be stably maintained as an aqueous solution for almost one month or more in almost the entire concentration range of the aqueous solution obtained. When the holding temperature was examined at a temperature higher than 5 ° C., a tendency to shorten the time until solidification was observed as the holding temperature increased. That is, the higher the holding temperature, the shorter the stabilization time of the aqueous solution. At a holding temperature of 20 ° C, the aqueous solution could be maintained for more than 1 month only at an ammonia concentration of 0.05N or more and a hornet silk concentration of 2wt% or less. Further, when the holding temperature was increased, the aqueous solution could not be maintained for more than 1 month under any conditions.

<Example 7> Molecular structure of hornet silk protein in aqueous solution Next, in order to investigate the molecular structure of hornet silk protein in the aqueous solution obtained by ammonia water dialysis, CD measurement was attempted (FIG. 9). An aqueous solution dialyzed with 0.1N ammonia water and having a hornet silk protein concentration of 0.1 wt% was measured under the conditions of a resolution of 0.2 nm, a bandwidth of 1.0 nm, and a sensitivity of 50 mdeg. From this result, it was found that the hornet silk protein formed an α-helix structure in an aqueous solution.

<Example 8> In the case of Hornet silk protein produced by a genetically modified organism In order to isolate the gene (Vssilk 1, accession no. AB537885) of the main protein that constitutes the moth of the killer whale, GAGATCTGGGCCATCAAGGTTGTCTG (SEQ ID NO: 1) Using two types of GGTCGACTTAGGCGCTGCTACTACTC (SEQ ID NO: 2) as primers, PCR was performed on the cDNA of the silk gland of Kirosuzubee (Sezutsu et al. (2007): Biosci. Biotechnol. Biochem., 71, 2725-2734.). The PCR product was cloned with the pGEM T-Easy vector (Promega), and then subcloned between the BglII site and EcoRI site of the expression vector pTrcHis (Invitorogen). BL21 E. coli strain is used as the host cell for expression, grown at 37 ° C in LB medium supplemented with 150 mg / mL ampicillin, and 0.5 mM IPTG is added when the cell concentration reaches 0.5-0.7 OD _600. And the culture was continued for another 5 hours. After completion of the culture, the inclusion body was treated according to the QIAexpressionist protocol, and the solidified protein product was dissolved in 9M LiBr aqueous solution. When the obtained 9M LiBr protein aqueous solution was examined by electrophoresis, it was found that it was an aqueous solution in which Vssilk 1, which is a major protein of the moth wasp, was dissolved with high purity.

When the obtained 9M LiB protein aqueous solution was dialyzed with water at room temperature, protein precipitation occurred. On the other hand, when dialysis was performed at room temperature with 0.05N ammonia water, the amount of protein precipitated was significantly smaller than in the case of water dialysis. The aqueous solution after dialysis was centrifuged (12000 rpm, 4 ° C., 10 minutes), and the supernatant was diluted 10 times and the absorbance at 280 nm was measured.The absorbance of water dialysis was 0.065, while that of 0.05N ammonia water dialysis was 0.242. Thus, a 3.7-fold density difference was observed. This result also means that the hornet silk protein produced by the genetically modified Escherichia coli can be dialyzed in ammonia water to suppress solidification during dialysis and obtain an aqueous silk solution.

<Example 9> Production of film The peripheral part of the cocoon was taken out from the nest of the yellow wasp. After removing as much as possible the nest material (made by solidifying the wood chips) adhering to the spear, 1.5 g of the nest was dissolved in 30 mL of 9M LiBr aqueous solution. The dissolution was performed by shaking at high speed for 30 minutes at 37 ° C. After dissolution, the mixture was centrifuged (10 kG, 20 minutes) to separate insoluble components (mostly wood chips from the nest material), and then filtered to collect the filtrate. The filtrate was put in a dialysis membrane (Wako Pure Chemical Cellulose Tube, size 24) and dialyzed in 0.1N ammonia water. As the ammonia water, 28% ammonia water (manufactured by Nacalai Tesque, reagent grade) was diluted as 14.8N ammonia water and used. Dialysis was performed in a constant temperature chamber at 5 ° C., and dialysis was performed with constant agitation using 1 L or more of dialysis external solution (ammonia water). The dialysate was exchanged at least once a day, and the exchange of the external solution was repeated until the conductivity decreased to about 200-300 or less and became constant (at least 4 exchanges were performed).

Since insoluble matters (components that could not be removed by filtration before dialysis) precipitate during dialysis, filtration was performed again. The obtained aqueous solution had a viscosity of 3.33 cp (15 ° C.) and a concentration of 3.38 wt%. 28 mL of this aqueous solution was poured into a container having a flat bottom surface (manufactured by Toyo Kikai Co., Ltd., square No. 1 petri dish (235 mm × 85 mm × 16 mm) polystyrene) and dried (cast) in a constant temperature room at 20 ° C. The drying speed was adjusted by blowing air so that it could be dried within about 2 days (Figs. 10 and 11). The film thickness was 30 ± 5 μm. The film obtained under these conditions was cut into strips having a width of 3 mm and a length of 30 mm, and the mechanical properties were measured. The results are shown in Table 1.

The above-mentioned physical property values are the mechanical properties (Young's modulus 2.7 GPa, tensile strength 80 MPa, elongation at break, reported by drying 6% silk fibroin aqueous solution reported by Yin et al. (Biomacromolecules, 11, 2890, 2010). 5%).

As described above, in order to obtain a film by casting, it is preferable to use a container having a flat bottom surface. The ease of peeling of the film differs depending on the material of the container. Polystyrene (e.g., Toyo Kikai Kagaku No. 1 Petri dish, Eiken Chemical Co., Ltd. Sterilized No. 2 Petri dish, sterilized MM Petri dish, etc.) Petri dishes, Teflon petri dishes, or containers with a Teflon-coated surface are easy to peel off and are convenient.

FIG. 12 shows a solid state NMR spectrum of the cast film produced. A peak derived from the α helix appears greatly, indicating that it has a structure mainly composed of α helix. The fact that a hornet silk film mainly composed of an α-helix structure is obtained is the same as the film produced by casting from the HFIP solution disclosed in Patent Document 2.

FIG. 13 shows the FT-IR spectrum of the produced cast film. In the amide I band region, a peak with the top at 1638 cm ^-1 appears. The α-helix molecular chain forms a super-secondary structure (coiled coil structure) because it is shifted to the lower wavelength side by 10 cm ^-1 than the typical α-helix amide I band (around 1645 cm-1). (Heimburg et al., Biochemistry, 1990).

<Example 10> Conditions for film production Using the "drying temperature" as a parameter, the conditions under which films can be produced were examined (Fig. 14). Here, “Film was made” refers to a case where a continuous film was peeled off from the petri dish and removed. “When the film could not be produced” refers to a case where the hornet silk film on the petri dish is cracked when it is dried, or it is cracked, crushed or torn in the process of peeling the hornet silk film from the petri dish. Point to. In addition, when a film cannot be formed, the Hornet silk film often does not adhere to the petri dish.

In the following, the results of studying the “drying temperature” that the film can be produced are described below. An aqueous solution of Hornet silk protein concentration of 2.44 wt% obtained by dissolving 1.5 g of Kirosuzume wasp in 30 mL of 9 M lithium bromide aqueous solution and dialyzing with 0.1 N aqueous ammonia was added to a square petri dish (Eiken Chemical Co., Ltd., No. 2 square petri dish) ) Was poured into the solution and dried (cast) in a temperature range of 20 to 36 ° C. to produce a film. Table 2 below summarizes the cases where a film was formed after drying, with a circle mark and a case where a film was not formed. In this experiment, all films were dried within 2 days.

From this result, it was found that a film could be formed at a temperature below 27 ° C and 29 ° C. Even when the film was dried at a temperature of 27 ° C. or lower, the frequency at which the film could not be increased as the drying time increased. In the above experiment, the sample was dried within 2 days. However, when it was dried for more than 2 days, it easily breaks. It is desirable that the drying time be as short as possible. However, rapid drying causes deterioration of the film shape. It was appropriate to dry within 2 days.

Therefore, it is preferable to appropriately adjust the “drying temperature” and “drying time” in the production of the film. A particularly preferable condition for forming a film is when the aqueous ammonia solution in which the hornet silk protein is dissolved is dried at 27 ° C. or less within 2 days. Regarding “drying time”, it is important to control the evaporation rate of moisture in order to prevent cracks and cracks during film processing.

When the film was produced under conditions that allow it to be produced, a film that could not be broken even when it was completely folded to the extent that the streaks were attached with fingers or tweezers was produced (FIG. 15). However, depending on the humidity, the thickness of the film, and the like, there are cases where it can be bent and broken, so strictly speaking, it can be said to be “a film that does not break even when folded” rather than a “film that does not break even when folded”. On the other hand, when the hornet silk film produced on the conditions which cannot produce a film was subjected to the bending test, all the samples were cracked. Figure 15 shows a 1cm wide film folded and creased with tweezers (top). The inside of the creased tweezers (middle). This is a picture of the bottom of the creased film with both ends widened (bottom). As shown in this figure, under the condition that a flexible film can be produced, it is possible to produce a film that does not break even if it is bent and has streaks.

<Example 11> Electrical properties of film The capacitance C of the cast film of Hornet silk protein obtained by the procedure of Example 9 was measured. Two 2 cm × 2 cm square copper plates were prepared, and the capacitance was measured by sandwiching a film between the copper plates. A custom LCR meter (ELC-133A) was used for the measurement. The capacitance value (pF) was measured for three test signal frequencies of 100 Hz, 1 kHz and 10 kHz.

Figure 16 shows the capacitance values (pF) at test signal frequencies of 100 Hz, 1 kHz, and 10 kHz, with respect to the film thickness (mm), ◇ (diamond), □ (square), and △ (triangle), respectively. ). The hornet silk protein cast film was measured before and after drying a plurality of films having different thicknesses. Drying was performed in a vacuum dryer.

The electric capacity of the hornet silk film changes greatly before and after drying, and it can be seen that the electric capacity is lowered (insulation performance is improved) by drying. Furthermore, it is expected that the electric capacity is reduced by removing the residual moisture in the film. For comparison, it can be said that the hornet silk film has a low electric capacity even when compared with a general-purpose film measured under the same conditions, and can be said to be an excellent electric insulator.

<Example 12> Film when alkaline solution other than aqueous ammonia is used An aqueous solution of pH 11 prepared with sodium carbonate Na ₂ CO ₃ is used as an external solution for dialysis, and a hornet silk protein aqueous solution (1.5 When 2 mL of g / 10 ml male hornet wase was poured into a circular petri dish (Eiken Petri dish AG2000) having a diameter of 55 mmφ and dried (cast), a cloudy substance as shown in FIG. 17 was obtained. Since this material is brittle and easy to break, it cracked during removal from the petri dish. The cause of white turbidity is due to precipitation of sodium carbonate by drying. If salt precipitates in the hornet silk cured body by drying, the hornet silk cured body becomes brittle and easily broken, and it is considered that a film was not obtained. From the above results, it can be seen that it is important to use a volatile substance such as ammonia as a base substance to be used in order to obtain a film.

<Example 13>, Film in the case of using an aqueous solution containing a volatile base substance As in the case of ammonia, dialysis was performed using water added with diethylamine, which is a volatile base, as an external dialysis solution. When a diethylamine 0.1N aqueous solution was prepared, an aqueous solution having a pH of 11.7 was obtained. Using this basic aqueous solution as an external solution for dialysis, a 9M lithium bromide aqueous solution of killer whale wase was dialyzed. The dialysis temperature was 5 ° C. The aqueous solution was maintained after dialysis, and a uniform aqueous solution was obtained. The concentration of the aqueous solution determined by TG measurement was 6.39%. When 4 ml of the obtained aqueous solution was poured into a circular petri dish having a diameter of 5.5 mmφ (sterilized MM petri dish manufactured by Eiken Chemical Co., Ltd.) and dried, a transparent and flexible film as shown in FIG. 18 was obtained.

<Example 14> Film in which soot is dissolved with an inorganic salt other than lithium bromide (1) Film production The case of dissolving soot in a calcium chloride aqueous solution was also examined. 5.4M calcium chloride aqueous solution was prepared by dissolving 15 g of calcium chloride (Nacalai tesque, reagent grade) in 20 ml of water. This 5.4M calcium chloride aqueous solution was heated to 65 ° C., and 600 mg of killer whale moth was added and dissolved while stirring. Since almost all of the cocoons were dissolved within 3 minutes, after heating and cooling with running water, insoluble materials (such as nests of wood from the nests) that had adhered to the cocoons were filtered (Kiriyama Mfg. Co., Ltd., Kiriyama funnel (φ60) No.5A filter paper). When the filtrate was poured into a dialysis tube and dialyzed at 5 ° C, a uniform aqueous solution was obtained without solidifying the results of ammonia water in the dialysis external solution at 0.5N, 0.1N or 0.05N. It was. The silk concentration of the aqueous solution obtained by 0.1N dialysis was 1 wt%. When the calcium chloride aqueous solution was dialyzed with pure water without using ammonia, the hornet silk protein solidified during dialysis to become a white gel, and no aqueous solution was obtained. Therefore, it was found that an aqueous solution can be obtained by dialysis against ammonia water even when the killer whale moth is dissolved with an aqueous calcium chloride solution.

When this 1 wt% aqueous solution was poured into a circular petri dish (Eiken Petri dish AG2000) having a diameter of 55 mmφ and dried (cast) at 20 ° C., a flexible film could be obtained (FIG. 19).

(2) Solubility test Solubility of soot in aqueous calcium chloride solution was examined. Figure 20 shows the concentration of calcium chloride and the concentration of calcium chloride when immersed in 10 mL of calcium chloride aqueous solution at 50, 60 and 70 ° C and shaken 30 minutes and 60 minutes after shaking. It is the figure which plotted dissolution rate (%). The dissolution rate was calculated from the absorbance of ultraviolet rays having a wavelength of 280 nm measured with a UV apparatus. From this figure, it can be seen that in the temperature range of 50 ° C. to 70 ° C., there is no difference in dissolution rate between shaking for 30 minutes and shaking for 60 minutes. This suggests that the equilibrium dissolution state has been reached with shaking within 30 minutes. In addition, this figure shows that the dissolution rate (%) of soot in the equilibrium dissolution state depends on the concentration of calcium chloride. Soot was easily dissolved in the concentration range of calcium chloride of 3.0 to 6.0M, and soot was completely dissolved when the calcium chloride concentration was 4 to 5M, but the saturated dissolution concentration decreased before and after that.

FIG. 21 shows that when 20 mg of giant hornet was soaked in 10 mL of 4.5 M and 3.6 M calcium chloride aqueous solution and shaken at each temperature in the range of 20 to 70 ° C., 30 minutes after shaking, and 60 It is the figure which plotted the dissolution rate after a minute with respect to temperature. From the results at a calcium chloride concentration of 4.5M, it can be seen that the higher the temperature at the time of shaking, the smaller the difference in dissolution rate after 30 minutes and 60 minutes, and almost the same at 50 ° C or higher. From this result, it was found that the dissolution rate of soot varies depending on the shaking temperature. Next, the relationship between the dissolution rate and the shaking time was plotted against each shaking temperature, mainly at 50 ° C or less. (Figure 22).

Figure 22 shows the change in dissolution rate when 20 mg of giant hornet moth is immersed in 10 mL of 4.5 M and 3.6 M calcium chloride aqueous solution and shaken at 20 ° C, 30 ° C and 50 ° C. FIG. When 4.5M calcium chloride is shaken at 50 ° C, the dissolution rate reaches 100% within 30 minutes, but the time until the dissolution rate reaches 100% increases as the temperature decreases to 30 ° C and 20 ° C. Become. However, even at 20 ° C., it can be seen that all the soot can be dissolved by shaking for a long time. On the other hand, when it is shaken at 30 ° C in a 3.6M calcium chloride aqueous solution, it takes more time to reach an equilibrium dissolution state than when it is shaken at 4.5 ° C at 30 ° C in the same temperature. Long, ie, slow dissolution rate. Furthermore, when the solution was shaken in a 3.6 M calcium chloride aqueous solution at 30 ° C., the dissolution rate did not reach 100%, but reached equilibrium at around 55%.

Based on the above results, Hornet Silk Koji is better dissolved in 4-5M calcium chloride aqueous solution. In this case, a particularly high concentration of soot can be dissolved. In addition, the dissolution temperature can be dissolved in a shorter time as the dissolution temperature increases, but decomposition of molecules due to the increase in temperature may be a problem. From the viewpoint of preventing molecular decomposition, it is preferable to dissolve at a low temperature as much as possible. However, since the dissolution rate decreases as the dissolution temperature decreases, the time required for dissolution becomes longer. On the other hand, a shorter dissolution time is preferable from the viewpoint of suppressing molecular decomposition. Considering the above, it is most preferable to dissolve at about 30 ° C.

<Example 15> Film when using other than hornet of hornet (1) Cross hornet The hornet belongs to Vespula and is different from the vespid subfamily (Vespa), but some of the constituent proteins are high. It shows homology. Cross-beetles are also soluble in 9M lithium bromide aqueous solution, and then solidify (precipitate, gel or sol) during dialysis when dialysis for desalting is performed in pure water. Therefore, dialysis was attempted using an aqueous solution of 0.1N or 0.5N ammonia water as an aqueous solution of Lithium bromide.

270-300 mg of soot was weighed and dissolved in 3 mL of 9M aqueous lithium bromide solution, and many insolubles remained. Since it has been confirmed by electrophoresis and NMR that all protein components of the hornet moth are dissolved in 9M lithium bromide aqueous solution, the insoluble matter is considered to be a contaminant other than the cocoon protein. Since the hornet is small, it is difficult to collect only the moth, and many foreign materials such as nests are attached to the moth. After removing insolubles by centrifugation, the solution was dialyzed in 0.5N ammonia water at 5 ° C., and an aqueous solution was obtained without solidifying during dialysis. The concentration of the aqueous solution was 4.0 to 4.4 wt%.

Similarly, 150 mg of soot was weighed out and dissolved in 3 mL of 9 M lithium bromide aqueous solution, insoluble matter was removed, and dialysis was performed at 5 ° C. in 0.1 N aqueous ammonia to obtain a 2.8 wt% aqueous solution. . From the above results, it was found that an aqueous solution can be obtained even in the case of the hornet of the hornet.

Next, 4 mL of a 4.0 to 4.4 wt% aqueous solution obtained by dialysis with 0.5N aqueous ammonia was poured into a circular petri dish (Eiken Petri dish AG2000) with a diameter of 55 mmφ and dried (cast) in an atmosphere at 5 ° C. A good film was obtained (FIG. 23).

(2) Silk fibroin Silk fibroin and sericin produced by silkworms can be dissolved in a lithium bromide aqueous solution and then dialyzed with pure water to obtain an aqueous solution without solidifying during dialysis. Therefore, for the purpose of obtaining an aqueous fibroin solution, it is not necessary to perform dialysis with aqueous ammonia, but even in the case of fibroin, an aqueous solution can be obtained by dialysis with aqueous ammonia. For example, when 3 g of refined silk fibroin was dissolved in 20 ml of 9M LiBr aqueous solution and dialyzed against 0.5N ammonia water, a clear aqueous solution was obtained. Similarly, an aqueous solution was obtained when dialyzed against 0.1N aqueous ammonia.

Silk fibroin aqueous solution dialyzed with pure water solidifies into a white gel when left for a long time (about 1 month) even at low temperatures (5 ° C), but is dialyzed against 0.5N or 0.1N aqueous ammonia. The silk fibroin aqueous solution thus obtained did not solidify even when stored at a low temperature (5 ° C.) for more than 1 month, and the aqueous solution was maintained. Therefore, it can be said that the stability of the fibroin aqueous solution is improved by using the aqueous ammonia solution. When the aqueous ammonia solution of fibroin obtained was cast at 20 ° C., a transparent and flexible film as shown in FIG. 24 was obtained.

<Example 16> Film in the case of using a fluorine-processed formwork The surface of a stainless steel petri dish (manufactured by Yamada Seisakusho Co., Ltd., 75 mmφ) was coated with a fluororesin. Thereby, the inner surface of the stainless steel petri dish became gray. When an aqueous solution produced under the same conditions as in Example 9 was poured into this petri dish and cast, a transparent and flexible film as shown in FIG. 25 was obtained.

<Example 17> Reuse of film (solution behavior of cast film)
The reuse of the cast film produced by the method described in the above example was examined.
The cast film obtained from the aqueous solution dialyzed with 0.1N aqueous ammonia after dissolving the moth wasp in 9M lithium bromide aqueous solution was dissolved again in 9M lithium bromide aqueous solution, and the resulting hornet silk protein was dissolved. The viscosity of the aqueous lithium bromide solution was measured. For comparison, the viscosity was also measured in a state in which a moth hornet, giant hornet or moth wasp was dissolved in a 9M lithium bromide aqueous solution. The results are shown in FIG.

It can be seen that the value of the viscosity with respect to the amount of silk protein dissolved in 9M lithium bromide aqueous solution is almost the same between the cocoon and the recycled film. In general, it is known that the viscosity decreases as the molecular weight decreases. The result that the viscosity was hardly changed suggests that even when the cast film is redissolved, a solution similar to that obtained when the soot is directly dissolved is obtained.

When a lithium bromide aqueous solution obtained by re-dissolving the obtained cast film was dialyzed against 0.1N ammonia water at 5 ° C., a similar aqueous solution was obtained. Furthermore, when this aqueous solution was cast on a petri dish and dried, a flexible film was obtained. Therefore, in the present invention method, the cast film can be reused (FIG. 27).

<Example 18> Fibrosis Since a uniform aqueous solution was obtained by the method described in the above Example, it was possible to use it as a spinning stock solution for spinning. For example, a 5 wt% solution of polyethylene oxide having a molecular weight of 900,000 is mixed at a volume ratio of 3: 1, 2: 1, 1: 1 in an aqueous ammonia solution in which 5.4 wt% Hornet silk protein prepared by the above method is dissolved. When mixed at a ratio and electrospun (electrospinning) at a voltage of 15 kV from a 27G needle, uniform nanofibers with a diameter of several hundred nanometers were obtained from 3: 1 and 2: 1 solutions. It was. In the 1: 1 system, bubbles entered into the fibers, and uniform fibers could not be obtained.

<Example 19>
About the experiment performed using the chiros wasp among the above examples 3 to 7, 9 to 11, 13, 14, 16, 18, the chiros wasp is substantially the same instead of the beetle wasp, the giant wasp, the wasp, the wasp, or the cross wasp. The experiment was conducted. As a result, almost the same result as that obtained when using a key wasp was obtained. In addition, a dialyzed aqueous solution and a film could be made by mixing a plurality of species of wasp cocoons.

<Discussion>
As a result of the above, it was revealed that when the inorganic salt aqueous solution in which the hornet silk protein was dissolved was dialyzed with a high pH aqueous solution, the dialysis internal solution could maintain the aqueous solution state. Furthermore, as dialysis conditions, the pH of the external dialysis solution is 9 or more, the ammonia concentration of the dialysis external solution is over 0.0001 N, the dialysis temperature is 20 ° C. or less, or the hornet silk protein concentration of the dialysis internal solution is 140 mg / mL or less (after dialysis) It was found that the dialysis internal solution was able to maintain a stable aqueous solution state and the degradation of the hornet silk protein in the dialysis internal solution could be suppressed.

Moreover, using the obtained dialyzed aqueous solution, a film having sufficient mechanical properties, transparency and flexibility and having an α helix structure could be produced. Furthermore, it has been found that when an aqueous solution containing a volatile basic substance is used as the dialysis external solution during dialysis, a particularly good film can be produced.

In the above, this invention was demonstrated based on the Example. It is to be understood by those skilled in the art that this embodiment is merely an example, and that various modifications are possible and that such modifications are within the scope of the present invention.

Claims (21)

1. A method for producing a dialyzed aqueous solution containing silk protein,
   A production method comprising a step of dialysis using an aqueous solution of an inorganic salt containing bee silk protein as an internal dialysis solution and an aqueous solution having a pH of 9.0 or more as an external dialysis solution.
2. 2. The production method according to claim 1, wherein the aqueous solution having a pH of 9 or more is an aqueous solution containing a volatile basic substance.
3. 3. The production method according to claim 2, wherein the aqueous solution having a pH of 9 or more contains the volatile base substance in excess of 0.0001N.
4. 4. The production method according to claim 3, wherein the dialysis is performed at 20 ° C. or lower.
5. The production method according to claim 4, wherein the silk protein concentration of the dialysis internal solution before dialysis is 140 mg / mL or less.
6. 5. The production method according to claim 4, wherein the dialysis is performed so that the silk protein concentration of the dialyzed aqueous solution is 6.5 wt% or less.
7. The production method according to any one of claims 1 to 6, wherein the dialysis is performed so that the dialysis internal solution maintains an aqueous solution state.
8. The production method according to any one of claims 1 to 7, further comprising a step of dissolving bee silk protein in a 3 to 6 mol / L calcium chloride aqueous solution.
9. A dialyzed aqueous solution obtained through the production method according to any one of claims 1 to 8.
10. 10. The dialyzed aqueous solution according to claim 9, for medical products, cosmetics, electronic devices, or textile products.
11. A cured material obtained through a step of curing the dialyzed aqueous solution according to claim 9 or 10.
12. The curable material according to claim 11, which is a film.
13. 13. The curable material according to claim 11 or 12, for medical products, cosmetics, electronic equipment, or textile products.
14. A method for producing a dialyzed aqueous solution containing silk protein,
    Dissolving the curable material according to any one of claims 11 to 13 in an aqueous inorganic salt solution;
    Dialysis using an aqueous inorganic salt solution in which the curable material is dissolved as the dialysis internal solution and an aqueous solution having a pH of 9.0 or more as the external dialysis solution.
15. A dialyzed aqueous solution obtained through the production method according to claim 14.
16. A curable material obtained through a step of curing the dialyzed aqueous solution according to claim 15.
17. A method for producing a curable material containing silk protein,
    A step of dialysis using an aqueous solution of inorganic salt containing bee silk protein as an internal dialysis solution, and an aqueous solution of pH 9.0 or more as an external dialysis solution;
    Recovering the dialysis internal solution after the dialysis step from the dialysis membrane;
    Curing the dialysis internal solution after collection;
    Including the production method.
18. A dialyzed aqueous solution containing at least 0.1 wt% bee silk protein, 0.0001N to 14.8N volatile base substance, and 20 ° C or lower.
19. 19. A curable material obtained through a step of curing the dialyzed aqueous solution according to claim 18.
20. A method for producing an aqueous silk protein solution comprising the step of dissolving bee silk protein in a 3-6 mol / L calcium chloride aqueous solution.
21. 21. A curable material obtained by dialysis of a silk protein aqueous solution obtained through the production method of claim 20 to prepare a dialyzed aqueous solution and a step of curing the dialyzed aqueous solution.

Images