WO2014189257A1 - 연자성미세구조물을 이용한 리간드의 스크리닝 시스템 및 그 용도 - Google Patents

연자성미세구조물을 이용한 리간드의 스크리닝 시스템 및 그 용도 Download PDF

Info

Publication number
WO2014189257A1
WO2014189257A1 PCT/KR2014/004495 KR2014004495W WO2014189257A1 WO 2014189257 A1 WO2014189257 A1 WO 2014189257A1 KR 2014004495 W KR2014004495 W KR 2014004495W WO 2014189257 A1 WO2014189257 A1 WO 2014189257A1
Authority
WO
WIPO (PCT)
Prior art keywords
ligand
magnetic
target material
microstructure
soft magnetic
Prior art date
Application number
PCT/KR2014/004495
Other languages
English (en)
French (fr)
Inventor
김성천
Original Assignee
Kim Sung-Chun
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Kim Sung-Chun filed Critical Kim Sung-Chun
Publication of WO2014189257A1 publication Critical patent/WO2014189257A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
    • G01N33/54313—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals the carrier being characterised by its particulate form
    • G01N33/54326—Magnetic particles
    • G01N33/5434—Magnetic particles using magnetic particle immunoreagent carriers which constitute new materials per se
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/531—Production of immunochemical test materials
    • G01N33/532—Production of labelled immunochemicals

Definitions

  • the present invention relates to a method and system for screening a ligand using a soft magnetic microstructure, and more particularly, to a target material formed by reacting a library of ligand magnetic particles composed of a plurality of different compounds with a target material that is a biochemical system.
  • the present invention relates to a method and system for screening ligands using a chain soft magnetic microstructure, in which a particle complex changes a flow path under the influence of a magnetic force applied from a magnetic force generating module in a microfluidic channel.
  • Protein binding and biologically active proteins have many biological activities due to their ability to specifically bind to one or more binding partners (ligands), themselves proteins or other molecules.
  • binding partner of a protein Once the binding partner of a protein is known, research is relatively focused on how the interaction of the binding protein and its binding partner affects biological activity. It also screens compounds for their ability to competitively inhibit complex formation or dissociate complexes already formed. Such inhibitors will affect the biological activity of the protein, at least if they can be delivered to the site of interaction in vivo.
  • the binding protein is a receptor
  • the binding partner will be an effector with biological activity and the inhibitor will antagonize the biological activity. If a binding partner interferes with any biological activity through binding, the inhibitor of that interaction will be an agonist.
  • the current state of the art regarding the screening for ligands that bind to an isolated single protein relates to the search for ligand magnetic particles that bind to the ligand binding pockets of a single protein. This analysis only searches for the appropriate ligand depending on the relative affinity of the compound for the protein, and the activity of the compound on the receptor as to whether the compound acts as an agonist or antagonist of the receptor activity. Can't figure it out.
  • Both natural products and synthetic compounds may be tested for only one activity, but may be comprehensively tested for all biological activities of interest to the tester. Testing was originally performed in animals, after which a less expensive and more convenient system utilizing isolated organs, tissues or cells, or cell cultures, membrane extracts or purified receptors was developed for some pharmacological evaluation. Testing in whole animals and isolated organs typically requires large amounts of chemical compounds to be tested. Since the amount of a given compound in the set of potential pharmaceutical compounds is limited, this needs to limit the number of screenings performed.
  • Combination chemistry allows many kinds of compounds to be synthesized in small quantities suitable for automated analysis of molecular targets quickly and relatively inexpensively. Numerous laboratories have successfully produced a wide range of combinatorial chemistry libraries (Doyle, 1995, Gordon et al., 1994a, Gordon et al., 1994b).
  • the first combinatorial library consisted of peptides or proteins, with all or selected amino acid positions in them being random. Peptides and proteins can exhibit high and specific binding activity and can act as enzymes. As a result, they are most important in biological systems. Unfortunately, the peptides themselves are of limited use in therapy. They are expensive to synthesize, unstable in the presence of proteases, and generally do not cross cell membranes. Different classes of compounds have better properties as drug candidates.
  • Nucleic acids are also used in combinatorial libraries. Their greatest advantage is that nucleic acids with the appropriate binding activity can be easily amplified. As a result, combinatorial libraries composed of nucleic acids can have low repeatability and thus high diversity.
  • the resulting oligonucleotides are not suitable as pharmaceuticals for several reasons. First, oligonucleotides have a high molecular weight and cannot be simply mass synthesized. Second, oligonucleotides are polyvalent anions and cannot cross cell membranes. Finally, deoxy- and ribo-nucleotides are hydrolyzed by nucleases, which occur in all biological systems and are typically degraded before reaching the target.
  • ligand screening and verification is an improvement achieved using parallel screening methods such as robotics and high throughput detection systems and other technological advances
  • current screening methods still have a number of related problems. For example, screening a large number of samples using existing parallel screening methods requires a large venue requirement to accommodate samples and equipment, such as robotics, the high costs associated with this equipment, and the large amount of reagents required to perform the assay. This is necessary.
  • the reaction volume should be low because of the small amount of test compounds available. These small volumes add to errors associated with fluid handling and measurement, such as errors due to evaporation, formulations, and the like.
  • fluid handling equipment and methods it has typically been impossible to handle these volume ranges with acceptable levels of accuracy due in part to the effect of surface tension at such small volumes.
  • Developing a system to solve these problems requires consideration of aspects of various testing methods. These aspects include target and compound sources, test compound and target handling, specific assay requirements, and data acquisition, clearance storage, and analysis. In particular, there is a need for high throughput screening methods and related equipment and systems capable of performing repetitive and accurate assay screening and operating at very low volumes.
  • microfluidics enabling micro-synthesis to accurately and conveniently analyze samples in less time and at lower volumes. Advances are being made in the form of micro-total analysis systems (-TAS) and lab-on-a-chip.
  • -TAS micro-total analysis systems
  • the present invention is to provide a system for screening a ligand binding to a target material using a molecular transport system of the molecular transport system (Korean Patent Registration 10-1067695) patent using a soft magnetic microstructure.
  • the present invention satisfies the need for a screening system of ligands from a ligand library consisting of a plurality of test compounds and a variety of other needs for target materials that are biochemical systems.
  • the present invention provides a system for performing screening that presents an important solution to the problems of existing ligand screening systems.
  • the present invention has been made to improve the prior art as described above, and includes a target material-ligand magnetic particle complex formed by reacting a ligand magnetic particle library consisting of a plurality of test compounds in a reaction solution with a target material which is a biochemical system. It is an object of the present invention to provide a method and system for screening a ligand that separates only a target material-ligand magnetic particle complex from a reaction mixture by using a soft magnetic microstructure and binds to a target material.
  • a screening system 1 for ligands using soft magnetic microstructures for a target material which is a biochemical system from a library of ligand magnetic particles composed of a plurality of test compounds.
  • the ligand screening system using the soft magnetic microstructure according to the present invention comprises reacting the ligand magnetic particle library with the target material to produce a reaction mixture including the unbound ligand magnetic particle and the target material-ligand magnetic particle complex 300.
  • Reaction module (2) to form;
  • a magnetic force generating module 3 for controlling the external magnetic field 100 to magnetize the soft magnetic microstructure 200 and the unbound ligand magnetic particles and the target material-ligand magnetic particle complex 300;
  • the chain soft magnetic microstructure 7 When the magnetic field is magnetized by the external magnetic field 100, the chain soft magnetic microstructure 7 generates an internal magnetic field 400 and controls the movement of the target material-ligand magnetic particle composite 300 according to the magnetization direction 500.
  • a transport module (4) consisting of a loading location (loading 6) for placing the reaction mixture at one end and a sensing location (8) at which the target material-ligand magnetic particle complex is transported to the other end;
  • the unbound ligand magnetic particle and target material-ligand magnetic particle complex 300 controlled by movement of the internal magnetic field 400 generated as the soft magnetic microstructure 200 is magnetized;
  • an analysis module 5 for analyzing the ligand separated from the transferred target substance-ligand magnetic particle complex 300 and / or the effect of the ligand on the biological activity of the target substance.
  • the soft magnetic fine structure is formed by patterning a soft magnetic thin film of any one of NiFe, Fe, Ni, and Co.
  • the soft magnetic fine structure is characterized in that it is implemented in any one form of an elliptic plate and a half elliptic plate.
  • the soft magnetic microstructure is characterized in that the target material-ligand magnetic particle complex is arranged in a chain to attract the analysis sphere in the fluid microchip.
  • the soft magnetic fine structure has a saturation magnetization of about 1 Tesla and has a length of 10 m or less.
  • the degree of change of the internal magnetic field is in the range of about 10 4 T / m.
  • the soft magnetic microstructure magnetized by the external magnetic field generates a local internal magnetic field due to the geometry and the soft magnetic force, and the target material-ligand magnetic particle complex is transferred to the internal magnetic field due to the difference in the force of the internal magnetic field.
  • the strong magnetic force of the soft magnetic microstructures characterized in that to move to the pole.
  • the soft magnetic microstructure magnetized by the external magnetic field generates a local internal magnetic field by geometry and soft magnetic and moves the target material-ligand magnetic particle complex by the external magnetic field which rotates or vibrates. It features.
  • the soft magnetic microstructure when the external magnetic field rotates clockwise or counterclockwise, the soft magnetic microstructure is in the form of an elliptic plate and the soft magnetic microstructure is in a fluid channel, the target material-ligand magnetic particle complex is transferred to the fluid. It is characterized in that the transfer to a specific position of the channel.
  • the target material-ligand magnetic particle composite proceeds forward and the external magnetic field rotates in the counterclockwise direction.
  • the target material-ligand magnetic particle complex is characterized in that it proceeds backward.
  • the target material-ligand magnetic complexes are concentrated in a portion where the diagonals are centered and the external magnetic field is counterclockwise.
  • the target material-ligand magnetic particle complexes are rotated in the direction and the soft magnetic microstructures are arranged in diagonal lines, and the target material-ligand magnetic particle complexes are scattered from a portion where the diagonal lines are collected in the center.
  • the analysis module 600 is characterized by consisting of a device for analyzing the ligand.
  • a system for assaying ligands using a screening system of ligands for a target material which is a biochemical system from a library of ligand magnetic particles consisting of a plurality of test compounds.
  • the system for assaying the effect of the ligand on the biological activity of the target material the assay module 600 performs a cytological analysis, physiological analysis, biochemical analysis, molecular biological analysis, genomic analysis, proteomic analysis, etc. It is characterized by consisting of a device.
  • a method for screening a ligand for a target material which is a biochemical system from a library of ligand magnetic particles composed of a plurality of test compounds.
  • Screening method of a ligand using a soft magnetic microstructure preparing a ligand magnetic particle library; Preparing a reaction mixture including the unbound ligand magnetic particles and the target-ligand magnetic particle complex 300 by reacting the ligand magnetic particle library with the target material in the reaction module 2; Put the reaction mixture in the loading place (6) to generate a magnetic force on the soft magnetic microstructure 200 in the magnetic force generating module (3) in the reaction mixture only the target material-ligand magnetic particle complex 300 in the chain Transferring the complex 300 to a sensing location 8 located at the end of a soft magnetic microstructure 7; The target material-ligand magnetic particle complex 300 transferred to the sensing place 8 using the magnetic force generating module 3 is transferred to the analysis module 5 to separate the target material-ligand magnetic particle complex. , Separating and analyzing the ligand magnetic particles in the separated complex.
  • the step of preparing a reaction mixture by separating the non-specific or relatively weakly bound ligand magnetic particles by washing the target material-ligand magnetic particle complex 300 of the reaction mixture in the reaction module (2) with a washing solution It is characterized by including.
  • a ligand assay method using a screening system of ligands for a target material which is a biochemical system from a library of ligand magnetic particles composed of a plurality of test compounds.
  • Assay method of the ligand the step of preparing the identified ligand magnetic particles; Preparing a reaction mixture including a target material-ligand magnetic particle complex 300 by reacting the ligand magnetic particles with a target material in the reaction module 2; Put the reaction mixture in the loading place (6) to generate a magnetic force on the soft magnetic microstructure 200 in the magnetic force generating module (2) in the reaction mixture only the target material-ligand magnetic particle complex 300 in the chain Separating the complex by transferring to a sensing location (8) located at the end of the soft magnetic microstructure (7); And transferring the separated target material-ligand magnetic particle complex 300 to the analysis module 5 using the magnetic force generating module 2 to affect the biological activity of the target ligand material. Analyzing and assaying.
  • the verification of the ligand magnetic particles performed in the analysis module 5 is performed by analyzing the effect of the ligand magnetic particles on the biological activity of the target material, which is the biochemical system. Characteristic analysis, molecular biological analysis, genomic analysis, proteomics analysis and the like.
  • the analysis module 5 is characterized by consisting of a device for qualitative and quantitative analysis of the target material from the target material-ligand magnetic particle complex 300 in the sensing place (8).
  • the target material is characterized in that the biochemical system including a single molecule, a virus, a cell, a bacteria and the like.
  • the ligand in the screening system (1) of the ligand using a soft magnetic microstructure according to the present invention is characterized in that the material to bind to the target material, including organic materials, proteins, peptides, aptamers and the like.
  • the ligand magnetic particles verified in the screening system (1) of the ligand using the soft magnetic microstructure according to the present invention is characterized in that it is used as a leading material for drug development.
  • the ligand magnetic particles verified in the screening system (1) of the ligand using the soft magnetic microstructure according to the present invention is characterized in that it is used as a material for qualitative and quantifying the target material.
  • the screening system of a ligand using a soft magnetic microstructure by using a soft magnetic microstructure to provide a screening system of a ligand for separating the target material-ligand magnetic particle complex to analyze the ligand and screening of conventional ligands It has much greater potential than the system, is easy to manufacture, requires a small amount of target material, and a library of ligands, and the assayed ligand can be used as a leading material in diagnostic materials and drug development.
  • FIG. 1 is a diagram showing a screening system of a ligand using a soft magnetic microstructure according to the present invention.
  • Figure 2 is a view showing the movement of the unbound ligand magnetic particles and the target material-ligand magnetic particle complex by the external magnetic field when the soft magnetic microstructure in the form of an elliptic plate according to the present invention.
  • FIG. 3 is a view showing a chain soft magnetic microstructure in which an elliptic plate-like soft magnetic microstructure for linear transport of a target material-ligand magnetic particle composite according to the present invention is continuously arranged.
  • FIG. 4 is a diagram illustrating a chain soft magnetic microstructure in which a soft magnetic microstructure in the form of a half elliptic plate for front and rear movement of a target material-ligand magnetic particle complex according to the present invention is continuously arranged.
  • FIG. 5 and 6 illustrate a chain soft magnetic microstructure in which soft magnetic fine structures for collecting or scattering target material-ligand magnetic particle complexes are arranged in an oblique direction continuously according to the rotation direction of an external magnetic field according to the present invention.
  • FIG. 7 is a diagram showing an image of an aptamer head binding to a liver cancer cell line and GIBCO hepatocytes using a liver cancer cell line aptamer-based biochip and a primarily screened aptamer head.
  • FIG. 8 is a diagram showing the results of confirming the reactivity of the liver cancer cell line and GIBCO hepatocytes by labeling the liver cancer cell line Apta head gangan screened with a fluorescent material according to the present invention
  • FIG. 9 is a diagram showing the results of confirming the binding degree of liver cancer cell line and GIBCO hepatocytes using the screened liver cancer cell line Apta head gande in accordance with the present invention.
  • FIG. 10 shows an example of a human cdk2 siRNA according to the present invention.
  • FIG. 11 is a view showing the effect of the cdk2 siRNA according to the present invention on the cdk2 mRNA expression of liver cancer cell line.
  • FIG. 12 is a diagram showing the effect of the liver cancer cell line Apta head gande -cdk2 siRNA complex on the expression of cdk2 mRNA of liver cancer cell line
  • the apparatus 1 basically comprises a reaction module 2, a magnetic force generating module 3, a transfer module 4 and an analysis module 5.
  • the reaction module (2) is a reaction mixture comprising a ligand magnetic particle library consisting of a plurality of test compounds and the target material which is the biochemical system to react with the unbound ligand magnetic particle and the target material-ligand magnetic particle complex (300) It is a module to form.
  • the target material-ligand magnetic particle complex 300 of the reaction mixture may be washed with a washing solution to separate non-specific or relatively weakly bound ligand magnetic particles to prepare a reaction mixture.
  • the target material is characterized in that the biochemical system containing a single molecule, viruses, cells, bacteria and the like.
  • biochemical system generally refers to chemical interactions involving molecules of the type commonly found in living organisms. Such interactions include the full range of catabolic and assimilation reactions occurring in the survival system, including enzyme binding, signaling, and other reactions.
  • the biochemical systems defined in the present invention also include model systems that mimic certain biochemical interactions. Examples of biochemical systems of particular interest in practicing the present invention include model barrier systems (eg, cells or membranes) for receptor-ligand interactions, enzyme-substrate interactions, cell signaling pathways, bioavailability screenings. Transport reactions, and various other general systems.
  • Cell or organism viability or activity can also be screened using the methods and devices of the invention, for example in toxicology experiments.
  • Biological materials to be assayed include cells, cell fractions (membrane, cytosol preparations, etc.), agonists and antagonists of cell membrane receptors (eg, cell receptor-ligand interactions, eg transferrin, c-kit, viral receptor ligands (eg For example, CD4-HIV), cytokine receptors, chemokine receptors, interleukin receptors, immunoglobulin receptors and antibodies, cadherein family, intergrin family, selectin family and the like; see Pigott and Power.
  • cell membrane receptors eg, cell receptor-ligand interactions, eg transferrin, c-kit, viral receptor ligands (eg For example, CD4-HIV)
  • cytokine receptors eg, chemokine receptors, interleukin receptors, immunoglobulin receptors and antibodies, cadherein family,
  • the ligand is characterized in that it is a substance that binds to a target material including an organic material, protein, peptide, aptamer and the like.
  • the term “ligand” relates to compounds that are screened for their ability to affect a particular biochemical system.
  • the test compound may be a chemical compound, a mixture of chemical compounds, for example polysaccharides, small organic or inorganic molecules, biological macromolecules such as peptides, proteins, nucleic acids, aptamers or bacteria, plants, fungi, or animal cells or A variety of different compounds can be included, including extracts made from tissues, natural or synthetic compositions.
  • the magnetic force generating module 3 is a module for magnetizing the soft magnetic microstructure 200 and the unbound ligand magnetic particles and the target material-ligand magnetic particle complex 300 by controlling an external magnetic field 100. It may be configured to include an electrode array that is spaced apart from.
  • the magnetic force generating means according to the present invention controls the external magnetic field 100 to magnetize the soft magnetic fine structure 200 and the magnetic particles. For example, the magnetic force generating means may change the rotation direction of the external magnetic field 100 clockwise or counterclockwise.
  • the transfer module 4 generates an internal magnetic field 400 when magnetized by the external magnetic field 100 and controls a movement of the target material-ligand magnetic particle composite 300 according to the magnetization direction 500.
  • Module (4) consisting of a soft magnetic microstructure (7), a loading well (6) for placing the reaction mixture at one end, and a sensing place (8) at which the target substance-ligand magnetic particle complex is transferred to the other end. )to be.
  • the soft magnetic microstructure 200 generates an internal magnetic field 400 when magnetized by the external magnetic field 100, and target material-ligand magnetic particle composite 300 according to the magnetization direction 500 of the soft magnetic microstructure 200. ) To control the movement.
  • the soft magnetic fine structure 200 may be formed by patterning a soft magnetic thin film of any one of NiFe, Fe, Ni, and Co.
  • the soft magnetic microstructure 200 is a chain to attract the target material-ligand magnetic particle composite 300 to the sensing place in the fluid microchip It can be arranged to constitute a chain soft magnetic microstructure (7).
  • the magnetization direction of the soft magnetic microstructure 200 changes as the external magnetic field 100 rotates.
  • the difference in force of the internal magnetic field 400 attracts the partially magnetized target material-ligand magnetic particle composite 300 to the pole of the soft magnetic microstructure 200 in which a stronger internal magnetic field 400 is present. That is, the pulling force between the soft magnetic microstructure 200 and the target material-ligand magnetic particle composite 300 is due to the various internal magnetic fields 400 in different directions due to the aspect ratio of the soft magnetic microstructure 200.
  • the soft magnetic microstructure 200 magnetized by the external magnetic field 100 generates a local internal magnetic field 400 due to the geometry and soft magnetic properties of the soft magnetic microstructure 200.
  • the target material-ligand magnetic particle composite 300 is moved to the pole of the soft magnetic microstructure 200 is the strongest of the internal magnetic field 400.
  • the soft magnetic microstructure 200 magnetized by the external magnetic field 100 generates a local internal magnetic field 400 by the geometry and the soft magnetic force, and the target material-ligand by the external magnetic field 100 that rotates or vibrates.
  • the magnetic particle composite 300 may be moved.
  • FIG. 3 is a diagram illustrating a chain soft magnetic microstructure 7 in which an elliptic plate-like soft magnetic microstructure for linear transport of a target material-ligand magnetic particle composite according to an embodiment of the present invention is continuously arranged.
  • the target material-ligand magnetic particle composite 300 when the external magnetic field 100 rotates, a local difference in the force of the internal magnetic field 400 governs the movement of the target material-ligand magnetic particle composite 300. That is, the target material-ligand magnetic particle composite 300 is moved along the magnetization direction of each soft magnetic microstructure 200 and another soft magnetic microstructure located adjacent to one soft magnetic microstructure 300 ( 300).
  • the soft magnetic microstructure 200 when the external magnetic field 100 rotates clockwise or counterclockwise, the soft magnetic microstructure 200 is in the form of an elliptic plate, and the soft magnetic microstructure 200 is in a fluid channel.
  • the substance-ligand magnetic particle composite 300 may be transferred to a specific position of the fluid channel.
  • the external magnetic field 100 rotates clockwise and the target material-ligand magnetic particle composite 300 is located above the soft magnetic microstructure 200.
  • the target material-ligand magnetic particle complex 300 is to proceed in the future.
  • the target material-ligand magnetic particle complex 300 proceeds backward. Done.
  • the direction of movement of the target material-ligand magnetic particle composite 300 in the path as shown in FIG. 3 is determined by the geometry of the soft magnetic microstructure 200 and the position of the target material-ligand magnetic particle composite 300. .
  • FIG. 4 is a diagram illustrating a chain microstructure 7 in which soft magnetic microstructures in the form of half ellipsoids for the front and rear movement of the target material-ligand magnetic particle complex according to the present invention are continuously arranged.
  • the target material-ligand magnetic particle composite 300 may move forward or backward depending on the direction of rotation of the external magnetic field 100.
  • the movement of the target material-ligand magnetic particle composite 300 shown in FIG. 4 is only by the direction of rotation of the external magnetic field 100. The difference is that it is determined.
  • the target material-ligand magnetic particle composite 300 proceeds forward.
  • the target material-ligand magnetic particle composite 300 proceeds backward.
  • FIG. 5 to 6 illustrate a chain soft magnetic structure 7 in which soft magnetic fine structures for collecting or scattering microbeads are arranged in an oblique direction in accordance with a rotation direction of an external magnetic field according to an embodiment of the present invention. Figure is shown.
  • the target material-ligand magnetic particle complexes 300 may have the diagonal lines. It will be concentrated in the center. In addition, when the external magnetic field 100 rotates in a counterclockwise direction and the soft magnetic microstructures 200 are arranged in diagonal lines, the target material-ligand magnetic particle complexes 300 are scattered from a portion where the diagonal lines are collected in the center. You lose.
  • the portion where the diagonal is collected in the center is preferably implemented as a sensing place in the fluid microchip.
  • the present invention there is an effect of inducing a path change of the target material-ligand magnetic particle complex only by the formation of a fine magnetic force.
  • the analysis module 5 is a module for screening ligands from the target substance-ligand magnetic particle complex 300 transferred from the transfer module 4 and / or analyzing the effect of the screened ligands on the biological activity of the target substance. to be.
  • the assay module 5 is used for screening ligands, analyzing the effects of the screened ligand magnetic particles on the biological activity of the target material which is the biochemical system, and performing qualitative quantitative analysis of the target material. It includes equipment for chemical analysis, biochemical analysis, molecular biological analysis, genome analysis, proteomic analysis, and the like. As described above, the screening methods of the present invention are generally carried out in microfluidic devices or "microscopic experimental systems", which perform assays, automation and environmental impacts on the assay system, e.g., loss, contamination. Consider integrating the elements necessary to minimize human error. Numerous devices for carrying out the assays and quantitative methods of the present invention are described in the detailed description section below.
  • the specific arrangement of such a device generally depends on the type of assay and / or desired assay orientation.
  • the screening method of the present invention can be performed using a microfluidic device having two crossing channels.
  • multichannel / crossover devices are optionally used. The low integration and self-contained nature of this device ultimately takes into account any assay arrangements to be realized within the environment of microexperimental systems.
  • the first step of the ligand screening method using a soft magnetic microstructure according to the present invention the ligand magnetic particle library composed of a plurality of different compounds, that is, in this embodiment single stranded nucleic acids (hereinafter, ' And reacting the random single-stranded nucleic acids to determine the single-stranded nucleic acids (hereinafter referred to as 'Aptahead gande') that bind to the target material, a biochemical system.
  • Nucleic acid can act as a ligand to a specific substance containing a protein, with high binding capacity and specificity through a constant screening process and sequencing from a library of single stranded nucleic acids arranged in various nucleotide sequences. Nucleic acids that bind to specific substances are being selected.
  • the method of screening nucleic acids for binding to a specific substance is called SELEX (Systematic Evolution of Ligand by Exponential enrichment), and the selected nucleic acid is called aptamer (Tuerk C.
  • SELEX selects molecules that can bind with a very high affinity not only to proteins that can bind nucleic acids in nature, but also to various biomolecules, including proteins that do not bind nucleic acids. have.
  • N40 CATAACCCAGAGGTCGATGGATCC CCCC-3 '(where the underlined base sequence is a fixed site of the nucleic acid library and N40 means that there are equal concentrations of A, G, T, C, etc. at each position.
  • the FW primer (5'-GGGGGAATTCTAATACGACTCACTATAGGGAGAGCGGAAGC GTGCTGGG-3 ': SEQ ID NO: 1) used for PCR (Polymerase Chain Reaction) can base bond with the 5' end of the underlined bases of the above nucleotide sequence and RNA polymer of bacteriophage T7. It contains a promoter sequence for an aze.
  • the RE primer of PCR (5'-GGGGGGATCCATCGACCTCTGGGTTATG-3 ': SEQ ID NO: 2) can base bond with the 3' end of the underlined bases of the above base sequence.
  • FW and RE primers contain restriction enzyme cleavage sequences such as EcoRI and BamHI, respectively, for subsequent cloning.
  • Random single-stranded nucleic acids to be reacted with a biological sample is an RNA library containing 2'-F-substituted pyrimidine, DNA nucleic acid library transcript and PCR primers were designed and prepared as described above prepared by PCR and in vitro transcription method.
  • PCR was carried out using a primer pair (5P7) of 1,000 pmoles single-stranded nucleic acid transcript, 2,500 pmoles PCR, 50 mM KCl, 10 mM Tris-Cl (pH 8.3), 3 mM MgCl2, 0.5 mM dNTP (dATP, dCTP, dGTP, and dTTP). ), And purified by 0.1 U Taq DNA Polymerase (Perkin-Elmer, Foster City Calif.) And purified by QIAquick-spin PCR purification column (QIAGEN Inc., Chatsworth Calif.).
  • Random single-stranded nucleic acids comprising 2′-F-substituted pyrimidines were prepared by synthesis and purification by in vitro transcription. 200 pmoles double stranded DNA transcript, 40 mM Tris-Cl (pH 8.0), 12 mM MgCl 2, 5 mM DTT, 1 mM spermidine, 0.002% Triton X-100, 4% PEG 8000, 5 U T7 RNA Polymerase and 1 mM After ATP, GTP and 3 mM 2'F-CTP, 2'F-UTP was reacted at 37 to 6 to 12 hours, and then purified by Bio-Spin 6 chromatography column (Bio-Rad Laboratories, Hercules Calif.) UV spectrometer was used to search for the amount of purified nucleic acid and its purity.
  • RNA single-stranded nucleic acid Attached to the biotin with T4 RNA ligase (Thermo Scientific Pierce RNA 3 End Biotinylation Kit) at the three ends of the prepared RNA single-stranded nucleic acid, and purified by reacting with streptavidin (streptavidin) to form a ligand magnetic particle library RNA single strand
  • streptavidin streptavidin
  • the target material includes a single molecule, a virus, a cell, a bacterium, etc. as a biochemical system, and a hepatic cancer cell line (Hep3B) was used in this example.
  • a reaction mixture was prepared by reacting the hepatocellular carcinoma cell line and the RNA single-stranded nucleic acid magnetic particle library prepared above.
  • the concentration solution of 10 15 sequence / 1 of the random RNA single-stranded nucleic acid magnetic particle library synthesized above was selected at a concentration of 200 pmol / 200 (50 mM TrisCl (pH 7.4), 5 mM KCl, 100 mM NaCl, 1). mM MgCl 2, 0.1% NaN 3) was heated at 80 minutes for 10 minutes and then left on ice for 10 minutes.
  • a reaction solution was prepared by adding 5 times yeast tRNA (yeast tRNA, Life Technologies) and 0.2% BSA (bovine serum albumin, Merck) of the used single-stranded nucleic acid.
  • RNA single-stranded nucleic acid magnetic particle library prepared above was treated with a liver cancer cell line and reacted for 30 minutes.
  • the washing buffer of the hepatocellular cell line-RNA single-stranded nucleic acid magnetic particle complexes included in the reaction mixture prepared above was used with 0-1 x Serex buffer or 0-500 mM EDTA solution.
  • the isolation of RNA single-stranded nucleic acid magnetic particles that bind to hepatocarcinoma cell lines primarily targets RNA single-stranded nucleic acid magnetic particles that bind to hepatocarcinoma cell lines, and the reaction process is repeated only once with various washing buffers after the reaction. Liver cancer cell line-RNA single-stranded nucleic acid magnetic particle complexes were secured.
  • the reaction mixture was prepared by separating the non-specific or relatively weakly bound RNA single-stranded nucleic acid ligand magnetic particles from the hepatocellular cell line-RNA single-stranded nucleic acid ligand magnetic particle complex using a washing solution in the reaction mixture.
  • the reaction mixture containing the liver cancer cell line-RNA single-stranded nucleic acid magnetic particle complex prepared in the reaction module 2 of the ligand screening system 1 using the soft magnetic microstructure of the present invention is transferred to the reaction module 4.
  • the magnetic force generating module (3) in the loading place (6) to generate a magnetic force on the soft magnetic microstructure 200 in the reaction mixture of the cell lung cancer cell line-RNA single-stranded nucleic acid magnetic particle complex in the chain soft magnetic fine Transfer to the sensing location 8 located at the end of the structure 7.
  • the transferred hepatocellular cell line-RNA single-stranded nucleic acid magnetic particle complexes were transferred to the assay module 5 using the magnetic force generation module 3, and then the hepatic cancer cell line-RNA single-stranded nucleic acid ligand magnetic particle complexes were harvested.
  • liver cancer cell line-RNA single-stranded nucleic acid ligand magnetic particle complex harvested in the analysis module 5 was subjected to RT-PCR to amplify a DNA pool indicating RNA single-stranded nucleic acid ligand bound to the liver cancer cell line.
  • the selection and amplification process may be repeated a number of times, and the biomolecule binding RNA single-stranded nucleic acid magnetic particle library may be reconstructed by the above method.
  • Ligand amplification of the ligand in the isolated target material-ligand magnetic particle complex may be prepared by repeating the reaction step, washing step, and separation step.
  • RT-PCR product obtained in the analysis module (5) of the ligand screening system (1) using the soft magnetic microstructure of the present invention in a plasmid to obtain a monoclonal, biomolecule binding-single stranded nucleic acid Completed their production.
  • the base sequence of the single stranded nucleic acids binding to these liver cancer cell lines was performed by standard methods.
  • hepatocarcinoma cell line aptamer-based biochip was manufactured by the standard method, and the aptamer binding to the liver cancer cell line was fluorescently labeled and reacted to the hepatocellular cell line and hepatocytes (Hepatocyte). Ligands were determined (FIG. 7). After confirming the secondary structure and structure free energy using the MFOLD program that models the secondary structure of nucleic acid based on the nucleotide sequence of the single stranded nucleic acid binding to the determined liver cancer cell line, hepatocarcinoma of the liver cancer cell line having the most stable secondary structure Selected
  • Binding capacity was observed at the cellular level with the liver cancer cell line Apta head gangan screened above.
  • the binding ability of the screened aptamers, liver cancer cell lines, and GIBCO hepatocytes was confirmed by binding specific aptamers to both cells and amplifying the bound aptamers by electrophoresis (FIG. 8).
  • FIG. 8 By forming a stronger band in liver cancer cell lines than hepatocytes, it can be seen that the screened liver cancer cell line Apta head gande binds more strongly to liver cancer cell lines than hepatocytes.
  • the analysis module (5) in the ligand screening system (1) using the soft magnetic microstructure of the present invention is composed of a fluorescence microscope to determine whether the screened liver cancer cell line Apta head gangue specifically binds to the liver cancer cell line. Analyze at the level. Screened liver cancer cell line Apta head gande was labeled with Rhodamine staining reagent and stained for liver cancer cell line and GIBCO hepatocytes and observed by light microscopy. could be (FIG. 9). Therefore, the screened liver cancer cell line Aptahead Gand can distinguish between liver cells and liver cancer cell lines by the above analysis.
  • Assay module (5) in the ligand screening system (1) using the soft magnetic microstructure of the present invention the assay of the ligand to analyze the effect of the screened ligand on the biological activity of the target material, cytological analysis, physiological Analysis, biochemical analysis, molecular biological analysis, genomic analysis, proteomic analysis, and the like.
  • the role of siRNA as a carrier of siRNA was investigated using a hepatic cancer cell line-specific binding aptamer.
  • the prepared cdk2 siRNA was coupled to a hepatocellular cell line specific aptamer ligand to develop a complex specifically acting on the hepatic cancer cell line to confirm its function (FIG. 12).
  • Hepatocellular carcinoma cell line-specific apta headhand-cdk 2 siRNA complexes were prepared.
  • Hepatocellular carcinoma cell-specific Apta head gande-cdk 2 siRNA complexes were prepared and treated with 100 nM (1) and 250nM (2) complexes, treated with 100 nM cdk 2 siRNA (3), and then incubated for 3 days after no treatment (4).
  • Total RNA was isolated and quantitatively analyzed for cdk2 mRNA. The upper figure shows transfection and the lower figure shows direct reagent treatment.
  • Transfection reduced the amount of cdk2 mRNA in both hepatocellular cell line-specific Aptaheadand-cdk 2 siRNA complex and cdk 2 siRNA.
  • the direct treatment only the aptamer head-cdk 2 siRNA complex, which is specific for hepatic cancer cell line, reduced the amount of cdk2 mRNA.
  • the ata head gande in the complex specifically binds to the protein on the cell surface of the liver cancer cell line, moves into the cell, acts as siRNA, and the amount of cdk2 mRNA It was confirmed that the reduced.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Biotechnology (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Microbiology (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Cell Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Wood Science & Technology (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 연자성미세구조물을 이용한 리간드의 스크리닝 시스템 및 방법에 관한 것이다. 특히, 본 발명의 시스템 및 방법은 바람직하게는 생화학적 시스템인 표적물질에 대해 다수의 상이한 화합물로 구성된 리간드자성입자 라이브러리를 스크리닝하는 데 유용하다. 본 발명에 따른 연자성미세구조물을 이용한 리간드의 스크리닝 시스템은 다수의 시험 화합물로 구성된 리간드자성입자 라이브러리와 생화학적 시스템인 표적물질을 반응시켜 미결합 리간드자성입자 및 표적물질-리간드자성입자 복합체를 포함하는 반응혼합물을 형성하는 반응모듈; 외부 자기장을 제어하여 하기 연자성미세구조물, 상기 미결합 리간드자성입자 및 표적물질-리간드자성입자 복합체를 자화시키는 자기력 발생모듈; 상기 외부 자기장에 의해 자화되는 경우 내부 자기장을 발생시키며 자화 방향에 따라 상기 표적물질-리간드자성입자 복합체의 움직임을 제어하는 연쇄 연자성미세구조체, 한쪽 말단에 상기 반응혼합물을 넣는 로딩장소, 및 다른 말단에 상기 표적물질-리간드자성입자 복합체가 이송되는 감지장소로 구성된 이송모듈; 상기 연자성미세구조물이 자화됨에 따라 발생된 상기 내부 자기장에 의해 움직임을 제어받는 상기 미결합 리간드자성입자 및 표적물질-리간드자성입자 복합체; 및 상기 이송된 표적물질-리간드자성입자 복합체로부터 분리된 리간드 및 상기 리간드가 표적물질의 생물학적 활성에 미치는 영향을 분석하는 분석모듈을 포함한다.

Description

연자성미세구조물을 이용한 리간드의 스크리닝 시스템 및 그 용도
본 발명은 연자성미세구조물을 이용한 리간드의 스크리닝 방법 및 시스템에 관한 것으로 더욱 상세하게는 생화학적 시스템인 표적물질에 대해 다수의 상이한 화합물로 구성된 리간드자성입자 라이브러리를 반응시켜 형성되는 표적물질-리간드자성입자 복합체가 미세 유체 채널에서 자기력 발생모듈로부터 인가되는 자기력의 영향을 받아 흐름 경로를 변경하도록 하는 연쇄 연자성미세구조체를 이용한 리간드의 스크리닝 방법 및 시스템에 관한 것이다.
단백질 결합 및 생물학적 활성단백질은, 그 자체가 단백질이거나 다른 분자인 하나 이상의 결합 파트너(리간드)에 특이적으로 결합할 수 있는 능력으로 인해 많은 생물학적 활성을 갖게 된다.
단백질의 결합 파트너가 알려지면, 연구는 결합 단백질 및 그 결합 파트너의 상호작용이 생물학적 활성에 어떻게 영향을 미치는 가에 상대적으로 집중된다. 또한 복합체 형성을 경쟁적으로 저해하거나 이미 형성된 복합체를 해리시키는 능력에 대해 화합물들을 선별하기도 한다. 그러한 저해제들은, 적어도 그것들이 생체에서 상호작용하는 부위로 전달될 수 있으면 단백질의 생물학적 활성에 영향을 미칠 것이다.
결합 단백질이 수용체라면 그 결합 파트너는 생물학적 활성을 갖는 이펙터일 것이고, 그 저해제는 그 생물학적 활성을 길항할 것이다. 결합 파트너가 결합을 통해 어떤 생물학적 활성을 방해한다면, 그 상호작용의 저해제는 작용물질일 것이다.
분리된 단일 단백질에 결합하는 리간드에 대한 스크리닝에 관한 현재의 기술 상태는, 단일 단백질의 리간드 결합 포켓에 결합하는 리간드자성입자의 탐색에 관한 것이다. 이 분석을 통해서는, 단백질에 대한 화합물의 상대적 친화도에 따라 적절한 리간드를 탐색할 수 있을 뿐이고, 그 화합물이 수용체 활성의 작용물질로 작용하는지 아니면 길항물질로 작용하는지에 관한 수용체 상에서의 화합물의 활성을 알아낼 수는 없다.
작용물질과 길항물질을 구별할 수 있는, 지금까지 개발되어 온 분석들은 세포-기초 분석 및 수용체 유전자 시스템에 관한 것이다(McDonnell et al., Molec. Endocrinol., 9:659(1995)). 이러한 분석은 시간을 요하는 작업이고, 다른 세포주에서 행하거나 또는 다른 리포터 유전자 또는 반응 요소를 가지고 행하면 다른 결과를 가져올 수 있다. 따라서 그 데이터는 주의를 갖고 해석해야만 한다.
천연 산물 및 합성 화합물 둘다 단지 한 활성에 대해서만 테스트 될 수도 있지만, 테스트 하는 사람이 관심있는 모든 생물학적 활성에 대해 포괄적으로 테스트될 수도 있다. 테스트는 원래 동물에서 수행되었고, 그 이후에 분리된 기관, 조직 또는 세포, 또는 세포 배양액, 막 추출물 또는 정제된 수용체를 이용하는 덜 비싸고 더 간편한 시스템이 일부 약리학적 평가를 위해 개발되었다. 동물 전체 및 분리된 기관에서 테스트하기 위해서는 전형적으로 테스트할 대량의 화학적 화합물이 필요하다. 잠재적인 의약 화합물의 집합 내에 주어진 화합물의 양은 한정되어 있기 때문에, 이는 수행되는 스크리닝의 수를 제한할 필요가 있다.
단백질이 생리학적 매개를 위한 생산성 표적이 될 만한 가능성이 큰지를 결정하는 방법이 요구된다. 관심있는 표적으로 거의 10,000개의 단백질을 이미 알고 있다해도, 이 10,000개 표적에 대해 유용한 활성을 부여할 가능성이 있는 몇 만개의 리간드를 효율적으로 스크리닝하는 것이 문제로 남아있다. 화학적 화합물 라이브러리를 얻어야 하는 것이 약제 발견 분야로 진출하는 데에 장벽이 되었다. 동물 전체 및 배양액 중의 세포 상에서 테스트하기 위해서는 대량의 화학물질이 필요하기 때문에, 화합물이 생산될 때마다 그것은 상당히 대량으로 행해져야 한다. 그러나 분자 수준으로 표적이 소형화되고 스크리닝이 자동화되면서, 분석에 필요한 특정 화합물의 양은 매우 소량으로 감소되었다. 이러한 변화로 인해 전통적 화학 라이브러리 대신에 소위 조합 화학 라이브러리의 이용을 위한 문이 열렸다. 조합 화학으로 인해, 많은 종류의 화합물을 빠르고 상대적으로 저렴하게 분자 표적에 관한 자동화된 분석에 적합한 소량을 합성할 수 있게 되었다. 수많은 실험실에서 성공적으로 다양한 범위의 조합 화학 라이브러리를 생산하였다(Doyle, 1995, Gordon et al., 1994a, Gordon et al., 1994b).
조합 라이브러리에서는, 화학 빌딩 블록이 많은 수(10E15정도)의 다른 화합물들로 랜덤하게 조합되고, 이것은 후에 하나 이상의 표적에 대한 결합(또는 다른) 활성에 대해 동시에 스크리닝된다.
랜덤한 올리고펩티드들로 이루어진 수천, 심지어 수백만 라이브러리들이 화학 합성(Houghten et al., Nature, 354:84-6(1991)), 또는 유전자 발현(Marks et al., J Mol Biol, 222:581-97(1991))에 의해 제조되는데 유전자 발현은 크로마토그래피 지지체 상에(Lam et al., Nature, 354:82-4(1991)), 박테리아 세포 내에(Colas et al., Nature, 380:548-550(1996)), 박테리아 필리 상에(Lu, Bio/Technology, 13:366-372(1990), 또는 파아지에(Smith, Science, 228:1315-7(1985)) 디스플레이되고; 항체(Valadon et al., J Mol Biol, 261:11-22(1996)), 세포 단백질(Schmitz et al., J Mol Biol, 260:664-677(1996)), 바이러스 단백질(Hong and Boulanger, Embo J, 14:4714-4727(1995)), 박테리아 단백질(Jacobsson and Frykberg, Biotechniques, 18:878-885(1995)), 핵산(Cheng et al., Gene, 171:1-8(1996)), 및 플라스틱(Siani et al., J Chem Inf Comput Sci, 34:588-593(1994))을 포함하는 다양한 표적에의 결합에 대해 스크리닝된다.
단백질(Ladner, USP 4,664,989), 펩토이드(Simon et al., Proc Natl Acad Sci USA, 89:9367-71(1992)), 핵산(Ellington and Szostak, Nature, 246:818(1990), 탄수화물 및 작은 유기 분자(Eichler et al., Med Res Rev, 15:481-96(1995))의 라이브러리 또한 약제 스크리닝 목적으로 제조되고 제안되어 왔다.
첫번째 조합 라이브러리는 펩티드 또는 단백질로 구성되어 있었고, 그 안의 모든 또는 선별된 아미노산 위치는 랜덤하였다. 펩티드 및 단백질은 높고 특이적인 결합 활성을 나타낼 수 있고 효소로서 작용할 수 있다. 결과적으로 그것들은 생물학적 계에서 가장 중요하다. 불행히도, 펩티드 그 자체는 치료법에 제한적으로만 이용된다. 그것들은 합성하는 데에 돈이 많이 들고, 프로테아제 존재 하에서 불안정하며, 일반적으로 세포막을 통과하지 않는다. 다른 클래스의 화합물들이 약제 후보로서 더 좋은 특성을 갖는다.
핵산 또한 조합 라이브러리에서 이용되고 있다. 그들의 가장 큰 장점은 적절한 결합 활성을 갖는 핵산이 쉽게 증폭될 수 있다는 것이다. 결과적으로 핵산으로 구성된 조합 라이브러리는 낮은 반복성, 따라서 높은 다양성을 가질 수 있다. 그러나 결과적인 올리고뉴클레오티드는 몇가지 이유로 인해 약제로서 적당치 않다. 첫째, 올리고뉴클레오티드는 높은 분자량을 갖고 간편하게 대량 합성될 수 없다. 둘째, 올리고뉴클레오티드는 다가 음이온이므로 세포막을 통과할 수 없다. 마지막으로, 데옥시- 및 리보-뉴클레오티드는 뉴클레아제에 의해 가수분해되는데, 이는 모든 생물계에서 일어나므로 표적에 도착하기 전에 통상 분해되어 버린다.
따라서 약제학적 이용에 더 적합한, 특히, 유용한 약리학적 약제를 생산했던 화학 클래스에 속하는 벤조디아제핀과 같은 작은 분자에 기초한 조합 라이브러리에 많은 관심이 집중되어 왔다. 조합 화학 기술은 이러한 표적에 작용하는 작은 분자들을 찾기 위한 가장 효율적인 모듈로서 인식되었다. 현재, 작은 분자 조합 화학은 통상의 비계 상에서 기능성을 갖는 다양한 배열을 나타내는 풀형성되거나 개별적인 분자들의 합성에 관한 것이다. 이러한 화합물들은 생물학적 활성의 결합 또는 저해를 위한 관심의 표적에 대해 스크리닝되는 라이브러리 내에 그룹지어진다. 몇만개의 화합물을 함유하는 라이브러리는 현재 루틴하게 합성되지만, 이러한 라이브러리를 모든 만개의 잠재적 표적과의 결합 또는 저해에 대해 스크리닝하는 것은 현재의 스크리닝 기술로는 논리적으로 불가능하고, 각 표적에 대해 스크리닝 되어야 하는 화합물의 수를 감소시키는 개선 하에서 수많은 실험적 그리고 계산적 방법들이 있다.
Paterson, et al., J. Med. Chem., 39:3049-59(1996)에 의해 지적된 바와 같이, 의약 화학은 "선도 발견" 및 "선도 최적화"의 이중 과정을 통해 진보한다. "선도 발견"에서 조사 목적은 "활성 섬(island)", 즉 높은 빈도의 활성 분자를 갖는 화학 클래스(이 클래스는 다양한 분자 디스크립터에 의해 정의된 다차원적 장소 내의 어떤 부피로서 수학적으로 정의될 수 있다)를 발견하는 것이다. "선도 최적화", "활성 섬"은 상세히 연구된다. 합성되고 테스트된 각 화합물이 "선도 발견"에서 유사한 화합물의 "이웃"의 프로브로서 간주될 수 있다면, 그 이웃들이 중첩하는 물질을 테스트하는 것은 비효율적이다.
리간드 스크리닝 및 검정(verification)은 로봇공학 및 고처리율 검출 시스템과 같은 병렬 스크리닝 방법 및 그 밖의 기술 진보를 이용하여 달성된 개선에도 불구하고, 현재의 스크리닝 방법은 여전히 다수의 관련된 문제점을 갖는다. 예를 들어, 현존하는 병렬 스크리닝 방법을 사용하여 다수의 샘플을 스크리닝하려면 샘플 및 장비, 예를 들어 로보틱스를 수용하기 위한 넓은 장소 요건, 이 장비와 관련된 고비용 및 검정을 수행하기에 필요한 다량의 시약 요건이 필요하다. 추가로, 대부분의 많은 경우에, 이용가능한 시험 화합물이 소량이기 때문에 반응 부피가 적어야 한다. 이러한 적은 부피는 유체 취급 및 측정과 관련된 오차, 예를 들어 증발로 인한 오차, 조제과오 등을 가중시킨다. 추가로, 유체 취급 장비 및 방법에서는 이러한 적은 부피에서의 표면 장력 효과에 부분적으로 기인하여 허용 수준의 정확도로 이들 부피 범위를 취급하는 것이 전형적으로 불가능해왔다.
이들 문제점을 해소하기 위한 시스템을 개발하기 위해서는 다양한 검정 방법의 측면을 고려해야 한다. 이러한 측면은, 표적 및 화합물 공급원, 시험 화합물 및 표적 취급, 특정 검정 요건, 및 데이터 입수, 정리 저장 및 분석을 포함한다. 특히, 고처리율 스크리닝 방법 및 반복적이고 정확한 검정 스크리닝을 수행하고, 매우 적은 부피로 조작할 수 있는 관련 장비 및 시스템이 필요하다.
상기와 같은 추세에 따라 생명 현상의 규명과 신약 개발 및 진단을 위한 생물학적 스크리닝 및 검정 시스템은 미세 유체 공학(microfluidics)의 기반 위에서 보다 적은 양으로 빠른 시간에 정확하고 편리하게 시료를 분석하기 위한 미세종합 분석 시스템(-TAS: micro-Total Analysis System)과 랩온어칩(lab-on-a-chip)의 형태로 발전하고 있다.
본 발명은 연자성미세구조물을 이용한 분자이송시스템(대한민국 등록특허 10-1067695) 특허의 분자이송시스템을 이용하여 표적물질에 결합하는 리간드를 스크리닝하는 시스템을 제공하고자한다. 본 발명은 생화학적 시스템인 표적물질에 대해 다수의 시험 화합물로 구성된 리간드 라이브러리로부터 리간드의 스크리닝 시스템의 필요성 및 다양한 기타 필요성을 충족시킨다. 특히, 본 발명은 기존 리간드의 스크리닝 시스템의 문제점에 대한 중요한 해결법을 제시하는 스크리닝을 수행하기 위한 시스템을 제공한다.
본 발명은 상기와 같은 종래 기술을 개선하기 위해 안출된 것으로서, 반응용액에서 다수의 시험 화합물로 구성된 리간드자성입자 라이브러리와 생화학적인 시스템인 표적물질이 반응하여 형성되는 표적물질-리간드자성입자 복합체를 포함하는 반응혼합물로부터 연자성미세구조물을 이용하여 표적물질-리간드자성입자 복합체만을 분리하고 표적물질에 결합하는 리간드의 스크리닝 방법 및 시스템을 제공하는 것을 목적으로 한다.
또한, 본 발명은 하나의 리간드의 검정 시스템으로 분리된 표적물질-리간드자성입자 복합체에서 리간드가 표적물질의 생물학적 활동에 미치는 영향을 검정하는 방법 및 시스템을 제공하는데 또 다른 목적이 있다.
또한, 본 발명은 하나의 표적물질의 정성정량 시스템으로 확인된 리간드를 사용하여 표적물질을 정성 및 정량하는 방법 및 시스템을 제공하는데 또 다른 목적이 있다.
본 발명에 따라, 다수의 시험 화합물로 구성된 리간드자성입자 라이브러리로부터 생화학적 시스템인 표적물질에 대한 연자성미세구조물을 이용한 리간드의 스크리닝 시스템(1)이 제공된다.
본 발명에 따른 연자성미세구조물을 이용한 리간드의 스크리닝 시스템은, 상기 리간드자성입자 라이브러리와 상기 표적물질을 반응시켜 미결합 리간드자성입자 및 표적물질-리간드자성입자 복합체(300)를 포함하는 반응혼합물을 형성하는 반응모듈(2); 외부 자기장(100)을 제어하여 하기 연자성미세구조물(200) 및 상기 미결합 리간드자성입자 및 표적물질-리간드자성입자 복합체(300)를 자화시키는 자기력 발생모듈(3); 상기 외부 자기장(100)에 의해 자화되는 경우 내부 자기장(400)을 발생시키며 자화 방향(500)에 따라 상기 표적물질-리간드자성입자 복합체(300)의 움직임을 제어하는 연쇄 연자성미세구조체(7), 한쪽 말단에 상기 반응혼합물을 넣는 로딩장소(loading well,6), 및 다른 말단에 상기 표적물질-리간드자성입자 복합체가 이송되는 감지장소(8)로 구성된 이송모듈(4); 상기 연자성미세구조물(200)이 자화됨에 따라 발생된 상기 내부 자기장(400)에 의해 움직임을 제어받는 상기 미결합 리간드자성입자 및 표적물질-리간드자성입자 복합체(300); 및 상기 이송된 표적물질-리간드자성입자 복합체(300)로부터 분리된 리간드 및/또는 상기 리간드가 표적물질의 생물학적 활성에 미치는 영향을 분석하는 분석모듈(5)을 포함한다.
바람직하게, 상기 연자성미세 구조물은 NiFe, Fe, Ni, 및 Co 중 어느 하나인 연자성 박막을 패터닝하여 형성되는 것을 특징으로 한다.
바람직하게, 상기 연자성미세 구조물은 타원판 및 반쪽 타원판 중 어느 하나의 형태로 구현되는 것을 특징으로 한다.
바람직하게, 상기 연자성미세 구조물은 상기 표적물질-리간드 자성입자 복합체를 유체 미세 칩 내에 분석구로 유인하도록 연쇄적으로 배치되는 것을 특징으로 한다.
바람직하게, 상기 연자성미세 구조물은 약 1 테슬라(Tesla)의 포화 자화를 가지고 10m 이하의 길이를 갖는 것을 특징으로 한다.
바람직하게, 상기 내부 자기장의 변화도는 약 104 T/m의 범위 내인 것을 특징으로 한다.
바람직하게, 상기 외부 자기장에 의해 자화된 상기 연자성미세 구조물은 기하학적 구조 및 연자성에 의하여 국소적인 내부 자기장을 발생시키고 상기 내부 자기장의 힘의 차이로 인해 상기 표적물질-리간드자성입자 복합체를 상기 내부 자기장의 힘이 가장 강한 상기 연자성미세구조물의 극으로 이동시키는 것을 특징으로 한다.
바람직하게, 상기 외부 자기장에 의해 자화된 상기 연자성미세 구조물은 기하학적 구조 및 연자성에 의하여 국소적인 내부 자기장을 발생시키고 회전 또는 진동하는 상기 외부 자기장에 의해 상기 표적물질-리간드자성입자 복합체를 이동시키는 것을 특징으로 한다.
바람직하게, 상기 외부 자기장이 시계방향으로 또는 반시계 방향으로 회전하고 상기 연자성미세 구조물이 타원판의 형태이며 상기 연자성미세 구조물이 유체 채널 내에 있는 경우 상기 표적물질-리간드자성입자 복합체를 상기 유체 채널의 특정 위치로 이송시키는 것을 특징으로 한다.
바람직하게, 상기 외부 자기장이 시계방향으로 회전하고 상기 연자성미세 구조물이 반쪽 타원판의 형태인 경우 상기 표적물질-리간드자성입자 복합체는 앞으로 진행하게 되고 상기 외부 자기장이 반시계 방향으로 회전하고 상기 연자성미세 구조물이 반쪽 타원판의 형태인 경우 상기 표적물질-리간드자성입자 복합체는 뒤로 진행하게 되는 것을 특징으로 한다.
바람직하게, 상기 외부 자기장이 시계방향으로 회전하고 상기 연자성미세 구조물들이 사선으로 배열되는 경우 상기 표적물질-리간드자성이자 복합체들은 상기 사선이 가운데로 모아지는 부분으로 집중되게 되고 상기 외부 자기장이 반시계 방향으로 회전하고 상기 연자성미세 구조물들이 사선으로 배열되는 경우 상기 표적물질-리간드자성입자 복합체들은 상기 사선이 가운데로 모아지는 부분으로부터 흩어지게 되는 것을 특징으로 한다.
바람직하게, 상기 분석모듈(600)은 리간드를 분석하는 장치로 구성된 것을 특징으로 한다.
또한, 본 발명에 따라, 다수의 시험 화합물로 구성된 리간드자성입자 라이브러리로부터 생화학적 시스템인 표적물질에 대한 리간드의 스크리닝 시스템을 이용한 리간드를 검정하는 시스템이 제공된다.
바람직하게, 리간드가 표적물질의 생물학적 활성에 미치는 영향을 검정하는 시스템은, 상기 분석모듈(600)이 세포학적 분석, 생리학적 분석, 생화학적 분석, 분자생물학적 분석, 유전체 분석, 단백질체 분석 등을 하는 장치로 구성된 것을 특징으로 한다.
또한, 본 발명에 따라, 다수의 시험 화합물로 구성된 리간드자성입자 라이브러리로부터 생화학적 시스템인 표적물질에 대한 리간드의 스크리닝 방법이 제공된다.
본 발명에 따른 연자성미세구조물을 이용한 리간드의 스크리닝 방법은, 리간드자성입자 라이브러리를 준비하는 단계; 상기 반응모듈(2)에서 상기 리간드자성입자 라이브러리와 표적물질을 반응시켜 미결합 리간드자성입자 및 표적물질-리간드자성입자 복합체(300)를 포함하는 반응혼합물을 준비하는 단계; 상기 반응혼합물을 로딩장소(6)에 넣고 상기 자기력 발생모듈(3)에서 상기 연자성미세구조물(200)에 자기력을 발생시켜 상기 반응혼합물에서 상기 표적물질-리간드자성입자 복합체(300)만을 상기 연쇄 연자성미세구조체(7) 말단에 위치한 감지장소(8)로 상기 복합체(300)를 이송하는 단계; 상기 자기력 발생모듈(3)을 이용하여 상기 감지장소(8)에 이송된 표적물질-리간드자성입자 복합체(300)를 상기 분석모듈(5)로 이송하여 표적물질-리간드자성입자 복합체를 분리한 후, 상기 분리된 복합체에서 리간드자성입자를 분리하여 분석하는 단계를 포함한다.
바람직하게, 상기 반응모듈(2)에서 상기 반응혼합물의 상기 표적물질-리간드자성입자 복합체(300)를 세척용액으로 세척하여 비특이적이거나 상대적으로 약하게 결합한 리간드자성입자를 분리하여 반응혼합물을 준비하는 단계를 포함하는 것을 특징으로 한다.
바람직하게, 상기 이송모듈(4)로부터 분석모듈(5)로 이송된 표적물질-리간드자성입자 복합체(300)로부터 리간드를 증폭하는 단계; 및 리간드자성입자를 준비하고 이어서; 반응단계; 세척단계; 및 분리단계; 을 2회이상 반복하는 것을 특징으로 한다.
또한, 본 발명에 따라, 다수의 시험 화합물로 구성된 리간드자성입자 라이브러리로부터 생화학적 시스템인 표적물질에 대한 리간드의 스크리닝 시스템을 이용한 리간드 검정방법이 제공된다.
본 발명에 따른 리간드의 검정 방법은, 상기 동정된 리간드자성입자를 준비하는 단계; 상기 반응모듈(2)에서 상기 리간드자성입자와 표적물질을 반응시켜 표적물질-리간드자성입자 복합체(300)를 포함하는 반응혼합물을 준비하는 단계; 상기 반응혼합물을 로딩장소(6)에 넣고 상기 자기력 발생모듈(2)에서 상기 연자성미세구조물(200)에 자기력을 발생시켜 상기 반응혼합물에서 상기 표적물질-리간드자성입자 복합체(300)만을 상기 연쇄 연자성미세구조체(7) 말단에 위치한 감지장소(8)로 이송하여 상기 복합체를 분리하는 단계; 및 상기 자기력 발생모듈(2)을 이용하여 상기 분리된 표적물질-리간드자성입자 복합체(300)를 상기 분석모듈(5)로 이송하여 상기 동정된 리간드자성입자가 상기 표적물질의 생물학적 활성에 미치는 영향을 분석하여 검정하는 단계를 포함한다.
바람직하게, 상기 분석모듈(5)에서 수행하는 상기 리간드자성입자의 검증은 상기 리간드자성입자가 상기 생화학적 시스템인 표적물질의 생물학적 활성에 미치는 영향을 분석하는 것으로 세포학적 분석, 생리학적 분석, 생화학적 분석, 분자생물학적 분석, 유전체 분석, 단백질체 분석 등을 포함하는 것을 특징으로 한다.
또한, 본 발명에 따라, 연자성미세구조물을 이용한 리간드의 스크리닝 시스템을 이용한 표적물질을 정성 및 정량하는 방법이 제공된다.
본 발명에 따른 표적물질의 정성 및 정량 방법은, 상기 표적물질에 결합하는 리간드자성입자를 준비하는 단계; 상기 반응모듈(2)에서 상기 리간드자성입자와 시료를 반응시켜 표적물질-리간드자성입자 복합체(300)를 포함하는 반응혼합물을 준비하는 단계; 및 상기 반응혼합물을 로딩장소(6)에 넣고 상기 자기력 발생모듈(2)에서 상기 연자성미세구조물(200)에 자기력을 발생시켜 상기 반응혼합물에서 상기 표적물질-리간드자성입자 복합체(300)만을 상기 연쇄 연자성미세구조체(7) 말단에 위치한 감지장소(8)로 이송하여 분석모듈(5)로 상기 표적물질-리간드자성입자 복합체(300)로부터 표적물질을 정성 및 정량하는 단계를 포함한다.
바람직하게, 상기 분석모듈(5)은 상기 감지장소(8)에 있는 표적물질-리간드자성입자 복합체(300)로부터 표적물질을 정성 및 정량 분석하는 장치로 구성된 것을 특징으로 한다.
또한, 본 발명에 따른 연자성미세구조물을 이용한 리간드의 스크리닝 시스템(1)에서 상기 표적물질은 단일분자, 바이러스, 세포, 세균 등을 포함하는 생화학적 시스템으로 하는 것을 특징으로 한다.
또한, 본 발명에 따른 연자성미세구조물을 이용한 리간드의 스크리닝 시스템(1)에서 상기 리간드는 유기물질, 단백질, 펩타이드, 압타머 등을 포함하는 표적물질에 결합하는 물질로 하는 것을 특징으로 한다.
또한, 본 발명에 따른 연자성미세구조물을 이용한 리간드의 스크리닝 시스템(1)에서 검증된 리간드자성입자는 약제개발의 선도물질로 이용하는 것을 특징으로 한다.
또한, 본 발명에 따른 연자성미세구조물을 이용한 리간드의 스크리닝 시스템(1)에서 검증된 리간드자성입자는 표적물질을 정성 및 정량하는 소재로 이용하는 것을 특징으로 한다.
본 발명에 따른 연자성미세구조물을 이용한 리간드의 스크리닝 시스템에 따르면, 연자성미세구조물을 이용하여 표적물질-리간드자성입자 복합체를 분리하여 리간드를 분석하는 리간드의 스크리닝 시스템을 제공하고 종래의 리간드의 스크리닝 시스템보다 훨씬 더 뛰어난 잠재력을 가지고 있으며 제작하기 쉽고, 소량의 표적물질, 및 리간드라이브러리가 요구되며, 검정된 리간드는 진단소재 및 약제개발의 선도물질로 이용할 수 있다.
도 1은 본 발명에 따른 연자성미세구조물을 이용한 리간드의 스크리닝 시스템을 도시한 도면.
도 2은 본 발명에 따른 연자성미세구조물이 타원판 형태인 경우 외부 자기장에 의한 미결합리간드자성입자와 표적물질-리간드자성입자 복합체의 움직임을 도시한 도면.
도 3는 본 발명에 따른 표적물질-리간드자성입자 복합체의 직선형 이송을 위한 타원판 형태의 연자성미세구조물이 연속적으로 배열된 연쇄 연자성미세구조체를 도시한 도면.
도 4은 본 발명에 따른 표적물질-리간드자성입자 복합체의 앞 뒤 움직임을 위한 반쪽 타원판 형태의 연자성미세구조물이 연속적으로 배열된 연쇄 연자성미세구조체를 도시한 도면.
도 5 및 도 6는 본 발명에 따른 외부 자기장의 회전 방향에 따라 표적물질-리간드자성입자 복합체들을 모이게 하거나 흩어지게 하기 위한 연자성미세 구조물이 사선 방향으로 연속적으로 배열된 연쇄 연자성미세구조체를 도시한 도면.
도7은 본 발명에 따른 간암세포주 압타머 기반 바이오칩 및 일차적으로 스크리닝된 압타머리간드를 이용하여 간암세포주 및 GIBCO 간세포에 결합하는 압타머리간드의 이미지를 도시한 도면
도 8은 본 발명에 따른 스크리닝된 간암세포주 압타머리간드를 형광물질로 표지하여 간암세포주 및 GIBCO 간세포의 반응성을 확인한 결과를 도시한 도면
도 9는 본 발명에 따른 스크리닝된 간암세포주 압타머리간드를 이용하여 간암세포주 및 GIBCO 간세포의 결합정도를 확인한 결과를 도시한 도면.
도 10은 본 발명에 따른 인간 cdk2 siRNA의 례를 도시한 도면
도 11은 본 발명에 따른 cdk2 siRNA가 간암세포주의 cdk2 mRNA 발현에 미치는 영향 결과를 도시한 도면.
도 12는 본 발명에 따른 간암세포주 압타머리간드-cdk2 siRNA 복합체가 간암세포주의 cdk2 mRNA 발현에 미치는 영향 결과를 도시한 도면
1: 연자성미세구조물을 이용한 리간드의 스크리닝 시스템
2: 반응모듈
3: 자기력 발생모듈
4: 이송모듈
5: 분석모듈
6: 로딩장소
7: 연쇄 연자성미세구조체
8: 감지장소
100: 외부 자기장
200: 연자성미세구조물
300: 표적물질-리간드자성입자 복합체
400: 내부 자기장
500: 연자성미세구조물의 자화 방향
이하, 본 발명에 따른 연자성미세구조물을 이용한 리간드의 스크리닝 시스템을 보다 상세히 설명한다. 이하의 구체예는 본 발명을 예시적으로 설명하는 것일 뿐, 본 발명의 범위를 제한하는 것으로 의도되지 아니한다.
먼저, 도1을 참조하여 본 발명에 따른 연자성미세구조물을 이용한 리간드의 스크리닝 시스템(1)을 설명한다.
도1에 예시된 바와 같이, 본 발명에 따른 장치(1)는, 기본적으로 반응모듈(2), 자기력 발생모듈(3), 이송모듈(4) 및 분석모듈(5)을 포함한다.
상기 반응모듈(2)은 다수의 시험 화합물로 구성된 리간드자성입자 라이브러리와 상기 생화학적 시스템인 표적물질을 반응시켜 미결합 리간드자성입자 및 표적물질-리간드자성입자 복합체(300)를 포함하는 반응혼합물을 형성하는 모듈이다. 상기 반응모듈(2)에서 상기 반응혼합물의 상기 표적물질-리간드자성입자 복합체(300)를 세척용액으로 세척하여 비특이적이거나 상대적으로 약하게 결합한 리간드자성입자를 분리하여 반응혼합물을 준비할 수도 있다.
상기 표적물질은 단일분자, 바이러스, 세포, 세균 등을 포함하는 생화학적 시스템으로 하는 것을 특징으로 한다. 본 발명에서 사용되는 용어 "생화학적 시스템"이란 일반적으로 생존 생물체내에서 일반적으로 발견되는 유형의 분자를 포함하는 화학적 상호작용을 의미한다. 이러한 상호작용은 효소 결합, 시그널링 및 그 밖의 반응을 포함하여 생존 시스템에서 발생하는 전범위의 이화 및 동화 반응을 포함한다. 또한, 본 발명에 규정된 생화학적 시스템은 특정 생화학적 상호작용을 모방하는 모델 시스템도 포함한다. 본 발명을 실시하는 데에 있어서 특히 관심있는 생화학적 시스템의 예로는, 수용체-리간드 상호작용, 효소-기질 상호작용, 세포 시그널링 경로, 생체이용률 스크리닝을 위한 모델 장벽 시스템(예를 들어, 세포 또는 막 분획)을 포함하는 수송 반응, 및 다양한 그 밖의 일반적 시스템이 있다. 세포 또는 생물체 생존성 또는 활성은, 예를 들어 독물학 실험에서 본 발명의 방법 및 장치를 사용하여 또한 스크리닝될 수 있다. 검정되는 생물학적 물질은 세포, 세포분획(막, 시토졸 제제 등), 세포막 수용체의 작용제 및 길항제(예를 들어, 세포 수용체-리간드 상호작용, 예를 들어 트랜스페린, c-킷, 바이러스 수용체 리간드(예를 들어, CD4-HIV), 시토카인 수용체, 케모카인 수용체, 인터루킨 수용체, 면역글로불린 수용체 및 항체, 카드헤레인(cadherein) 패밀리, 인터그린(intergrin) 패밀리, 셀렉틴(selectin) 패밀리 등; 참조: Pigott 및 Power (1993) The Adhesion Molecule FactsBook Academic Press New York 및 Hulme (ed) Receptor Ligand Interactions A Practical Approach Rickwood 및 Hames (series editors) IRL Press at Oxford Press NY), 독소 및 독액, 바이러스 에피토프, 호르몬(예를 들어, 아편제, 스테로이드 등), 세포내 수용체(예를 들어, 스테로이드, 갑상선 호르몬, 레티노이드 및 비타민 D를 포함하는, 다양한 소형 리간드의 효과를 매개함; 참조: Evans(1988) Science, 240:889-895; Ham 및 Parker (1989) Curr. Opin. Cell Biol., 1:503-511; Burnstein et al, (1989), Ann, Rev. Physiol., 51:683-699; Truss 및 Beato (1993) Endocr. Rev., 14:459-479), 펩티드, 레트로-인버소 펩티드, -, -, 또는 - 아미노산(D- 또는 L-)의 중합체, 효소, 효소 기질, 보조인자, 약제, 렉틴, 당, 핵산(선형 및 구형 중합체 배열 둘 모두), 올리고사카라이드, 단백질, 인지질 및 항체를 포함하지만, 이들에 제한되지는 않는다.
상기 리간드는 유기물질, 단백질, 펩타이드, 압타머 등을 포함하는 표적물질에 결합하는 물질로 하는 것을 특징으로 한다. 본 발명에서 사용되는 용어 "리간드"는 특정 생화학적 시스템에 영향을 주는 능력에 대해 스크리닝되는 화합물에 관한 것이다. 시험 화합물은 화학적 화합물, 화학적 화합물의 혼합물, 예를 들어 폴리사카라이드, 작은 유기 또는 무기 분자, 생물학적 거대 분자, 예를 들어 펩타이드, 단백질, 핵산, 압타머 또는 박테리아, 식물, 진균류, 또는 동물 세포 또는 조직으로부터 제조된 추출물, 천연 또는 합성 조성물을 포함하는 여러 가지 상이한 화합물을 포함할 수 있다.
상기 자기력 발생모듈(3)은 외부 자기장(100)을 제어하여 하기 연자성미세구조물(200) 및 상기 미결합 리간드자성입자 및 표적물질-리간드자성입자 복합체(300)를 자화시키는 모듈로 미세 유체 채널로부터 이격되어 위치하는 전극배열을 포함하여 구성될 수 있다. 본 발명에 따른 자기력 발생수단은 외부 자기장(100)을 제어하여 연자성미세 구조물(200) 및 자성입자를 자화시킨다. 예를 들어, 자기력 발생수단은 외부 자기장(100)의 회전 방향을 시계 방향으로 또는 반시계 방향으로 바꿀 수 있다.
상기 이송모듈(4)은 상기 외부 자기장(100)에 의해 자화되는 경우 내부 자기장(400)을 발생시키며 자화 방향(500)에 따라 상기 표적물질-리간드자성입자 복합체(300)의 움직임을 제어하는 연쇄 연자성미세구조체(7), 한쪽 말단에 상기 반응혼합물을 넣는 로딩장소(loading well,6), 및 다른 말단에 상기 표적물질-리간드자성입자 복합체가 이송되는 감지장소(8)로 구성된 모듈(4)이다. 연자성미세구조물(200)은 외부 자기장(100)에 의해 자화되는 경우 내부 자기장(400)을 발생시키며 연자성미세구조물(200)의 자화 방향(500)에 따라 표적물질-리간드자성입자 복합체(300)의 움직임을 제어한다.
연자성미세 구조물(200)은 NiFe, Fe, Ni, 및 Co 중 어느 하나인 연자성 박막을 패터닝하여 형성될 수 있다.
도 3 내지 도 4에 도시된 바와 같이, 본 발명의 일실시예에 따른 연자성미세구조물(200)은 표적물질-리간드자성입자 복합체(300)를 유체 미세 칩 내에 있는 감지장소로 유인하기 위하여 연쇄적으로 배치되어 연쇄 연자성미세구조체(7)을 구성할 수 있다.
도 2에 도시된 바와 같이 외부 자기장(100)이 회전함에 따라 연자성미세구조물(200)의 자화 방향이 변화한다. 내부 자기장(400)의 힘의 차이가 부분적으로 자화된 표적물질-리간드자성입자 복합체(300)를 더 강한 내부 자기장(400)이 존재하는 연자성미세구조물(200)의 극으로 끌어 당긴다. 즉, 연자성미세구조물(200)과 표적물질-리간드자성입자 복합체(300) 간의 끌어 당기는 힘은 연자성미세구조물(200)의 가로 세로의 비에 의해 각기 다른 방향의 다양한 내부 자기장 (400)을 생성한다.
도 2에 도시된 바와 같이 외부 자기장(100)에 의해 자화된 연자성미세구조물(200)은 연자성미세구조물(200)의 기하학적 구조 및 연자성에 의하여 국소적인 내부 자기장(400)을 발생시킨다. 이러한 경우, 내부 자기장(400)의 힘의 차이로 인해 표적물질-리간드자성입자 복합체(300)는 내부 자기장(400)의 힘이 가장 강한 연자성미세구조물(200)의 극으로 이동하게 된다.
즉, 외부 자기장(100)에 의해 자화된 연자성미세구조물(200)은 기하학적 구조 및 연자성에 의하여 국소적인 내부 자기장(400)을 발생시키고 회전 또는 진동하는 외부 자기장(100)에 의해 표적물질-리간드자성입자 복합체(300)를 이동시킬 수 있다.
도 3는 본 발명의 일실시예에 따른 표적물질-리간드자성입자 복합체의 직선형 이송을 위한 타원판 형태의 연자성미세구조물이 연속적으로 배열된 연쇄 연자성미세구조체(7)을 도시한 도면이다.
도 3에 도시된 바와 같이 외부 자기장(100)이 회전할 때 내부 자기장(400)의 힘의 국소적인 차이가 표적물질-리간드자성입자 복합체(300)의 움직임을 지배한다. 즉, 표적물질-리간드자성입자 복합체(300)는 각 연자성미세구조물(200)의 자화 방향을 따라 움직이게 되고 하나의 연자성미세구조물(300)에서 이웃하여 위치한 또 다른 하나의 연자성미세구조물(300)로 이동하게 된다.
도 3에 도시된 바와 같이 외부 자기장(100)이 시계 방향으로 또는 반시계 방향으로 회전하고 연자성미세구조물(200)이 타원판의 형태이며 연자성미세구조물(200)이 유체 채널 내에 있는 경우 표적물질-리간드자성입자 복합체(300)를 상기 유체 채널의 특정 위치로 이송시킬 수 있다.
본 발명의 일실시예에 따르면, 도 3에 도시된 바와 같이 외부 자기장(100)이 시계 방향으로 회전하고 표적물질-리간드자성입자 복합체(300)가 연자성미세구조물(200)의 위쪽에 위치하는 경우 표적물질-리간드자성입자 복합체(300)는 앞으로 진행하게 된다.
또한, 외부 자기장(100)이 시계 방향으로 회전하고 표적물질-리간드자성입자 복합체(300)가 연자성미세구조물(200)의 아래쪽에 위치하는 경우 표적물질-리간드자성입자 복합체(300)는 뒤로 진행하게 된다.
도 3에 도시된 바와 같은 경로에서 표적물질-리간드자성입자 복합체(300)의 움직임 방향은 연자성미세구조물(200)의 기하학적 구조와 표적물질-리간드자성입자 복합체(300)의 위치에 의해 결정된다.
도 4은 본 발명에 따른 표적물질-리간드자성입자 복합체의 앞 뒤 움직임을 위한 반쪽 타원판 형태의 연자성미세구조물이 연속적으로 배열된 연쇄 미세구조물(7)을 도시한 도면이다.
도 4에 도시된 바와 같이 외부 자기장(100)의 회전 방향에 따라 표적물질-리간드자성입자 복합체(300)를 앞으로 진행하게 하거나 뒤로 진행하게 할 수 있다. 도 3에 도시된 표적물질-리간드자성입자 복합체(300)의 움직임과 비교했을 때 도 4에 도시된 표적물질-리간드자성입자 복합체(300)의 움직임은 오직 외부 자기장(100)의 회전 방향에 의해서만 결정된다는 점에서 차이가 있다.
도 4에 도시된 바와 같이 외부 자기장(100)이 시계 방향으로 회전하고 연자성미세 구조물(200)이 반쪽 타원판의 형태인 경우 표적물질-리간드자성입자 복합체(300)는 앞으로 진행하게 된다. 또한, 외부 자기장(100)이 반시계 방향으로 회전하고 연자성미세 구조물(200)이 반쪽 타원판의 형태인 경우 표적물질-리간드자성입자 복합체(300)는 뒤로 진행하게 된다.
도 5 내지 도 6는 본 발명의 일실시예에 따른 외부 자기장의 회전 방향에 따라 마이크로 비드들을 모이게 하거나 흩어지게 하기 위한 연자성미세구조물이 사선 방향으로 연속적으로 배열된 연쇄 연자성구조물(7)을 도시한 도면이다.
도 5 내지 도 6에 도시된 바와 같이 외부 자기장(100)이 시계 방향으로 회전하고 연자성미세 구조물들(200)이 사선으로 배열되는 경우 표적물질-리간드자성입자 복합체들(300)은 상기 사선이 가운데로 모아지는 부분으로 집중되게 된다. 또한, 외부 자기장(100)이 반시계 방향으로 회전하고 연자성미세구조물들(200)이 사선으로 배열되는 경우 표적물질-리간드자성입자 복합체들(300)은 상기 사선이 가운데로 모아지는 부분으로부터 흩어지게 된다.
이러한 경우, 상기 사선이 가운데로 모아지는 부분은 유체 미세 칩 내에 있는 감지장소로 구현되는 것이 바람직하다. 본 발명에 따르면 미세한 자기력의 형성만으로 표적물질-리간드자성입자 복합체의 경로 변경을 유도할 수 있는 효과가 있다. 또한, 본 발명에 따르면 일련의 생체 분석 과정을 미세유체 칩 내에서 수행하게 함으로써 랩온어칩을 구현할 수 있는 효과가 있다.
상기 분석모듈(5)는 상기 이송모듈(4)로부터 이송되는 표적물질-리간드자성입자 복합체(300)로부터 리간드를 스크리닝하고/거나 상기 스크리닝된 리간드가 표적물질의 생물학적 활성에 미치는 영향을 분석하는 모듈이다.
상기 분석모듈(5)은 리간드의 스크리닝, 상기 스크리닝된 리간드자성입자가 상기 생화학적 시스템인 표적물질의 생물학적 활성에 미치는 영향의 분석, 그리고 표적물질의 정성정량 분석을 하기 위해, 세포학적 분석, 생리학적 분석, 생화학적 분석, 분자생물학적 분석, 유전체 분석, 단백질체 분석 등을 할 수 있는 장비를 포함한다. 상기에 기재한 바와 같이, 본 발명의 스크리닝 방법은 일반적으로 미세한 유체 장치 또는 "미량실험용 시스템"에서 수행되며, 이 시스템은 검정, 자동화를 수행하고 검정 시스템에 대한 환경 영향, 예를 들어 소실, 오염, 사람 실수 등을 최소화하는 데 필요한 요소의 통합을 고려한다. 본 발명의 검정 및 정성정량 방법을 수행하기 위한 수많은 장치가 하기의 상세한 설명 부분에 기재되어 있다. 그러나, 이러한 장치의 구체적인 배열은 일반적으로 검정 유형 및/또는 목적하는 검정 배향에 따라 달라지는 것을 알 수 있다. 예를 들어, 일부 구체예에서, 본 발명의 스크리닝 방법은 2개의 교차 채널을 갖는 미세한 유체 장치를 사용하여 수행될 수 있다. 더욱 복잡한 검정 또는 검정 배향에 있어서, 다중 채널/교차 장치가 임의로 사용된다. 이 장치의 적은 범위의 통합률 및 자가 함유 특성은 미량실험용 시스템의 환경내에서 실현하려는 어떠한 검정 배열을 궁극적으로 고려한다.
이하, 구체적인 실시예를 통해 본 발명을 설명한다.
실시예 1. 리간드자성입자 라이브러리 준비
본 발명에 따른 연자성미세구조물을 이용한 리간드의 스크리닝 방법의 상기 제 1단계는, 다수의 상이한 화합물로 구성된 리간드자성입자 라이브러리 즉, 본 실시예에서는 무작위 염기서열을 가진 단일가닥핵산들(이하, '무작위 단일가닥핵산들'이라 한다)을 반응시켜 생화학적 시스템인 표적물질과 결합하는 단일가닥핵산들(이하, '압타머리간드'이라 한다)을 결정하는 단계이다.
핵산이 단백질을 포함하는 특정물질에 대하여 하나의 리간드(ligand)로서 작용할 수 있는 바, 다양한 염기순서로 배열된 단일가닥 핵산이 조합된 라이브러리로부터 일정한 선별과정과 염기서열결정을 통하여 높은 결합력과 특이성으로 특정물질과 결합하는 핵산들이 선별되고 있다. 특정물질과 결합하는 핵산을 선별하는 방법은 셀렉스 (SELEX, Systematic Evolution of Ligand by Exponential enrichment)라 하고, 선별된 산물인 핵산을 압타머(aptamer)라 하며(Tuerk C. and Gold L.; Science, 249, pp505-510, 1990), SELEX를 통하여 자연상태에서 핵산과 결합할 수 있는 단백질뿐만 아니라 핵산과 결합하고 있지 않은 단백질을 비롯한 여러 생체분자와도 매우 높은 친화력으로 결합할 수 있는 분자들이 선별되고 있다.
아래와 같은 무작위의 염기서열을 가진 단일가닥의 DNA 올리고뉴클레오티드를 이용하여 PCR(Polymerase Chain Reaction)을 통해 이중가닥의 DNA를 제조한 후, 생체외 전사를 통하여 단일가닥의 RNA 라이브러리(무작위 단일가닥핵산들)를 제조하였다.
5'-GGGAGAGCGGAAGCGTGCTGGGCC N40 CATAACCCAGAGGTCGATGGATCC CCCC-3' (여기에서 밑줄 친 염기배열은 핵산 라이브러리의 고정된 부위이며 N40은 각 위치에 A, G, T, C등의 염기들이 같은 농도로 존재함을 의미한다.
PCR(Polymerase Chain Reaction)에 이용되는 FW 프라이머(5'-GGGGGAATTCTAATACGACTCACTATAGGGAGAGCGGAAGC GTGCTGGG- 3': 서열번호 1)는 위의 염기배열의 밑줄 친 염기들의 5'말단과 염기결합을 할 수 있고 박테리오파지 T7의 RNA 폴리머아제를 위한 프로모터 염기서열을 포함하고 있다.
PCR의 RE 프라이머(5'-GGGGGGATCCATCGACCTCTGGGTTATG-3': 서열번호 2)는 위의 염기배열의 밑줄친 염기들의 3'말단과 염기결합을 할 수 있다. 그리고 FW와 RE 프라이머는 이후의 클로닝을 위해 각각 EcoRI과 BamHI등의 제한효소 절단 염기서열을 함유하고 있다.
생체시료와 반응할 무작위 단일가닥핵산들은 2'-F-치환 피리미딘을 포함하는 RNA 라이브러리이며, DNA 핵산라이브러리 전사체 및 PCR 프라이머를 상기와 같이 설계 제작하여 PCR 및 생체외 전사 방법으로 준비하였다.
PCR은 1,000 pmoles 단일가닥핵산 전사체, 2,500 pmoles PCR의 프라이머 쌍(5P7)을 50 mM KCl, 10 mM Tris-Cl(pH 8.3), 3 mM MgCl2, 0.5 mM dNTP(dATP, dCTP, dGTP, 및 dTTP), 0.1 U Taq DNA Polymerase (Perkin-Elmer, Foster City Calif.)에서 PCR를 수행한 후 QIAquick-spin PCR 정제 칼럼(QIAGEN Inc., Chatsworth Calif.)으로 정제하였다.
2'-F-치환 피리미딘을 포함하는 무작위 단일가닥핵산들은 생체외 전사로 합성하고 정제하여 준비하였다. 200 pmoles 이중가닥 DNA 전사체, 40 mM Tris-Cl (pH 8.0), 12 mM MgCl2, 5 mM DTT, 1 mM spermidine, 0.002% Triton X-100, 4% PEG 8000, 5 U T7 RNA Polymerase 그리고 1 mM ATP, GTP 및 3 mM 2'F-CTP, 2'F-UTP를 37에서 6 ~ 12시간 반응시킨 후, Bio-Spin 6 크로마토그래피 칼럼(Bio-Rad Laboratories, Hercules Calif.)으로 정제한 후, UV 스펙트로미터를 이용하여 정제된 핵산의 양 및 그 순수도를 검색하였다.
상기 준비된 RNA 단일가닥핵산의 3 말단에 T4 RNA ligase(Thermo Scientific Pierce RNA 3 End Biotinylation Kit)으로 바이오틴(biotin)을 부착시키고 스트렙타비딘(streptavidin)과 반응시켜 정제하여 리간드자성입자 라이브러리인 RNA 단일가닥핵산 자성입자 라이브러리를 준비하였다.
실시예 2. 표적물질-리간드자성입자 복합체를 포함하는 반응혼합물 준비
상기 표적물질은 생화학적 시스템으로 단일분자, 바이러스, 세포, 세균 등을 포함하는 것이며 본 실시례에서 간암세포주(Hep3B)를 사용하였다. 본 발명의 연자성미세구조물을 이용한 리간드 스크리닝 시스템(1)의 반응모듈(2)에서 간암세포주와 상기에서 준비된 RNA 단일가닥핵산 자성입자 라이브러리를 반응시켜 반응혼합물을 준비하였다.
상기에서 합성된 무작위 RNA 단일가닥핵산 자성입자 라이브러리의 1015 염기서열/1의 농도용액을 200 pmol/200의 농도로 선택버퍼(50 mM TrisCl (pH 7.4), 5 mM KCl, 100 mM NaCl, 1 mM MgCl2, 0.1% NaN3)에서 80에서 10분간 가열한 후, 얼음에 10분간 방치하였다. 사용한 단일가닥핵산의 5배의 효모 tRNA(yeast tRNA, Life Technologies사) 및 0.2% BSA(bovine serum albumin, Merck사)을 첨가하여 반응용액을 준비하였다.
상기에서 준비된 RNA 단일가닥핵산 자성입자 라이브러리를 간암세포주에 처리하여 30분간 반응시켰다. 상기에서 준비된 반응혼합물에 포함된 간암세포주-RNA 단일가닥핵산 자성입자 복합체들의 세척버퍼는 0 내지 1 x 세렉스버퍼 또는 0 내지 500 mM EDTA 용액을 사용하였다. 간암세포주와 결합하는 RNA 단일가닥핵산자성입자의 분리는, 일차적으로 간암세포주에 결합력을 보이는 RNA 단일가닥핵산자성입자들을 대상으로 하며, 반응 후 다양한 세척버퍼로 세척 과정을 반복하여 일회만의 분리과정으로 간암세포주-RNA 단일가닥핵산 자성입자 복합체들을 확보하였다.
상기 반응혼합물에 세척용액을 사용하여 상기 간암세포주-RNA 단일가닥핵산 리간드자성입자 복합체에서 비특이적이거나 상대적으로 약하게 결합한 상기 RNA 단일가닥핵산 리간드자성입자를 분리하여 반응혼합물을 준비하였다.
실시예 3. 반응혼합물에서 표적물질-리간드자성입자 복합체 분리
본 발명의 연자성미세구조물을 이용한 리간드 스크리닝 시스템(1)의 상기 반응모듈(2)에서 준비된 간암세포주-RNA 단일가닥핵산 자성입자 복합체를 포함하는 반응혼합물을 상기 반응혼합물을 이송모듈(4)의 로딩장소(6)에 넣고 상기 자기력 발생모듈(3)에서 상기 연자성미세구조물(200)에 자기력을 발생시켜 상기 반응혼합물에서 상기 세포폐암세포주-RNA 단일가닥핵산 자성입자 복합체만을 상기 연쇄 연자성미세구조체(7) 말단에 위치한 감지장소(8)로 이송하였다. 상기 자기력 발생모듈(3)을 이용하여 상기 이송된 간암세포주-RNA 단일가닥핵산 자성입자 복합체를 상기 분석모듈(5)로 이송시킨 후, 간암세포주-RNA 단일가닥핵산 리간드자성입자 복합체를 수확하였다.
분석모듈(5)에서 수확된 간암세포주-RNA 단일가닥핵산 리간드자성입자 복합체를 RT-PCR을 수행하여 간암세포주에 결합하는 RNA 단일가닥핵산 리간드를 지시하는 DNA 풀을 증폭 제작하였다.
이때, 상기의 선택과 증폭과정을 다수회 반복하여 생체분자결합 RNA 단일가닥핵산 자성입자 라이브러리를 상기 방법으로 다시 제작할 수도 있다. 분리된 표적물질-리간드자성입자 복합체에서 리간드를 증폭하여 리간드자성입자를 준비하고 반응단계, 세척단계, 및 분리단계를 반복하여 실시할 수 도 있다.
실시예 4. 리간드의 분석
본 발명의 연자성미세구조물을 이용한 리간드 스크리닝 시스템(1)의 분석모듈(5)에서 확보된 RT-PCR 산물인 DNA를 플라스미드에 클로닝하여 단일클론을 확보하는 과정으로, 생체분자결합-단일가닥핵산들의 제작을 완료하였다. 이들 간암세포주에 결합하는 단일가닥핵산들의 염기서열은 표준방법으로 수행하였다.
상기 염기서열을 기반으로 간암세포주 압타머기반 바이오칩을 표준방법으로 제작하여 간암세포주에 결합하는 압타머를 형광표지하여 간암세포주 및 간세포(Hepatocyte)에 반응시킨 후 생산된 이미지로부터 간암세포주 특이 결합 압타머 리간드를 결정하였다(도 7). 결정된 간암세포주와 결합하는 단일가닥핵산들의 염기서열을 기반으로 핵산의 이차구조를 모델링하는 MFOLD 프로그램을 사용하여 이차구조 및 구조체 자유에너지를 확인한 후, 가장 안정도가 높은 이차구조를 갖는 간암세포주 압타머리간드를 선정하였다
상기에서 스크리닝된 간암세포주 압타머리간드로 세포수준에서 결합능을 관찰하였다. 스크리닝된 압타머와 간암세포주 및 GIBCO 간세포의 결합능을 특정 압타머를 양 세포에 결합시킨 후, 결합된 압타머를 증폭하여 전기영동하여 확인하였다(도 8). 간세포보다 간암세포주에서 강한 밴드를 형성함으로 스크리닝된 간암세포주 압타머리간드들이 간세포보다는 간암세포주에 더 강하게 결합함을 알 수 있다.
실시예 5. 스크리닝된 리간드로 표적물질의 분석
본 발명의 연자성미세구조물을 이용한 리간드의 스크리닝 시스템(1)에 있는 분석모듈(5)을 형광현미경으로 구성하여 상기에서 스크리닝된 간암세포주 압타머리간드가 간암세포주에 특이적으로 결합하는 지를 세포학적 수준에서 분석하였다. 스크리닝된 간암세포주 압타머리간드를 로다민(Rhodamine) 염색시약으로 표지하여 간암세포주 및 GIBCO 간세포를 염색하여 광학현미경으로 관찰한 결과 간암세포주에 특이적으로 결합하고 GIBCO 간세포에는 거의 결합 하지 못 함을 확인할 수 있었다(도 9). 따라서 스크리닝된 간암세포주 압타머리간드로 상기와 같은 분석으로 간세포와 간암세포주를 구분할 수 있다.
실시예 6.리간드의 검정
본 발명의 연자성미세구조물을 이용한 리간드 스크리닝 시스템(1)에 있는 분석모듈(5)로 리간드의 검정은 스크리닝된 리간드가 표적물질의 생물학적인 활성에 미치는 효과를 분석하는 것은 세포학적 분석, 생리학적 분석, 생화학적 분석, 분자생물학적 분석, 유전체 분석, 단백질체 분석 등을 포함한다. 본 실시례에서 간암세포주 특이결합 압타머리간드를 이용하여 siRNA의 운반체로써 역할을 조사하였다.
암세포에서 많이 발현하여 종양유전자로 알려진 cdk2 유전자의 기능을 저해하는 cdk2 siRNA를 4종류를 제작하였다(도 10).
제작된 cdk2 siRNA를 간암세포주에 형질주입(transfection)한 후, RNA를 분리하여 cdk2 mRNA를 정량분석한 결과 cdk2-1 siRNA>cdk2-2 siRNA>cdk2-4 siRNA>cdk2-3 siRNA 순으로 기능함을 확인하였다(도 11).
상기 준비된 cdk2 siRNA를 간암세포주 특이 압타머 리간드에 결합시켜 간암세포주에 특이적으로 작용하는 복합체를 개발하여 그 기능을 확인하였다(도 12). 간암세포주특이 압타머리간드-cdk 2 siRNA 복합체를 제작하였다. 간암세포주특이 압타머리간드-cdk 2 siRNA 복합체를 제작하여 100nM(1) 및 250nM(2) 복합체를, 100 nM cdk 2 siRNA(3)를 처리하였고, 무처리(4)한 후 3일간 배양한 후 총 RNA를 분리하여 cdk2 mRNA를 정량분석한 결과이며 위쪽 그림은 transfection한 경우이고 아래쪽 그림은 직접 시약을 처리한 경우이다. 각각에서 총 RNA를 분리하여 cdk2 mRNA를 정량분석하였다. 형질주입한 경우는 간암세포주특이 압타머리간드-cdk 2 siRNA 복합체 및 cdk 2 siRNA 모두에서 cdk2 mRNA의 양을 감소시켰다. 그러나 직접처리(direct treatment)한 경우는 간암세포주특이 압타머리간드-cdk 2 siRNA 복합체만 cdk2 mRNA의 양을 감소시켰다. 이 결과로 간암세포주특이 압타머리간드-cdk 2 siRNA 복합체의 경우 복합체에 있는 압타머리간드가 간암세포주의 세포표면에 있는 단백질에 특이적으로 결합하여 세포 속으로 이동하여 siRNA로 작용하여 cdk2 mRNA의 양을 감소시켰음을 확인할 수 있었다.
이상과 같이 본 발명은 비록 한정된 실시예와 도면에 의해 설명되었으나, 본 발명은 상기의 실시예에 한정되는 것은 아니며, 이는 본 발명이 속하는 분야에서 통상의 지식을 가진 자라면 이러한 기재로부터 다양한 수정 및 변형이 가능하다. 따라서, 본 발명 사상은 아래에 기재된 특허청구범위에 의해서만 파악되어야 하고, 이의 균등 또는 등가적 변형 모두는 본 발명 사상의 범주에 속한다고 할 것이다.

Claims (25)

  1. 다수의 시험 화합물로 구성된 리간드자성입자 라이브러리로부터 생화학적 시스템인 표적물질에 대한 연자성미세구조물을 이용한 리간드의 스크리닝 시스템(1)으로서,
    상기 리간드자성입자 라이브러리와 상기 표적물질을 반응시켜 미결합 리간드자성입자 및 표적물질-리간드자성입자 복합체(300)를 포함하는 반응혼합물을 형성하는 반응모듈(2);
    외부 자기장(100)을 제어하여 하기 연자성미세구조물(200) 및 상기 미결합 리간드자성입자 및 표적물질-리간드자성입자 복합체(300)를 자화시키는 자기력 발생모듈(3);
    상기 외부 자기장(100)에 의해 자화되는 경우 내부 자기장(400)을 발생시키며 자화 방향(500)에 따라 상기 표적물질-리간드자성입자 복합체(300)의 움직임을 제어하는 연쇄 연자성미세구조체(7), 한쪽 말단에 상기 반응혼합물을 넣는 로딩장소(loading well,6), 및 다른 말단에 상기 표적물질-리간드자성입자 복합체가 이송되는 감지장소(8)로 구성된 이송모듈(4);
    상기 연자성미세구조물(200)이 자화됨에 따라 발생된 상기 내부 자기장(400)에 의해 움직임을 제어받는 상기 미결합 리간드자성입자 및 표적물질-리간드자성입자 복합체(300); 및
    상기 이송된 표적물질-리간드자성입자 복합체(300)로부터 분리된 리간드 및/또는 상기 분리된 리간드가 표적물질의 생물학적 활성에 미치는 영향을 분석하는 분석모듈(5); 을 포함하는 것을 특징으로 하는 연자성미세구조물을 이용한 리간드의 스크리닝 시스템.
  2. 제1항에 있어서,
    상기 연자성미세구조물(200)은 NiFe, Fe, Ni, 및 Co 중 어느 하나인 연자성 박막을 패터닝하여 형성되는 것을 특징으로 하는 연자성미세구조물을 이용한 리간드의 스크리닝 시스템.
  3. 제1항에 있어서,
    상기 연자성미세구조물(200)은 원판, 타원판, 및 반쪽 타원판 중 어느 하나의 형태로 구현되는 것을 특징으로 하는 연자성미세구조물을 이용한 리간드의 스크리닝 시스템.
  4. 제1항에 있어서,
    상기 연쇄 연자성미세구조체(7)은 상기 표적물질-리간드자성입자 복합체(300)를 유체 미세 칩 내에 있는 감지장소(8)로 유인하도록 연쇄적으로 배치되는 것을 특징으로 하는 연자성미세구조물을 이용한 리간드의 스크리닝 시스템.
  5. 제1항에 있어서,
    상기 연자성미세구조물(200)은 약 1 테슬라(Tesla)의 포화 자화를 가지고 10m 이하의 길이를 갖는 것을 특징으로 하는 연자성미세구조물을 이용한 리간드의 스크리닝 시스템.
  6. 제1항에 있어서,
    상기 내부 자기장(400)의 변화도는 약 104 T/m의 범위 내인 것을 특징으로 하는 연자성미세구조물을 이용한 리간드의 스크리닝 시스템.
  7. 제1항에 있어서,
    상기 외부 자기장(100)에 의해 자화된 상기 연자성미세구조물(200)은 기하학적 구조 및 연자성에 의하여 국소적인 내부 자기장(400)을 발생시키고 상기 내부 자기장(400)의 힘의 차이로 인해 상기 표적물질-리간드자성입자 복합체(300)를 상기 내부 자기장(400)의 힘이 가장 강한 상기 연자성미세구조물(200)의 극으로 이동시키는 것을 특징으로 하는 연자성미세구조물을 이용한 리간드의 스크리닝 시스템.
  8. 제1항에 있어서,
    상기 외부 자기장(100)에 의해 자화된 상기 연자성미세구조물(200)은 기하학적 구조 및 연자성에 의하여 국소적인 내부 자기장(400)을 발생시키고 회전 또는 진동하는 상기 외부 자기장(100)에 의해 상기 표적물질-리간드자성입자 복합체(300)를 이동시키는 것을 특징으로 하는 연자성미세구조물을 이용한 리간드의 스크리닝 시스템.
  9. 제1항에 있어서,
    상기 외부 자기장(100)이 시계 방향으로 또는 반시계 방향으로 회전하고 상기 연자성미세구조물(200)이 타원판의 형태이며 상기 연자성미세구조물(200)이 유체 채널 내에 있는 경우 상기 표적물질-리간드자성입자 복합체(300)를 상기 유체 채널의 특정 위치로 이송시키는 것을 특징으로 하는 연자성미세구조물을 이용한 리간드의 스크리닝 시스템.
  10. 제1항에 있어서,
    상기 외부 자기장(100)이 시계 방향으로 회전하고 상기 연자성미세구조물(200)이 반쪽 타원판의 형태인 경우 상기 표적물질-리간드자성입자 복합체(300)는 앞으로 진행하게 되고 상기 외부 자기장(100)이 반시계 방향으로 회전하고 상기 연자성미세구조물(200)이 반쪽 타원판의 형태인 경우 상기 표적물질-리간드자성입자 복합체(300)는 뒤로 진행하게 되는 것을 특징으로 하는 연자성미세구조물을 이용한 리간드의 스크리닝 시스템.
  11. 제1항에 있어서,
    상기 외부 자기장(100)이 시계 방향으로 회전하고 상기 연자성미세구조물(200)이 사선으로 배열되는 연쇄 연자성미세구조체(7)은 상기 표적물질-리간드자성입자 복합체(300)은 상기 사선이 가운데로 모아지는 부분으로 집중되게 되고 상기 외부 자기장(100)이 반시계 방향으로 회전하고 상기 연자성미세구조물(200)이 사선으로 배열되는 연쇄 연자성미세구조체(7)은 상기 표적물질-리간드자성입자 복합체(300)은 상기 사선이 가운데로 모아지는 부분으로부터 흩어지게 되는 것을 특징으로 하는 연자성미세구조물을 이용한 리간드의 스크리닝 시스템.
  12. 제11항에 있어서,
    상기 사선이 가운데로 모아지는 부분은 유체 미세 칩 내에 있는 감지장소(8)인 것을 특징으로 하는 연자성미세구조물을 이용한 리간드의 스크리닝 시스템.
  13. 제 1청구항에 있어서,
    상기 분석모듈(600)은 리간드를 분석하는 장치로 구성된 것을 특징으로 하는 연자성미세구조물을 이용한 리간드의 스크리닝 시스템.
  14. 제 1청구항에 있어서,
    상기 분석모듈(600)은 리간드가 표적물질의 생물학적 활성에 미치는 영향을 분석하기 위해, 세포학적 분석, 생리학적 분석, 생화학적 분석, 분자생물학적 분석, 유전체 분석, 단백질체 분석 등을 하는 장치로 구성된 것을 특징으로 하는 연자성미세구조물을 이용한 리간드의 스크리닝 시스템.
  15. 다수의 시험 화합물로 구성된 리간드자성입자 라이브러리로부터 생화학적 시스템인 표적물질에 대한 연자성미세구조물을 이용한 리간드의 스크리닝 방법으로서,
    리간드자성입자 라이브러리를 준비하는 단계;
    상기 반응모듈(2)에서 상기 리간드자성입자 라이브러리와 표적물질을 반응시켜 미결합 리간드자성입자 및 표적물질-리간드자성입자 복합체(300)를 포함하는 반응혼합물을 준비하는 단계;
    상기 반응혼합물을 로딩장소(6)에 넣고 상기 자기력 발생모듈(3)에서 상기 연자성미세구조물(200)에 자기력을 발생시켜 상기 반응혼합물에서 상기 표적물질-리간드자성입자 복합체(300)만을 상기 연쇄 연자성미세구조체(7) 말단에 위치한 감지장소(8)로 상기 복합체(300)를 이송하는 단계;
    상기 자기력 발생모듈(3)을 이용하여 상기 감지장소(8)에 이송된 표적물질-리간드자성입자 복합체(300)를 상기 분석모듈(5)로 이송하여 표적물질-리간드자성입자 복합체를 분리한 후, 상기 분리된 복합체에서 리간드자성입자를 분리분석하여 동정하는 단계; 를 포함하는 것을 특징으로 하는 연자성미세구조물을 이용한 리간드의 스크리닝 방법.
  16. 제15청구항에 있어서,
    상기 반응모듈(2)에서 상기 반응혼합물의 상기 표적물질-리간드자성입자 복합체(300)를 세척용액으로 세척하여 비특이적이거나 상대적으로 약하게 결합한 리간드자성입자를 분리하여 반응혼합물을 준비하는 단계를 포함하는 것을 특징으로 하는 연자성미세구조물을 이용한 리간드의 스크리닝 방법.
  17. 제15청구항에 있어서,
    상기 이송모듈(4)로부터 분석모듈(5)로 이송된 표적물질-리간드자성입자 복합체(300)로부터 리간드를 증폭하여 리간드자성입자를 준비하는 단계에 이어서; 반응단계; 세척단계; 및 분리단계; 를 2회이상 반복하는 것을 특징으로 하는 연자성미세구조물을 이용한 리간드의 스크리닝 방법.
  18. 다수의 시험 화합물로 구성된 리간드자성입자 라이브러리로부터 생화학적 시스템인 표적물질에 대한 연자성미세구조물을 이용한 리간드의 스크리닝 시스템(1)을 이용한 리간드의 검정 방법으로서,
    상기 동정된 리간드자성입자를 준비하는 단계;
    상기 반응모듈(2)에서 상기 리간드자성입자와 표적물질을 반응시켜 미결합 리간드자성입자 및 표적물질-리간드자성입자 복합체(300)를 포함하는 반응혼합물을 준비하는 단계;
    상기 반응혼합물을 로딩장소(6)에 넣고 상기 자기력 발생모듈(2)에서 상기 연자성미세구조물(200)에 자기력을 발생시켜 상기 반응혼합물에서 상기 표적물질-리간드자성입자 복합체(300)만을 상기 연쇄 연자성미세구조체(7) 말단에 위치한 감지장소(8)로 이송하여 상기 복합체를 분리하는 단계; 및
    상기 자기력 발생모듈(2)을 이용하여 상기 분리된 표적물질-리간드자성입자 복합체(300)를 상기 분석모듈(5)로 이송하여 상기 동정된 리간드자성입자가 표적물질의 생물학적 활성에 미치는 영향을 분석하고 상기 리간드를 검정하는 단계; 를 포함하는 것을 특징으로 하는 연자성미세구조물을 이용한 리간드의 검정 방법.
  19. 제18청구항에 있어서,
    상기 분석모듈(5)에서 상기 리간드의 검증은 상기 리간드자성입자가 상기 표적물질의 생물학적 활성에 미치는 영향을 분석하는 것으로 세포학적 분석, 생리학적 분석, 생화학적 분석, 분자생물학적 분석, 유전체 분석, 단백질체 분석 등을 포함하는 것을 특징으로 하는 연자성미세구조물을 이용한 리간드의 검정 방법.
  20. 다수의 시험 화합물로 구성된 리간드자성입자 라이브러리로부터 생화학적 시스템에 대한 연자성미세구조물을 이용한 리간드의 스크리닝 시스템(1)을 이용한 표적물질의 정성 및 정량 방법으로서,
    상기 표적물질에 결합하는 리간드자성입자를 준비하는 단계;
    상기 반응모듈(2)에서 상기 리간드자성입자와 시료를 반응시켜 표적물질-리간드자성입자 복합체(300)를 포함하는 반응혼합물을 준비하는 단계; 및
    상기 반응혼합물을 로딩장소(6)에 넣고 상기 자기력 발생모듈(2)에서 상기 연자성미세구조물(200)에 자기력을 발생시켜 상기 반응혼합물에서 상기 표적물질-리간드자성입자 복합체(300)만을 상기 연쇄 연자성미세구조체(7) 말단에 위치한 감지장소(8)로 이송하여 분석모듈(5)로 상기 표적물질-리간드자성입자 복합체(300)로부터 표적물질을 정성 및 정량하는 단계; 를 포함하는 것을 특징으로 하는 연자성미세구조물을 이용한 표적물질의 정성 및 정량 방법.
  21. 제20청구항에 있어서,
    상기 분석모듈(5)을 이용하여 상기 감지장소(8)에 있는 표적물질-리간드자성입자 복합체(300)로부터 표적물질을 정성 및 정량 분석하는 장치로 구성된 것을 특징으로 하는 연자성미세구조물을 이용한 표적물질을 정성 및 정량하는 방법.
  22. 상기 표적물질은 단일분자, 바이러스, 세포, 세균 등을 포함하는 생화학적 시스템으로 하는 것을 특징으로 하는 연자성미세구조물을 이용한 리간드의 스크리닝 시스템.
  23. 상기 리간드는 유기물질, 단백질, 펩타이드, 압타머 등을 포함하는 표적물질에 결합하는 물질로 하는 것을 특징으로 하는 연자성미세구조물을 이용한 리간드의 스크리닝 시스템.
  24. 검증된 리간드자성입자는 약제개발의 선도물질로 이용하는 것을 특징으로 하는 연자성미세구조물을 이용한 리간드의 스크리닝 시스템.
  25. 검증된 리간드자성입자는 표적물질을 정성 및 정량하는 소재로 이용하는 것을 특징으로 하는 연자성미세구조물을 이용한 리간드의 스크리닝 시스템.
PCT/KR2014/004495 2013-05-22 2014-05-20 연자성미세구조물을 이용한 리간드의 스크리닝 시스템 및 그 용도 WO2014189257A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020130057508A KR101580360B1 (ko) 2013-05-22 2013-05-22 연자성미세구조물을 이용한 리간드의 스크리닝 시스템 및 그 용도
KR10-2013-0057508 2013-05-22

Publications (1)

Publication Number Publication Date
WO2014189257A1 true WO2014189257A1 (ko) 2014-11-27

Family

ID=51933767

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2014/004495 WO2014189257A1 (ko) 2013-05-22 2014-05-20 연자성미세구조물을 이용한 리간드의 스크리닝 시스템 및 그 용도

Country Status (2)

Country Link
KR (1) KR101580360B1 (ko)
WO (1) WO2014189257A1 (ko)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10481158B2 (en) 2015-06-01 2019-11-19 California Institute Of Technology Compositions and methods for screening T cells with antigens for specific populations
CN113474645A (zh) * 2019-06-20 2021-10-01 松下知识产权经营株式会社 检测方法和检测装置
CN113474645B (zh) * 2019-06-20 2024-05-24 松下知识产权经营株式会社 检测方法和检测装置

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006066368A1 (en) * 2004-12-23 2006-06-29 Vrije Universiteit Brussel Method for screening and selecting ligands
US20060199219A1 (en) * 2002-09-04 2006-09-07 Bjorn Frendeus Method for screening anti-ligand libraries for identifying anti-ligands specific for differentially and infrequently expressed ligands
WO2007133988A1 (en) * 2006-05-09 2007-11-22 Beckman Coulter, Inc. Nonseparation assay methods
KR101067695B1 (ko) * 2010-03-25 2011-09-27 충남대학교산학협력단 연자성 미세 구조물을 이용한 분자 이송 시스템

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000049417A1 (en) * 1999-02-17 2000-08-24 Arcaris, Inc. Methods for substrate-ligand interaction screening

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060199219A1 (en) * 2002-09-04 2006-09-07 Bjorn Frendeus Method for screening anti-ligand libraries for identifying anti-ligands specific for differentially and infrequently expressed ligands
WO2006066368A1 (en) * 2004-12-23 2006-06-29 Vrije Universiteit Brussel Method for screening and selecting ligands
WO2007133988A1 (en) * 2006-05-09 2007-11-22 Beckman Coulter, Inc. Nonseparation assay methods
KR101067695B1 (ko) * 2010-03-25 2011-09-27 충남대학교산학협력단 연자성 미세 구조물을 이용한 분자 이송 시스템

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10481158B2 (en) 2015-06-01 2019-11-19 California Institute Of Technology Compositions and methods for screening T cells with antigens for specific populations
CN113474645A (zh) * 2019-06-20 2021-10-01 松下知识产权经营株式会社 检测方法和检测装置
CN113474645B (zh) * 2019-06-20 2024-05-24 松下知识产权经营株式会社 检测方法和检测装置

Also Published As

Publication number Publication date
KR20140137088A (ko) 2014-12-02
KR101580360B1 (ko) 2015-12-28

Similar Documents

Publication Publication Date Title
EP3857222B1 (en) High throughput epitope identification and t cell receptor specificity determination using loadable detection molecules
JP6802185B2 (ja) ハイスループットｂｈ３プロファイリング：少量の細胞でのｂｈ３プロファイルのための迅速かつ拡大縮小可能な技術
Phizicky et al. Protein analysis on a proteomic scale
JP6608803B2 (ja) 分泌物の多細胞アッセイにおけるマイクロ流体デバイスおよびその使用方法
US7232691B2 (en) Bioassay and biomolecular identification, sorting, and collection methods using magnetic microspheres
JP4959691B2 (ja) 繰り返し調製可能なタンパク質アレイ
EP2044219B1 (en) Detectable nucleic acid tag
US20040219066A1 (en) Apparatus used in identification, sorting and collection methods using magnetic microspheres and magnetic microsphere kits
KR20020059370A (ko) 융합 라이브러리의 제작 및 사용을 위한 방법 및 조성물
US9983203B2 (en) Method for protein analysis
US20080020453A1 (en) Analytical system based on porous material for highly parallel single cell detection
US20030049647A1 (en) Use of nucleic acid libraries to create toxicological profiles
WO2008122241A1 (en) Rapid protein analyses and the device thereof
WO1999055826A1 (en) Micro-compartmentalization device and uses thereof
Minakshi et al. Single-Cell proteomics: technology and applications
Hung et al. Microfluidic platforms for discovery and detection of molecular biomarkers
JP2009000070A (ja) 大規模並列核酸分析方法
Shao et al. Single-cell analysis for proteome and related researches
WO2014189257A1 (ko) 연자성미세구조물을 이용한 리간드의 스크리닝 시스템 및 그 용도
CN103695419B (zh) 一种病毒核酸提取试剂
Steiner et al. Cell type-specific affinity purification of nuclei for chromatin profiling in whole animals
Moshkovskii et al. Single cell proteogenomics—Immediate prospects
Gebreyesus et al. Recent advances in microfluidics for single-cell functional proteomics
Kim et al. Recent methodological advances towards single-cell proteomics
JP2002537564A (ja) 基質−リガンド相互作用スクリーニング方法

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14801682

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM 1205A DATED 07.04.2016)

122 Ep: pct application non-entry in european phase

Ref document number: 14801682

Country of ref document: EP

Kind code of ref document: A1