WO2014183639A1

WO2014183639A1 - Oxygenase gene caceo and encoded protein and use thereof

Info

Publication number: WO2014183639A1
Application number: PCT/CN2014/077431
Authority: WO
Inventors: 何健; 陈青; 李怡; 闫新; 蒋建东; 洪青; 黄星; 李顺鹏; 朱建春
Original assignee: 南京农业大学
Priority date: 2013-05-16
Filing date: 2014-05-14
Publication date: 2014-11-20
Also published as: CN103255154A; CN103255154B

Abstract

Disclosed is an oxygenase gene caceO and encoded protein and use thereof, the oxygenase gene caceO sequence being represented as SEQ ID NO.1, and the encoded product CaceO sequence being represented as SEQ ID NO.2. Also disclosed is the use of the oxygenase gene caceO in degrading and converting chloroacetamide herbicide and constructing transgenic crops, and the use of oxygenase CaceO in degrading chloroacetamide herbicide and removing residual chloroacetamide herbicide.

Description

An oxygenase gene cacei? and its encoded protein and application

Technical field

The invention belongs to the field of applied environment microorganisms and agriculture, and relates to an oxygenase gene cace^ and its encoded protein and application. Background technique

The use of herbicides reduces the intensity of agricultural labor and ensures the normal production of agriculture. At the same time, its residues also bring serious crop phytotoxicity problems. According to statistics, the area of farmland affected by herbicides in China is 30 million mu per year, of which serious phytotoxicity The area is 5 million mu, causing billions of losses every year, and herbicide-tolerant genetic modification is the best way to solve the herbicide phytotoxicity. Chloroacetamide herbicides are a class of highly effective, highly selective contact herbicides that have a very significant killing effect on grass weeds. Chloroamide herbicides are one of the most widely used herbicides in the world. By 2007, the annual production and use area is second only to organophosphorus herbicides, ranking second in the world. Its main representative species is alachlor and B. Oxalamine and butachlor, of which acetochlor is most used. As the agricultural workforce decreases and the way agriculture is cultivated, the demand and use of such herbicides will continue to increase.

Chloroacetamide herbicides are chemically stable and have a long residual period in the soil, and such herbicides and their metabolites migrate from the soil into groundwater, causing pollution of domestic water sources. Studies have shown that some varieties of this herbicide are teratogenic and mutagenic. Alachlor, acetochlor and butachlor are classified as B-2 carcinogens by the US Environmental Protection Agency, and metolachlor is classified as C. Carcinogens (USEAP, 1994), therefore, residues of chloroacetamide herbicides in the environment and agricultural products are a serious hazard to human health.

Chloroacetamide herbicides are highly toxic to fish and 500-10,000 times more toxic than mammals, so the introduction of such herbicides into water bodies can cause serious damage to fishery resources. Acetochlor and butachlor inhibited the soil microbial quantity and the growth rate of bacteria, actinomycetes and fungi in the soil, and significantly reduced soil microbial diversity.

In addition, chloroacetamide herbicides such as acetochlor and butachlor have serious phytotoxicity to crops, especially in sand-type soils with low organic matter content, or when the dosage is too large, or after continuous application. In high-humidity weather, it will seriously affect the growth of crops. In recent years, crop phytotoxicity caused by improper use of acetochlor and butachlor in China has occurred frequently, causing serious losses to agriculture.

Therefore, the residual pollution of chlorinated herbicides in soil and water environment seriously endangers human health, damages the ecological environment and has serious phytotoxicity to crops. Obtaining chlorinated acetamide herbicide-degrading strains and degradation genes have the following functions and functions in the research and development of herbicide residues and the elimination of their phytotoxicity technology. (1) Introducing degradation genes into crops through modern biotechnology to construct corresponding degradation Chloroacetamide herbicide-resistant transgenic crops, (ii) herbicide chlorinated B in soil and water Elimination of residual intermediates in amide herbicides, (iii) Biotransformation for useful chemical products and drug synthesis. Therefore, the degradation gene has very important theoretical and practical value in eliminating the herbicide phytotoxicity and biotransformation. Summary of the invention

The object of the present invention is to provide a new oxygenase gene cace which degrades various chloroacetamide herbicides such as alachlor, acetochlor and butachlor against the above-mentioned deficiencies of the prior art.

Another object of the invention is to provide a protein encoding the gene.

A further object of the invention is to provide the use of the gene and its encoded protein.

The object of the invention is achieved by the following technical solution:

An oxygenase gene caceft which degrades the chloroacetamide herbicide has the nucleotide sequence of SEQ ID NO.

The starting strain used in this patent is a bacterial strain capable of degrading chloroacetamide herbicide.

Sp. DC-2 (contained in the China-China Type Culture Collection, with the accession number CCTCCNO: M 2012190). A mutant strain DC-2 MUT of this strain was obtained by multiple passages (preservation date 2013. 4.28, accession number: CCTCCNO: M 2013164). The strain DC-2 MUT (CCTCCNO: M 2013164) lost the ability to degrade chloroacetamide herbicides such as alachlor, acetochlor and butachlor. The first step in the degradation of acetochlor by strain DC-2 is the formation of 2-chloro-N-(2-ethyl-6-methylphenyl)acetamide under the catalysis of an oxygenase.

The acquisition of the oxygenase gene for the degradation of chloroacetamide herbicides was obtained using modern bioinformatics (technical route is shown in Figure 1). That is, by comparing the genomic information of the wild-type DC-2 and the mutant DC-2 MUT, the oxygenase gene which is present in the wild-type DC-2 genome but is deleted in the mutant DC-2 MUT is sought. The total DNA of the wild-type DC-2 and the mutant DC-2 MUT was first extracted, and the total DNA was subjected to genome sequencing, assembly, and KEGG database alignment. The sequencing results showed that the wild-type DC-2 genome size was 6, 334, 837 bp, 481 scaffold; the mutant DC-2 MUT genome size was 6, 325, 634 bp, 892 scaffold.

After comparison with wild strain DC-2 (CCTCCNO: M 2012190 ) and mutant DC-2 MUT (CCTCCNO: M 2013164), a Rieske (2Fe-2S) domain-containing protein type was found in the total genome of wild strains. The oxygenase gene is lost in the mutant DC-2 MUT, the protein and

One of the oxygenases in RW1 was 43% homologous to vani l late monooxygenase. The 1.2K fragment containing the gene was amplified from the wild strain by PCR and ligated into pBBR1MCS-5 to construct a recombinant vector, which was introduced into £ coli DH5 α by transformation, and a recombinant strain was obtained: coli DH5 a -CaceO The recombinant vector containing the oxygenase gene was complemented to the mutant DC_2 MUT by triple-parent binding to obtain the recombinant strain DC-2 MUT-Cace0 (see Figure 2 for the technical scheme). Recombinant strains were tested ^: coli DH5 a -CaceO and DC-2 MUT-CaceO The degradation of alachlor, acetochlor and butachlor showed that the recombinant strains coli DH5 ct -CaceO and DC-2 MUT-CaceO obtained the oxygenase gene were degraded alachlor and acetochlor. And the ability of butachlor, indicating that the gene is indeed the target gene for the degradation of chloroacetamide herbicide, the gene was named cace. The degradation of metabolites of coli DH5 a -CaceO to acetochlor was tested. ^: coli DH5 a -CaceO hydrolyzes acetochlor to form 2-chloro-N-(2-ethyl-6-methylphenyl)acetamide (see Figure 3).

The protein Cace encoded by the oxygenase gene cac has an amino acid sequence of SEQ ID NO.

The recombinant expression vector _P BBR1MCS5-cace0 containing the oxygenase gene cac.

The genetically engineered strain E. coli DH5 a -Cace0 containing the recombinant expression vector pBBR1MCS5_cace0. The use of the oxygenase gene cace^ in the degradation and conversion of chloroacetamide herbicides. The chloroacetamide herbicide described therein is preferably one or more of alachlor, acetochlor or butachlor.

The use of the recombinant expression vector containing the oxygenase gene caceO for the degradation and conversion of chloroacetamide herbicides. The chloroacetamide herbicide described therein is preferably one or more of alachlor, acetochlor or butachlor.

The use of the oxygenase gene cace^ in the construction of transgenic crops resistant to chloroacetamide herbicides. The chloroacetamide herbicide described therein is preferably one or more of alachlor, acetochlor or butachlor.

The use of the oxygenase CaceO in the degradation of chloroacetamide herbicides. The chloroacetamide herbicide described therein is preferably one or more of alachlor, acetochlor or butachlor.

The use of the oxygenase CaceO in removing chloroacetamide herbicide residues in soil and water. The chloroacetamide herbicide described therein is preferably one or more of alachlor, acetochlor or butachlor. The beneficial effects of the present invention are as follows:

The starting strain of the present invention is a sphingolipid i Sphingobi DC-2 (CCTCCNO: M 2012190 ), and the strain DC-2 can degrade acetochlor to produce 2-ethyl-6-methylaniline; degrading alachlor and butyl grass The amine produces 2,6-diethylaniline. On this basis, the cloning of the oxygenase gene cace from the strain DC-2 to the degradation of alachlor, acetochlor and butachlor in the GenBank showed that the gene was a new gene, from the full length. The start codon to the stop codon is 1047 bp and encodes 348 amino acids. The gene is capable of degrading chloroacetamide herbicides and can be used in the construction of transgenic crops resistant to chloroacetamide herbicides. The encoded protein of the gene can be used in the degradation of chloroacetamide herbicides or in the removal of chloroacetamide herbicide residues in soils and water bodies. DRAWINGS Figure 1. Roadmap for cloning of oxygenated enzymes for degradation of chloroacetamide herbicides.

Figure 2: Oxygenase gene force energy verification technology roadmap.

Figure 3A is a liquid phase detection spectrum of acetochlor standard;

B is a liquid phase detection map of the recombinant strain E. coli DH5 a -CaceO degrading acetochlor;

Figure C is a mass spectrum of the product in Figure B.

D is a liquid phase detection map of alachlor standard

E is a liquid phase detection map of the recombinant strain E. coli DH5 a -CaceO degrading alachlor;

Figure F is a mass spectrum of the product in Figure E.

Figure G is the liquid phase detection spectrum of butachlor standard

H is a liquid phase detection map of the recombinant strain E. coli DH5 a -CaceO degrading butachlor;

Figure I is a mass spectrum of the product in Figure H. Biomaterial preservation information

Chloroacetamide herbicide-degrading bacteria DC-2, classified as

Quisquiliarum DC_2, kept at the China Center for Type Culture Collection (CCTCC), Wuhan, China, Wuhan University, with the accession number CCTCC NO: M 2012190, with a deposit date of May 30, 2012.

The mutant DC-2 MUT, named as ^wV^ sp. DC-2, is stored in the China Center for Type Culture Collection (CCTCC), Wuhan, China, Wuhan University, under the accession number CCTCC NO: M 2013164, date of preservation For April 28, 2013. detailed description

Example 1. Cloning of acetochlor degradation gene (strategic figure is shown in Figure 1)

1. 1 mutant strain DC-2 MUT acquisition

The water solubility of acetochlor at room temperature is 225 mg/kg, so the LB plate containing 400 mg/kg acetochlor produces turbidity, and the wild strain DC-2 (CCTCC NO: M 2012190) is streaked on LB plate (containing 400 mg/kg B). There is a transparent circle when cultured at 30 ° C, and the degradation of acetochlor is judged by the naked eye. However, after several passages, it was found that a colony did not produce a transparent circle around it. The colony was selected and cultured in 100 ml of LB liquid medium. After the strain was cultured to the late logarithm, it was washed twice with 6 000 centrifugation of distilled water and resuspended to 20 ml (containing 100 mg/kg acetochlor) to verify the effect of the inorganic salt. The results showed that it lost the function of degrading acetochlor, and named this strain DC-2 MUT (CCTCC NO: M 2013164). 1.2 Extraction of total DNA from bacterial genome

Strain\)C-2 Sphin _g obiums . ) (CCTCCNO: M 2012190) and DC-2 MUT (CCTCC NO: M 2013164) After high-concentration, high-purity combined with CTAB method was used to extract high-purity, large-segment DC-2. The total DNA of the genome is dissolved in TE buffer (pH 8.0) and stored at -20 °C. For details, please refer to the "Guide to the Experimental Guide to Molecular Biology" edited by F. Osb.

1.3 DNA sample delivery and testing

Bacterial genome sequencing requires a sample 0D value between 1.8 and 2.0. The higher the concentration, the better, the concentration is not less than 30 ng/μΐ, and the fine pattern requires at least 30 μg of sample. A sufficient amount of prepared DNA samples were sent to Meiji Biotech under dry ice.

Sample testing uses: 1. Concentration detection, agarose gel electrophoresis; 2. 0D260: 280 and 0D260/230 detection method: NanoDrop.

1.4 strain genome sequencing

After the DNA samples were tested, the library was built, sequenced, and the data was analyzed (including base identification, filter linker sequence, decontamination). Subsequent bioinformatics analysis, including genomic sequence assembly, gene composition analysis, gene function annotation, and comparative genomic analysis.

1.5 Sequencing fragment assembly and analysis

The SOAPdenovo assembly software was used to assemble the reads data, and the scaffold sequence was obtained and related basic data statistics were obtained.

1.6 Gene prediction and functional annotation

Genes the assembly results using the Glimmer 3.0 gene prediction software? ο ο Forecast, and compare the predicted genes to the database and perform functional annotations.

Gene annotation is based primarily on protein sequence alignments. The sequence of the gene is compared with each database to obtain corresponding functional annotation information. Since each sequence may have many alignment results, in order to ensure its biological significance, we reserve the best results for the comparison as a comment for this gene. All notes are completed using BLAST software in conjunction with the characteristics of each database. The version of BLAST is: blastall 2.2.21, the annotated protein library is: KEGG, GO, etc.

1.7 Comparison of DC-2 genome and DC-2 MUT genome

According to the genome sequencing results, the wild-type DC-2 genome size was 6,334,837 bp, 481 scaffold, 388 scaffolds larger than 1000 bp, and 6612 ORFs predicted by ώ? Ο ;; the mutant DC_2 MUT genome size was 6, 325, 634 bp, 892 scaffold, 704 scaffolds greater than lOOOObp, predicted a total of 6779 0RFs by ώ? Ο 。. The 892 scaffold of the strain DC-2 MUT was compared with the wild strain DC_2 genome by 0MIGA3.0, and it was found that 50 fragments of the wild strain DC-2 genome were found in DC-2 but not in T. The 20KB sequence may contain functional fragments that are lost during the passage. Then, the 20KB sequence was subjected to ORF prediction, protein translation, focusing on the Rieske (2Fe-2S) domain-containing protein type oxygenase, and these oxygenases were placed on the NCBI online Blast, and one of the Rieske was found. 2Fe-2S) domain-containing protein type oxygenase and Sphingomoans RW1 vanillate monooxygenase homology 43%, named this protein as CaceO, amino acid sequence 歹|J as shown in SEQ IDN0.2, the corresponding gene is caceO, nucleoside The acid sequence is shown in SEQ ID N0.1.

1.8 Design Primer Pairs with cace Fragments PCR Amplification Verification

The wild type DC-2 colony and the mutant strain DC-2 MUT colony were PCR-amplified according to the primers containing the cace fragment, and the corresponding fragment was amplified only in the wild strain DC-2.

1.9 Wild strain DC-2 PCR product sequencing

The PCR product TA in 1.7 was cloned into pMD-18 T simple vector and sent to Nanjing Jinsui Biotechnology Co., Ltd. for sequencing. The result was 100% homologous to the predicted fragment.

Example 2 Oxygenase gene caceCtC force verification technology roadmap (see Figure 2 for the strategy map)

2.1 strain DC-2 genome DNA extraction

Same as 1·1

2.2 inclusion of 1.2K nucleic acid fragments PCR amplification

Forward primer: 5- CGGGATCCCGGCCAGTTCCGCCGCCCCAAAATCCA (SEQ ID N0.3) Underlined EcoR I restriction site and reverse primer: A2: 5- CGGAATTCCGCTACCCCGCCGACACAGCGACGACC (SEQ IDN0.4) Underlined BamH I restriction site as primer, PCR Amplification of 1·2K-cace0 _o from ^ /3⁄4 ^ TM DC-2 (CCTCCNO: M 2012190) genomic DNA

Amplification system:

Prime STAR TacM (5U/ 1) 0.5 μ 1

5 X PrimeSTAR Buffer (Mg ²⁺ Plus) 25 μ 1

dNTP Mixture (2.5mM each) 5 μ 1

Template DNA 10 ng

Forward primer (20μΜ) 1μ 1

Reverse primer (20μΜ) 1μ 1

Sterilize distilled water to 50 μ 1 PCR amplification procedure:

a. 98 °C denaturation lmin;

b. Denaturation at 98 °C for 15 s, annealing at 53 °C for 15 s, extension at 72 °C for 70 s, for 30 cycles;

c. Extend at 72 ° C for 10 min and cool to room temperature.

2. 3 PCR products were digested with BamH I and ^.

Enzyme digestion system:

Nde I 1 μ 1

EcoRI 1 μ 1

DNA μ g

Sterilized distilled water added to 20 μ 1

The reaction was carried out for 10 hours or more in a 37 ° C water bath. The digested product was subjected to 0.75% agarose gel electrophoresis and recovered.

2. 4 pBBRlMCS-5 (purchased from Shanghai Beinuo Biotechnology Co., Ltd.) Double-digested with BamH I and EcoRI (Ref. 2. 3). 2. 5 conversion

2. The recovered fragment in 3 and the enzymatically ligated pBBR1MCS-5 in 2.4. The recombinant pBBR1MCS5_cace0 recombinant plasmid was transformed into E. coli DH5α (purchased from TransGen Biotech) to obtain recombinant E. coli DH5 a -CaceO, and positive clones were picked. E. coli DH5 a -CaceO complemented pBBR1MCS5-ca _C e0 to the mutant DC-2 MUT (degraded acetochlor trait loss) with the aid of the helper E. coli HB101 (pRK600) (purchased from Novegen) The binder was coated on an LB plate containing 100 mg/kg Str and 50 mg/kg Gm, and the grown single bacteria were verified by the extraction plasmid to obtain a positive clone DC-2 MUT-Cace0.

2. Verification of degradation effect of 6 genetic engineering strains and identification of products

E. coli DH5 a -CaceO and DC_2 MUT-CaceO were inoculated into 100 LB liquid containing 50 mg/kg Gm and grown to the middle of the logarithm. The cells were collected by centrifugation, and the cells were washed by centrifugation with sterilized distilled water. all over. Then, the cells were separately added to a basal salt medium containing 100 mg * L ^-1 alachlor, acetochlor and butachlor to make the basal salt medium 0D ₆ . . =2, 37 ° C, 180 r · min ¹ Shaker culture for 48 h. The basic salt medium formula is: 5. 0g * L- ¹ glucose, 1·0 g · L- ¹ Tan 0 ₃ , 1. 0 g · L- ¹ NaCl, 1. 5g · L- ¹ K ₂ HP0 ₄ , ^{0 · 5 g · L- 1 KH} 2 P0 4, 0. 02 g · L- 1 MgS0 4 · 7H 2 0, 100 mg · L- 1 vitamin B12, adjusted to pH 7.0.

The degradation effect was determined by high performance liquid chromatography. The method was as follows: Firstly, an equal volume of dichloromethane was added to the above basic salt medium for extraction, and after shaking vigorously, the layer was allowed to stand, and then 1 ml of the lower layer of dichloromethane was evaporated. After completion, it was dissolved in 1 mL of methanol (chromatographically pure) and filtered through a filter (pore size 0.22 μm). Liquid Chromatographic Conditions: Mobile phase: methanol: water (80: 20, V/V), Zorbax C218 0DS Spherex reversed phase column (5 μπι, 4. 6mm X 250mm, Agi lent, USA), column temperature For room temperature, UV detector, measuring wavelength 230 nm, injection volume 20 μL, flow rate 0.8 mL · min-1. The results are shown in Figure 3. The remaining filtrate is taken as 10 L of the components in the extract detected by GC/MS. Detection method: Column type: BD-5MS quartz capillary column (15mX0.25mmX0.25 m); Sample injection volume: 2 μL; Split ratio : 30; carrier gas: helium; carrier gas flow rate lml / min; inlet temperature is 230 ° C, column temperature is 200 ° C. Primary mass spectrometry conditions: The ion detection mode is multi-reactive ion detection; the ion polarity is negative ion; the ionization mode is electrospray ionization; the capillary voltage is 4000 volts; the drying gas temperature: 33 CTC; the drying gas flow rate: 10.0 L/min, Atomizing gas pressure: 35 psi, collision voltage: 135 volts; mass scanning range (m/z): 300-500. Secondary ion mass spectrometry conditions: Collision voltage: 90 volts; mass scan range (m/z): 30-400.

The results showed that the genetically engineered strain catalyzed the hydrolysis of acetochlor to 2 - chloro-N-(2-ethyl-6-methylphenyl)acetamide, hydrolyzing alachlor and butachlor to form 2-chloro-N- ( 2,6-Diethylphenyl)acetamide.

Claims

Claim

An oxygenase gene raceO which degrades a chloroacetamide herbicide, characterized in that the nucleotide sequence is SEQ ID NO.

The oxygenase gene caceO according to claim 1 and the encoded protein CaceO, characterized in that the amino acid sequence is SEQ ID N0.2.

3. The recombinant vector pBBR1MCS5-caceO comprising the oxygenase gene caceO of claim 1, characterized in that a nucleic acid fragment comprising the oxygenase gene caceO of claim 1 is inserted into BamH I and EcoR I of pBBR1MCS-5 Obtained between the loci.

4. A genetically engineered bacterium comprising the oxygenase gene 0 of claim 1.

The genetically engineered bacterium according to claim 4, wherein the genetically engineered bacterium is obtained by introducing the recombinant vector pBBR1MCS5-caceO according to claim 3 into Escherichia coli E. coli DH5a.

6. The use of the oxygenase gene ra O according to claim 1 for the degradation and conversion of a chloroacetamide herbicide, wherein the chloroacetamide herbicide is preferably one of alachlor, acetochlor and butachlor. Kind or more.

7. The use of the oxygenase gene ra O of claim 1 in the construction of an anti-chloroacetamide herbicide transgenic crop.

8. Use of the oxygenase CaceO of claim 2 for the degradation of a chloroacetamide herbicide.

9. The use of the oxygenase CaceO of claim 2 for the removal of chloroacetamide herbicide residues in soil and water environments.

10. Use according to claim 9, characterized in that the chloroacetamide herbicide is selected from one or more of alachlor, acetochlor and butachlor.