WO2014182197A1

WO2014182197A1 - Method of identification of native dna or rna fragments pairs present in the same living cells

Info

Publication number: WO2014182197A1
Application number: PCT/RU2014/000323
Authority: WO
Inventors: Dmitry Mikhajlovich CHUDAKOV; Maria Andreyevna TURCHANINOVA
Original assignee: Evrogen Joint Stock Company
Priority date: 2013-05-08
Filing date: 2014-05-06
Publication date: 2014-11-13
Also published as: RU2013121000A; RU2578009C2

Abstract

The invention disclose the method of identification of DNA or RNA fragments pairs that are initially present in the same living or fixed cells, in particular the method of identification of native pairs of antibody heavy and light chains genes, as well as native pairs of T-cell receptor (TCR) alpha and beta chains genes. The method is based on emulsion PCR or RT-PCR that is performed on living or fixed cells, that enables the PCR-amplification of DNA or RNA fragments pairs with subsequent physical fusion of products of PCR-amplification. All described reactions are performed within the emulsion with separated cells, where each cell is enclosed into separate emulsion droplet. The new feature of the method is innovative new type of PCR-suppression that allows selectively amplify the library of gene fragments that were fused in the emulsion after the emulsion reaction. The character of the invention is that selective PCR-suppression of unfused fragments allows predominant amplification of target fragment pairs, which were successfully fused within the emulsion droplets previously, as compared with amplification of fragment pairs capable of non target fusion after the isolation of nucleic acids mixture from the emulsion. The generated amplified fused libraries may be further analyzed using massive sequencing methods, e.g. high throughput Illumina sequencing method. Using the present method the pairs of native TCR chains genes in the human donor blood sample were found and the accuracy of identification was independently confirmed. The described approach can be effectively applied for native antibody chains pairs, native TCR chains pairs and for search of any RNA molecules that are co-expressed in the same cells, or the DNA fragments that are contained within the same cells.

Description

METHOD OF IDENTIFICATION OF NATIVE DNA OR RNA FRAGMENTS PAIRS PRESENT IN THE SAME LIVING CELLS

FIELD OF INVENTION

The present invention relates to the field of molecular biology and immunology, in particular to the method of identification of native DNA or RNA fragments pairs present in the same living cells, e.g. native antibody heavy and light chain gene fragments pairs or native T-cell receptor alpha and beta chain gene fragments pairs.

BACKGROUND OF THE INVENTION

[1] Antibodies and T-cell receptors (TCRs), the weapons of adaptive immunity capable of selective recognition of specific antigens, represent an invaluable resource for biological studies and medical applications [Leavy O., 2010, Nat Rev Immunol, 10, 297; Schumacher T.N. , 2002, Nat Rev Immunol, 2, 512-519].

[2] The antibody is composed of two pairs of polypeptide chains: heavy chains with molecular weight of about 50000 and light chains with molecular weight of about 25000, which are conjugated via disulfide bonds.

[3] T-cell receptor is also a heterodimer that is composed of a pair of different polypeptide chains - a and β (or γ and δ for γδ T cells) - with molecular weight of about 50000. The a and β chains are connected via disulfide bond.

[4] H-, L-, a- and β-chains have similar structure and belong to the immunoglobulin superfamily proteins. Each chain has constant (C) and variable (V) regions. Variable regions of H- and L-chains of antibodies or a- M β-chains of TCR perform the function of specific recognition and binding of antigens and form the active sites. Because of the symmetrical structure of immunoglobulin each antibody molecule has two antigen binding centers in V-domains of heavy and light chains of each pair. The functional unit of the antibody or TCR, i.e. the part that provides specificity and antigen binding, is thereby a pair of H- and L-chains of antibody and pair of a- and β-chains of TCR.

[5] Genes coding one polypeptide chain of the antibody or TCR are separated in 2 ore 3 segments (V/J MJIM V/D/J) located in one region of a chromosome in specific order. The genes coding H- and L-chains of antibody and pair of a- and β-chains of TCR are classified into families according the structure of each segment. It is known tens of such families. For example for Homo sapiens it is known more than 50 l families of TCR β-chain gene and more than 60 families of antibody heavy chain genes.

[6] During the lymphocyte maturation the fragments recombine to form a single gene in a random way. For different antibody or TCR chains the number of combination variants reaches thousands or tens of thousands. During the fragments assembly the shortening and extending of joining segments ends takes place in relatively stochastic way. The variation further increases when combination of variable regions in chain pairs take place. Because of fragment based V-gene assembly and formation of active sites by different chains there total number of more than 10¹⁵ variants of unique antibody and TCR molecule fragments can be generated, that can further give a repertoire of antibodies and TCRs. (Arstila, T.P. et al. Science 2000, 288, 1135).

[7] Analysis of the native TCR and antibody repertoires is also of fundamental importance for our understanding of adaptive immunity in health and disease (Miles J.J., et al., 2011 , Immunol Cell Biol, 89, 375-387).

[8] Because of this, methods for efficient identification of their functional units - native pairs of heavy/light antibody or alpha/beta TCR chains - have been highly desired for decades.

[9] A series of different approaches have been developed to this end. One of such approaches includes obtaining of hybrid cells (Schwaber J., et al., 1973, Nature, 244, 444-447): antibody secreting cell line is generated by fusion of a lymphoid cell of immunized animal capable of producing antibodies with plasmacytoma cell of the same differentiation stage. The resulting hybrid cell obtains the ability of antibody production of one parental cell and the ability of unlimited growth in vitro of other parental plasmacytoma cell. The selected for their specificity hybrid cell can be used for native heavy and light antibody chain pairs identification or for production of monoclonal antibodies.

[10] The other approach is the single cell PCR (Lagerkvist A.C., et al. 1995

Biotechniques, 18, 862-869; Babcook J.S., 1996, Proc Natl Acad Sci USA, 93, 7843-

7848; Meijer P.J., et al., 2006, J Mol Biol, 358, 764-772). The method is based on cloning of immunoglobulin variable regions DNA or cDNA segments derived from one lymphocyte, e.g. from sorted specific antibody producing cells of rabbit or mice.

[11] The frequency-based pairing of molecules was described (Reddy ST., et al.,

2010, Nat Biotechnol, 28, 965-969). This method also includes immunization with subsequent isolation of cells, producing specific antibodies and obtaining of variable immunoglobulin chain segments cDNA. Further the high-throughput sequencing methods and bioinformatical approaches are used for antibody chains variable regions determination. The a- and β-chain pair determination in this method is based on simple analysis of relative frequency of most represented molecules, that is applicable for some most represented pairs in the sample only.

[12] The native antibody or TCR chain pairs can also be identified by lymphocyte clones cultivation (Lagerkvist A.C., et al., 1995, Biotechniques, 18, 862-869) or sorting of antigen-specific T-cell populations (Trautmann L, et al., 2005, J Immunol, 175, 6123-6132) or B-cell populations (Franz B., et al., 2011 , Blood, 118, 348-357).

[13] While these approaches are feasible to identify native heavy and light antibody chain pairs or alpha and beta TCR chain pairs, they can only be performed serially for a limited number of clones and for one or few pairs at one laborious experiment.

[14] High precision and high-throughput identification of antibody or TCR chain pairs for complex lymphocyte mixture was an unrealizable demand for a long time.

[15] Display technologies are one of such high-throughput approaches. Phage display (Smith, G.P., 1985, Science, 228,1315-1317) employs insertion of fusion protein gene in the phage genome, wherein the fusion protein gene is a fusion of heavy and light antibody chains fragments with phage particle surface protein. Heavy and light antibody chains fragments are exposed on phage particle surface. The phage particle screening is based on antibody and antigen binding affinity. Typically, the M13 phage is used and antibody fragments are expressed as fusion proteins with pill, pIV and pVMI phage coat proteins (Benhar, I., Pastan, I., 1994, Protein Eng., 7, 1509-1515). The selected phage particles are then used for phage cDNA isolation with subsequent antibody fragment nucleotide sequence determination. The full- length recombinant antibodies are then generated based on this sequence (Luginbuhl, B.,et al., 2006, J. Mol. Biol., 363, 75-97; Krebber, A., et al., 1997, J. Immunol. Methods, 201 , 35-55; Maynard, J., Georgiou, G., 2000, Annu. Rev. Biomed. Eng. 2,339-376.9; Winter, G. et al., 1994, Annu. Rev. Immunol., 12, 433- 455). One of display approaches in eukaryotes is the yeast display. Fusion proteins of antibody or the fragments thereof and Aga2p agglutinin subunit, that is covalently attached with Aga1 agglutinin anchored in yeast cell wall via two disulphide bonds, are generated for exposing recombinant protein fragments on yeast cell surface

(Boder, E.T. et al., 2000, Proc. Natl. Acad.Sci., 97, 10701-10705; Boder, E.T., Wittrup, K.D. 1998, Biotechnol. Prog., 14, 55-62; Boder, E.T., Wittrup, K.D. 1997, Nat. Biotechnol., 15, 553-557; Siegel R.W. 2009, Methods Mol.Biol., 504, 351-383).

[16] Phage and yeast display technologies are effective for antigen specific antibody isolation Hoogenboom H.R. et al., 1991 , Nucleic Acids Res, 19, 4133-4137; Marks J.D. et al., 1991 , J Mol Biol, 222, 581-597; Bowley D.R. et al., 2009, Proc Natl Acad Sci U S A, 106, 1380-1385), but this technologies rely on random pairing and do not provide information on the native pairs of chains.

[17] The other potential high-throughput approach is based on heavy and light antibody chain gene fragments amplification and assembly in fixed cells (Embleton M.J., 1992, Nucleic Acids Res, 20, 3831-3837; Chapal N., 1997, Biotechniques, 23, 518-524). In this approach the cells are fixed and than the RT-PCR with the primer set and subsequent fragment assembly via ligation or overlap-extension is performed within the fixed cells. But this approach appeared to be not suitable for analyses. The approach is not feasible to detect native antibody or TCR chain pairs, possibly due to low reaction efficiency in fixed cells and high background of assembled chain gene fragments from different cells.

[18] The new technology of native antibody chains pairs identification was published recently (DeKosky B.J. et al., Nature Biotechnology, 2013). In this approach the lymphocytes are initially placed in multiwell plate, containing microbeads bearing poly-T oligonucleotides. Then the cells are lysed and the mRNA from the cells including heavy and light immunoglobulin chains coding mRNA hybridizes with the beads. Then the beads are pulled from the plate and place in the water-in-oil emulsion, where the reverse transcription, PCR and overlap extension assembly of fragments occur (Ho S.N., et al., 1989, Gene, 77, 51-59). The reaction yields a complex mixture of PCR products, where emulsion RT-PCR assembled A-B molecules as well as non assembled single molecules A and B, amplified from genetic material of different cells, are present.

[19] The applicants showed that further PCR amplification that is necessary for preparation of the sample for sequencing according to this technology lead to nonspecific pairing of A and B single molecules from different cells and the initial information about native chain pairs is abolished.

[20] To this end the identification of native chains pairs of antibody or TCR in the complex mixture of lymphocytes with high precision and high throughtput remains the unresolved task. Such technologies are of greate demand for the diagnosis and treatment of deseases and for fundamental research also. The present invention provides an original method for suppression of non-specific pairing of single molecules A and B from different cells using new method of PCR suppression.

[21] There are several methods to supress non-specific PCR were developed. The method of selective PCR supression is based on the fact that PCR of DNA molecules flanked by inverted terminal repeats is suppressed when primers used in PCR are shorter then inverted terminal repeats (Diatchenko et al., 1996, Proc Natl Acad Sci USA 93:6025-6030; Siebert et al., 1995, Nucleic Acids Res 23:1087-1088). Selective PCR suppression allows DNA target amplification with only one sequence- specific primer per target and a second primer that is common for all targets.

[22] Another approach is headloop suppression of PCR (Rand et al., Nucleic Acids Res. 2005 Aug 9;33(14):e127). It allows distinguishing related sequences in which additional selectivity is dependent on sequences within the amplicon. A 5' extension is included in one (or both) primer(s) that corresponds to sequences within one of the related amplicons. After copying and incorporation into the PCR product this sequence is then able to loop back, anneal to the internal sequences and prime to form a hairpin structure-this structure is then refractory to further amplification. Thus, amplification of sequences containing a perfect match to the 5' extension is suppressed while amplification of sequences containing mismatches or lacking the sequence is unaffected.

[23] Also a wide range of blocking oligonucleotides used to inhibit undesired PCR. This is a DNA oligo that is modified so that it does not serve as an initiation point for polymerisation of a complementary strand by Taq polymerase or similar enzymes. A number of modifications are suggested to inactivate oligos, including 3'-phosphate group (Carlson et al., 2003, Genetics 165, 243-56), and chemically reversed 3'- terminal nucleotide (3' to 5')/lnverted end (Corless et al., 2006, Journal of Molecular Diagnostics 8, 604-12) etc. Such oligonucleotides can contain modified bases that increase melting temperature of temlate-oligo duplex and stop DNA elongation by polymerase (Peano et al., 2005, Analytical Biochemistry 344, 174-82; Karkare et al., 2006, Applied Microbiology and Biotechnology 71 , 575-86; Tatsumi et al., 2008, Journal of Molecular Diagnostics 10, 520-6; Orum H., 2000, Current Issues in Molecular Biology, 1 , 27-30; Troedsson et al., 2008, Applied and Environmental Microbiology 74, 4346-53; Dominguez et al., 2005, Oncogene 24, 6830-4). [24] Applicants suggest novel type of PCR supression with blocking oligonucleotides that play a role of template for extension of new 3'-end of undesired DNA primer, where the new 3'-end sequence is not complementary with expected templates and excludes further participation of said undesired DNA in the amplification as a primer.

SUMMARY OF THE INVENTION

[25] The present invention relates to the method of identification of native nucleic acid (DNA or RNA) fragments pairs present in the same cells.

[26] The method comprises:

(1) amplification and physical fusion of target fragments A and B in the emulsion;

(2) post-emulsion PCR amplification of fused target fragments in the presense of oligonucleotides, blocking fusion and amplification of fragments that were not fused in the same emulsion droplet on stage (1)

[27] The stage (1) of the method consists of the following steps: (a) generating of "water-in-oil" emulsion, wherein the cells are enclosed into water phase droplets; (b) amplification of target fragments A and B in emulsion; (c) physical fusion of target amplified fragments A with target amplified fragments B enclosed into the same droplet. In preferred embodiment the steps (b) and (c) occurs simultaneously during amplification in the emulsion.

[28] The stage (2) of the method consists of the following steps: (d) isolation of nucleic acid fraction, containing fused fragments, from the emulsion; (e) amplification of target fused fragments in the presence of oligonucleotides blocking the fusion of fragments that were not fused in the same emulsion droplet during the step (c).

[29] In preferred embodiments the method of invention also includes the stage (3) of sequencing of obtained PCR-amplicons.

[30] In one embodiment the method relates to identification of different DNA fragments (fragments A and B), that are present in the same cell. For example the method of invention relates to identification of DNA molecules fragments, coding the alpha-chain (fragment A) and the beta-chain (fragment B) of T-cell receptor, that are present in genome of the same cell and are the functional unit of the T-cell receptor. The method of invention also relates to identification of DNA molecules fragments, coding the heavy chain (fragment A) and the light chain (fragment B) of the antibody, that are present in genome of the same cell and are the functional unit of the antibody.

[31] In other embodiment the method relates to identification of two different RNA molecules fragments (fragments A and B), that are synthesized in the same cell. For example the method of invention relates to identification of mRNA molecules fragments, coding the alpha-chain (fragment A) and the beta-chain (fragment B) of T- cell receptor, that are co-expressed in the same cell and are the functional unit of the T-cell receptor. The method of invention also relates to identification of mRNA molecules fragments, coding the heavy chain (fragment A) and the light chain (fragment B) of the antibody, that are co-expressed in the same cell and are the functional unit of the antibody.

[32] The method of present invention allows massive identification of A and B fragments pairs in live or fixed cells populations.

[33] In certain embodiments stage (b) of the method according the present invention (amplification of target Fragments A and B in the emulsion) is performed by emulsion PCR, where the template is target DNA fragments.

[34] In other embodiments stage (b) of the method according the present invention is performed by emulsion reverse transcription with PCR (RT-PCR), where the template is target RNA fragments.

[35] In certain embodiments stage (c) of the method according the present invention (physical fusion of target amplified fragments A with target amplified fragments B enclosed into the same droplet) is performed by overlap extension technology. In other embodiments this stage is performed by ligation, amplification on beads or recombination.

[36] In preferred embodiments stage (e) of the method according to the present invention is performed by one or more consequent PCR reactions. The present invention differs from the background art in that the original method of selective suppression of amplification of unfused target amplified fragments A and unfused target amplified fragments B that were obtained on step (a) and present in nucleic acids mixture is used. The suppression of non specific amplification of unfused fragments A and B is essential and fundamental part of this step.

[37] The selective suppression of unfused target fragments amplification is performed by adding the blocking oligonucleotides to the reaction mixture. The blocking oligonucleotide comprises: [38] (a') 3'-end sequence that is complementary to the 3'-end sequence of DNA fragment, where the amplification of said DNA fragment is to be suppressed;

[39] (b') 5'-end sequence that is the template for extension of new 3'-end of said

DNA fragment, where the new 3'-end sequence is not complementary with expected templates and excludes further participation of said fragment in the amplification as a primer.

[40] The invented type of PCR-suppression allows selectively amplify the library of gene fragments that were fused in emulsion after the reaction in emulsion. The essence of invention is selective suppression of PCR amplification of unfused fragments, that allows preferentially amplify target fragment pairs that were fused previously inside the emulsion droplets compared with amplification of fragment pairs capable of non target pairing after isolation of nucleic acids mixture from the emulsion.

[41] The present invention further relates to the method of PCR suppression using blocking oligonucleotide that comprises:

[42] (a') 3'-end sequence that is complementary to the 3'-end sequence of DNA fragment or oligonucleotide, where the use of this DNA fragment or oligonucleotide as a primer should be inhibited;

[43] (b') 5'-end sequence that is the template for extension of new 3'-end of said DNA fragment or oligonucleotide, where the new 3'-end sequence is not complementary with expected templates and excludes further participation of said fragment in the amplification as a primer.

[44] The method comprises PCR amplification of PCR reaction mixture which comprises undesired primer to be inactivated in the presence of blocking oligonucleotide.

BRIEF DESCRIPTION OF THE DRAWINGS

[45] Fig.1 describes the scheme of fused TCR alpha and beta-chains production. Emulsified leucocytes are lysed by brief heating to 65°C, the released TCR alpha and beta-chains mRNA are reverse transcribed at 50°C with specific primers, and the amplification reaction with subsequent fusion of fragments by overlap extension is performed within each emulsion droplet. The reaction products are isolated from the emulsion and fused molecules of interest are selectively amplified while the amplification of unfused molecules is blocked.

[46] Fig.2 describes the scheme of fused TCR alpha and beta-chains production within the emulsion droplet. The released TCR alpha and beta-chains mRNA are reverse transcribed at 50°C with specific primers and then amplification reaction with subsequent fusion of fragments by overlap extension is performed within each emulsion droplet.

[47] Fig.3 describes the scheme of PCR-suppression. The fused molecules of interest are selectively amplified while the amplification of unfused molecules is blocked

[48] Fig.4 describes the post-emulsion amplification reaction of fused TCR molecules, produced in one emulsion containing all primers (αβ), or combined after production in two separate emulsions, one of which contains primers for TCR alpha- chains amplification, and the other contains primers for TCR beta-chains amplification (α+β after RT-PCR, i.e. control of stochastic overlap extension reactions after isolation from emulsion), or produced in two separate emulsions, one of which contains primers for TCR alpha-chains amplification, and the other contains primers for TCR beta-chains amplification, that were combined after reverse transcription (α+β after RT, i.e. control of stochastic overlap extension reactions as the result of emulsion droplets fusion). All the reactions were performed with and without PCR- suppression.

[49] Fig.5 shows the experiments of blocking oligonucleotides concentration titration in emulsion reactions with living cells. The results of second post-emulsion amplification of fused alpha and beta TCR chains are shown. The previous first post- emulsion amplification was conducted in presence of 0, 0.2, 0.4, 0.8, 1.6, 3.2, 6.4 or 12.8 μΜ of each blocking oligonucleotide, where said amplification in one case was conducted (a) starting from the product of complete emulsion reaction with primers for amplification and overlap extension reactions of both alpha and beta TCR chains; and in other case (b) starting from the product mixture obtained after combining two separate emulsions each containing primers for amplification and overlap extension reactions of either alpha- either beta TCR chains.

[50] Fig.6 illustrates the formation of 400 theoretically most probable pairs of 20

CDR3 alpha chains and 20 CDR3 beta chains, which were predominantly present in control reaction. The percent of each detected pair among all identified pairs in emulsion (a) and control non emulsion reaction (b) is shown. The frequency- expected random pairing was subtracted. The circular plots of TCR alpha and beta chains fusion are generated using Circos (Krzywinski M., et al., 2009, Genome Res., 19, 1639-1645). Segment sizes indicate rank of chain variant abundance in control, ribbon widths are scaled to the number of reads for a pair in a referred emulsion. The identified native pairs are indicated by numbers P1-P6 (see Example 1 , Table 3).

[51] Fig.7 shows the results of fluorescence-activated cell sorting (FACS) of CD8+ HLA-A*02-CMV (NLV peptide)-specific T-cells. The CD8+ population is shown. More than 100 000 T-cells of population of interest (R1 region) were sorted from 20 million of peripheral blood mononuclear cells. R1 region contains 3.8 % of CD8+ T-cells and 1.7% of all cells. The purity of sorted population was 97%.

DETAILED DESCRIPTION OF THE INVENTION

[52] The present invention relates to the method of identification of two different nucleic acid fragments present in the same living cells and novel PCR suppression method.

[53] The schematic representation of the method is shown on Fig. 1-3.

[54] The method of identification of two different nucleic acid fragments comprises:

[55] Stage (1): amplification and physical fusion of target fragments A and B in the emulsion;

[56] Stage (2): non emulsion PCR amplification of fused target fragments in the presense of oligonucleotides, blocking the fusion and amplification of fragments that were not fused in the same emulsion droplet on stage (1)

[57] In preferred embodiments the method of invention also includes the stage (3) of sequencing of obtained PCR-amplicons.

[58] In one embodiment the method relates to identification of different DNA fragments (fragments A and B), that are present in the same cell. In other embodiment the method relates to identification of two different RNA molecules fragments (fragments A and B), that are synthesized in the same cell. For example the method of invention relates to identification of DNA or mRNA molecules fragments, coding the alpha-chain (fragment A) and the beta-chain (fragment B) of T- cell receptor, that are present in the same cell and are the functional unit of the T-cell receptor. The method of invention also relates to identification of mRNA molecules fragments, coding the heavy chain (fragment A) and the light chain (fragment B) of the antibody, that are present in the same cell and are the functional unit of the antibody.

[59] The method of present invention allows massive identification of A and B fragments pairs in live or fixed cells populations. In particular the method of present invention allows identification of native T-cell receptor alpha and beta chains pairs and antibody heavy and light chains pairs that are the functional units thereof in blood samples.

[60] The method is of great advantage for adaptive immunity investigations and engineering of functional monoclonal antibodies and TCR for clinical and scientific applications.

[61] As used herein the term "native pair" means the pair of T-cell receptor alpha and beta chains or the pair of antibody heavy and light chains, that are expressed in the same lymphocyte of the living organism and are the functional unit of the T-cell receptor or the antibody respectively.

[62] As used herein the term "functional unit" means the pair of T-cell receptor alpha and beta chains or the pair of antibody H- and L-chains, that determines the specificity and provides the binding of antigen by antibody or TCR respectively.

[63] Stage (1): amplification and physical fusion of target fragments A and B in the emulsion

A) Generation of cell emulsion

[64] The key requirement for successful realisation of the method of invention is generation of representative DNA or cDNA library of A and B fragments that are fused during the emulsion reaction, where the library is generated from cells that are individually isolated in separate droplet of minimal volume sufficient to perform the PCR reaction (Fig.1)

[65] The emulsion is characterized by some important features that make it possible to use it in present invention: it is stable (including when the temperature changes during PCR), it is inert to cells enclosed into the droplets, and it is capable to form droplets of effective volume. The term "effective volume" means the volume of a droplet that is sufficient to enclose the cell and the volume of the reaction mixture that is at least comparamble with the volume of the cell. In preferred embodiment the effective volume is sufficient to enclose the cell and the volume of the reaction mixture that is at least 2 fold greater than the cell volume, preferably at least 5 fold greater, e.g. 10 fold greater and typically 20 fold greater.

[66] There are various technical solutions for generation of "water in oil" cell emulsion that meats the said requirements and suitable for further PCR (RT-PCR).

[67] The preferred embodiment of cell emulsion is the "water in oil" emulsion, where the cells and all the reagents for PCR (RT-PCR) are enclosed into the water droplets. The critical component of this composition is surfactant (emulsifier) that is essential for stabilisation of water droplets is the oil phase.

[68] One approach is "agarose in oil" emulsion preparation. In this case all the compounds of the water phase (the cells and all the components for PCR or RT- PCR) are enclosed into the low-melting point agarose droplets that is in liquid state at temperatures above 16°C, thereby providing effective reaction in the emulsion (Zhang H et al, Anal Chem. 2012 Apr 17;84(8):3599-606; Leng X, Yang CJ., Methods Mol Biol. 2013;949:413-22; Zhi Zhu et al., Lab Chip, 2012, 12, 3907-3913).

[69] In some embodiments of present invention the oil dispersion medium for the emulsion is fluorocarbon oil. The preferred emulsifiers for stabilization of water droplets in fluorocarbon oil are perfluoropolyether (PFPE) based surfactants:

[70]

rytox (DuPont) (C. Holtze, A. C. Rowat, J. J. Agresti, J. B. Hutchison, F. E. Angile, C. H. J. Schmitz, S. Koster, H. Duan, K. J. Humphry, R. A. Scanga, J. S. Johnson, D. Pisignano, D. A. Weitz, Lab Chip 2008, 8, 1632 -1639.), polyethylene glycol -PFPE (J. Clausell-Tormos, D. Lieber, J. C. Baret, A. El-Harrak, O. J.Miller, L. Frenz, J. Blouwolff, K. J. Humphry, S. Koster, H. Duan, C. Holtze, D. A. Weitz, A. D. Griffiths, C. A. Merten, Chem. Biol. 2008, 15, 427 - 437.), hexaethylene glycol -PFPE (D. J. Holt, R. J. Payne, W. Y. Chow, C. Abell, J. Colloid Interface Sci. 2010, 350, 205 - 211).

[71] In other embodiments of present invention the oil dispersion medium for the emulsion is hydrocarbon (mineral) oil. The following emulsifiers systems for stabilization of water droplets in hydrocarbon oil are known:

-4.5% Span-80, 0.4% Tween 80, 0.05% Triton X-100 (Williams et al., Nat

Methods, vol.3 no.7, 545-550)

73% Tegosoft DEC, 7% ABIL WE (Schutze et al., Anal. Biochem.2 [ March 1; 410 (1):155-7)

-3% ABIL-EM90 (Schaerli Y et al, 2009 Anal Chem 81 :302-306); -2% ABIL-EM90, 0.05% Triton X-100 (Hatch AC et al., 2011 , Lab Chip 11 :3838-3845)

[72] In some embodiments of present invention (DNA amplification) the water component of the emulsion is the PCR reaction mixture, where the cells are added.

[73] In other embodiments of present invention (RNA amplification) the water component of the emulsion is the RT-PCR reaction mixture, where the cells are added.

[74] The composition of reaction mixtures and the enzymes for PCR and RT-PCR are well known in the art are commercially available as kits of reagents. The differences of reaction mixtures according the present invention are disclosed in section "B) Emulsion PCR or RT-PCR" below. The examples of particular mixtures are set in section "Examples".

[75] In some embodiments of present invention the living cells immediately after the isolation from biological sample can be used for preparation of cell emulsion. For example for the method of identification of native pairs of T-cell receptor alpha and beta chains or the antibody heavy and light chains the peripheral blood mononuclear cells (PBMC), isolated by centrifugation of whole blood in ficoll-urografin, can be used.

[76] In other embodiments of present invention the frozen cells can be used for preparation of cell emulsion. In preferred embodiment the serum and DMSO supplemented medium is used for cell freezing. Before the preparation of emulsion the cells are thawed out and washed from cryoconservation medium. The corresponding protocols are well known in the art and described, e.g. (Kreher et al. (2003) Journal of Immunological Methods 278:79-93, Reimann, et al. (2000) Clin. Diagn. Lab. Immunol. 7:352-359, and Romeu et al. (1992) J. Immunol. Methods 154:7-10.). In other embodiments of present invention the fixed cells can be used for preparation of cell emulsion. The preferred cell fixation technique is formaldehyde fixation. Before the preparation of emulsion the cells have to be washed from fixation reagent.

[77] The number of cells added in reaction is an important parameter that influences the quality of emulsion. When the number cells that are added to the reaction mixture is to small, it is enable to get a detectable amount of target fused fragments A-B. When the excess of cells is added to the reaction mixture the probability of inclusion of more than one cell into the droplet is increased. Nevertheless the concentration of cells in different embodiments of invention can vary in broad interval of between 100 to 100 million of cells in 100 μΙ of water phase of the emulsion. In the preferred embodiment the concentration of cells is between 10000 to 1 million of cells in 100 μΙ of water phase of the emulsion.

[78] The emulsion is prepared by mixing the oil component and water component e.g. in 9:1 ratio. The mixing is conducted e.g. at 25°C. The emulsion preparation techniques are known in the art. In some embodiments of the method of invention the microfluidic arrays are used for mixing of oil (oil and emulcifier mixture) and water (mixture of PCR/RT-PCR reagents and cells) components of emulsion. Microfluidic arrays is a set of micro-channels etched or molded into a solid support made of glass, silicon or polymers (Eric Brouzes et al., 2009, PNAS, vol. 106, no. 34, 14195- 14200; Zeng et al., Anal. Chem. 2010, 82, 3183-3190; Zhang et al., Anal. Chem. 2012, 84, 3599-3606). In other embodiments of method of present invention the mechanical mixing of emulsion components is used, e.g. with magnetic stirrer (Williams et al., Nat Methods, vol.3 no.7, 545-550; Dekosky BJ et al., Nat Biotechnol. 2013 Jan 20;31(2):166-9; Shao et al., PLoS One. 2011 ;6(9):e24910).

[79] After the mixing of oil and water components the prepared emulsion is separated into the PCR tubes where the number of tubes depends on the reaction mixture volume.

[80] B) Emulsion PCR or RT-PCR

[81] In some embodiments of the method of present invention the stage of target A and B fragments amplification is performed in cell emulsion via emulsion PCR where the template is target DNA fragments. In other embodiments of the method of present invention the stage of target A and B fragments amplification is performed in cell emulsion via emulsion reverse transcription - PCR (RT-PCR) where the template is target RNA fragments.

[82] Various technical solutions for isolation of nucleic acids (DNA/RNA) from cells that are individually enclosed in emulsion droplets can be used. In some embodiments of the method of present invention the laser photolysis technology can be used (M. He, J. S. Edgar, G. D. M. Jeffries, R. M. Lorenz, J. P. Shelby, D. T. Chiu, Anal. Chem. 2005, 77, 1539 - 1544). In other embodiments of the method of present invention the temperature lysis technology can be used. The authors of present invention showed that the heating of the emulsion containing living peripheral blood mononuclear cells to 65°C and incubation at this temperature for more than 30 seconds, e.g. for 2 minutes lead to cell destruction inside the emulsion droplets and release of nucleic acids (DNA/RNA) to the reaction mixture.

[83] In the embodiment of present invention where the template for target fragments synthesis is RNA, the stage (b) of the method begins with the reverse transcription process. Reverse transcription is the synthesis of single-stranded cDNA on the RNA template and provides the transition from unstable RNA molecules to more stable cDNA molecules.

[84] In this case in the preferred embodiment of invention the RNAse inhibitor is present in the reaction mixture on stage (b) of the method of invention, e.g. the RNAsin inhibitor of placental or recombinant origin or vanadyl-riboside complex - the non-specific RNAse inhibitor of broad spectrum action.

[85] The synthesis of first strand cDNA on RNA template is performed by RNA- dependent DNA polymerase enzyme (reverse transcriptase). For reverse transcription reaction various commercially available termostable reverse transcriptase preparations, that retains their activity after incubation of reaction mixture at 65°C for 2 minutes, may be used, e.g. MMLV (Evrogen) or Superscript III (Invitrogen) reverse transcriptase.

[86] Target A and B fragments amplification on DNA or cDNA template is performed by DNA-dependent DNA polymerase enzyme. For amplification reaction various commercially available termostable DNA-polymerase preparations may be used, e.g. Encyclo polymerase (Evrogen). For cDNA amplification the key feature of DNA polymerase to be used is ability to work in the same buffer with the reverse transcriptase, as the reaction is performed in emulsion and the buffer replacement is impossible.

[87] For the target A and B fragments amplification on DNA or cDNA template at least two pairs of specific primers (forward and reverse) for amplification of fragment "A" ("a" primers) and amplification of fragment "B" ("b" primers) should be present in reaction mixture on the stage (b) of the method.

[88] Primers are synthetic oligonucleotides that are complementary to DNA sequences on the left and right borders of the fragment to be amplified and arranged in the way that extension of the new DNA chains occurs between them. PCR results in multiple increase of target specific DNA or cDNA fragment copy number (amplification). [89] One primer of the pair is defined as "forward" primer and the other primer is defined as "reverse". For the purpose herein the term "forward" primer means the primer that repeats the sequence of DNA coding chain sequence, and the term "reverse" primer means the primer that is complementary to the coding chain. As used herein the "DNA coding chain" means the chain that is identical to mRNA, and the complementary chain is used as a template for transcription.

[90] In the embodiment of present invention where the template for target fragments synthesis is RNA, two reverse primers are also used to start the synthesis of the first strand cDNA on RNA template. Two forward primers are used for PCR- amplification of target fragments A and B.

[91] The optimal concentrations of primers in reaction mixture varies in the range of 0.1 - 1 μΜ, typically, in the range 0.2 - 0.5 μΜ.

[92] In the embodiment of present invention where the identification of several nucleic acid fragments pairs that are present in the same living cells is conducted, the mixture of forward and reverse primers that are specific to the pairs of specific target fragments is used on the stage (b) of the method.

[93] Besides the nucleic acids (DNA/RNA) that are the template for target fragments A and B synthesis, the enzymes that catalyze this synthesis (reverse transcriptase, DNA polymerase) and primers the reaction mixture contains the following components:

[94] The mixture of four types of deoxyribonucleotide triphosphates (dATP, dTTP, dGTP, dCTP). The concentration of dNTP can vary 0.2 mM to 0.6 mM for each dNTP, and all four dNTPs should be used in equivalent concentrations to minimize the mistakes of synthesis. In the preferred embodiment of invention the concentration of 0.6 mM of dNTP is used;

[95] The reaction buffer solution, where the required enzymes retain their functionality. The composition of the buffer solution depends on the enzymes that are used for PCR or RT-PCR.

[96] As used herein the term "functional" means that the enzyme is able to function for indicated test or goal. For example the term "functional" with respect to DNA polymerase means that it is able to catalyze the synthesis on appropriate DNA or RNA template. [97] The target A and B fragments amplification reaction is conducted with specific equipment, namely the amplifier, according to the temperature regimen, shown in Table 1 below.

Table 1. The temperature regimen for emulsion PCR or RT-PCR

[98] The reverse transcription stage is present in amplification program only in embodiments where the template for target A and B fragments synthesis is RNA.

[99] The Tm annealing temperature depends on primer structure and generally varies between 50 °C to 72°C.

[100] For amplification of target A and B fragments in emulsion are typically requiered not less than 15 cycles, but in some applications of the present invention the less number of cycles may be used.

[101] For amplification of target A and B fragments in emulsion it is not recommended to perform more than 30 cycles because multiple heating and cooling of the emulsion reduce its stability.

[102] The optimal conditions of amplification (temperature, duration of incubation and the number of PCR cycles) may vary depending on e.g. the amplifier, the volume of reaction mixture, the primer structure.

[103] C) Physical fusion of target amplified fragments A with target amplified fragments B, that are present in the same droplet.

[104] The method of identification described herein is conducted by physical fusion of DNA or RNA fragments, amplified on stage (b). In the preferred embodiment of the method the fusion is performed via overlap extension technology (Ho S.N., et al., 1989, Gene, 77, 51-59) within each emulsion droplet.

[105] In this embodiment the fusion of products of DNA or RNA amplification, that are present in the same emulsion droplet only, is performed.

[106] In this embodiment of the fusion the process of target DNA or RNA amplification and the process of overlap extension of amplified DNA or RNA fragments are performed simultaneously and in the same volume.

[107] In this embodiment the same primers are used for the fusion by overlap extension of amplified target fragments and for the amplification of target DNA or RNA fragments.

[108] For the overlap the additional so called "overlaping tails" sequences are introduced in the primer sequences, as shown on Fig.2.

[109] In one embodiment of the method of invention the "overlaping tails" for overlap extension reaction are introduced in forward primers, that are specific for "A" and "B" fragments. 5'-end regions of two forward primers designed for fusion of target fragments A and B are complementary sequences. In this case two reverse primers (one of them is specific for "A" fragment and the other - for "B" fragment) are used for A and B fragments PCR-amplification and subsequent PCR-amplification of fused chains A-B. When starting with cDNA the same two reverse primers can serve to start the cDNA synthesis.

[110] In other embodiment of the method of invention the "overlaping tails" are introduced in reverse primers. The reverse primers also may be used for amplification of the fragments. The reverse primers also may be used to start the cDNA synthesis. In this embodiment of the method of invention two forward primers (one of them is specific for "A" fragment and the other - for "B" fragment) are used only for A and B fragments PCR-amplification and subsequent PCR-amplification of fused chains A-B.

[111] In the third embodiment of the method of invention the "overlaping tails" are introduced in forward primer "a" and reverse primer "b". In this case forward primer "b" and reverse primer "a" are used for A and B fragments PCR-amplification and subsequent PCR-amplification of fused chains A-B.

[112] In the fourth embodiment of the method of invention the "overlaping tails" are introduced into adapter, that is used as a template by reverse transcriptase after cDNA synthesis in template switching cDNA synthesis approach (Template switching cDNA synthesis approach, Matz, M., et al., Nucleic Acids Res. 1999. 27:1558- 1560.).

[113] The length of the sequence for overlap extension can vary between 8 to 75 nucleotides, but preferably is 15-28 nucleotides. The use of longer 5'-end sequences for overlap may increase the efficiency of target fragments fusion but decrease the efficiency of binding of 3'-end region of primer with target fragments. The use of too short 5'-end sequences for overlap may result in preferential amplification of target fragments and less efficient fusion. The design of sequense for overlap should consider the ability of Taq-polymerase to add adenosine (dATP) to the 3'-end of newly synthesized DNA molecule in non-template dependent manner. Additionally the common rules for PCR primers design should be taken into account: the primers shouldn't form hairpins, dimers and include sites for non-specific annealing.

[1 4] In the preferred embodiment of present invention the concentration of primers with the region for overlap extension should be lower than concentration of primers used for PCR amplification of target fragments A and B only. The total concentration of oligonucleotides in the overlap extension reaction can reach 1-2 μΜ and more. When the target fragment A amplifies less efficient than target fragment B the amplification efficiencies can be equalized by increasing the concentrations of forward and reverse primers "a" or decreasing the concentrations of forward and reverse primers "b". For example the concentration of primer can be increased up to 5 μΜ or decreased to 0.03 μΜ. The optimal concentrations of each primer are in the range of 0.1-0.5 μΜ.

[115] In other embodiment of present invention said fusion can be performed by ligation. In other embodiment of present onvention the fused molecules can be prepared via amplification on beads. In yet another embodiment the fused molecules pairs can be prepared via recombination.

[116] Stage 2. Post-emulsion PCR-amplification of fused target fragments in the presense of oligonucleotides blocking the fusion of fragments that were not fused in the same emulsion droplet on previous stage.

[117] (D) Isolation of nucleic acids fraction containing fused fragments from the emulsion. [118] For the embodiment of the method of invention after the emulsion PCR/RT- PCR and physical fusion of A and B fragments the isolation of reaction product containing fused target A and B molecules should be performed.

[119] This can be performed by different methods of "water in oil" emulsion breaking, including the use of coagulating agents. One of the approaches includes use of inorganic compounds as coagulating agents - KCI, NaCI, AICI3, FeC , AI₂(SO₄)3, Fe₂(SO₄)3 (Japanese Unexamined Patent Publication No. 54-156268, No. 50-116369, No. 46-49899, No. 46-33131).

[120] Other approach includes use of organic solvents as coagulating agents - water saturated diethyl ether, ethylacetate (Williams R., et al., 2006, Nat Methods, 3, 545-550).

[121] In yet another embodiment the emulsion breaking can be performed mechanically by filtration (Japanese Unexamined Patent Publication No. 53-91462).

[122] In the preferred embodiment of method according the invention the chelating agent such as EDTA is added to the reaction mixture on stage of nucleic acid isolation from the emulsion in concentration of at least 0.5 mM, preferably 1 mM or more to block the activity of polymerase.

[123] In the preferred embodiment of method according the invention the product of emulsion PCR/RT-PCR after the isolation from the emulsion is purified by any commercially available kit for purification of PCR-products, e.g. PCR CleanUp Kit (Qiagen, USA).

[124] In one embodiment of method according the invention the total nucleic acid fraction isolated from the emulsion is further purified.

[125] In other embodiment of method according the invention the total nucleic acid fraction isolated from the emulsion is separated using agarose gel-electroforesis by the amplicon size. Only the fraction of total PCR-product that is consistent by size with fused A-B PCR-product is purified and further amplified.

[126] E) PCR-amplification of target fused fragments in the presense of oligonucleotides blocking the fusion of fragments that were not fused in the same emulsion droplet on stage (c).

[127] The result of emulsion PCR/RT-PCR on base of living cells is the complex mixture of PCR products, where the target products i.e. the fused in emulsion A-B products of overla-extension are present but not necessary prevail. [128] The method of invention provides the application of nested PCR-amplification for production of detectable amounts of target A-B products of overla-extension (Porter-Jordan K., et al. 1990, J Med Virol, 30, 85-91).

[129] The primers that amplify the fused fragment but anneal closer to the center of fused fragment relative the primers that flanked the fused fragment during emulsion PCR are used for nested PCR-amplification. The optimal primer concentrations for nested PCR are typically between 0.2 to 0.5 μΜ.

[130] Besides the emulsion PCR product as a template for nested PCR and primers the reaction mixture for stage (e) also contains the mixture of four types of deoxyribonucleotide triphosphates (dATP, dTTP, dGTP, dCTP) in concentration of 0.2 mM of each dNTP, the enzyme that catalyses the synthesis of DNA on DNA template (DNA-dependent DNA-polymerase) and reaction buffer solution.

[131] The amplification reaction is conducted with specific equipment, namely the amplifier, according to the temperature regimen, shown in Table 2 below.

Table 2. The temperature regimen of amplification on stage "e".

[132] After the emulsion breaking on stage (d) of the present method the fused during the emulsion PCR/RT-PCR molecules A-B, as well as non-fused single molecules A and B, amplified from different cell genetic material are combined in the same reaction volume. The authors showed that the amplification of fused molecules A-B that were generated as a result of overlap-extension of fragments A and B inside emulsion droplets (target product) is equally effective as the amplification of molecules A-B that were fused as a result of random post-emulsion overlap- extension of fragments A and B during PCR on stage Έ". [133] To selectively block this random overlap-extension and to selectively block the mega-priming (i.e. priming of the amplification of fused fragment by unfused fragment PCR product acting as a primer) of single unfused PCR products A and B the amplification of target fused fragments A-B isolated from the emulsion is conducted in presense of oligonucleotides that block this processes. The authors of present invention showed the ability to suppress the undesired amplification more than 100 fold by adding the blocking oligonucleotides in concentration of more than 1.6 μΜ (Fig.5)

[134] The 5'-ends of blocking oligonucleotides are the sequences that are complemetary to 3'-ends of unfused single molecules A and B and provides the hybridization of blocking oligonucleotides with unfused fragments A and B that potentially can participate in random overlap-extension reaction.

[135] The length of the complementary sequence depends on the GC content and should provide effective hybridization of blocking oligonucleotides with unfused fragments A and B at the annealing temperature of primer that is used for PCR. Typically the length of the blocking oligonucleotides is at least 12 nucleotides, e.g. 18 or 22 nucleotides or more.

[136] The 3'-ends of blocking oligonucleotides are the non-coding sequences that function as a template for extension of unfused fragments A and B with several nonsense nucleotides. The extended products lose their annealing site with paired molecule on the 3'-end (fragment A with fragment B and/or fragment B with fragment A) and, consequently, the ability to participate in overlap-extension reaction. The proposed method of suppression is illustrated by Fig.3.

[137] In proposed embodiment of the blocking method of invention the 3 -ends of blocking oligonucleotides are protected against the extension with terminal nucleotide. In certain embodiment of the method of invention the terminal nucleotide is dideoxynucleotide triphosphate (ddNTP's). In other embodiment the phosphate group (PO₄-) is used to block the extension the 3'-ends. The presence of terminal nucleotide prevents the extension of blocking oligonucleotides during PCR.

[138] In certain embodiment of the invention the length of the blocking part is 1 or more nucleotides, preferably 2 or more nucleotides or 3 or more nucleotides. In preferred embodiment the length of the blocking part is at least 7 nucleotides, e.g. 7- 25 nucleotides. [139] The blocking oligonucleotides are added to the reaction mixture in excess as compared with concentration of primers. The optimal concentration of blocking oligonucleotides is determined experimentally by titration in each case. Too small concentration does not provide effective suppression of undesired amplification. Too high concentration of additional oligonucleotides in the reaction mixture leads to the suppression of target fragments amplication.

[140] In certain embodiment of the invention the concentration of blocking oligonucleotides in the reaction mixture exceeds the primer concentration at least two fold. But preferably the highest concentration of blocking oligonucleotides that doesn't inhibit amplification of target fragments should be used. In the case illustrated in Example 1 such concentration of blocking oligonucleotides is the concentration that exceeds the primer concentration 32 fold and is 3.2 μΜ.

[141] In preferred embodiment of the method of target fused fragments amplification in the presence of oligonucleotides that block the amplification of unfused fragments, the DNA-dependent DNA-polymerase that lacks the proofreading activity, e.g. the Taq-polymerase is used.

[142] The PCR-product obtained in nested PCR-amplification with blocking oligonucleotides is the product of preferential amplification of fused in emulsion target fragments A-B.

[143] The new type of PCR suppression hereby allows to eliminate background amplification generated by random overlap-extension reactions after the emulsion PCR or emulsion RT-PCR.

[144] Stage 3. Sequencing of generated PCR-amplicons

[145] The sequencing of generated PCR-amplicons can be permormed by any known sequencing technology or method. The preferred sequencing technology is highthroughput sequencing, e.g. bidirectional lllumina sequencing, that allows to obtain hundreds of thousands and millions of paired reads for a library of PCR- fragments. The sequencing can be permormed according to the manufacturer's recommendations.

[146] Methods of application [147] The method of present invention is in great demand for identification of unique nucleic acids that are present in the same cell, in particular for identification of native pairs of T cell receptor chains and native pairs of antibody heavy and light chains.

[148] The identification of native pairs of T cell receptor chains is required for rational analysis of T cell repertoire and immune system investigation and for direct identification of specific TCR, including TCRs, that are specific to viral or bacterial peptides, autologous peptides and peptides exposed on cancer cell surface.

[149] Consequently, the identification of native pairs of T cell receptor chains can be efficiently used in development of precise diagnostic methods and for high specific individual therapy of infectious, autoimmune and neoplastic diseases.

[150] The identification of native pairs of antibody heavy and light chains is required for rational investigation of the adaptive immunity in health and disease. The identification of native pairs of antibody heavy and light chains is also required for generation of high specific monoclonal therapeutic antibodies, that are widely used for treatment of multiple conditions.

[151] In some embodiments PCR supression find use for a wide variety of applications in which we need to "kick out" the 3' ends of undesirable DNA molecules. For example it can be used in complicated multistage experiments for effective blocking of oligonucleotides remaining from the previous stage of process (e.g. nested PCR, PCR after ligation reaction). In the subsequent reactions these oligonucleotides can act as primers for nonspecific amplification. Excess of oligonucleotide that is complimentary to the 3' end of unwanted primer is added into reaction to prevent such amplification. Blocking oligonucleotide hybridizes with 3' end of unwanted primer and also provides a template for further elongation with several nonsense nucleotides. As a consequence, elongated products lose homology to the PCR template molecule and thus cannot enter the further reaction efficiently.

[152] The following examples are provided as merely illustrative and are not to be construed as limiting the scope of the invention.

EXAMPLES

[153] Example 1. Identification of native TCR alpha and beta chains pairs for peripheral blood mononuclear cells (PBMC) from the human donor blood sample.

[154] The Example demonstrates the application of the method of invention for identification of native TCR chains pairs for 16 variants of alpha-chain V-segments (TRAV4, 8, 12, 13, 14, 21, 22, 24, 25, 26-1 , 26-2, 27, 29, 38, 39, 41) and 1 family of beta-chains (TRBV7) of TCR for PBMC from the human donor blood sample

[155] The experiment included the following stages:

Isolation of PBMC and introducing of PBMC into the emulsion;

Emulsion RT-PCR;

Post-emulsion PCR with nested primers with PCR-suppression of unfused fragments;

Massive sequencing of generated library of fused fragments and data analysis;

The verification of identified pairs by sorting of antigen-specific cells and sequencing of generated TCR alpha and beta chains genes libraries.

[ 56] Isolation of PBMC and introducing of PBMC into the emulsion.

[157] PBMCs were isolated from the peripheral blood sample of a 45-year-old man (informed consent obtained) by Ficoll-Paque (Paneco) density gradient centrifugation. For each of the eight emulsion and two control reactions, 1 x 10⁶ PBMCs were pre-incubated overnight with 10 U/ml IL-2 (Roche). Emulsions were generated at 25 °C as described previously (Williams R., et al., 2006, Nat Methods, 3, 545-550) from 900 μΙ oil-surfactant (2% ABIL EM 90 and 0.05% Triton X-100 in mineral oil) and 100 μΙ aqueous phase. The aqueous phase included PBMCs in 10 μΙ 150 mM NaCI, PCR mix (7.5 U Encyclo polymerase (Evrogen), 5 μΙ 10x Encyclo buffer, 5 U MMLV reverse transcriptase (Evrogen), 3.5 mM MgCI2, 1.4 mM DTT; In four emulsion reactions, it was substituted with single stage RT-PCR mix, Evrogen), 0.5 g/L BSA, 30 U RNasin (Promega), 2.4 mM dNTP mix, and oligonucleotide primers. Primer set included 0.2 μΜ each: BC_synth_rev, AC_synth_rev, BV7_for, and AV_for_uni, as well as a mix of the following 13 TRAV primers (0.02 μΜ each): AV14_for, AV26-1/4_for, AV26-2/4_for, AV39/24_for, AV38-2_for, AV13-2_for, AV25- 2_for, AV41/22_for, AV8_for, AV29/23_for, AV12-3_for, AV27_for, and AV5_for. All oligonucleotides used in the study and their functions are listed in Table 3.

[158] Emulsion RT-PCR

[159] The emulsion that contained the cells was heated at 65°C for 2 minutes to burst the PBMCs and release RNA into the droplet volume. [160] For the sequential reactions shown in Fig. 2, we employed the following temperature regimen: 30 min incubation at 50°C for specific cDNA priming and synthesis, followed by 27 cycles of PCR amplification and overlap extension at 94°C (10 s), 53°C (10 s) and 72°C (20 s).

[161] 1 mM EDTA was added immediately after the emulsion reaction to block polymerase activity. Emulsion product was extracted using diethyl ether/ethyl acetate/diethyl ether as described previously (Williams R., et al., 2006, Nat Methods, 3, 545-550) and purified using a PCR cleanup kit (Qiagen).

[162] Post-emulsion PCR with nested primers with PCR-suppression of unfused fragments

[163] Emulsion-derived DNA was further amplified in two sequential PCR amplification reactions with nested primers specific to the constant regions of the

TCR alpha and beta genes (Table 4) with PCR-suppression method of present invention to block the amplification of TCR alpha and beta chains fragments that were not fused during the emulsion stage, as shown on Fig.3.

[164] The first post-emulsion PCR contained: 5 UE Taq polymerase (Evrogen), 2.5 μΙ 10x Taq polymerase buffer (Evrogen), 2,4 mM dNTP mix, and oligonucleotide primers: BC_R5_I (0,2 μΜ), AC_R3_I (0,2 μΜ), Z_BV_block (3,2 μΜ), Z-AV-block

(3,2 μΜ). The reaction volume was 25 μΙ.

[165] We employed the following temperature regimen:

[166] preliminary DNA denaturation 95C - 1 min 30 s,

[167] 15 cycles (denaturation 95C - 10 s, annealing 62C - 10 s, elongation 72C - 20 s).

[168] The product of first post-emulsion PCR was diluted 25 fold and the second post-emulsion PCR was conducted. The second post-emulsion PCR contained: 5 UE

Taq polymerase (Evrogen), 2.5 μΙ 10x Taq polymerase buffer (Evrogen), 2,4 mM dNTP mix, and oligonucleotides: acj1-indN (0,2 μΜ), bcj1-indN (0,2 μΜ), bcj2-indN

(0,2 μΜ). The reaction volume was 25 μΙ.

[169] We employed the following temperature regimen:

[170] preliminary DNA denaturation 95C - 1 min 30 s,

[171] 15 cycles (denaturation 95C - 10 s, annealing 62C - 10 s, elongation 72C - 20 s). [172] The sequences of nucleotides, that were employed on this stage, are shown in Table 4.

[173] Massive sequencing of generated library of fused fragments and data analysis

[174] The generated library of DNA fragments was sequenced on next generation MiSeq sequencer with 150 nucleotides paired-end read length.

[175] To extract sequences of TCR alpha and beta regions and correct PCR errors that introduce artificial sequence diversity and lead to biased read counts, raw lllumina data were analyzed as previously described (Bolotin D.A., et al., 2012 Eur J Immunol. 42(11), 3073-83).

[176] To minimize noise from random events such as leakage through PCR suppression or overlap-extension of incomplete PCR products during library amplification, and cross-bridge amplification on lllumina array we discarded low-count pairs (<0.05% of total reads in each sample). We identified 664 pairs after such filtration.

[177] Further analysis showed that some CDR3 pairs were selectively expanded during the emulsion reaction as the result of specific fusion in contrast to control reaction where the frequency of pairs was almost equal to the quantity of random fusions that was expected based on fragments frequency.

[178] Most significantly and selectively enriched alpha-beta CDR3 TCR pairs were identified in each emulsion reaction based on number of reads.

[179] 425 (64%) of identified pairs were significantly (p-value of less 0,01) and selectively amplified in the emulsion as compared with the control reaction and were selected for further analysis.

[180] To exclude the random events resulted from enclosing of two T-cells into the same droplet during the emulsification or fusion of droplets that contained cells, we considered reliable only pairs that were identified at least in two different emulsions. This strict criterion filtered out the naive T-cells and low abundant T-cell clones and the most of identified pairs (most of them were correct) were discarded on this stage. Nevertheless, we suppose that this filtration is necessary for obtaining the unambiguous information, as it provides the independent confirmation for each identified pair.

[181] As a result 30 alpha/beta TCR pairs meet all the quality criteria (Fig.6, Table 5) [182] The verification of identified pairs by sorting of antigen-specific cells and sequencing of generated TCR alpha and beta chains genes libraries

[183] To verify the correction of TCR chains fusion we sorted the subpopulation of CD8+ T-cells clones of the same patient that are specific NLV-peptide of cytomegalovirus using flow cell sorting method.

[184] PBMCs were isolated from the peripheral blood samples by Ficoll-Paque (Paneco) density gradient centrifugation, incubated with CD8-specific antibody (clone YTC 182.20, Abeam), CD4-specific antibody (clone S3.5, Invitrogen), and HLA- A*02-CMV (NLVPMVATV) pelimer (Sanquin) for 20 min at room temperature, then washed twice with PBS and sorted on a MoFlo cell sorter (DakoCytomation). We sorted more than 100,000 cells with a 97% purity (Fig. 7)

[185] RNA was extracted using TRIZOL reagent (Life Technologies), and TCR alpha and beta chain libraries were generated using template-switch technology as previously described (Mamedov I.Z., et al., 2011 , EMBO Mol Med, 3, 201-207).

[186] The alpha and beta chains genes libraries were analyzed by paired-end lllumina MiSeq with length of read of up to 150 nucleotides. More then 20,000 CDR3- containing sequences were obtained and analyzed for each of two libraries.

[187] The deep profiling revealed the major CDR3 TCR alpha and beta chains that are specific to HLA-A*02-CMV (NLV), as well as provided the statistic of frequency based fusion probability (Reddy ST., et al., 2010, Nat Biotechnol, 28, 965-969). CDR3 variant CASSLAPGATNEKLFF-1 constituted approximately 90% of all NLV- specific TCR beta sequences, nearly equal to the cumulative input of TCR alpha variants CIRDNNNDMRF and CAGYSGGGADGLTF.

[188] The analysis of sorted cells revealed 2 pairs of TCR chains, that are specific to HLA-A*02-CMV (NLV): CDR3-alpha CIRDNNNDMRF/CDR3-beta CASSLAPGATNEKLFF pair, that is supported by substantially identical NLV-specific T-cell clone, identified in an independent study (Trautmann L., et al., 2005, J Immunol, 175, 6123-6132), and CDR3-alpha CAGYSGGGADGLTF/CDR3-beta CASSLAPGATNEKLFF clone. The algorithm of T-cell maturation implies that the same TCR beta-chain may be coupled with several TCR alpha chains that results in several T-cell clones with similar specificity (Arstila T.P., et al., 2000, Science, 288, 1135). Consequently it was not surprise to discover two T-cell clones with identical beta chains. [189] Both pairs that were identified by sequencing of libraries generated from sorted T-cells were successfully identified by emulsion RT-PCR method (pairs P1 and P4, Fig.6, Table 5). The emulsion approach allows the unambiguous identification of functional TCR alpha and beta chains, at least for relatively large T- cell clones.

[190] The relatively narrow pool of TRBV7 gene family fragments was analyzed but this result can be extrapolated to thousands of functional TCR chains pairs, that can be unambiguously identified for a given blood sample using the same method with different primer set. The depth of the method of invention can be further increased by increasing the number and volume of emulsion reactions and consequent augmentation of independently identified sequences.

Table 3. Primers used in the emulsion PCR in Example 1.

Z_AV26- ATTGGGCAGCCCTGATTG

TRAV 4, 26-2 amplification and

07 2/4_BV_s ACGACAGAAAGTCCAGTA

fusion with TRBV

Z_AV39/24_ AT I GGGCAGCCC I GA I I I TRAV 24, 39 amplification and 08 BV_s AAGTGCCTCACTTRATAC fusion with TRBV

ATTGGGCAGCCCTGATTA

AV38_2_Z TRAV 38-2 amplification and 09

CTTCCAGAAAGCAGCCAA fusion with TRBV

ATTGGGCAGCCCTGATTA

AV13_2_Z TRAV 13-2 amplification and

10 CATTGAACAAGACAGCCA fusion with TRBV

ATTGGGCAGCCCTGATTC

AV25_2_Z TRAV 25-2 amplification and 11

A I I I CAGTTTGGAGAAGC fusion with TRBV

Z_AV41/22_ ATTGGGCAGCCCTGATTA TRAV 22,41 amplification and 12 BV GCATGGAAGATTAAKTGC fusion with TRBV

ATTGGGCAGCCCTGATTC

Z_AV8_BV TRAV 8 amplification and

13 TGACGAAACCCTCAGCC fusion with TRBV

Z_AV ATTGGGCAGCCCTGATTC

TRAV 23, 29 amplification and

29/23_BV CTTAAAYAAAAGTGCCAA 14 fusion with TRBV

Z_AV12S3_ ATTGGGCAGCCCTGATTC TRAV 12-3 amplification and 15 BV CAGCAAGTATATCTCCTT fusion with TRBV

ATTGGGCAGCCCTGATTC

AV27_BV_I TRAV 27 amplification and

16 C I I I CAGTTTGGTGAT fusion with TRBV

Table 4. Primers used after the emulsion PCR in Example 1.

SEQ ID

name Sequence function

No:

TTCTGATGGCTCAAACACA 17

BC_R5_I Amplification of TCR chains

GCGA

fusion product in the first post-

GGTACACGGCAGGGTCAG 18

AC_R3_I emulsion reaction

GGTTC

tttttttAATCAGGGCTGCCCAA 19

Z_BV_block TRBV fragment blocking

TG ATCGGTTCttt-P

tttttttATTGGGCAGCCCTGAT 20

Z-AV-block TRAV fragment blocking

Tttt-P

Amplification of TCR chains 21 ar.i1-inH? ΤΑητΓ.ηηητΓΔ ηττη.τ GGATAT

ACTTCGGGTCAGGGTTCTG 22 acj1-ind3

GATAT

acj1-ind4 TCACTGGGTCAGGGTTCTG 23

GATAT

acj1-ind5 GATTCGGGTCAGGGTTCT 24

GGATAT

GTCTTGGGTCAGGGTTCTG 25 acj1-ind6

GATAT

AGTCTGGGTCAGGGTTCT 26 acj1-ind7

GGATAT fusion product in the second bcj-ind2 TAGTCACACSTTGTTCAGG post-emulsion reaction 27

TCCTC

bcj-ind3 ACTTCACACSTTGTTCAGG 28

TCCTC

bcj-ind4 TCACTACACSTTGTTCAGG 29

TCCTC

GATTCACACSTTGTTCAGG 30 bcj-ind5

TCCTC

GTCTTACACSTTGTTCAGG 31 bcj-ind6

TCCTC

AGTCTACACSTTGTTCAGG 32 bcj-ind7

TCCTC

Table 5. The identified TCR alpha and beta chains pairs

# SEQ SEQ ID

TRAV CDR3 alpha ID TRAJ TRBV CDR3 beta TRBJ No:

No:

P1 26-2 CIRDNNNDMRF 33 43 7-6 CASSLAPGATNEKLFF- 1-4 34

P2 4 CLVNTGGGNKLTF 35 10 7-9 CASSLVEAGDPYEQYF 2-7 36

P3 38-1 CAFMYPQGGSEK 37 57 7-9 CASGSGLAGGELFF 2-2 38

P4 27 CAGYSGGGADGL 39 45 7-6 CASSLAPGATNEKLFF- 1-4 40

P5 13-1 CAAIGSEKLVF 41 57 7-3 CASSFGNRENIQYF 2-4 42

P6 38-2 CAYIPMDSNYQLI 43 33 7-8 CASSTIGGPVNTGELF 2-2 44

P7 38-2 CAYRLRGRGSNY 45 53 7-3 CASSPTRNTEAFF 1-1 46 P8 8-2/8-4 CAAGFQKLVF 47 8 7-9 CASSLVTSGNSYEQYF 2-7 48

P9 4 CLVATGAGSYQLT 49 28 7-2 CASSLSAYEQYF 2-7 50

P1 26-1 CIVRVAFSGGYNK 51 4 7-8 CASSSPIFLPGNEQFF 2-1 52

P1 38-1 CAFTNAGGTSYG 53 52 7-9 CASSLAGLNYEQYF 2-7 54

P1 13-1 CAASITGGGNKLT 55 10 7-2 CASSLATNEKLFF 1-4 56

P1 22 CAVAVNFGNEKLT 57 48 7-2 CASSFIVYEQYF 2-7 58

P1 41 CAWKGAQKLVF 59 54 7-2 CASSFTTNTGELFF 2-2 60

P1 8-4 CAVTKNRDDKIIF 61 30 7-9 CASSLDRQGNREQYF 2-7 62

P1 26-1 CIGRFSDGQKLLF 63 16 7-2 CASSRRLPGETQYF 2-5 64

P1 25 CAGPRTGNQFYF 65 49 7-3 CASSSGQEVGELFF 2-2 66

P1 8-4 CAVSDRGDDKIIF 67 30 7-9 CASSLASGLAEEQFF 2-1 68

P1 8-4 CAVSDRGSARQL 69 22 7-7 CASSLSKGAYEQYF 2-7 70

P2 38-1 CAIRKGNNNDMR 71 43 7-3 CASSLNIA-EFETQYF 2-5 72

P2 38-2 CAYRSVLRDDKIIF 73 30 7-2 CASSLPTGNNSPLHF 1-6 74

P2 26-1 CIVSSYGQNFVF 75 26 7-9 CASSLARDQ ETQYF 2-5 76

P2 38-2 CALIGNQFYF 77 49 7-8 CASSLRAGSEDTQYF 2-3 78

P2 41 CAVNLYNNNDMR 79 43 9 CASSEWTGAETQYF 2-5 80

P2 4 CLSQWF-ARQLTF 81 22 7-2 CASSLADSPLHF 1-6 82

P2 8-2 CWSGPKGSNTG 83 37 12-4 CASSVANWADTQYF 2-3 84

P2 5 CAEMGGSNYKLT 85 53 7-9 CASSGTYEQYF 2-7 86

P2 4 CLVGLGGQAGTA 87 15 7-6 CASSLQQGSYEQYF 2-7 88

P2 26-1 CIVRANDYKLSF 89 20 9 CASSVN LGTPYEQ YF 2-7 90

P3 26-2 CILDNNNDMRF 91 43 7-6 CASSLAPGATNEKLFF- 1-4 92

[191] Example 2

[192] In this example suppression was observed for one of the adapters remaining in the PCR mixture from previous step of ligation. The oligunucleotides used in

Example 2 are shown in Table 6.

Table 6. Oligonucleotides used in Example 2

Tru-B-Rev- Ligation adapter CTCGGTGAGAGNNNNNNNNNNNNNNAGA 94 NNNSt12 TCGGAAGAGCACACGTCTGAACTCCAGTC

AC

Kill NNNSt-P Blocking GCACGCGTCGACTCGGTGAGAG-P 95 oligonucletide

[193] Product of ligation reaction containing DNA flanking by adapters sequences (Tru-A-Dir-NNNSt12 and Tru-B-Rev-NNNSt12) and remains of unreacted

oligonucleotides Tru-A-Dir-NNNSt12 and Tru-B-Rev-N N NSt12 used as starting material for subsequent PCR amplification.

[194] The standard PCR mixture, including target DNA (product of previous ligation reaction), nucleoside triphosphates, DNA polymerase and two specific PCR primers, was prepared. Supression oligonucleotide was added to block the remains of unreacted Tru-A-Dir-NNNSt12 adapter. To minimize potential side-effects in PCR, the 3'-ends of the blocking oligonucleotides were phosphate-protected.

[195] The following temperature profile was used: 65°C -10 seconds (for polymerase activation), 50°C -20 seconds (for hybridization of Kill NNNSt-P and Tru-A-Dir- NNNSt12 with subsequent elongation of Tru-A-Dir-NNNSt12 with several nonsense nucleotides) followed by regular PCR cycling 15-18 times.

[196] The results demonstrate that addition of blocking oligonucleotides Kill NNNSt- P provides selective suppression of nonspecific amplification with Tru-A-Dir-NNNSt12 primer.

Claims

1. Method for identification of nucleic acid fragment pairs that are present in same cells, including:

(1) Amplification and physical fusion of target fragments A and B, that is performed in emulsion;

(2) Post-emulsion PCR-amplification of the fused target fragments in the presence of oligonucleotides that block amplification of fragments that were not fused in the same emulsion droplet previously on stage (1).

2. Method of claim 1 , further including the stage (3) of sequencing the obtained PCR- amplicons.

3. Method of claim 1 , wherein identification of nucleic acid fragment pairs can be performed in fixed or live cell populations.

4. Method of claim 1 , wherein the nucleic acids are the DNA molecules.

5. Method of claim 1 , wherein the nucleic acids are the RNA molecules.

6. Method of claim 1 , wherein the physical fusion in the emulsion is performed by overlap-extension technology.

7. Method of claim 5, wherein the RNA fragments pairs are native pairs of fragments of mRNA of T-cell receptor alpha and beta chains.

8. Method of claim 5, wherein the RNA fragments pairs are native pairs of fragments of mRNA of heavy and light antibody chains.

9. Method of claim 4, wherein the DNA fragments pairs are native pairs of fragments of DNA of T-cell receptor alpha and beta chains.

10. Method of claim 4, wherein the DNA fragments pairs are native pairs of fragments of DNA of heavy and light antibody chains.

11. Method for selective suppression of PCR amplification of DNA fragments by adding the blocking oligonucleotide to the reaction mixture, wherein one region of said oligonucleotide anneals to the 3'-end of the DNA fragment to be suppressed and the other region of said oligonucleotide functions as a template for extension of new 3'-end of said DNA fragment, wherein the new 3'- end sequence doesn't have complementarity with proposed templates and lacks the ability to further participate in amplification as a primer.