WO2014043813A1

WO2014043813A1 - Immune repertoire profiling

Info

Publication number: WO2014043813A1
Application number: PCT/CA2013/050719
Authority: WO
Inventors: Robert Holt
Original assignee: British Columbia Cancer Agency Branch
Priority date: 2012-09-19
Filing date: 2013-09-19
Publication date: 2014-03-27

Abstract

A method for determining nucleotide sequences of a first polynucleotide and a second polynucleotide. The method includes: transcribing the first polynucleotide in the presence of a first template oligonucleotide to generate a first extended polynucleotide and transcribing the second polynucleotide in the presence of a second template oligonucleotide to generate a second extended polynucleotide, wherein the first template oligonucleotide is annealable to the second template oligonucleotide; annealing the first and second extended polynucleotides through the complementary sequences of the first and second template oligonucleotides; performing polymerase chain reaction (PCR) to generate a linked polynucleotide having a sequence comprising the sequences of the first and the second polynucleotides; and decoding the sequence of the linked polynucleotide.

Description

IMMUNE REPERTOIRE PROFILING

CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority of U.S. Provisional Patent Application No. 61/702,848 filed September 19, 2012, which is incorporated herein by reference in its entirety.

FIELD

[0002] The present disclosure relates to immune repertoire profiling. More particularly, the present disclosure provides, in part, methods for determining the sequence of at least two polynucleotides.

BACKGROUND

[0003] Knowledge of DNA sequences has become essential in numerous applied fields such as modern biotechnology and medicine. Modern sequencing techniques allow for rapid sequencing and have been instrumental in the advancement of genetic study.

[0004] In the genome, there are no loci that have greater complexity or extend a deeper and broader reach into human biology that those encoding the antigen receptors of T-cells and B-cells. The T-cell and B-cell repertoire is continuously molded by the input of new T-cells and B-cells, and their response to immune challenges. The choreographed programs of stochastic recombination that unfold at these loci during T-cell and B-cell maturation provide mammals with the personalized armamentarium necessary for defining and defending their cellular space.

[0005] Because the diversity in protein sequence is nearly limitless, and adaptive immune systems cannot know, a priori, what specific antigenic challenges lie ahead, the immune systems must initiate and maintain a repertoire of educated T-cell clonotypes bearing receptor variants of adequate diversity to recognize essentially any pathogen or mutation that may be encountered during life. The task of characterizing the size and dynamics of T-cell and B-cell repertoires is challenged by this enormous scope of T-cell receptor (TCR) and B-cell receptor (BCR) combinatorial diversity.

[0006] Various T cell sequencing methods have been discussed in, for example,

Copelan EA. Hematopoietic stem-cell transplantation. N Engl J Med (2006) 354: 1813-1826; Passweg JR, et al. Hematopoietic stem cell transplantation: a review and recommendations for follow-up care for the general practitioner. Swiss medical weekly (2012) 142:w13696; Klarenbeek PL, et al. Inflamed target tissue provides a specific niche for highly expanded T- cell clones in early human autoimmune disease. Ann Rheum Dis (2012) 71 : 1088-1093; Klarenbeek PL, et al. Deep sequencing of antiviral T-cell responses to HCMV and EBV in humans reveals a stable repertoire that is maintained for many years. PLoS Pathog (2012), 8:e1002889; and Wu D, et al. High-throughput sequencing detects minimal residual disease in acute T lymphoblastic leukemia. Sci TransI Med (2012) 4: 134ra63. To date, large-scale T- cell and B-cell repertoire analysis has been limited to interrogation of a single TCR or BCR subunit per sequencing run. For example, Freeman, D.J. et al., in "Profiling the T-cell receptor beta-chain repertoire by massively parallel sequencing." (Genome Res.

2009; 19(10): 1817-24), disclose determining the sequence of a beta subunit of the T-cell receptors. SUMMARY

[0007] In one aspect, the present disclosure provides a method for determining nucleotide sequences of a first polynucleotide and a second polynucleotide.

[0008] In some embodiments, the method includes:

a) providing a first polynucleotide sequence and a second polynucleotide sequence, where the first polynucleotide sequence and the second polynucleotide sequence each includes a known sequence and an unknown sequence, the known sequence being positioned 3' to the unknown sequence;

b) providing a first template oligonucleotide;

c) providing a second template oligonucleotide, where at least a portion of the sequence of the first template oligonucleotide is annealable to at least a portion of the sequence of the second template oligonucleotide;

d) providing a first priming oligonucleotide and a third priming oligonucleotide, each including a sequence that is annealable to at least a portion of the known sequence of the first polynucleotide, where the first priming oligonucleotide and a third priming oligonucleotide optionally have the same sequence;

e) providing a second priming oligonucleotide and a fourth priming oligonucleotide, each including a sequence that is annealable to at least a portion of the known sequence of the second polynucleotide, where the second priming oligonucleotide and a fourth priming oligonucleotide optionally have the same sequence;

f) providing a reverse transcriptase;

g) reverse transcribing the first polynucleotide in the presence of the first priming oligonucleotide and the first template oligonucleotide to generate a first extended

polynucleotide;

h) reverse transcribing the second polynucleotide in the presence of the second priming oligonucleotide and the second template oligonucleotide to generate a second extended polynucleotide;

i) annealing the first and second extended polynucleotides through the anealable sequences of the first and second template oligonucleotides to generate a linked

polynucleotide;

j) extending the 3' ends of the linked polynucleotide to generate an extended linked polynucleotide including the sequences of the first and second extended polynucleotides; k) amplifying the extended linked polynucleotide in the presence of the third priming oligonucleotide and the fourth priming oligonucleotide; and

I) determining the sequence of the extended linked polynucleotide.

[0009] Reverse transcribing may include reverse transcribing using a reverse transcriptase having a terminal nucleotidyl transferase-like activity. The reverse transcriptase may be a Moloney murine leukemia virus reverse transcriptase, an avian myeloblastosis virus reverse transcriptase, or a functional variant thereof.

[0010] When the reverse transcriptase is a Moloney murine leukemia virus reverse transcriptase, the first and the second template oligonucleotides each, independently, may have at least two terminal guanine nucleotides at their 3' ends.

[0011] The sequence of the first template oligonucleotide may include: a first sequence towards the 3' end of the first template oligonucleotide, the first sequence being annealable to non-template nucleotides towards the 3' end of the complement of the first polynucleotide, and a second sequence towards the 5' end of the first template

oligonucleotide, the second sequence being annealable to the second template

oligonucleotide. And the sequence of the second template oligonucleotide may include: a first sequence towards the 3' end of the second template oligonucleotide, the first sequence being annealable to non-template nucleotides towards the 3' end of the complement of the second polynucleotide, and a second sequence towards the 5' end of the second template oligonucleotide, the second sequence being annealable to the first template oligonucleotide.

[0012] The first and the second template oligonucleotides may each, independently, be at least 20 nucleotides in length.

[0013] Each of the first and the second template oligonucleotides may include a palindromic sequence at least 4 base pairs in length.

[0014] The first template oligonucleotide may include polynucleotides having the sequence of

5'<CTAATACGACTCACTATAGGGCAAGCAGTGGTAACAACGCAGAGTACGCGGG<3' (SEQ ID NO: 19).

[0015] The second template oligonucleotide may include polynucleotides having the sequence of

5'<CTGCTTGCCCTATAGTGAGTGTATTTAGTGGTAACAACGCAGAGTACGCGGG<3' (SEQ ID NO: 20).

[0016] The method may further include performing PCR to amplify the linked polynucleotide.

[0017] The first polynucleotide and the second polynucleotide may be

polyribonucleotides (RNA), and the first extended polynucleotide and the second extended polynucleotides may be polydeoxyribonucleotides (DNA). The polyribonucleotides may be from a single cell. In some embodiments, the first polynucleotide and the second

polynucleotide may be messenger RNA.

[0018] The first polynucleotide and the second polynucleotides may encode proteins that are protein subunits of a multiprotein complex.

[0019] In one example, the single cell is a T-cell. In a specific example: the first polynucleotide is a polynucleotide encoding an alpha subunit of a T-cell receptor and the first priming oligonucleotide is annealable to a constant region of the alpha subunit of the T-cell receptor, and the second polynucleotide is a polynucleotide encoding a beta subunit of the T- cell receptor and the second priming oligonucleotide is annealable to a constant region of the beta subunit of the T-cell receptor. The first and the second priming oligonucleotides may each be, independently, at least 15 nucleotides in length.

[0020] The first priming oligonucleotide may include a polynucleotide having the sequence of 5'<CATTTGTTTGAGAATCAAAATCGGTGA<3' (SEQ ID NO: 1), 5' <AGGCAGACAGACTTGTCACTGGATT<3' (SEQ ID NO: 2), or

5'<CTCAGCTGGTACACGGCAGGGTCA<3' (SEQ ID NO: 3).

[0021] The second priming oligonucleotide may include a polynucleotide having the sequence of 5'<CACGTGGTCGGGGWAGAAGC<3' (SEQ ID NO: 4),

5' <TCTCTGCTTCTGATGGCTCAAAC<3' (SEQ ID NO: 5), or

5'<AGCGACCTCGGGTGGGAACA<3' (SEQ ID NO: 6).

[0022] In another example, the single cell is a B-cell. In a specific example: the first polynucleotide is a polynucleotide encoding a heavy chain of a B-cell receptor and the first priming oligonucleotide is annealable to a constant region of the heavy chain of the B-cell receptor, and wherein the second polynucleotide is a polynucleotide encoding a light chain of the B-cell receptor and the second priming oligonucleotide is annealable to a constant region of the light chain of the B-cell receptor. The first and the second priming oligonucleotides may each be, independently, at least 15 nucleotides in length.

[0023] The first priming oligonucleotide may include a polynucleotide having the sequence of 5'<AYCCAGGAGGCCCCAGAGCWCA<3' (SEQ ID NO: 7),

5'<CCTCCTCMGGTCAGCCCYGGACAT<3' (SEQ ID NO: 8), or

5'<CCCAGGACGCAGCACCRCTGTCAA<3' (SEQ ID NO: 9).

[0024] The second priming oligonucleotide may include a polynucleotide having the sequence of 5'<AGAGATCTCAGGACAGGTGGTCAGG<3' (SEQ ID NO: 10) or

5'<AGCAACAACAAGTACGCGGCCAGCAGCTA<3' (SEQ ID NO: 11).

[0025] The single cell may be isolated from a plurality of cells.

[0026] In another aspect of the present disclosure, there is provided a method for determining the nucleotide sequence of at least two polynucleotides in a plurality of cells, the method including:

a) providing a single cell isolated from the plurality of cells, where the single cell comprises a first polynucleotide and a second polynucleotide, and where the first

polynucleotide sequence and the second polynucleotide sequence each includes a known sequence and an unknown sequence, the known sequence being positioned 3' to the unknown sequence;

b) providing a first template oligonucleotide;

d) providing a first priming oligonucleotide and a third priming oligonucleotide, each including a sequence that is annealable to at least a portion of the known sequence of the first polynucleotide;

e) providing a second priming oligonucleotide and a fourth priming

oligonucleotide, each including a sequence that is annealable to at least a portion of the known sequence of the second polynucleotide;

f) providing a reverse transcriptase;

g) annealing the first priming oligonucleotide to the known sequence of the first polynucleotide and annealing the second priming oligonucleotide to the known sequence of the second polynucleotide;

h) reverse transcribing the first polynucleotide in the presence of the first template oligonucleotide to generate a first extended polynucleotide;

i) reverse transcribing the second polynucleotide in the presence of the second template oligonucleotide to generate a second extended polynucleotide;

j) annealing the first and second extended polynucleotides through the anealable sequences of the first and second template oligonucleotides to generate a linked polynucleotide;

k) extending the 3' ends of the linked polynucleotide to generate an extended linked polynucleotide comprising the sequences of the first and second extended

polynucleotides;

I) amplifying the extended linked polynucleotide in the presence of the third priming oligonucleotide and the fourth priming oligonucleotide; and

m) determining the sequence of the linked polynucleotide.

[0027] Reverse transcribing may include reverse transcribing using reverse transcriptase having a terminal nucleotidyl transferase-like activity. The reverse transcriptase may be a Moloney murine leukemia virus reverse transcriptase, an avian myeloblastosis virus reverse transcriptase, or a functional variant thereof.

[0028] When the reverse transcriptase is a Moloney murine leukemia virus reverse transcriptase, the first and the second template oligonucleotides may each, independently, have at least two terminal guanine nucleotides at their 3' ends.

[0029] The sequence of the first template oligonucleotide may include: a first sequence towards the 3' end of the first template oligonucleotide, the first sequence being annealable to non-template nucleotides towards the 3' end of the complement of the first polynucleotide, and a second sequence towards the 5' end of the first template

oligonucleotide, the second sequence being annealable to the second template

[0030] The first and the second template oligonucleotides may each be,

independently, at least 20 nucleotides in length.

[0031] Each of the first and the second template oligonucleotides may include a palindromic sequence at least 4 base pairs in length.

[0032] The first template oligonucleotide may include polynucleotides having the sequence of

5'<CTAATACGACTCACTATAGGGCAAGCAGTGGTAACAACGCAGAGTACGCGGG<3' (SEQ ID NO: 19). The second template oligonucleotide may include polynucleotides having the sequence of

5'<CTGCTTGCCCTATAGTGAGTGTATTTAGTGGTAACAACGCAGAGTACGCGGG<3' (SEQ ID NO: 20).

[0033] The method may further include performing PCR to amplify the linked polynucleotide.

[0034] The first polynucleotide and the second polynucleotide may be

polyribonucleotides (RNA) and the first extended polynucleotide and the second extended polynucleotides may be polydeoxyribonucleotides (DNA). In some embodiments, the first polynucleotide and the second polynucleotide may be messenger RNA.

[0035] The first polynucleotide and the second polynucleotides may encode proteins that are protein subunits of a multiprotein complex.

[0036] In some examples, the single cell is a T-cell. In specific examples, the first polynucleotide is a polynucleotide encoding an alpha subunit of a T-cell receptor and the first priming oligonucleotide is annealable to a constant region of the alpha subunit of the T-cell receptor, and wherein the second polynucleotide is a polynucleotide encoding a beta subunit of the T-cell receptor and the second priming oligonucleotide is annealable to a constant region of the beta subunit of the T-cell receptor. The first and the second priming

oligonucleotides may each be, independently, at least 15 nucleotides in length.

[0037] The first priming oligonucleotide may include a polynucleotide having the sequence of 5'<CATTTGTTTGAGAATCAAAATCGGTGA<3' (SEQ ID NO: 1),

5' <AGGCAGACAGACTTGTCACTGGATT<3' (SEQ ID NO: 2), or

5'<CTCAGCTGGTACACGGCAGGGTCA<3' (SEQ ID NO: 3).

[0038] The second priming oligonucleotide may include a polynucleotide having the sequence of 5'<CACGTGGTCGGGGWAGAAGC<3' (SEQ ID NO: 4),

5' <TCTCTGCTTCTGATGGCTCAAAC<3' (SEQ ID NO: 5), or

5'<AGCGACCTCGGGTGGGAACA<3' (SEQ ID NO: 6).

[0039] In other examples, the single cell is a B-cell. In specific examples, the first polynucleotide is a polynucleotide encoding a heavy chain of a B-cell receptor and the first priming oligonucleotide is annealable to a constant region of the heavy chain of the B-cell receptor; and wherein the second polynucleotide is a polynucleotide encoding a light chain of the B-cell receptor and the second priming oligonucleotide is annealable to a constant region of the light chain of the B-cell receptor. The first and the second priming oligonucleotides may each be, independently, at least 15 nucleotides in length.

[0040] The first priming oligonucleotide may include a polynucleotide having the sequence of 5'<AYCCAGGAGGCCCCAGAGCWCA<3' (SEQ ID NO: 7),

5'<CCTCCTCMGGTCAGCCCYGGACAT<3' (SEQ ID NO: 8), or

5'<CCCAGGACGCAGCACCRCTGTCAA<3' (SEQ ID NO: 9).

[0041] The second priming oligonucleotide may include a polynucleotide having the sequence of 5'<AGAGATCTCAGGACAGGTGGTCAGG<3' (SEQ ID NO: 10) or

5'<AGCAACAACAAGTACGCGGCCAGCAGCTA<3' (SEQ ID NO: 11).

[0042] In another aspect, there is provided a kit for determining the nucleotide sequences of a first polynucleotide and a second polynucleotide. The kit includes: a first template oligonucleotide and a second template oligonucleotide where the first template oligonucleotide is annealable to the second template oligonucleotide, and where the first and the second template oligonucleotides each, independently, have at least two terminal guanine nucleotides at their 3' ends.

[0043] The kit may also include a reverse transcriptase having a terminal nucleotidyl transferase-like activity. The reverse transcriptase may be a Moloney murine leukemia virus reverse transcriptase, an avian myeloblastosis virus reverse transcriptase, or a functional variant thereof.

[0044] The first and the second template oligonucleotides may each be,

independently, at least 20 nucleotides in length.

[0045] The sequence of the first template oligonucleotide may include: a first sequence towards the 3' end of the first template oligonucleotide, the first sequence being annealable to non-template nucleotides towards the 3' end of the complement of the first polynucleotide, and a second sequence towards the 5' end of the first template

oligonucleotide, the second sequence being annealable to the second template

[0046] The first template oligonucleotide may include polynucleotides having the sequence of

5'<CTAATACGACTCACTATAGGGCAAGCAGTGGTAACAACGCAGAGTACGCGGG<3' (SEQ ID NO: 19).

[0047] The second template oligonucleotide may include polynucleotides having the sequence of

5'<CTGCTTGCCCTATAGTGAGTGTATTTAGTGGTAACAACGCAGAGTACGCGGG<3' (SEQ ID NO: 20).

[0048] The first template oligonucleotide and the second template oligonucleotide may be polyribonucleotides.

[0049] The kit may also include a first priming oligonucleotide and a second priming oligonucleotide. The first priming oligonucleotide may have a sequence that is annealable to a first sequence towards the 3' end of the first polynucleotide; and the second priming oligonucleotide may have a sequence that is annealable to a second sequence towards the 3' end of the second polynucleotide.

[0050] When the first polynucleotide is a polynucleotide encoding an alpha subunit of a T-cell receptor (TCR), and the first priming oligonucleotide may be annealable to a constant region of the alpha subunit of the T-cell receptor. The first priming oligonucleotide may include a polynucleotide having the sequence of

5'<CATTTGTTTGAGAATCAAAATCGGTGA<3' (SEQ ID NO: 1),

5' <AGGCAGACAGACTTGTCACTGGATT<3' (SEQ ID NO: 2), or

5'<CTCAGCTGGTACACGGCAGGGTCA<3' (SEQ ID NO: 3).

[0051] When the second polynucleotide is a polynucleotide encoding a beta subunit of the T-cell receptor, the second priming oligonucleotide may be annealable to a constant region of the beta unit of the T-cell receptor. The second priming oligonucleotide may include a polynucleotide having the sequence of 5'<CACGTGGTCGGGGWAGAAGC<3' (SEQ ID NO: 4), 5'<TCTCTGCTTCTGATGGCTCAAAC<3' (SEQ ID NO: 5), or

5'<AGCGACCTCGGGTGGGAACA<3' (SEQ ID NO: 6).

[0052] When the first polynucleotide is a polynucleotide encoding a heavy chain of a

B-cell receptor, the first priming oligonucleotide may be annealable to a constant region of the heavy chain of the B-cell receptor. The first priming oligonucleotide may include a polynucleotide having the sequence of 5'<AYCCAGGAGGCCCCAGAGCWCA<3' (SEQ ID NO: 7), 5'<CCTCCTCMGGTCAGCCCYGGACAT<3' (SEQ ID NO: 8), or

5'<CCCAGGACGCAGCACCRCTGTCAA<3' (SEQ ID NO: 9).

[0053] When the second polynucleotide is a polynucleotide encoding a light chain of the B-cell receptor, the second priming oligonucleotide may be annealable to a constant region of the light chain of the B-cell receptor. The second priming oligonucleotide may include a polynucleotide having the sequence of

5'<AGAGATCTCAGGACAGGTGGTCAGG<3' (SEQ ID NO: 10) or

5'<AGCAACAACAAGTACGCGGCCAGCAGCTA<3' (SEQ ID NO: 1 1).

[0054] In yet another aspect, there is provided a pair of replicable vectors encoding: a first template oligonucleotide, and a second template oligonucleotide, where the first template oligonucleotide is annealable to the second template oligonucleotide, and where the first and the second template oligonucleotides each, independently, have at least two terminal guanine nucleotides at their 3' ends.

[0055] In a further aspect, there is provided a pair of bacteria, each bacteria transfected with one of the pair of replicable vectors discussed above, the pair of bacteria capable of expressing the first and second template oligonucleotides.

[0056] In a still further aspect, there is provided a pair of viruses, each virus including one of the pair of replicable vectors discussed above.

[0057] In still yet another aspect, the present disclosure provides a method for determining the nucleotide sequences of at least two polynucleotide from a plurality of T cells or B cells, the method incldung:

polynucleotide sequence and the second polynucleotide sequence each together encode a T-cell receptor or a B-cell receptor and each include a known sequence and an unknown sequence, the known sequence being positioned 3' to the unknown sequence;

b) generating a first extended polynucleotide that comprises a first additional sequence and a sequence that is complementary to the first polynucleotide and, generating a second extended polynucleotide that comprises a second additional sequence and a sequence that is complementary to the second polynucleotide, where the first additional sequence is annealable to the second additional sequence;

c) annealing the first and second extended polynucleotides through the first and the second additional sequences to generate a linked polynucleotide;

d) extending the 3' ends of the linked polynucleotide to generate an extended linked polynucleotide including the sequences of the first and second extended

polynucleotides;

e) amplifying the extended linked polynucleotide; and

f) determining the sequence of the extended linked polynucleotide

[0058] Generating the first extended polynucleotide and generating the second extended polynucleotide may be accomplished as discussed herein.

[0059] Alternatively, generating the first extended polynucleotide and generating the second extended polynucleotide may include: ligating a first 5' adenylated 3' blocked oligonucleotidedeoxynucleotide to the 3' end of the first polynucleotide using an RNA ligase in the absence of adenosine triphosphate; and ligating a second 5' adenylated 3' blocked oligonucleotidedeoxynucleotide to the 3' end of the second polynucleotide using an RNA ligase in the absence of adenosine triphosphate; where the first 5' adenylated 3' blocked oligonucleotidedeoxynucleotide includes the first additional sequence, and the second 5' adenylated 3' blocked oligonucleotidedeoxynucleotide includes the second additional sequence; and where performing polymerase chain reaction includes performing a reverse transcription polymerase chain reaction.

[0060] Alternatively, generating the first extended polynucleotide and generating the second extended polynucleotide may include: reverse transcribing the first polynucleotide in the presence of a first priming oligonucleotide to generate a first complementary DNA (cDNA); reverse transcribing the second polynucleotide in the presence of a second priming oligonucleotide to generate a second cDNA; polishing the first and the second cDNA to generate blunt ends; ligating a first double stranded linker to the blunt end of the first cDNA and ligating a second double stranded linker to the blunt end of the second cDNA using a DNA ligase, where the first and the second double stranded linkers comprise recognition sites for a restriction enzyme; and cleaving the first and the second double stranded linkers using the restriction enzyme, where: the cleaved first double stranded linker provides the first additional sequence, and the cleaved second double stranded linker provides the second additional sequence, the first additional sequence being annealable to the second additional sequence.

[0061] In another aspect, there is provided a method for obtaining a polynucleotide for determination of its sequence, the method comprising:

a) providing a first polynucleotide sequence and a second polynucleotide sequence, wherein the first polynucleotide sequence and the second polynucleotide sequence each comprise a known sequence and an unknown sequence, the known sequence being positioned 3' to the unknown sequence;

b) providing a first template oligonucleotide;

c) providing a second template oligonucleotide, wherein at least a portion of the sequence of the first template oligonucleotide is annealable to at least a portion of the sequence of the second template oligonucleotide;

d) providing a first priming oligonucleotide and a third priming oligonucleotide, each comprising a sequence that is annealable to at least a portion of the known sequence of the first polynucleotide;

e) providing a second priming oligonucleotide and a fourth priming

oligonucleotide, each comprising a sequence that is annealable to at least a portion of the known sequence of the second polynucleotide;

f) providing a reverse transcriptase;

g) reverse transcribing the first polynucleotide in the presence of the first priming oligonucleotide and the first template oligonucleotide to generate a first extended polynucleotide;

i) annealing the first and second extended polynucleotides through the anealable sequences of the first and second template oligonucleotides to generate a linked polynucleotide;

j) extending the 3' ends of the linked polynucleotide to generate an extended linked polynucleotide comprising the sequences of the first and second extended

polynucleotides; and

k) amplifying the extended linked polynucleotide in the presence of the third priming oligonucleotide and the fourth priming oligonucleotide to obtain sufficient quantities of the extended linked polynucleotide such that the sequence of the extended linked

polynucleotide is determinable.

BRIEF DESCRIPTION OF THE DRAWINGS

[0062] These and other features of the disclosure will become more apparent from the following description in which reference is made to the appended drawings wherein:

[0063] Fig. 1 is an illustration of an example of the relationship between a

polynucleotide, a template oligonucleotide, and an extended polynucleotide.

[0064] Figs. 2A-D are illustrations of one method according to the present disclosure where: Fig. 2A illustrates reverse transcribing first and second polynucleotides in the presence of first and second template oligonucleotides; Fig. 2B illustrates switching from transcribing the template polynucleotides to transcribing the template oligonucleotides generating first and second extended polynucleotides; Fig. 2C illustrates annealing the first extended polynucleotide and the second polynucleotide through their complementary sequences; and Fig. 2D illustrates performing PCR to generate a linked polynucleotide having a sequence comprising the sequences of the first and second polynucleotides.

[0065] Figs. 3A-D are an alternative illustration of the method illustrated in Figs. 2A-

D.

[0066] Fig. 4 is a flow chart illustrating a method according to the present disclosure. Fig. 5 is a picture of the PCR product run on an agarose gel.

Fig. 6 an illustration of the sequence confirming successful T-cell receptor a and beta subunit fusion and amplification.

DETAILED DESCRIPTION

Generally, the present disclosure provides, in part, a method for determining the nucleotide sequences at least two polynucleotides of, for example, a multimeric protein, in a single sequencing run. Such methods may be useful in determining the sequences of polynucleotides that, for example, encode the alpha and beta subunits of a T-cell receptor (TCR), or the heavy and light chains of a B-cell receptor (BCR), in a single sequencing run such that it is possible to determine the sequences of naturally-occurring alpha and beta subunit or heavy and light chain pairs. In some embodiments, methods according to the present disclosure may be carried out in parallel, using for example, micro-titre plates or by emulsion PCR, allowing comprehensive profiling of immune repertoires, such as alpha and beta TCR repertoires or heavy and light chain antibody (BCR) repertoires, to determine antigen specificities. In some embodiments, determination of the sequences of both subunits of a TCR or BCR will enable their use a probes, therapeutics, diagnostics and/or in functional studies. It is to be understood that, while the methods are described with respect to first and second polynucleotides, the methods are applicable to the sequencing of additional polynucleotides by, for example, using additional template and priming oligonucleotides. It is also to be understood that determination of the sequence of the at least two polynucleotides may be performed at a later time and therefore that the methods disclosed herein include methods for obtaining a polynucleotide in sufficient quantities for determination of its sequence.

[0070] In some embodiments, the method includes:

b) providing a first template oligonucleotide;

f) providing a reverse transcriptase;

polynucleotide;

I) determining the sequence of the extended linked polynucleotide.

[0071] In alternative embodiments, the disclosure provides a method for obtaining a polynucleotide for determination of its sequence, the method comprising:

b) providing a first template oligonucleotide;

e) providing a second priming oligonucleotide and a fourth priming

f) providing a reverse transcriptase;

polynucleotide;

polynucleotides; and

polynucleotide is determinable.

[0072] The terms "polynucleotide," "nucleic acid" or "nucleic acid molecule" encompass both RNA (plus and minus strands) and DNA, including cDNA, genomic DNA, and synthetic (e.g., chemically synthesized) DNA. The nucleic acid may be double-stranded or single-stranded. Where single-stranded, the nucleic acid may be the sense strand or the antisense strand. A nucleic acid molecule may be any chain of two or more covalently bonded nucleotides, including naturally occurring or non-naturally occurring nucleotides, or nucleotide analogs or derivatives. By "RNA" is meant a sequence of two or more covalently bonded, naturally occurring or modified ribonucleotides. One example of a modified RNA included within this term is phosphorothioate RNA. By "DNA" is meant a sequence of two or more covalently bonded, naturally occurring or modified deoxyribonucleotides. By "cDNA" is meant complementary or copy DNA produced from an RNA template by the action of RNA- dependent DNA polymerase (reverse transcriptase). Thus a "cDNA clone" means a duplex DNA sequence complementary to an RNA molecule of interest, carried in a cloning vector. By "complementary" is meant that two nucleic acids, e.g., DNA or RNA, contain a sufficient number of nucleotides which are capable of forming Watson-Crick base pairs to produce a region of double-strandedness between the two nucleic acids. Thus, adenine in one strand of DNA or RNA pairs with thymine in an opposing complementary DNA strand or with uracil in an opposing complementary RNA strand. It will be understood that each nucleotide in a nucleic acid molecule need not form a matched Watson-Crick base pair with a nucleotide in an opposing complementary strand to form a duplex. A nucleic acid molecule is "annealable" or "complementary" to another nucleic acid molecule if it hybridizes, under conditions of moderate or high stringency, as desired, with the second nucleic acid molecule. The term "nucleic acid" and "polynucleotide" are used interchangeably herein to describe a polymer of any length, e.g., greater than about 2 bases, greater than about 10 bases, greater than about 100 bases, greater than about 500 bases, greater than 1000 bases, up to about 10,000 or more bases composed of nucleotides, e.g., deoxyribonucleotides or ribonucleotides, and may be produced enzymatically or synthetically which can hybridize with naturally occurring nucleic acids in a sequence specific manner analogous to that of two naturally occurring nucleic acids, e.g., can participate in Watson-Crick base pairing interactions. The term "oligonucleotide" as used herein, whether referring to a template oligonucleotide or a priming oligonucleotide, denotes a single-stranded multimer of nucleotides of from about 2 to 500 nucleotides in length or any number in between. For example, an oligonucleotide may be 10 to 20, 11 to 30, 31 to 40, 41 to 50, 51-60, 61 to 70, 71 to 80, 80 to 100, 100 to 150, 150 to 200, nucleotides in length or more. Oligonucleotides may contain ribonucleotide monomers (i.e., may be oligoribonucleotides) or deoxyribonucleotide monomers. In the context of the present disclosure, two polynucleotides or oligonucleotides that "anneal" or "are annealable" or "are complementary" refer to two polynucleotides or oligonucleotides that can form

Watson-Crick base pairs where one of the two polynucleotides or oligonucleotides is in a 5' → 3' orientation and the other of the two polynucleotides or oligonucleotides is in a 3'→ 5' orientation. It should be understood that each nucleotide residue in an "annealable" polynucleotide or oligonucleotide need not form an exact, matched Watson-Crick base pair with a nucleotide in an opposing complementary strand, to form a duplex and be considered "annealable"; rather, two polynucleotides or oligonucleotides that are annealable need only form sufficient base pairs to allow the methods according to the present disclosure to be performed.

[0073] The term "hybridization" refers to the process by which a strand of nucleic acid joins with a complementary strand through base pairing as known in the art. A nucleic acid is considered to be "Selectively hybridizable" to a reference nucleic acid sequence if the two sequences specifically hybridize to one another under moderate to high stringency hybridization and wash conditions. Moderate and high stringency hybridization conditions are known (see, e.g., Ausubel, et al., Short Protocols in Molecular Biology, 3rd ed., Wiley & Sons 1995 and Sambrook et al., Molecular Cloning: A Laboratory Manual, Third Edition, 2001 Cold Spring Harbor, N.Y., and updates thereto). One example of high stringency conditions include hybridization at about 42°C in 50% formamide, 5XSSC, 5XDenhardt's solution, 0.5% SDS and 100 ug/ml denatured carrier DNA followed by washing two times in 2XSSC and 0.5% SDS at room temperature and two additional times in 0.1XSSC and 0.5% SDS at 42°C. In other examples, high stringency conditions include a buffer containing 0.5 NaHP0₄, pH 7.2, 7% SDS, 1 mM EDTA, and 1 % BSA (fraction V) at a temperature of 65°C.

[0074] In general, the first and the second polynucleotides each include a known sequence and an unknown sequence, the known sequence being positioned 3' to the unknown sequence. For example, the known sequence can be a sequence derived from the constant region of a TCR or BCR and the unknown sequence can be the associated antigenic sequence.

[0075] At least a portion of the first and the second template oligonucleotides is annealable to at least a portion of the sequence of the second template oligonucleotide i.e., the first and the second template oligonucleotides need not be annealable throughout their full sequences as long as there is a sufficient region of complementarity that allows annealing of the first and the second template oligonucleotides to each other. Determination of sequences sufficient to permit annealing are known to those of skill in the art. The first and the second polynucleotides can be annealed or "linked" through a linking portion that includes the portion of the sequences of the first and the second template oligonucleotides that are annealable to each other.

[0076] In some embodiments, methods according to the present disclosure use reverse transcription to generate first and second extended polynucleotides, and anneal the first and the second extended polynucleotides prior to performing PCR. In some

embodiments, methods according to the present disclosure do not use amplification techniques, such as PCR, to generate the extended polynucleotides.

[0077] In the context of the present disclosure, a pair of template oligonucleotides would be understood to refer to a pair of oligonucleotides. In some embodiments, the first template oligonucleotide includes a first sequence that is annealable to a sequence of a first polynucleotide, and a second sequence that is annealable to the second template

oligonucleotide. In some embodiments, the second template oligonucleotide includes a first sequence that is annealable to a sequence of a second polynucleotide, and a second sequence that is annealable to the first template oligonucleotide.

[0078] In some examples, the sequence of the first template oligonucleotide includes: a first sequence towards the 3' end of the first template oligonucleotide, the first sequence being annealable to non-template nucleotides (such as those added by a reverse

transcriptase) towards the 3' end of the complement of the first polynucleotide, and a second sequence towards the 5' end of the first template oligonucleotide, the second sequence being annealable to the second template oligonucleotide; and the sequence of the second template oligonucleotide includes: a first sequence towards the 3' end of the second template oligonucleotide, the first sequence being annealable to non-template nucleotides (such as those added by a reverse transcriptase) towards the 3' end of the complement of the second polynucleotide, and a second sequence towards the 5' end of the second template oligonucleotide, the second sequence being annealable to the first template oligonucleotide.

[0079] In some embodiments, template oligonucleotides are at least 20 nucleotides in length.

[0080] In some embodiments, a pair of template oligonucleotides may include a palindromic sequence at least 4 base pairs in length. A palindromic sequence refers to a nucleotide sequence locus whose 5'→ 3' sequence is identical on each strand. The sequence is the same when one strand is read left to right and the other strand is read right to left. Recognition sites of many restriction enzymes are palindromic. After the sequence of the linked extended polynucleotide is determined, if the pair of template oligonucleotides includes a recognition site of a restriction enzyme, the linked polynucleotide may be cleaved to provide separate polynucleotides that encode first and the second proteins. The separate polynucleotides may be, for example, inserted into expression vectors. The expressed proteins may be used, for example, in a binding assay.

[0081] In the context of the present disclosure, an extended polynucleotide would be understood to refer to a polynucleotide that includes a sequence that is substantially complementary to a template sequence and further includes an additional sequence towards the 3' end of the extended polynucleotide that is substantially complementary to the template oligonucleotide.

[0082] It is understood that transcription techniques may introduce errors in a complementary sequence. Accordingly, substantially complementary would be understood to mean that the complementary sequence may contain bases that are not complementary to their template bases, but that the template sequence and the complementary sequence hybridize under high stringency conditions. In some examples, complementary sequences are at least 80% identical to their template sequences and vice versa, such as at least 85%, 90%, 95% or 99% identical to their template sequences and vice versa. In other examples, complementary sequences are at least 99.9% identical to their template sequences and vice versa.

[0083] An example of the relationship between a polynucleotide, a template oligonucleotide, and an extended polynucleotide is illustrated in Fig. 1. The polynucleotide (10) is the template for transcription to generate the extended polynucleotide (12). The template oligonucleotide (14) provides the template for an additional sequence (16) towards the 3' end of the extended polynucleotide (12). The additional sequence is substantially complementary to the template oligonucleotide (14).

[0084] Transcribing may further include priming the transcriptase with a first priming oligonucleotide that anneals a known sequence that is towards the 3' end of the first polynucleotide, and a second priming oligonucleotide that anneals a known sequence that is towards the 3' end of the second polynucleotide. In subsequent amplification steps, such as PCR steps, a third priming oligonucleotide that anneals a known sequence that is towards the 3' end of the first polynucleotide, and a fourth priming oligonucleotide that anneals a known sequence that is towards the 3' end of the second polynucleotide can be used. The sequences of the third priming oligonucleotide and fourth priming oligonucleotide may be the same or may be different from the sequences of the first priming oligonucleotide and second priming oligonucleotide.

[0085] A priming oligonucleotide may anneal to different polynucleotides of interest.

For example, the method may be used to determine the sequences of alpha subunits of different T-cell receptors. In such a situation, a single priming oligonucleotide may be used that anneals to the polynucleotides that encode the alpha subunits of the different T-cell receptors. The same priming oligonucleotide may then be used to prime the transcriptase for all of the different polynucleotides of interest. The priming oligonucleotide may anneal to a substantially conserved region shared by the different polynucleotides of interest. It should be understood that in the context of the present disclosure, a substantially conserved region would share at least 80%, 85% or 90% sequence identity. In some examples, a substantially conserved region would share at least 95% or 99% sequence identity.

[0086] In the context of the present disclosure, priming oligonucleotides anneal to a target polynucleotide to serve as a starting point for DNA synthesis. Examples include, but are not limited to: oligodT primers, random primers and sequence-specific primers. The primers should be annealable to the first and second polynucleotides under standard PCR conditions. In one example, the priming oligonucleotides can be annealable at 42 °C during first strand cDNA synthesis. In another example, the priming oligonucleotides can be annealable at 65 °C and 72 °C during PCR amplification.

[0087] The priming oligonucleotides may be annealable to conserved sequences of

T-cell receptors or B-cell receptors. Such conserved sequences of TCRs and BCRs are known in the art as, for example, disclosed in the Immunogenetics (IMGT) database

(www[dot]imgt[dot]org; see also, Giudicelli, V. et al., Nucleic Acids Res., 34: D781-D784 (2006)) which lists many T-cell receptor and B-cell receptor gene segments. Accordingly, one skilled in the art may use routine techniques to design a priming oligonucleotide that will, for example, anneal to conserved sequences in the TCR alpha subunit, the TCR beta subunit, the BCR heavy chain, or the BCR light chain.

[0088] The first priming oligonucleotide may be complementary to the T-cell receptor alpha subunit constant gene TRAC. The sequence of the first priming oligonucleotide may be, for example: 5'<CATTTGTTTGAGAATCAAAATCGGTGA<3' (SEQ ID NO: 1 ; TCRA-5 priming oligonucleotide), 5'<AGGCAGACAGACTTGTCACTGGATT<3' (SEQ ID NO: 2; TCRA-3 priming oligonucleotide), or 5'<CTCAGCTGGTACACGGCAGGGTCA<3' (SEQ ID NO: 3; TCRA-1 priming oligonucleotide).

[0089] The second priming oligonucleotide may be complementary to T-cell receptor beta subunit constant gene TRBC. The sequence of the second priming oligonucleotide may be, for example: 5'<CACGTGGTCGGGGWAGAAGC<3' (SEQ ID NO: 4; C6 priming oligonucleotide), 5'<TCTCTGCTTCTGATGGCTCAAAC<3' (SEQ ID NO: 5; C9B priming oligonucleotide), or 5'<AGCGACCTCGGGTGGGAACA<3' (SEQ ID NO: 6; C14 priming oligonucleotide).

[0090] The first priming oligonucleotide may be complementary to the B-cell receptor heavy chain constant gene. The sequence of the first priming oligonucleotide may be, for example: 5'<AYCCAGGAGGCCCCAGAGCWCA<3' (SEQ ID NO: 7),

5'<CCTCCTCMGGTCAGCCCYGGACAT<3' (SEQ ID NO: 8), or

5'<CCCAGGACGCAGCACCRCTGTCAA<3' (SEQ ID NO: 9).

[0091] The second priming oligonucleotide may be complementary to B-cell receptor light chain constant gene. The sequence of the second priming oligonucleotide may be, for example: 5'<AGAGATCTCAGGACAGGTGGTCAGG<3' (SEQ ID NO: 10) or

5'<AGCAACAACAAGTACGCGGCCAGCAGCTA<3' (SEQ ID NO: 11).

[0092] Reverse transcribing includes reverse transcribing using a reverse

transcriptase having a terminal nucleotidyl transferase-like activity. Reverse transcribing may be accomplished using a Moloney murine leukemia virus reverse transcriptase, an avian myeloblastosis virus reverse transcriptase, or a functional variant thereof. Moloney murine leukemia virus reverse transcriptase has been described in Schmidt, W.M. and M. W.

Mueller. 1996. Nucleic Acids Res. 24: 1789-1791. One example of Moloney murine leukemia virus reverse transcriptase has accession number EMBL AAA66622.1. In the context of the present disclosure, a functional variant of a transcription enzyme would be understood to refer to a transcription enzyme that is substantially identical in sequence and exhibits substantially the same activity as the reference transcription enzyme.

[0093] Different species often have enzymes that achieve the same function but whose sequences have evolutionarily diverged. A variant transcription enzyme that is substantially identical in sequence to a reference transcription enzyme would be understood to refer to a variant transcription enzyme that is at least 60% identical to the reference transcription enzyme. In some examples, a variant transcription enzyme is substantially identical if it is at least 70% identical to the reference transcription enzyme. In other examples, a variant transcription enzyme is substantially identical if it is at least 80% identical to the reference transcription enzyme. In yet other examples, a variant transcription enzyme is substantially identical if it is at least 90% identical to the reference transcription enzyme. In particular examples, a variant transcription enzyme is substantially identical if it is at least 95% identical to the reference transcription enzyme.

[0094] A variant transcription enzyme that exhibits substantially the same activity as a reference transcription enzyme would be understood to refer to a variant transcription enzyme that is capable of producing a polynucleotide having a sequence that is substantially complementary to the sequence of the template polynucleotide.

[0095] One benefit of using a Moloney murine leukemia virus reverse transcriptase, or functional variant thereof, is that the transcriptase is capable of template switching.

Template switching is the ability of a transcription enzyme to transcribe two template sequences that are not linked. The Moloney murine leukemia virus reverse transcriptase, or functional variant thereof, operates by transcribing a template polynucleotide. Once the template polynucleotide is transcribed, the Moloney murine leukemia virus reverse transcriptase, or functional variant thereof, adds at least two non-template cytosine residues to the complement of the template polynucleotide. Other reverse transcriptases having a terminal nucleotidyl transferase-like activity may add fewer non-template residues to the complement of the template polynucleotide.

[0096] These at least two non-template cytosine residues are one example of non- template nucleotides towards the 3' end of the complement of the polynucleotide that is annealable to the first sequence of a template oligonucleotide. Addition of the template oligonucleotide anneals the template oligonucleotide to the at least two non-template cytosine residues and allows the Moloney murine leukemia virus reverse transcriptase to switch from the template polynucleotide and transcribe the sequence of the template oligonucleotide.

[0097] A functional variant that exhibits substantially the same activity as a reverse transcriptase having a terminal nucleotidyl transferase-like activity would be understood to refer to a transcription enzyme that is capable of: producing a polynucleotide having a sequence that is substantially complementary to the sequence of the template

polynucleotide; adding at least one non-template residue to the complement of the template polynucleotide; and switching from transcribing the template polynucleotide to transcribing a sequence of a template oligonucleotide annealed to the non-template residues.

[0098] Substantially the same activity refers to the variant reverse transcriptase having at least about 80%, for example about 90%, about 95% or about 100%, of the wild type reverse transcriptase activity, as determined by the activity assay disclosed in Blain & Goff, J. Biol. Chem. (1993) 268:23585-23592.

[0099] The first and the second template oligonucleotides each, independently, may have at least two terminal guanine nucleotides at their 3' ends. The first and the second template oligonucleotides may each, independently, be at least 20 nucleotides in length.

[00100] The first template oligonucleotide may include polynucleotides having the sequence of 5'<TGGTAACAACGCAGAGTACGCGGG<3' (SEQ ID NO: 12),

5'<AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG<3' (SEQ ID NO: 13), or 5'<CGCAAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG<3' (SEQ ID NO: 14). The second template oligonucleotide may independently include polynucleotides having the sequence of SEQ ID NO: 12, 13 or 14. The three guanine nucleotides at the 3' end anneals to the non-template oligonucleotides at the 3' end of the complement of the first and second polynucleotides.

[00101] The first template oligonucleotide has a sequence that is annealable to a sequence of the second template oligonucleotide. For example, the first template

oligonucleotide may include polynucleotides having the sequence of:

5'<CTAATACGACTCACTATAGGGCAAGCAG<3' (SEQ ID NO: 15) and the second template oligonucleotide may include polynucleotides having the sequence of

5'<CTGCTTGCCCTATAGTGAGTGTATTTAG<3' (SEQ ID NO: 16), or vice versa. In another example, the first template oligonucleotide may include polynucleotides having the sequence of: 5'<AATACGACTCACTATGGCAAGC<3' (SEQ ID NO: 17) and the second template oligonucleotide may include polynucleotides having the sequence of

5'<GCTTGCCATAGTGAGTGTATTT<3' (SEQ ID NO: 18), or vice versa. The sequences of SEQ ID NOs: 15 and 16, and the sequences of SEQ ID NO: 17 and 18, are examples of pairs of reverse complementary sequences that enable annealing and extension in the subsequent PCR reactions.

[00102] In view of the above, in one example, the first template oligonucleotide has the sequence 5 <CTAATACGACTCACTATAGGGCAAGCAG-

TGGTAACAACGCAGAGTACGCGGG<3' (SEQ ID NO: 19; X-LTS) and the second template oligonucleotide has the sequence 5 <CTGCTTGCCCTATAGTGAGTGTATTTAG-

TGGTAACAACGCAGAGTACGCGGG<3' (SEQ ID NO: 20; XR-LTS).

[00103] In another example, the first template oligonucleotide has the sequence 5'<AATACGACTCACTATGGCAAGCAAGCAGTGGTATCAACGCAGAGTGGCCATTACGG CCGGG<3' (SEQ ID NO: 21) and the second template oligonucleotide has the sequence 5'< GCTTGCCATAGTGAGTGTATTTCGCAAGCAGTGGTATCAACGCAGAGTGGCCATTACG GCCGGG<3' (SEQ ID NO: 22).

[00104] Reverse transcription to generate a full length, first strand cDNA may be performed using SMARTScribe™ Reverse Transcriptase purchased from Clonetech. In such a method, synthesis of a first strand cDNA is accomplished by adding 600U of

SMARTScribe™ Reverse Transcriptase to a reaction mixture containing: 300 ng of total T- cell RNA, 2.4 μΜ TCRA-5 priming oligonucleotide, 1 μΜ of C6 priming oligonucleotide, 1 μΜ of X-LTS template oligonucleotide, 1 μΜ of XR-LTS template oligonucleotide, 2 mM DTT, 1 mM of each dNTP, and 40 Units of RNaseOUT (Invitrogen). In such a method, cDNA synthesis is performed at 42 °C for 90 minutes followed by inactivation at 70°C for 15 minutes.

[00105] The method may also include performing PCR to amplify the linked polynucleotide.

[00106] In the context of the present disclosure, PCR would be understood to generally refer to a method for amplification of a desired nucleotide sequences in vitro. PCR has been described, for example, in U.S. Pat. No. 4,683, 195. In general, the method relies on thermal cycling consisting of cycles of heating and cooling of the reaction for DNA melting and primer extension synthesis using two oligonucleotide primers capable of annealing to a template nucleic acid. Typically, the primers used will be complementary to the nucleotide sequence flanking the nucleotide sequence to be amplified. As PCR progresses, the DNA generated is itself used as template for replication, setting in motion a chain reaction in which DNA template is exponentially amplified.

[00107] One example of PCR which may be used in methods according to the present disclosure may include using nested gene-specific oligonucleotides to prime PCR

amplification. In another example, a second set of nested gene-specific oligonucleotides may be used to prime additional PCR amplification. One benefit of using nested gene-specific primers is to reduce non-specific binding in products due to the amplification of unexpected primer binding sites. The use of nested gene-specific oligonucleotides for priming PCR amplification are well known to those skilled in the art of molecular biology.

[00108] Primers that bind the conserved sequence of T-cell and B-cell receptors (for example, primers having sequences of SEQ ID NOs: 1-1 1) may be also used as nested PCR primers in the first round PCR amplification and in subsequent rounds of PCR amplification. PCR may be performed on T-cell receptor cDNA by adding 0.5 μΜ of TCRA-1 primer (SEQ ID NO: 3) and 0.5 μΜ of C9B primer (SEQ ID NO: 5) to 0.5 uL of the first strand cDNA reaction in the presence of 1 Unit of Phusion DNA Polymerase (New England Biolabs), 1 X Phusion HF Buffer, 1.5 μΙ_ DMSO, and 200 μΜ of each dNTP to generate double stranded cDNA. The PCR reaction is carried out under normal PCR conditions, such as: 30 second denaturation at 98°C, followed by 26 cycles of 98 °C for 10 seconds, 65 °C for 100 seconds and 72 °C for 1 minute, followed by 72 °C for 5 minutes for a final extension. The PCR reaction products are loaded on a 1.5% LMP agarose gel and excised from the gel. The gel slice is digested by agarase and the DNA products are removed by phenol extraction and ethanol precipitation using standard methods. The DNA is then re-suspended in 10 μΙ_ of TRIS buffer.

[00109] Secondary PCR may be performed on the PCR products. Nested PCR primers that anneal to the conserved regions of the alpha and beta subunits of the T-cell receptor (for example, primers having sequences of SEQ ID NOs: 1-11) may be used to prime PCR polymerization. PCR may be performed using a TCRA-1 primer (SEQ ID NO: 3), and a C14 primer (SEQ ID NO: 6) to prime the PCR product for subsequent PCR

amplification under similar conditions as described above.

[00110] Determining the sequence of the linked polynucleotide refers to determining the order of the nucleotides within the polynucleotide. It may be accomplished by standard techniques known in the art. For example, it may be accomplished using: Maxam-Gilbert sequencing method, chain termination methods, shotgun sequencing, bridge PCR, massively parallel signature sequencing, polony sequencing, 454 pyrosequencing, lllumina (Solexa) sequencing, SOLiD sequencing, Ion Torrent semiconductor sequencing, DNA nanoball sequencing, Heliscope single molecule sequencing, Single molecule real time (SMRT) sequencing, nanopore DNA sequencing, Tunnelling currents DNA sequencing, sequencing by hybridization, sequencing with mass spectrometry, microfluidic Sanger sequencing, microscopy-based techniques, RNAP sequencing, in vitro virus high-throughput sequencing. [00111] In one example, the PCR reaction is loaded on a 1.5% LMP agarose gel and the reaction product is excised and purified by phenol/chloroform extraction and ethanol precipitation. The purified fragment is A-tailed and inserted into the vector pCR-4 using the recommended conditions for Invitrogen's TOPO® TA Cloning Kit and One Shot® MAX Efficiency® DH5a™-T1 R Competent cells. Plasmid DNA is prepared using standard alkaline lysis procedures and T3 and T7 vector primers are used to prime Sanger Sequencing reactions.

[00112] In some examples, the first polynucleotide and the second polynucleotide are polyribonucleotides (RNA) and the first extended polynucleotide and the second extended polynucleotides are polydeoxynbonucleotides (DNA). The polyribonucleotides may be from a single cell. In some embodiments, the first polynucleotide and the second polynucleotide may be messenger RNA.

[00113] Polynucleotides may be isolated from a variety of cells, such as T cells or B cells, obtained from healthy individuals, clinical patients, clinical trial volunteers, experimental animals, etc. In some embodiments, polynucleotides may be isolated from a single cell. The single cell may be isolated from a plurality of cells. Isolating a single cell from a plurality of cells refers to separating an individual cell of interest from a group of cells. It may be accomplished by standard techniques known in the art. For example, it may be accomplished using: single cell isolation using microfluidic systems, dilution, micromanipulation, flow cytometry, compartmentalization, emulsion PCR, or any combination thereof. In some embodiments, a "single cell" refers to a cell isolated from a plurality of cells as well as progeny thereof.

[00114] In some examples, the single cell is a T-cell. T-cell receptor sequencing has been instrumental in characterizing the nature of, and clinical variables affecting, immune repertoire recovery after hematopoietic stem cell transplantation, as well as developing biomarkers or diagnostics for various diseases, for example infectious or neoplastic diseases. Accordingly, the first polynucleotide may be a polynucleotide encoding an alpha subunit of a T-cell receptor, and the second polynucleotide may be a polynucleotide encoding a beta subunit of the T-cell receptor.

[00115] In the context of the present disclosure, T-cells would be understood to refer to a type of lymphocyte that recognizes and kills foreign or aberrant cells via T-cell receptors (TCRs) located on their cell surface. TCRs are formed from constant and variable domains and most comprise two similar but distinct "chains" or subunits - alpha and beta - each of which includes a constant domain and a variable domain. The variable domain determines what epitope the TCR binds to and, accordingly, what foreign or aberrant cell the T-cell recognizes.

[00116] Variability in the TCRs is accomplished by shuffling short DNA segments that comprise the T-cell receptor genes. By identifying a T-cell that is directed to an immunogenic epitope, and by knowing the sequence of the alpha and beta subunits of the TCR, one may, for example, create an immunogenic formulation against an infectious agent or a tumor antigen.

[00117] In some examples, the single cell is a B-cell. In further examples, the first polynucleotide is a polynucleotide encoding a heavy chain of a B-cell receptor, and the second polynucleotide is a polynucleotide encoding a light chain of the B-cell receptor.

[00118] In the context of the present disclosure, B-cells would be understood to refer to a type of lymphocyte that once activated, secretes antibodies. B-cells recognize antigens via their B-cell receptors (BCRs) on their cell surface. BCRs are formed from constant domains and variable domains which consist of four chains: two identical light chains and two identical heavy chains. The variable domains determine what epitope the BCR binds to and, accordingly, what antigens the B-cell recognizes.

[00119] Similar to TCRs, BCR variability is accomplished by shuffling short DNA segments that comprise B-cell receptor genes. By identifying a B-cell that is directed to an antigen of interest, and by knowing the sequence of the heavy and light chain domains of the BCR, one may, for example: generate antibodies against an acute infection, a latent infection, or a tumor antigen; or create antibodies against the identified sequences produced during an autoimmune disease, during an immune disorder, during complications caused by organ or bone marrow transplantation, or during antiretroviral therapy for HIV infection.

[00120] The sequences of the first and the second polynucleotides for each single cell may be determined as discussed above.

[00121] Determining first and second polynucleotide sequences for a plurality of cells in a population of cells may provide clonotype information about the population of cells. This may be desirable, for example, in order to determine clonotypes, such as to determine changes in the clonotypes over time or after an immune challenge, or to compare the clonotypes to a public clonotype. Clonotyping the population of cells, with respect to a given protein, would be understood to refer to a process of identifying the unique nucleotide sequences of the proteins in the population of cells. Clonotypes would be understood to refer to a population of cells that share a unique nucleotide sequence. A responsive clonotype refers to a clonotype that has an increase in the number of cells after an external stimulus, in comparison to their number before the immune challenge.

[00122] Clonotyping, and associated methods, are discussed in, for example, Warren, R.L. et al. Exhaustive T-cell repertoire sequencing of human peripheral blood samples reveals signatures of antigen selection and a directly measured repertoire size of at least 1 million clonotypes. Genome Res. 21 :79-797; Warren, R.L. et al. Profiling model T-cell metagenomes with short reads. Bioinformatics. 2009; 25(4):458-464.

[00123] When comparing clonotypes, it may be desirable to normalize the input data, for example, by unbiased removal of reads from larger data sets until they are of the size of the smallest comparator. After appropriate normalization, methods widely used in ecology have potential utility to compare immune repertoires. Examples include the Simpson diversity index for comparing diversity between samples (Venturi V, et al. Methods for comparing the diversity of samples of the T cell receptor repertoire. J Immunol Methods 2007, 321 : 182- 195), or the Mosisita-Horn similarity index for determining the similarity, or overlap, between samples (Venturi V, et al.: Method for assessing the similarity between subsets of the T cell receptor repertoire. J Immunol Methods 2008, 329:67-80).

[00124] A healthy individual may be expected to harbour several million readily measurable protein clonotypes, for example TCR beta chain clonotypes, that vary widely in abundance, some subset of which originates as recombinants with high generation probability and which can be shared across different T-cell compartments and, indeed among individuals. Accordingly, a public clonotype provides a picture of the typical immune repertoire. Comparing an individual's clonotype to a public clonotype may provide diagnostic insight into the individual's immune status.

[00125] The nucleotide sequences of the alpha and beta subunits of the TCRs may be used, for example: to create an immunogenic formulation against an infectious agent or a tumor antigen. Methods according to the present disclosure may, therefore, include:

determining the nucleotide sequences of the alpha and beta subunits of T-cell receptor clonotypes responsive to an immune challenge; identifying an immunogenic epitope using the sequences of the responsive T-cell receptor clonotypes; and generating an immunogenic formulation that includes the epitope.

[00126] In a further aspect, the present disclosure also provides a method for determining the nucleotide sequences of heavy and light chains of B-cell receptors (BCR) in a pool of B-cells by determining the nucleotide sequences, as discussed above, of the heavy and light chains of each B-cell in the pool of B-cells.

[00127] The nucleotide sequences of the heavy and light chains of the BCRs may be used, for example: to generate antibodies against an acute infection, a latent infection, or a tumor antigen; to create antibodies against the identified sequences produced during an autoimmune disease, during an immune disorder, during complications caused by organ or bone marrow transplantation, or during antiretroviral therapy for HIV infection. Methods according to the present disclosure may, therefore, include: determining the nucleotide sequences of the heavy and light chains of B-cell receptor clonotypes responsive to an immune challenge; and generating antibodies from the sequences of the responsive B-cell receptor clonotypes or generating antibodies to the sequences of the responsive B-cell receptor clonotypes.

[00128] Preparing antibodies from the heavy and light chain sequences of a B-cell receptor may be accomplished by standard techniques known in the art. For example, it may be accomplished by inserting the heavy and light chain sequences of a B-cell receptor into an expression vector, transfecting the expression vector into a cell line and purifying the antibodies from the cell extract.

[00129] Immune disorders would be understood to refer to any failure in the body's defense mechanism against infectious organisms wherein the body's defense mechanism affects the B-cell and T-cell repertoires. Repertoire, in the context of the present disclosure would be understood to refer to the collection of B-cells or T-cells, for example the collections of B-cells before and after exposure to a particular pathogen.

[00130] During the recovery of the immune system following a bone marrow transplantation, or during the initiation of antiretroviral therapy for HIV infection, the immune system may respond to a previously acquired opportunistic infection with an inflammatory response that makes symptoms of the infection worse. Antibodies against the inflammatory response may be used to reduce such a response.

[00131] Initiation of highly active antiretroviral therapy for HIV infection would be understood to refer to initial administration of multiple drugs used to control HIV infection, where the drugs affect the number and types of B-cells and T-cells.

[00132] T-cell or B-cell clonotyping would be understood to refer to a process of identifying the unique nucleotide sequences of T-cell or B-cell receptors, respectively. T-cell and B-cll clonotypes would be understood to refer to a population of T-cell and B-cells, respectively, that share a unique nucleotide sequence that arises during the gene rearrangement process for that cell's receptor. A responsive T-cell or B-cell clonotype refers to a T-cell or B-cell clonotype, respectively, that has an increase in the number of T-cell or B- cell after an immune challenge, in comparison to their number before the immune challenge.

[00133] In the context of the present disclosure, an immune challenge refers to a challenge that generates an immune response, which may generally refer to a response of the adaptive immune system, such as a humoral response, or a cell-mediated response. The humoral response is the aspect of immunity that is mediated by secreted antibodies, produced by B-cells. Secreted antibodies bind to antigens on the surfaces of invading microbes (such as viruses or bacteria), which flags them for destruction. Humoral immunity is used generally to refer to antibody production and the processes that accompany it, as well as the effector functions of antibodies, including Th2 cell activation and cytokine production, memory cell generation, opsonin promotion of phagocytosis, pathogen elimination and the like. A cell-mediated response may refer to an immune response that does not involve antibodies but rather involves the activation of macrophages, natural killer cells (NK), antigen-specific cytotoxic T-lymphocytes, and the release of various cytokines in response to an antigen. Cell-mediated immunity may generally refer to some Th cell activation, Tc cell activation and T-cell mediated responses.

[00134] An autoimmune response would be understood to refer to when the immune system fails to properly distinguish between self and non-self, resulting in the immune system attacking part of the body, wherein B-cells and T-cells react with "self" antigens.

[00135] In the context of the present disclosure, an acute infection would be understood to refer to a short term invasion of the host's bodily tissue by disease-causing organisms, their multiplication, and the reaction of host tissues to these organisms and the toxins they produce. A latent infection would be understood to refer to a persistent infection that has periods of dormancy.

[00136] Complications caused by organ transplantation would be understood to refer to when transplanted tissue is rejected by the recipient's immune system. [00137] The disclosure also provides a kit for determining the nucleotide sequences of a first polynucleotide and a second polynucleotide. The kit includes a first template oligonucleotide; and a second template oligonucleotide; where the first template

oligonucleotide is annealable to the second template oligonucleotide, and where the first and the second template oligonucleotides each, independently, have at least two terminal guanine nucleotides at their 3' ends.

[00138] The kit may also include a Moloney murine leukemia virus reverse

transcriptase, or a functional variant thereof.

[00139] The first and the second template oligonucleotides may each, independently, be at least 20 nucleotides in length.

[00140] The first and second template oligonucleotides may have, independently, sequences that include the sequence of any one of SEQ ID NOs: 12-14.

[00141] In one example, the first template oligonucleotide has a sequence that includes the sequence of SEQ ID NO: 15 or 16, and the second template oligonucleotide has a sequence that includes the other of sequence of SEQ ID NO: 15 or 16. In another example, the first template oligonucleotide has a sequence that includes the sequence of SEQ ID NO: 17 or 18, and the second template oligonucleotide has a sequence that includes the other of sequence of SEQ ID NO: 17 or 18.

[00142] In a particular example, the first template oligonucleotide has a sequence that includes the sequence of SEQ ID NO: 19, and the second template oligonucleotide has a sequence that includes the other of sequence of SEQ ID NO: 20. In another particular example, the first template oligonucleotide has a sequence that includes the sequence of SEQ ID NO: 21 , and the second template oligonucleotide has a sequence that includes the other of sequence of SEQ ID NO: 22.

[00143] The sequence of the first template oligonucleotide may include a first sequence towards the 3' end of the first template oligonucleotide, the first sequence being annealable to non-template nucleotides towards the 3' end of the complement of the first polynucleotide, and a second sequence towards the 5' end of the first template

oligonucleotide, the second sequence being annealable to the second template

oligonucleotide.

[00144] The sequence of the second template oligonucleotide may include a first sequence towards the 3' end of the second template oligonucleotide, the first sequence being annealable to non-template nucleotides towards the 3' end of the complement of the second polynucleotide, and a second sequence towards the 5' end of the second template oligonucleotide, the second sequence being annealable to the first template oligonucleotide.

[00145] The first template oligonucleotide and the second template oligonucleotide may be polyribonucleotides.

[00146] The kit may further include a first priming oligonucleotide and a second priming oligonucleotide where the first priming oligonucleotide has a sequence that is annealable to a first sequence towards the 3' end of the first polynucleotide and the second priming oligonucleotide has a sequence that is annealable to a second sequence towards the 3' end of the second polynucleotide.

[00147] In some examples, the first polynucleotide is a polynucleotide encoding an alpha subunit of a T-cell receptor (TCR), where the first priming oligonucleotide is annealable to the first polynucleotide.

[00148] In some examples, the second polynucleotide is a polynucleotide encoding a beta subunit of the TCR, where the second priming oligonucleotide is annealable to the second polynucleotide.

[00149] In other examples, the first polynucleotide is a polynucleotide encoding an alpha subunit of a TCR, and the first priming oligonucleotide is annealable to the first polynucleotide, and the second polynucleotide is a polynucleotide encoding a beta subunit of the TCR, and the second priming oligonucleotide is annealable to the second polynucleotide.

[00150] The first priming oligonucleotide may be complementary to the T-cell receptor alpha subunit constant gene TRAC. The sequence of the first priming oligonucleotide may be, for example: SEQ I D NO: 1 , 2 or 3.

[00151] The second priming oligonucleotide may be complementary to T-cell receptor beta subunit constant gene TRBC. The sequence of the second priming oligonucleotide may be, for example: SEQ ID NO: 4, 5, or 6.

[00152] In some examples, the first polynucleotide is a polynucleotide encoding a heavy chain of a B-cell receptor (BCR), wherein the first priming oligonucleotide is annealable to the first polynucleotide.

[00153] In some examples, the second polynucleotide is a polynucleotide encoding a light chain of the BCR, where the second priming oligonucleotide is annealable to the second polynucleotide. [00154] In other examples, the first polynucleotide is a polynucleotide encoding a heavy chain of a BCR, and the first priming oligonucleotide is annealable to the first polynucleotide, and the second polynucleotide is a polynucleotide encoding a light chain of the BCR, and the second priming oligonucleotide is annealable to the second polynucleotide.

[00155] The first priming oligonucleotide may be complementary to the B-cell receptor heavy chain constant gene. The sequence of the first priming oligonucleotide may be, for example: SEQ ID NO: 7, 8, or 9.

[00156] The second priming oligonucleotide may be complementary to B-cell receptor light chain constant gene. The sequence of the second priming oligonucleotide may be, for example: SEQ ID NO: 10 or 1 1.

[00157] In a further aspect, the disclosure provides a pair of replicable vectors encoding: a first template oligonucleotide; and a second template oligonucleotide; where the first template oligonucleotide is annealable to the second template oligonucleotide, and where the first and the second template oligonucleotides each, independently, have at least two terminal guanine nucleotides at their 3' ends.

[00158] In yet another aspect, the disclosure provides a pair of bacteria, each bacteria transfected with one of the pair of replicable vectors, the pair of bacteria capable of expressing the first and second template oligonucleotides.

[00159] In still another aspect, the disclosure provides a pair of viruses, each virus comprising one of the pair of replicable vectors.

[00160] In a further aspect, the present disclosure provides a method for determining the nucleotide sequences of alpha and beta subunits of T-cell receptors (TCR) in a pool of T- cells by determining the nucleotide sequences, as discussed above, of the alpha and beta subunits of each T-cell in the pool of T-cells.

[00161] One example of a method according to the present disclosure is illustrated in Figs. 2A-D, as follows.

[00162] A first polynucleotide (210) is the template for transcription to generate the complementary sequence of the first polynucleotide (212). A second polynucleotide (214) is the template for transcription to generate the complementary sequence of the second polynucleotide (216). Transcription of the first polynucleotide and the second polynucleotide, in the presence of the first template oligonucleotide (218) and the second template oligonucleotide (220), is illustrated in the schematic diagrams following the two dashed arrows in Fig. 2A.

[00163] A Moloney murine leukemia virus reverse transcriptase adds three non- template cytosine residues (222) towards the 3' end of the complement of the first polynucleotide (212) and adds three non-template cytosine residues (224) towards the 3' end of the complement of the second polynucleotide (216), as illustrated by the schematic diagram following the first of the two dashed arrows in Fig. 2A.

[00164] The first template oligonucleotide (218) has a first sequence (226) of three guanine residues that can anneal to the three non-template cytosine residues (222) added by the Moloney murine leukemia virus reverse transcriptase, and a second sequence (228) that is annealable to the second template oligonucleotide (220), as illustrated in the schematic diagram following the second of the two dashed arrows in Fig. 2A.

[00165] The second template oligonucleotide (220) has a first sequence (230) of three guanine residues that can anneal to the three non-template cytosine residues (224) added by the Moloney murine leukemia virus reverse transcriptase, and a second sequence (232) that is annealable to the first template oligonucleotide (218), as illustrated in the schematic diagram following the second of the two dashed arrows in Fig. 2A.

[00166] After transcription of the first and second polynucleotides, the Moloney murine leukemia virus reverse transcriptase then transcribes the first and second template oligonucleotides which are annealed to the three non-template cytosine residues added by the virus to the complements of the first and second polynucleotides, generating the first extended polynucleotide (234) and the second extended polynucleotide (236), as illustrated in Fig. 2B. The first extended polynucleotide (234) therefore includes the complement of the second sequence of the first template oligonucleotide (238) as well as the three cytosine residues (222) added by the Moloney murine leukemia virus reverse transcriptase, in addition to the complement of the sequence of the first polynucleotide (212). The second extended polynucleotide (236) includes the complement of the second sequence of the second template oligonucleotide (240) as well as the three cytosine residues (226) added by the Moloney murine leukemia virus reverse transcriptase, in addition to the complement of the sequence of the second polynucleotide (216).

[00167] The templates (210 and 214) may be degraded using RNAse or otherwise dissociated from their complementary extended polynucleotides using routine techniques. The first extended polynucleotide (234) and the second extended polynucleotide (236) are then annealed to each other through the complement of the second sequence of the first oligonucleotide (238) and the second sequence of the second oligonucleotide (240), as illustrated in Fig. 2C.

[00168] As illustrated in Fig. 2D, performing PCR amplification adds additional nucleotides to the 3' end of the first extended polynucleotide (234) using the annealed second extended polynucleotide (236) as a template; and adds additional nucleotides to the 3' end of the second extended polynucleotide (236) using the annealed second extended polynucleotide (234) as a template; thereby generating a linked or fused polynucleotide (240) having a sequence comprising the sequences of the first and the second polynucleotides.

[00169] An alternative figure illustrating the method described above is shown in Figs. 3A-C.

[00170] Fig. 3A illustrates reverse transcription of the first and second polynucleotides in the presence of first and second priming oligonucleotides (a-1 and β-1), as well as first and second template oligonucleotides (TS-1 and TS-2). The shaded portions refer to portions of the template oligonucleotides that are annealable to each other. The reverse transcription results in first and second extended polynucleotides.

[00171] Fig. 3B illustrates annealing the first and second extended polynucleotides through the complementary sequences of shaded portions of TS-1 and TS-2; and performing polymerase chain reaction (PCR) in the presence of priming oligonucleotides (a-2 and β-2) to generate a linked polynucleotide.

[00172] Fig. 3C illustrates additional PCR amplification in the presence of priming oligonucleotides (a-3 and β-3) to amplify the linked polynucleotide. Determining the sequence of the linked polynucleotide is not illustrated.

[00173] Another example of a method according to the present disclosure is illustrated in Fig. 4 and includes:

• obtaining a plurality of B-cells before an immune challenge (310) and obtaining a plurality of B-cells after an immune challenge (312);

• isolating a single B-cell from the pluralities of B-cells (314 and 314'), where the first and the second polynucleotides correspond to the heavy and light chains, respectively, of the B-cell receptor;

• determining the sequence of the first and the second polynucleotides (316 and 316') by: annealing a first priming oligonucleotide to the first polynucleotide and a second priming oligonucleotide to the second polynucleotide; transcribing the first polynucleotide in the presence of a first template oligonucleotide to generate a first extended polynucleotide and transcribing the second polynucleotide in the presence of a second template oligonucleotide to generate a second extended polynucleotide, wherein the first template oligonucleotide is annealable to the second template oligonucleotide; annealing the first and second extended polynucleotides through the complementary sequences of the first and second template oligonucleotides;

performing polymerase chain reaction (PCR) to generate a linked polynucleotide having a sequence comprising the sequences of the first and the second

polynucleotides; and determining the sequence of the linked polynucleotide;

isolating a subsequent single B-cell from the pluralities of B-cells (314 and 314'); determining the sequences of the first and second polynucleotides of the subsequent single B-cell (316 and 316'), as discussed above;

· repeating the process with additional single B-cells isolated from the pluralities of B- cells (314, 314', 316 and 316');

comparing variable regions of the sequences of the different B-cell receptors for the B-cells obtained before the immune challenge (318);

comparing variable regions of the sequences of the different B-cell receptors for the B-cells obtained after the immune challenge (318');

identifying a responsive B-cell clonotype (320) based on an increase in the number of cells having a shared variable region;

generating an antibody (322) using a sequence of the B-cell receptor of the responsive B-cell clonotype.

[00174] The method may further include identifying other responsive B-cell clonotypes based on other shared variable regions.

[00175] In another aspect, the present disclosure provides a method for determining nucleotide sequences of a first polynucleotide and a second polynucleotide in a plurality of cells, the first and the second polynucleotides encoding a T-cell receptor or a B-cell receptor.

[00176] The method may include: isolating a single cell from the plurality of cells, the first polynucleotide and the second polynucleotide being from the single cell; generating a first extended polynucleotide that includes: (i) a first additional sequence and (ii) a sequence that is complementary to the first polynucleotide; generating a second extended polynucleotide that includes: (iii) a second additional sequence and (iv) a sequence that is complementary to the second polynucleotide, where the first additional sequence is annealable to the second additional sequence; annealing the first and second extended polynucleotides through the first and the second additional sequences; performing polymerase chain reaction (PCR) to generate a linked polynucleotide having a sequence comprising the sequences of the first and the second polynucleotides; and determining the sequence of the linked polynucleotide.

[00177] Generating the first extended polynucleotide and generating the second extended polynucleotide may include: ligating a first 5' adenylated 3' blocked

oligonucleotidedeoxynucleotide to the 3' end of the first polynucleotide using an RNA ligase in the absence of adenosine triphosphate; and ligating a second 5' adenylated 3' blocked oligonucleotidedeoxynucleotide to the 3' end of the second polynucleotide using an RNA ligase in the absence of adenosine triphosphate; where the first 5' adenylated 3' blocked oligonucleotidedeoxynucleotide includes the first additional sequence, and the second 5' adenylated 3' blocked oligonucleotidedeoxynucleotide includes the second additional sequence; and where performing polymerase chain reaction includes performing a reverse transcription polymerase chain reaction.

[00178] Generating the first extended polynucleotide and generating the second extended polynucleotide may include: reverse transcribing the first polynucleotide in the presence of a first priming oligonucleotide to generate a first complementary DNA (cDNA); reverse transcribing the second polynucleotide in the presence of a second priming oligonucleotide to generate a second cDNA; polishing the first and the second cDNA to generate blunt ends; ligating a first double stranded linker to the blunt end of the first cDNA and ligating a second double stranded linker to the blunt end of the second cDNA using a DNA ligase, where the first and the second double stranded linkers comprise recognition sites for a restriction enzyme; and cleaving the first and the second double stranded linkers using the restriction enzyme, where: the cleaved first double stranded linker provides the first additional sequence, and the cleaved second double stranded linker provides the second additional sequence, the first additional sequence being annealable to the second additional sequence. Example 1. TCR alpha and beta chain pairwise amplification and sequencing.

[00179] Total RNA from Jurkat cells, a T-cell line expressing a defined alpha-beta- TCR, was obtained from Ambion (Cat# AM7858). First strand cDNA was synthesized using, in the same reaction, the TCRA-5 primer (complementary to the TCR alpha chain constant gene TRAC), and the C6 primer (complementary to the TCR beta chain constant gene

TRBC). Also in the same reaction equal amounts of X-LTS and XR-LTS were added to serve as template switching oligonucleotides for extension of 1 st strand cDNA. The X-LTS and XR- LTS oligonucleotides are tailed with sequences that are reverse complements of one another, to enable anealing and extension in the subsequent PCR. Reaction conditions for cDNA synthesis were: 300 ng Jurkat total RNA, 2.4 μΜ TCRA-5, 1 μΜ each of C6, X-LTS and XR-LTS, 2 mM DTT, 1 mM each dNTP, 1x Clonetech 5x fist strand buffer, 40 Units of RNaseOUT (Invitrogen) and 600 Units of SMARTscribe reverse transcriptase (Clontech) in a 20 μΙ volume. Extension was at 42 °C for 90 minutes followed by inactivation at 70 °C for 15 minutes.

[00180] Primary fusion PCR was performed using 0.5 μΙ of first strand cDNA reaction as template, with nested TCR beta chain primer C9B, and TCR alpha chain primer TCRA-3. Reaction Conditions were 1 Unit of Phusion DNA Polymerase (NEB), 1x Phusion HF buffer, 1.5 μΙ DMSO, dNTPs 200 μΜ each and primers 0.5 μΜ each in a 50 μΙ total reaction volume. A 30 second denaturation at 98 °C was followed by 26 cycles of 98 °C for 10 seconds, 65 °C for 100 seconds and 72 °C for 1 minute, plus a final extension at 72 °C for 5 minutes. Note that although fusions products may be both TCR alpha or both TCR beta, these are expected to amplify poorly due to suppressive self-annealing, such that the main PCR product is heterodimeric alpha and beta chain.

[00181] The PCR reaction was loaded on a 1.5% LMP agarose gel and products centered between 1 Kb and 1.6 Kb were excised from the gel. The gel slice was digested by agarase and DNA was recovered by phenol extraction and ethanol precipitation using standard methods, then re-suspended in 10 μΙ of 10 mM Tris pH = 8 and 0.1 mM EDTA.

[00182] Secondary PCR was performed using 0.5 μΙ of gel purified primary PCR template with nested TCR beta chain primer C14, and nested TCR alpha chain primer TCRA-1. Reaction conditions for the secondary PCR were as for primary PCR, discussed above.

[00183] The secondary PCR reaction mixture was loaded on a 1.5% LMP agarose gel Fig. 5 shows the agarose gel. The lane on the right shows a DNA ladder used for size reference. The arrow signifies the PCR product is of an expected size (1.3kbp). The 1.3 Kb fusion product was excised and extracted from the gel as indicated above.

[00184] Purified fragment was A-tailed and inserted into the vector pCR-4 using the recommended conditions for Invitrogen's TOPO® TA Cloning Kit and One Shot® MAX Efficiency® DH5a™-T1 R Competent-cells. Plasmid DNA was prepared using standard alkaline lysis procedures and T3 and T7 vector primers were used to prime Sanger

Sequencing reactions.

[00185] The sequence was decoded. Fig. 6 shows the sequence of a linking portion of one strand of the linked oligonucleotide, where the linking portion links polynucleotides that encode the alpha and beta subunits of a T-cell receptor. The linking portion illustrated in Fig. 6 is generated through a method according to the present disclosure where the first template oligonucleotide has a sequence according to SEQ ID NOs: 19 and 20 and the second template oligonucleotide has the other sequence.

[00186] In the preceding description, for purposes of explanation, numerous details are set forth in order to provide a thorough understanding of the examples. However, it will be apparent to one skilled in the art that these specific details are not required. The above- described examples are intended to be exemplary only. Alterations, modifications and variations can be effected to the particular examples by those of skill in the art without departing from the scope, which is defined solely by the claims appended hereto.

Claims

WHAT IS CLAIMED IS:

1. A method for determining the sequence of at least two polynucleotides, the method comprising:

b) providing a first template oligonucleotide;

e) providing a second priming oligonucleotide and a fourth priming

f) providing a reverse transcriptase;

j) extending the 3' ends of the linked polynucleotide to generate an extended linked polynucleotide comprising the sequences of the first and second extended polynucleotides;

k) amplifying the extended linked polynucleotide in the presence of the third priming oligonucleotide and the fourth priming oligonucleotide; and

I) determining the sequence of the extended linked polynucleotide.

2. The method of claim 1 , wherein the reverse transcribing comprises reverse transcribing using a reverse transcriptase having a terminal nucleotidyl transferase-like activity.

3. The method of claim 2, wherein the reverse transcriptase is a Moloney murine leukemia virus reverse transcriptase, an avian myeloblastosis virus reverse transcriptase, or a functional variant thereof.

4. The method of claim 3, wherein the reverse transcriptase is a Moloney murine leukemia virus reverse transcriptase and the first and the second template oligonucleotides each, independently, comprise at least two terminal guanine nucleotides at their 3' ends.

5. The method of any one of claims 1 to 4, wherein:

a) the sequence of the first template oligonucleotide comprises:

i) a first sequence towards the 3' end of the first template oligonucleotide, the first sequence being annealable to non-template nucleotides towards the 3' end of the complement of the first polynucleotide, and

ii) a second sequence towards the 5' end of the first template oligonucleotide, the second sequence being annealable to the second template oligonucleotide;

and wherein

b) the sequence of the second template oligonucleotide comprises: i) a first sequence towards the 3' end of the second template oligonucleotide, the first sequence being annealable to non-template nucleotides towards the 3' end of the complement of the second polynucleotide, and

ii) a second sequence towards the 5' end of the second template oligonucleotide, the second sequence being annealable to the first template oligonucleotide.

6. The method of any one of claims 1 to 5, wherein the first and the second template oligonucleotides are each, independently, at least 20 nucleotides in length.

7. The method of any one of claims 1 to 6, wherein each of the first and the second template oligonucleotides comprise a palindromic sequence at least 4 base pairs in length.

8. The method of claim 6 or 7, wherein the first template oligonucleotide comprises the sequence set forth in SEQ I D NO: 19.

9. The method of any one of claims 6 to 8, wherein the second template oligonucleotide comprises the sequence set forth in SEQ ID NO: 20.

10. The method of any one of claims 1 to 9, further comprising performing polymerase chain reaction (PCR) to amplify the linked polynucleotide.

11. The method of any one of claims 1 to 10, wherein the first polynucleotide and the second polynucleotides encode proteins that are protein subunits of a multiprotein complex.

12. The method of any one of claims 1 to 11 , wherein the first polynucleotide and the second polynucleotide are polyribonucleotides (RNA) and the first extended polynucleotide and the second extended polynucleotides are polydeoxyribonucleotides (DNA).

13. The method of claim 12, wherein the first polynucleotide and the second

polynucleotide are messenger RNA (mRNA).

14. The method of claim 13, wherein the mRNA is obtained from a single cell.

15. The method of claim 14, wherein the single cell is a T-cell.

16. The method of claim 15, wherein the first polynucleotide is a polynucleotide encoding an alpha subunit of a T-cell receptor and the first priming oligonucleotide is annealable to a constant region of the alpha subunit of the T-cell receptor; and wherein the second polynucleotide is a polynucleotide encoding a beta subunit of the T-cell receptor and the second priming oligonucleotide is annealable to a constant region of the beta subunit of the T-cell receptor.

17. The method of claim 16, wherein the first and the second priming oligonucleotides are each, independently, at least 15 nucleotides in length.

18. The method of claim 16 or 17, wherein the first priming oligonucleotide comprises the sequence set forth in SEQ ID NO: 1 , SEQ ID NO: 2, or SEQ ID NO: 3.

19. The method of any one of claims 16 to 18, wherein the second priming

oligonucleotide comprises the sequence set forth in SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6.

20. The method of claim 14 wherein the single cell is a B-cell.

21. The method of claim 20, wherein the first polynucleotide is a polynucleotide encoding a heavy chain of a B-cell receptor and the first priming oligonucleotide is annealable to a constant region of the heavy chain of the B-cell receptor, and wherein the second

polynucleotide is a polynucleotide encoding a light chain of the B-cell receptor and the second priming oligonucleotide is annealable to a constant region of the light chain of the B- cell receptor.

22. The method of claim 21 , wherein the first and the second priming oligonucleotides are each, independently, at least 15 nucleotides in length.

23. The method of claim 21 or 22, wherein the first priming oligonucleotide comprises the sequence set forth in SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO: 9.

24. The method of any one of claims 21 to 23, wherein second priming oligonucleotide comprises the sequence set forth in SEQ ID NO: 10, or SEQ ID NO: 11.

25. The method of any one of claims 13 to 24 wherein the single cell is isolated from a plurality of cells.

26. A method for determining the nucleotide sequence of at least two polynucleotides in a plurality of cells, the method comprising:

a) providing a single cell isolated from the plurality of cells, wherein the single cell comprises a first polynucleotide and a second polynucleotide, and wherein the first polynucleotide sequence and the second polynucleotide sequence each comprise a known sequence and an unknown sequence, the known sequence being positioned 3' to the unknown sequence;

b) providing a first template oligonucleotide;

e) providing a second priming oligonucleotide and a fourth priming

f) providing a reverse transcriptase;

k) extending the 3' ends of the linked polynucleotide to generate an extended linked polynucleotide comprising the sequences of the first and second extended polynucleotides;

m) determining the sequence of the linked polynucleotide.

27. The method of claim 26, wherein the reverse transcribing comprises reverse transcribing using a reverse transcriptase having a terminal nucleotidyl transferase-like activity.

28. The method of claim 27, wherein the reverse transcriptase is a Moloney murine leukemia virus reverse transcriptase, an avian myeloblastosis virus reverse transcriptase, or a functional variant thereof.

29. The method of claim 28, wherein the reverse transcriptase is a Moloney murine leukemia virus reverse transcriptase, and the first and the second template oligonucleotides each, independently, comprise at least two terminal guanine nucleotides at their 3' ends.

30. The method of any one of claims 26 to 29, wherein:

a) the sequence of the first template oligonucleotide comprises:

and wherein

b) the sequence of the second template oligonucleotide comprises:

i) a first sequence towards the 3' end of the second template oligonucleotide, the first sequence being annealable to non-template nucleotides towards the 3' end of the complement of the second polynucleotide, and

31. The method of any one of claims 26 to 30, wherein the first and the second template oligonucleotides are each, independently, at least 20 nucleotides in length.

32. The method of any one of claims 26 to 31 , wherein each of the first and the second template oligonucleotides comprise a palindromic sequence at least 4 base pairs in length.

33. The method of claim 31 , wherein the first template oligonucleotide comprises the sequence set forth in SEQ ID NO: 19.

34. The method of claim 31 or 33, wherein the second template oligonucleotide comprises the sequence set forth in SEQ ID NO 20.

35. The method of any one of claims 26 to 34, further comprising performing PCR to amplify the linked polynucleotide.

36. The method of any one of claims 26 to 35, wherein the first polynucleotide and the second polynucleotide are polyribonucleotides (RNA) and the first extended polynucleotide and the second extended polynucleotides are polydeoxyribonucleotides (DNA).

37. The method of claim 36, wherein the first polynucleotide and the second

polynucleotide are mRNA.

38. The method of any one of claims 26 to 37, wherein the first polynucleotide and the second polynucleotides encode proteins that are protein subunits of a multiprotein complex.

39. The method of any one of claims 26 to 38, wherein the single cell is a T-cell.

40. The method of claim 39, wherein the first polynucleotide is a polynucleotide encoding an alpha subunit of a T-cell receptor and the first priming oligonucleotide is annealable to a constant region of the alpha subunit of the T-cell receptor, and wherein the second polynucleotide is a polynucleotide encoding a beta subunit of the T-cell receptor and the second priming oligonucleotide is annealable to a constant region of the beta subunit of the T-cell receptor.

41. The method of claim 40, wherein the first and the second priming oligonucleotides are each, independently, at least 15 nucleotides in length.

42. The method of claim 40 or 41 , wherein the first priming oligonucleotide comprises the sequence set forth in SEQ ID NO: 1 , SEQ ID NO: 2, or SEQ ID NO: 3.

43. The method of any one of claims 40 to 42, wherein the second priming

44. The method of any one of claims 26 to 38 wherein the single cell is a B-cell.

45. The method of claim 44, wherein the first polynucleotide is a polynucleotide encoding a heavy chain of a B-cell receptor and the first priming oligonucleotide is annealable to a constant region of the heavy chain of the B-cell receptor; and wherein the second

46. The method of claim 45, wherein the first and the second priming oligonucleotides are each, independently, at least 15 nucleotides in length.

47. The method of claim 45 or 46, wherein the first priming oligonucleotide comprises the sequence set forth in SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO: 9.

48. The method of any one of claims 45 to 47, wherein second priming oligonucleotide comprises the sequence set forth in SEQ ID NO: 10, or SEQ ID NO: 11.

49. A kit for determining the nucleotide sequence of a first polynucleotide and a second polynucleotide, the kit comprising:

a first template oligonucleotide; and

a second template oligonucleotide;

wherein the first template oligonucleotide is annealable to the second template oligonucleotide, and wherein the first and the second template oligonucleotides each, independently, have at least two terminal guanine nucleotides at their 3' ends.

50. The kit of claim 49, further comprising a Moloney murine leukemia virus reverse transcriptase, or a functional variant thereof.

51. The kit of claim 49 or 50, wherein the first and the second template oligonucleotides are each, independently, at least 20 nucleotides in length.

52. The kit of claim 51 , wherein the first template oligonucleotide comprises the sequence set forth in SEQ ID NO: 19).

53. The kit of claim 51 or 52, wherein the second template oligonucleotide comprises the sequence set forth in SEQ ID NO: 20.

54. The kit of claim 49, wherein:

a) the sequence of the first template oligonucleotide comprises:

i) a first sequence towards the 3' end of the first template oligonucleotide, the first sequence being annealable to non-template residues/nucleotides towards the 3' end of the complement of the first polynucleotide, and

ii) a second sequence towards the 5' end of the first template oligonucleotide, the second sequence being annealable to the second template oligonucleotide; and wherein b) the sequence of the second template oligonucleotide comprises: i) a first sequence towards the 3' end of the second template oligonucleotide, the first sequence being annealable to non-template residues/nucleotides towards the 3' end of the complement of the second polynucleotide, and

55. The kit of any one of claims 49 to 54, wherein the first template oligonucleotide and the second template oligonucleotide are polyribonucleotides.

56. The kit of any one of claims 49 to 55, further comprising a first priming oligonucleotide and a second priming oligonucleotide.

57. The kit of claim 56 wherein the first priming oligonucleotide has a sequence that is annealable to a first sequence towards the 3' end of the first polynucleotide; and the second priming oligonucleotide has a sequence that is annealable to a second sequence towards the 3' end of the second polynucleotide.

58. The kit of claim 57 wherein the first polynucleotide is a polynucleotide encoding an alpha subunit of a T-cell receptor (TCR), and wherein the first priming oligonucleotide is annealable to a constant region of the alpha subunit of the T-cell receptor.

59. The kit of claim 58, wherein the first priming oligonucleotide comprises the sequence set forth in SEQ ID NO: 1 , SEQ ID NO: 2, or SEQ ID NO: 3.

60. The kit of claim 57, 58 or 59, wherein the second polynucleotide is a polynucleotide encoding a beta subunit of the T-cell receptor, and wherein the second priming

oligonucleotide is annealable to a constant region of the beta unit of the T-cell receptor.

61. The kit of claim 60, wherein the second priming oligonucleotide comprises the sequence set forth in SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6.

62. The kit of claim 57 wherein the first polynucleotide is a polynucleotide encoding a heavy chain of a B-cell receptor, and wherein the first priming oligonucleotide is annealable to a constant region of the heavy chain of the B-cell receptor.

63. The kit of claim 62, wherein the first priming oligonucleotide comprises the sequence set forth in SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO: 9.

64. The kit of claim 57, 62 or 63, wherein the second polynucleotide is a polynucleotide encoding a light chain of the B-cell receptor, and wherein the second priming oligonucleotide is annealable to a constant region of the light chain of the B-cell receptor.

65. The kit of claim 64, wherein second priming oligonucleotide comprises the sequence set forth in SEQ ID NO: 10, or SEQ ID NO: 1 1.

66. A pair of replicable vectors encoding:

a first template oligonucleotide; and

a second template oligonucleotide;

67. A pair of bacteria, each bacteria transfected with one of the pair of replicable vectors according to claim 66, the pair of bacteria capable of expressing the first and second template oligonucleotides.

68. A pair of viruses, each virus comprising one of the pair of replicable vectors according to claim 66.

69. A method for determining nucleotide sequences of at least two polynucleotide from a plurality of T cells or B cells, the method comprising:

a) providing a single cell isolated from the plurality of cells, wherein the single cell comprises a first polynucleotide and a second polynucleotide, and wherein the first polynucleotide sequence and the second polynucleotide sequence each together encode a T-cell receptor or a B-cell receptor and each comprise a known sequence and an unknown sequence, the known sequence being positioned 3' to the unknown sequence;

b) generating a first extended polynucleotide that comprises a first additional sequence and a sequence that is complementary to the first polynucleotide and, generating a second extended polynucleotide that comprises a second additional sequence and a sequence that is complementary to the second polynucleotide, wherein the first additional sequence is annealable to the second additional sequence;

d) extending the 3' ends of the linked polynucleotide to generate an extended linked polynucleotide comprising the sequences of the first and second extended

polynucleotides;

e) amplifying the extended linked polynucleotide; and

f) determining the sequence of the linked polynucleotide.

70. The method according to claim 69, wherein generating the first extended

polynucleotide and generating the second extended polynucleotide comprises:

a) ligating a first 5' adenylated 3' blocked oligodeoxynucleotide to the 3' end of the first polynucleotide using an RNA ligase in the absence of adenosine triphosphate; and b) ligating a second 5' adenylated 3' blocked oligodeoxynucleotide to the 3' end of the second polynucleotide using an RNA ligase in the absence of adenosine triphosphate; wherein the first 5' adenylated 3' blocked oligodeoxynucleotide comprises the first additional sequence, and the second 5' adenylated 3' blocked oligodeoxynucleotide comprises the second additional sequence;

and wherein amplifying comprises performing a polymerase chain reaction, such as a reverse transcription polymerase chain reaction.

71. The method according to claim 69, wherein generating the first extended

polynucleotide and generating the second extended polynucleotide comprises:

a) reverse transcribing the first polynucleotide in the presence of a first priming oligonucleotide, to generate a first complementary DNA (cDNA) and reverse transcribing the second polynucleotide in the presence of a second priming oligonucleotide to generate a second cDNA;

b) polishing the first and the second cDNA to generate blunt ends;

c) ligating a first double stranded linker to the blunt end of the first cDNA and ligating a second double stranded linker to the blunt end of the second cDNA using a DNA ligase, wherein the first and the second double stranded linkers comprise recognition sites for a restriction enzyme; and

d) cleaving the first and the second double stranded linkers using the restriction enzyme, wherein:

the cleaved first double stranded linker provides the first additional sequence, and the cleaved second double stranded linker provides the second additional sequence, the first additional sequence being annealable to the second additional sequence.

72. A method for obtaining a polynucleotide for determination of its sequence, the method comprising:

b) providing a first template oligonucleotide;

e) providing a second priming oligonucleotide and a fourth priming oligonucleotide, each comprising a sequence that is annealable to at least a portion of the known sequence of the second polynucleotide; f) providing a reverse transcriptase;

j) extending the 3' ends of the linked polynucleotide to generate an extended linked polynucleotide comprising the sequences of the first and second extended polynucleotides; and

k) amplifying the extended linked polynucleotide in the presence of the third priming oligonucleotide and the fourth priming oligonucleotide to obtain sufficient quantities of the extended linked polynucleotide such that the sequence of the extended linked polynucleotide is determinable.

The method of any of claims 14, 26 or 69 wherein the single cell is isolated using microfluidic systems, dilution, micromanipulation, flow cytometry,

compartmentalization, emulsion PCR, or any combination thereof.