WO2014181107A1 - Genetic method of aiding the diagnosis and treatment of familial hypercholersterolaemia - Google Patents

Genetic method of aiding the diagnosis and treatment of familial hypercholersterolaemia Download PDF

Info

Publication number
WO2014181107A1
WO2014181107A1 PCT/GB2014/051399 GB2014051399W WO2014181107A1 WO 2014181107 A1 WO2014181107 A1 WO 2014181107A1 GB 2014051399 W GB2014051399 W GB 2014051399W WO 2014181107 A1 WO2014181107 A1 WO 2014181107A1
Authority
WO
WIPO (PCT)
Prior art keywords
ldlr
dna
sequencing
diagnosis
patients
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/GB2014/051399
Other languages
French (fr)
Other versions
WO2014181107A9 (en
Inventor
Timothy J. AITMANN
Jana VANDROVKOVA
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Medical Research Council
Original Assignee
Medical Research Council
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Medical Research Council filed Critical Medical Research Council
Publication of WO2014181107A1 publication Critical patent/WO2014181107A1/en
Publication of WO2014181107A9 publication Critical patent/WO2014181107A9/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Definitions

  • the invention is in the field of hypercholesterolaemia.
  • the invention relates to the provision of a comprehensive technique for patient management in the field of familial hypercholesterolaemia.
  • Familial hypercholesterolaemia (FH, OMIM #143890) is a common Mendelian disorder that affects 1 in 500 individuals and it is estimated that 12 million of people are affected worldwide (Goldstein et al., 2001). Patients with FH have raised serum cholesterol levels from birth and increased arterial deposition of low density
  • LDL lipoprotein
  • CHD premature coronary heart disease
  • FH-causing mutations in LDLR are found throughout the gene and include missense, truncating and splice site mutations, small insertion/deletion mutations, and large insertions/deletions which can encompass multiple exons. Some mutations have been found in many unrelated individuals with FH, while others are found rarely. (Leigh, Foster et al. 2008) Mutations in two other genes, PCSK9 and A POB, can also cause the FH phenotype, but in less than 10% of mutation positive cases. (Taylor, Wang et al. 2010)
  • FH familial hypercholesterolaemia
  • FH diagnostic genes these genes are APOB, LDLR and PCSK9.
  • Standard molecular diagnostic techniques detect mutations in 40% of FH patients and it is believed that a proportion of remaining cases have raised cholesterol due to a combined, polygenic, effect of several LDL-C-raising common variants. This is discussed in more detail below.
  • the current standard test for FH is a genetic test. This involves the analysis of the three diagnostic genes in an individual for mutations. This is currently accomplished by conventional sequencing techniques. This is most often accomplished using capillary sequencing. This is a very laborious process. This is a very time consuming process.
  • the gold standard treatment for hypercholesterolaemia is a prescription of statins, Statins control (reduce) cholesterol levels when administered to patients.
  • Statins are a long term treatment. Many patients will be prescribed statins for the rest of their natural lives when presenting with hypercholesterolaemia.
  • statin toxicity causes a range of harrowing effects, including muscular pain, muscle weakness, death and/or erosion of muscle fibres, and in severe cases a resulting trauma to the kidneys which can result in kidney failure. It is a problem in the art that patients suffering from statin toxicity are typically suffering a long term decline. As the toxicity problem runs on a patient gets weaker and weaker.
  • statin toxicity It is a problem in the prior art that the effects of statin toxicity are prone to end up as a separate diagnostic investigation unless the physician is alert to the risk and recognises the symptoms early in the treatment.
  • hypercholesterolaemia is laborious and expensive.
  • the extra demand for these resource intensive tests is creating a further problem to medical healthcare providers.
  • the present invention seeks to overcome problems associated with the prior art.
  • FH familial hypercholesterolaemia
  • the present inventors have studied FH in detail.
  • the invention is based on a combined test which individually examines multiple factors which are involved in FH.
  • the inventors teach the parallel analysis of three patient attributes - (i) assay of the three main diagnostic genes for FH (APQB, LDLR and PCSK9); (ii) assay of polygenic FH SNPs (a collection of lower penetrance incremental risk indicators); and (iii) assay of the patient's SLCO1B1 genotype (the genetic indicator of statin toxicity).
  • the inventors teach for the first time the combination of these three elements into a single diagnostic test.
  • the advantage of this is that the physician is then appraised with a complete picture of the patient's condition, including their incremental risk indicators, and al so at the same time an indication of whether they are likely to have a negative response to the gold standard statin treatment.
  • This combination has never been attempted in the prior art.
  • This combination has advantages in targeting the treatment to the patient in the correct manner, and also avoiding the extremely negative side effects for that proportion of the population who would typically be placed on statin treatment even though they are at risk of serious side effects from statin toxicity.
  • the present invention advantageously alleviates these problems associated with the prior art.
  • the tests are conducted using a paired approach of micro-fluidics with next generation sequencing.
  • This is also a departure from the prior art techniques which have relied on conventional PCR amplification coupled to ordinary sequencing techniques such as capillary sequencing.
  • NGS next generation sequencing
  • the invention provides a method for collecting information useful in aiding the diagnosis and treatment of familial hypercholesterolaemia (FH), the method comprising providing a sample of nucleic acid such as DNA from the subject, assaying said nucleic acid such as DNA for FH.
  • FH familial hypercholesterolaemia
  • w erein assaying said nucleic acid such as DNA comprises the step of contacting said nucleic acid such as DNA sample with one or more primers for amplification and/or sequencing of the relevant segment(s) of said nucleic acid such as DNA
  • the invention relates to a method as described above wherein assaying said nucleic acid such as DNA further comprises determining the nucleotide sequence of the relevant segment(s) of said nucleic acid such as DNA, and inferring from said nucleic acid such as DNA sequence whether said mutations of steps (i) and (iii), and said one or more SNPs of step (ii), are present.
  • the invention may be applied to any nucleic acid; suitably the nucleic acid is DNA.
  • the invention is described with reference to DNA as an exemplary nucleic acid.
  • 'single assay cycle' is meant that the assay steps are carried out on the same sample. Suitably this means in a multiplexed assay.
  • the single assay cycle which may consist of multiple tubes or reactions as necessary, is carried out as a single coherent test event.
  • the invention relates to a method as described above wherein said one or more genes indicative of FH diagnosis is selected from the group consisting of APOB, LDLR and PCSK9. Each gene in this group of genes shares the common property of being indicative of monogenic FH.
  • the invention relates to a method as described above wherein said mutation in one or more genes which is indicative of FH diagnosis is selected from those listed in Table 2.
  • the invention relates to a method as described above wherein said SNP is selected from Table A or Table B.
  • SNP is selected from Table A or Table B.
  • Each SNP in this group of SNPs shares the common property of being indicative of incremental risk of high cholesterol.
  • each SNP in this group of SNPs shares the common property of being indicative of polygenic FH.
  • the invention relates to a method as described above wherein said gene indicative of risk of statin toxicity is SLCO1B1.
  • step (iii) comprises determining the presence of the rs.4149056 or 1 * 54149056 variant of SLCO1B1.
  • step (iii) comprises determining the presence of the ⁇ 4149056 variant of SLCO1B1.
  • the invention relates to a method as described above wherein said DNA sample is subjected to micro-fluidic PGR amplification of the DNA segment(s) of interest.
  • PCR is carried out using at least one primer selected from Table 3.
  • PCR is carried out using each of the primers in Table 3.
  • Enrichment is suitably accomplished by PCR.
  • the invention relates to a method as described above wherein sequence information is determined by next generation sequencing (NGS).
  • NGS next generation sequencing
  • the invention in another aspect, relates to a method of treating a subject comprising performing the method according to any preceding claim wherein if an increased likelihood of FH is identified, then cholesterol lowering medicament is administered to said subject, wherein said medicament is selected according to the subject's SLCOiBi genotype.
  • selection of the medicament comprises selection of one or more of the upper limit of the dose of said medicament for said subject, the dose of said medicament to be administered to said subject, or the particular medicament to be administered to said subject.
  • said medicament is a statin.
  • the invention relates to a primer selected from Table 3.
  • the invention relates to a set of primers comprising at least one pair of the primers in Table 3. In another aspect, the invention relates to a set of primers according to claim 17 comprising each of the primers in Table 3.
  • the invention may relate to a method for determining whether a subject has a predisposition for monogenic familial hypercholesterolaemia by virtue of a mutation in one of the genes selected from LDLR, PCSK9, APOB or polygenic familial hypercholesterolaemia by virtue of combination of genotypes in (rs6511720) LDLR, (rs2479409) PCSK9, (1-8.1.367117) APOB, (TS629301) CELSR2, ( ⁇ -54299376) ABCG8, ( ⁇ 1564348) SLC22A1, (rsi8oos02) HFE, ( ⁇ 3757354) MYLIP, (1-511220462) ST3GAL4, (rs8oi7377) NYNRIN, ( S429358, 1-57412) APOE and for determining individual's response to statin treatment by virtue of a variant (1-54149056) in SLCO1B1 gene comprising:
  • nucleic acid amplification step uses all primer pairs, the primer pairs comprising a forward primer with a forward primer sequence selected from SEQ ID NO: i to SEQ ID NO:6o; or a reverse primer with a reverse primer sequence selected from SEQ ID NO: 61 to SEQ ID NO: 120;
  • the amplification product being a sequence of at least a part of one of the genes LDLR, PCSK9, APOB, CELSR2, ABCG8, SLC22A1, HFE, MYLIP, ST3GAL4, NYNRIN, APOE and SLCO1B1
  • APOE amplification products have SNPs that are indicative of a risk for a polygenic familial hypercholesterolaemia determining whether the SLCO1B1 amplification product represents a sequence that has an SNP that is indicative of a risk for adverse statin effect,
  • the exemplary PGR primers described may be used to assist in sequencing the full gene LDLR and selected genomic regions CELSR2, ABCG8, SLC22A1, HFE, MYLIP, ST3GAL4, NYNRIN, APOE and SLCOiBiof the subject.
  • the subject's gene sequence(s) is then compared with known variants of these genes associated with monogenic or polygenic FH. From the comparison, it is determined whether any particular DNA variant or variants exist in the subject. It is then possible to correlate the variants to risk of FH and statin related myopathy.
  • the comparison of the sequence information of the subject with known allele sequences can be carried out by making comparisons using established and freely available bio- info rmatic techniques (e.g. GATK or platform-specific software) with comparison to the reference human genome, 1000 genomes data and in high-quality controls, which we have established.
  • bio- info rmatic techniques e.g. GATK or platform-specific software
  • pathogenicity are well established. In short, if a mutation is known to cause the disease from previous publications that have shown segregation of the mutation in a family or enrichment of a mutation in cases versus controls then it is assigned as disease causing. New mutations, not present in the reference human genomes, that segregate in a family may also be assigned pathogenicity in combination with pathogenicity scoring tools (conservation, polyphen and sift). Variants of unknown significance are assigned as such and common benign variants are also identified.
  • Polygenic predisposition to FH is established by calculating a score, an LDL-c gene score, based on presence or absence of selected variants in LDLR, PCSK9, APOB,
  • the invention provides a method of determining whether a subject has a predisposition for familial hypercholesterolaemia and adverse reaction to statin treatment.
  • Amplification of polynucleotides may utilise methods such as the polymerase chain reaction (PCR), ligation amplification (or ligase chain reaction, LCR) and amplification methods based on the use of Q-beta replicase. Also useful are strand displacement amplification (SDA), thermophilic SDA, and nucleic acid sequence based amplification (3SR or NASBA).
  • PCR polymerase chain reaction
  • LCR ligation amplification
  • LCR ligase chain reaction
  • SDA strand displacement amplification
  • thermophilic SDA thermophilic SDA
  • NASBA nucleic acid sequence based amplification
  • PCR polymerase chain reaction
  • polymerase-driven amplification assays can achieve over a million-fold increase in copy number through the use of polymerase-driven amplification cycles.
  • the resulting nucleic acid can be sequenced or used as a substrate for DNA probes.
  • These methods are well known and widely practiced in the art. See, e.g., U.S. Patents 4,683,195 and 4,683,202 and Innis et al., 1990 (for PCR); Wu and Wallace, 1989 (for LCR); U.S. Patents 5,270,184 and 5,455,166 and Walker et al., 1992 (for SDA); Spargo et al, 1996 (for thermophilic SDA) and U.S. Patent 5,409,818, Fahy et al., 1991 and Compton, 1991 for 3SR and NASBA. Reagents and hardware for conducting PCR are commercially available.
  • Primers useful to amplify sequences from the LDLR, PCSK9, APOB, CELSR2, ABCG8, SLC22A1, HFE, MYLIP, ST3GAL4, NYNRIN, APOE and SLCO1B1 genes are suitably complementary to, and hybridise specifically to, sequences in the LDLR, PCSK9, APOB, CELSR2, ABCG8, SLC22A1, HFE, MYLIP, ST3GAL4, NYNRIN, APOE and SLCO1B1 genes or in regions that flank a region therein.
  • Sequences in the LDLR, PCSK9, APOB, CELSR.2, ABCG8, SLC22A1, HFE, MYLIP, ST3GAL4, NYNRXN, APOE and SLCO1B1 genes generated by amplification may be sequenced directly.
  • the amplified sequence(s) may be cloned prior to sequence analysis.
  • a method for the direct cloning and sequence analysis of enzymatically amplified genomic segments has been described by Scharf et ah, 1986. The most popular method used today is target amplification.
  • the target nucleic acid sequence is amplified with polymerases.
  • fragment of a polynucleotide sequence provided herein is a subsequence of contiguous nucleotides that is capable of specific hybridisation to a target of interest, e.g., a sequence that is at least 10 nucleotides in length.
  • the fragments may comprise 10, preferably 15 nucleotides, preferably at least 20 nucleotides, more preferably at least 30 nucleotides, more preferably at least 40 nucleotides, more preferably at least 50 nucleotides and most preferably at least 60 nucleotides of contiguous nucleotides of a polynucleotide.
  • a fragment of a polynucleotide sequence can be used as a primer, a probe, included in a mieroarray, or used in polynucleotide-based identification methods.
  • hybridise under stringent conditions refers to the ability of a polynucleotide molecule to hybridise to a target polynucleotide molecule (such as a target polynucleotide molecule immobilised on a DNA or RN A blot, such as a Southern blot or Northern blot) under defined conditions of temperature and salt concentration.
  • a target polynucleotide molecule such as a target polynucleotide molecule immobilised on a DNA or RN A blot, such as a Southern blot or Northern blot
  • the ability to hybridise under stringent hybridisation conditions can be determined by initially hybridising under less stringent conditions then increasing the stringency to the desired stringency.
  • typical stringent hybridisation conditions are no more than 25 to 30°C (for example, io°C) below the melting temperature (Tm) of the native duplex (see generally,
  • Typical stringent conditions for a polynucleotide of greater than 100 bases in length would be hybridisation conditions such as prewashing in a solution of 6X SSC, 0.2% SDS; hybridising at 6s°C, 6X SSC, 0.2% SDS overnight; followed by two washes of 30 minutes each in iX SSC, 0.1% SDS at 65°C and two washes of 30 minutes each in 0.2X SSC, 0.1% SDS at 65°C.
  • stringent conditions use 50% formamide, 5 x SSC, 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 ⁇ / ⁇ 1), o.i% SDS, and 10% dextran sulphate at 42°C, with washes at 42°C in 0.2 x SSC and 50% formamide at 55°C, followed by a wash comprising of 0.1 x SSC containing EDTA at 55°C.
  • exemplar stringent hybridisation conditions are 5 to io°C below Tm.
  • Tm of a polynucleotide molecule of length less than 100 bp is reduced by approximately (500/oligonucleotide length) °C.
  • nucleic acid as used herein, means a single or double-stranded
  • deoxyribonucleotide or ribonucleotide polymer of any length include as non- limiting examples, coding and non-coding sequences of a gene, sense and antisense sequences, exons, introns, genomic DNA, cDNA, pre-mRNA, mRNA, rRNA, siRNA, miRNA, tRNA, ribozymes, recombinant polynucleotides, isolated and purified naturally occurring DNA or RNA sequences, synthetic RNA and DNA sequences, nucleic acid probes, primers, and fragments thereof.
  • Reference to a polynucleotide(s) is to be similarly understood. Most suitably nucleic acid is DNA.
  • NGS next generation sequencing
  • CTR cyclic reversible termination
  • SNA single-nucleotide addition
  • real-time sequencing The imaging coupled with these techniques often range from measuring bioluminescent signals to four-colour imaging of single molecular events.
  • NGS technologies include, but are not limited to, Massively Parallel Signature Sequencing (MPSS), polony sequencing, 454 pyrosequencing, Alumina (Solexa) sequencing (sequencing based on reversible dye- terminators), Sequencing by Oligonucleotide Ligation and Detection (SOLID) sequencing, ion semiconductor sequencing, DNA nanoball sequencing, HelioscopeTM single scope sequencing, single molecule real time (SMRT) sequencing, single molecule real time (RNAP) sequencing and nanopore DNA sequencing.
  • MPSS Massively Parallel Signature Sequencing
  • polony sequencing 454 pyrosequencing
  • Alumina (Solexa) sequencing sequencing (sequencing based on reversible dye- terminators)
  • SOLID Oligonucleotide Ligation and Detection
  • ion semiconductor sequencing DNA nanoball sequencing
  • HelioscopeTM single scope sequencing single molecule real time (SMRT) sequencing
  • RNAP single molecule real time sequencing and nanopore DNA sequencing
  • oligonucleotide(s) are nucleic acids that are usually between 5 and 200 contiguous bases, and often between 5-10, 5-20, 10-20, 10-50, 5-50, 15-100, 20-50, 20-100, 20-200, 50-200, or 100-200 contiguous bases.
  • An oligonucleotide that is longer than about 20 contiguo s bases may be referred to as a polynucleotide.
  • a polymorphic site can occur at any position within an oligonucleotide.
  • a "polymorphic site” refers the position in a nucleic acid sequence at which a polymorphism occurs.
  • a polymorphic site may be as small as one base pair.
  • the term "polymorphism” refers to a genetic variation, or the occurrence of two or more genetically determined alternative sequences at a single genetic locus in a population. Each version of the sequence with respect to the polymorphic site is referred to as an "allele" of the polymorphic site.
  • Preferred polymorphisms ha ve two alleles, with the minor allele occurring at a frequency of greater than 1%, and more preferably greater than 5% or 10% of a selected population.
  • the allelic form occurring most frequently in a selected population is sometimes referenced as the "wildtype” form.
  • the allelic form occurring less frequently in a selected population is sometimes referenced as the "mutant” form. Diploid organisms may be homozygous or
  • a biallelic polymorphism has two forms.
  • a triaileiic polymorphism has three forms.
  • Examples of polymorphisms include restriction fragment length polymorphisms (RFLPs), variable number of tandem repeats (VNTRs), single nucleotide polymorphisms (SNPs), dinucleotide repeats, trinucleotide repeats, tetranucleotide repeats, simple sequence repeats, and insertion elements such as Alu.
  • RFLPs restriction fragment length polymorphisms
  • VNTRs variable number of tandem repeats
  • SNPs single nucleotide polymorphisms
  • dinucleotide repeats trinucleotide repeats
  • tetranucleotide repeats simple sequence repeats
  • insertion elements such as Alu.
  • an individual's susceptibility to FH refers to a statistically higher, or lower, frequency of FH in an individual carrying a particular polymorphic allele, or genotype (i.e. allelic or polymorphism pattern) in comparison to the frequency in a member of the population that does not carry the particular polymorphic allele, or genotype.
  • An individual that carries one or both high-risk alleles at a polymorphic site is said to have a heterozygous or homozygous "high-risk" genotype for that particular
  • primer refers to a polynucleotide, usually having a free 3' OH group, that may be hybridised to a template and used for priming polymerisation of a
  • Probes In general, it is expected that analysis of the amplification products will take place by sequencing. However, it may also be desirable to analyse the amplification products by "wet" binding probing to detect the presence or absence of specific sequences. Analyte nucleic acid and probe are incubated under conditions which promote stable hybrid formation of the target sequence in the probe with the putative targeted sequence in the analyte. The region of the probes which is used to bind to the analyte can be made completely complementary to the targeted region of the gene of interest such as LDLR, PCSK9, APOB, CELSR2, ABCG8, SLC22A1, HFE, IVfiT.JP,
  • ST3GAL4, NYNRFN, APOE or SLCO1B1 genes Therefore, high stringency conditions are desirable in order to prevent false positives.
  • conditions of high stringency are used only if the probes are complementary to regions of the chromosome which are unique in the genome.
  • the stringency of hybridization is determined by a number of factors during hybridization and during the washing procedure, including temperature, ionic strength, base composition, probe length, and concentration of formamide. These factors are outlined in, for example, Maniatis et al., 1982 and Sambrook et al., 1989.
  • SNP single nucleotide polymorphism
  • SNPs single nucleotide polymorphism
  • SNPs are the plural of SNP. SNPs are most frequently diallelic. A most common allele of a SNP is called a "major” or “wild-type” allele and an alternative allele of said SNP is called a "minor” or “mutant” allele.
  • a SNP usually arises due to substitution of one nu cleotide for another at the polymorphic site.
  • a transition is the replacement of one purine by another purine or one pyrimidine by another pyrimidine.
  • a transversion is the replacement of a purine by a pyrimidine or vice versa.
  • SNPs can also arise from a deletion of a nucleotide or an insertion of a nucleotide relative to a reference allele.
  • SNPs tend to be evolutionarily stable from generation to generation and, as such, can be used to study specific genetic abnormalities throughout a population. If SNPs occur in the protein coding region it can lead to the expression of a variant, sometimes defective, form of the protein that may lead to development of a genetic disease. Such SNPs can therefore serve as effective indicators of the genetic disease. Some SNPs may occur in non-coding regions, but nevertheless, may result in differential or defective splicing, or altered protein expression levels. SNPs can therefore be used as diagnostic tools for identifying individuals with a predisposition for certain diseases, genotyping the individual suffering from the disease in terms of the genetic causes underlying the condition, and facilitating drug development based on the insight revealed regarding the role of target proteins in the pathogenesis process.
  • SNP location or "SNP locus” is a polymorphic site at which a SNP occurs.
  • biological sample means a biological sample derived from a patient to be screened.
  • the biological sample may be any suitable sample known in the art in which the expression of the selected markers can be detected. Included are individual ceils or cell populations such as obtained from bodily tissues or fluids.
  • the biological sample may comprise for example a blood, tissue, saliva or buccal smear sample,
  • the biological sample comprises blood.
  • the biological sample comprises saliva.
  • a biological sample comprising nucleic acid is obtained from a subject.
  • Nucleic acid is suitably extracted from the biological sample for assay/analysis according to any suitable method known in the art. if further guidance is required, the reader is referred to the examples section.
  • the sample for analysis comprises nucleic acid.
  • the sample for analysis consists essentially of nucleic acid.
  • the sample for analysis consists of nucleic acid.
  • the sample is an in vitro sample.
  • the sample is an extracorporeal sample.
  • the method is an in vitro method.
  • the method is an extracorporeal method.
  • the actual sampling of the subject is not part of the method of the invention.
  • the method does not involve collection of the biological sample.
  • the sample is a sample previously collected.
  • the method does not require the presence of the subject whose nucleic acid is being assayed.
  • the sample is an in vitro sample.
  • the method does not involve the actual medical decision, stricto sensu; such a decision stricto sensu would typically be taken by the physician.
  • the inventors teach the application of emerging technologies such as micro-fluidic amplification and next generation sequencing (NGS) in the field of familial
  • hypercholesterolaemia It is an advantage of these techniques that the tests can be performed on a small amount of DNA, meaning a smaller sample needing to be collected form the patient. In addition the combined method is more efficient on both time and labour.
  • the inventors teach for the first time the comprehensive joining together of mutation detection for FH with the assay for SLCO1B1 and the polygenic FH genes. This is a novel approach and has not been taught previously and it is this tripartite assay that provides numerous advantages as set out herein.
  • the combined method of the invention advantageously provides a comprehensive picture of the patient's need for treatment, coupled to their tolerance of the
  • the invention advantageously provides a comprehensive management package for patients with high cholesterol.
  • the assay of the invention is advantageously carried out as a multiplex.
  • the separate and individual test which make up the assay of the invention are advantageously carried out on a single DNA sample.
  • the assays of the invention are carried out in a single run of a sequence analyser.
  • the assays of the invention are enriched in a single PCR run, such a micro-fluidic PGR run.
  • the assays are conducted in a multiplex format. This provides the advantage of presenting a complete set of information to the physician so that they may diagnose and design a suitable treatment regime on the basis of the output of the multiplexed assay.
  • a multiplex assay has its normal meaning in the art of molecular biology.
  • the individual tests being carried out as taught by the invention are performed by a single sample.
  • the individual tests of the invention are performed simultaneously.
  • the individual tests of the invention are performed in a single PGR assay.
  • Suitable the assays of the invention are performed in a single sequencing step.
  • the combination of the various tests taught into a single simultaneous (multiplexed) analysis is a departure from the prior art because the phenomenon of familial hypercholesterolaemia (whether monogenic or polygenic) is a separate medical condition from the status of sensitivity to statin toxicity. It is an advantage of the invention that analysis of these two phenomena is brought together in a single step procedure. This is more efficient. This is cheaper. This saves labour. This provides a greater armoury of information to the physician at a single time point, bringing together diagnosis and design of an appropriate treatment regime.
  • monogenic and polygenic FH in a single assay.
  • the patient will require treatment if they have either monogenic FH or polygenic FH. It is exceptionally rare for a patient to have both monogenic FH and polygenic FH. Even if they do possess both genetic predispositions to FH, in any case the treatment would typically be the same (although clearly the investigation of related family members would be different if they were diagnosed as having monogenic as opposed to polygenic FH). It is a result of the insight of the present inventors that it is taught to carry out the tests for both monogenic FH and polygenic FH in the same multiplexed sample. Clearly, this leads to an inbuilt redundancy since individual patients will typically only have either have only monogenic FH or polygenic FH as explained above.
  • Micro-fluidics offers a method for conducting highly parallel PGR. Instead of carrying out conventional PGR which allows amplification of (for example) 48 or 96 samples per ran, parallel PGR permits up to approximately 2500 amplifications to be carried out in the same machine. For example, up to approximately 500 primer pairs can be used in a single run of the machine. This technique provides a massively parallel PGR
  • micro-fluidics/ highly parallel PGR is an especially suitable approach to the enrichment of the sample for sequencing.
  • Other techniques for enrichment may equally be used if desired.
  • hybridisation techniques which may be used to enrich the nucleic acids of interest.
  • This is a lengthy and expensive approach to enrichment. If is an advantage to use micro- fluidic PGR based enrichment as described in more detail herein.
  • mutations in the exons of genes have been found to have the greatest effects on disease, and can also act as indicators of disease risk. Mutations in the introns of a gene (the non-coding regions) can also affect disease and indicate disease risk but are less readily interpreted.
  • GS next generation sequencing
  • primers In order for the genomic DNA to be amplified, it is necessary for appropriate primers to be provided. A skilled person working the invention may design their own primers, for example using commercially available software to aid the process. The invention should not be regarded as limited solely to the particular exemplary primer sequences provided herein. However, determining the sequences to be used for such primers is not always simple: long amplicons can incorporate erroneous bases; mutations in the gene can interfere with primer annealing, and tertiary structure of the DNA can make certain sequences inaccessible. Automated platforms for primer design can have variable performance and custom design is often important. In this regard, the inventors have also provided a set of especially useful exemplary primers according to the present invention. These are presented in Table 3.
  • the present inventors have designed a new series of primers which together provides complete coverage of the LDLR gene and clinically relevant parts of PCSK9, APOB, CELSR2, ABCG8, SLC22A1, HFE, MYLIP, ST3GAL4, NYNRIN, APOE and SLCO1B1 genes.
  • This level of completeness to be achieved by a single genetic assay provided by the complete new series of primer pairs set out in Table 3 has not previously been described.
  • the assay is applicable to screening large numbers of patients for genetic causes of hypercholesterolaemia where previous assays were unsuitable.
  • LDLR LDLR_U__17i__2 GCTATTG GAGGATCTTGAAAGGC 3 GGCAGGCGACTTGATiTGTrGTA 63 175
  • LDLR LDLR_tl_19 CTTCTGTGGACAACAACAGCAAA 4 GCTTTTTAACCCGTGAAGCTCTG 64 198
  • LDLR LDLR_tl_21 GGCgACACTTTCGAAGGACTG 5 CCCACGTCATITACAGCATTTCA 65 179
  • LDLR LDLR_t1_22r_l CAG CTA GG ACA CAG C AGGT 7 GGGGCTCCCTCTCAACCTATTC 67 171
  • LDLR LDLR_tlO_3 ATCCA C AGCAACATCTA CTG GAG 8 CtCCTfCCTGCTCCCfCCAT C 68 191
  • LDLR LDLR_tll_l GGCTGTT C i CCAGAATTCGTT 10 GTTTTCAGTCACCAGCGAGTAGA 70 179
  • LDLR LDLR dipalmittyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl) a 1:1 GAGCCACCTGGCAACCC 1 190
  • LDLR LDLR_ti2_l CtCTGGGACTG G C ATCA G C ⁇ 2 CAGCCTClTTfCATCCTCCAAGA 72 162
  • LDLR LDLR_ti2_2 TACTGGGtTGA CTCCAA ACTTCA ' ⁇ 3 GTCTGTGTCTATCCGCCACCTAA 73 171
  • LDLR LDLR_tl3_l GCTG'rGTCTCATCCCAGTG ' nTA 14 CTCTGGG GACAGT AGGTITTCAG 74 162
  • LDLR LDLR_tl3_2 TGGACAGATATCATCAACGAAGCC 15 TTTCCACAAGGAGGTTTCAAGGT 75 181
  • LDLR LDLR_tl4__l CTTCTGGTATAGCTGATGATCTCGT 16 GCAGGCGCAGGTAAACTTGG 76 163
  • LDLR LDLR_tl4_2 GAGTGAACTGGTgTGAGAGGAC 17 GACACAGGACGCAGAAACAAGG 77 187
  • LDLR LDLR_tl5_l ATT'AGGCGCACACCTATGAGAAG 18 GGAGGTGTCGGGAA CAG G 78 i8o
  • LDLR LDLR . n5 . _ 2 CGTCAGGCTAAAGGTCAGCTC " '9 GACCCGTCTCTGGGTGAAGA 79 181
  • LDLR LDLR_tl7 isomer GGAGCTGGGTCTCTGGTCT 21 GACCTCATCC 1 C 1 GTGGl C1TC ⁇ 81 177
  • LDLR LDLR__tl7__2 TACAGTGCTCcTCGTCTTCCTTT 22 CCATGGGCTCTGGCTTTCTA 82 198
  • LDLR LDLR__tl8__ i CgTG'TrCCTUAaTGCTGGACTG 23 CAGUCAA G 1 1 GTCT Id UJ ' 83 185
  • LDLR LDLR .. t2 1 GTCAGTTTCTGA FCTGGCGTTG 24 CTGGG ACTCATC AGAG CCATC 84 167
  • LDLR LDLR_t2_2 CTCCTITTCCTCTCTCTCAGTGG 25 ataaaTGCATATCATGCCCAAAGG 85 175
  • LDLR LDLR_t3l'_2 C GTAGTGTCTGTCACCTGCAAA 27 CgTAGAGACAAAGTCAGACCACTC 87 199
  • LDLR LDLR_t4_l GGTGtTGGGAGACTTCACACG 28 GCTGGCGG GACCACAG 88 197
  • LDLR LDLR_t4_3 TTCCAGTGCAACAGCTCC 30 GTGGATGCACTCGCCACTTA 90 177
  • LDLR LDLR_t4_4 GTAGGGGTCTT ACGTG ' rrCCAA 31 GAGCCCAGGGACAGGTGATA 91 198
  • LDLR LDLR_t5_l CCCTGCTrC'r r rCTCTGG'iTG 32 CA!TAACGCAGCCAACrrCATCG 92 88
  • LDLR LDLR_t5_2 ACACACTCTGTCCTG lTrCCA 33 CAGCAAGGCACAGAGAATGGG 93 196
  • LDLR LDLR . _t6 .. _l TGAATGAGTGCCAAGCAAACTGA 34 cgCACTCTTTGATGGGTTCATCT 94 194
  • LDLR LDLR . J7 .. 1 CGGCGAAGGGATGGGTAG 36 CCCACCcGGaAATCACCTTC 96 196
  • LDLR LDLR_t7T_l CCAACGAATC-CITGGACAACAAC 37 gtttG G'l G CCATGTCAG G AAG 97 179
  • LDLR LDLR_t8_l I CGAAGGTGTgGGITITGGC 38 CCTi ' CCTCACACTGGCACTr " 98 ⁇ 78
  • LDLR LDLR_t8_2 AGCCTCTTTCTCTCtCTTCCAGAT 39 GCCTGCAAGGG GTGAGG 99 196
  • LDLR LDLR_t9_l GGCACTCTTGGTTCCATCGAC 40 TTCTATTGCTGGCCACCTCC 100 19S
  • LDLR LDLR_t9_2 CAGGAAGATGACGCTGGAC 41 gCCAGGAGCCCTCATCT 101 188
  • PCSKg PCSK9_t4_2 GCAGCCTGGTGGAGGTG AT 43 ACCTCCAGGATGGGGATATGG 103 185
  • PCSKg PCSK9 relievet7_2 GTGACCCTGGGGACTTTGG 44 CCAAAGGGGCTGTTAGCATCA 104 197
  • PCSKg PCSK9_t9_2 GGcCCTTTTTGCAGGTTGG 45 acacgAAGGAGGGGTACA 105 186
  • LDLR LDLR_tl_22s_l CCCCCTGCTAGAAACCTCACAMT 47 CGGTCCAGCGCAATITCCAG 107 171
  • LIFE 1-51800562 CAGGGCTGGATAACCTTGG 54 AGCAGATCCTCATCTCACTGC 114 196
  • the primers of SEQ ID NO i to SEQ ID NO 46 and SEQ ID NO 61 to SEQ ID N O 106 make up a set of primers for the sequencing of the coding regions of the currently screened genes LDLR, PCSK9 and APOB. That set of primers however does not cover certain genomic regions that are important in determining polygenic FH and/or in outcome of statin treatment. Primers of sequences SEQ ID NO 47 to SEQ ID NO 60 and SEQ ID NO 107 to SEQ ID NO 120 provide coverage of these genomic regions, and are specifically taught to achieve improved and/or complete coverage of the clinically important regions in FH,
  • Primers SEQ ID NO 1 to SEQ ID NO 120 have been specifically designed to allow simultaneous PGR amplification and subsequent sequencing to achieve a greater than 4-fold reduction in time required for FH genetic testing,
  • the LDLR gene encodes low density lipoprotein receptor protein, which binds low density lipoprotein (LDL) particles at the cell membrane and internalises them for hepatic processing and excretion.
  • LDL low density lipoprotein
  • LDLR spans nearly 45W3 and is made up of 18 exons, with pathogenic mutations found throughout the gene, some of which have been found in many unrelated individuals with FH, while many others are rare.
  • the intronic regions of LDLR contain multiple Alu repeat sequences, which can recombine incorrectly leading to large FH-causing indels which encompass one or many exons.
  • Patients with homozygous or compound heterozygous mutations in LDLR have a severe phenotype with onset of cardiovascular disease in childhood requiring aggressive early treatment of lipid levels.
  • the gene is located on chromosome 19 between base pairs 11,200,225 and 11,241,992 on forward strand.
  • PCSK9 proteose subtilin-kexin-type 9
  • APOB apolipoprotein B
  • FDB familial defective apolipoprotein-Bioo
  • the defective APOB ligand has reduced affinity for LDLR, reducing LDL clearance and causing hypercholesterolaemia with a similar phenotype to LDLR mutations.
  • APOB is a highly polymorphic gene, complicating identification of pathogenic variants. The gene is located on chromosome 2 between base pairs 21,224,301-21,266,945 on reverse strand.
  • SLCOIB 1 substitute carrier organic anion transporter family member 1B1
  • statin-induced myopathy particularly in patients on high dose treatment.
  • HMGCoA reductase inhibitors are the mainstay of treatment for FH, and muscular side-effects ranging from muscle pa through to life-threatening
  • SLC01B1 encodes the organic anion-transporting polypeptide OATPiBi, which mediates hepatic uptake of many drugs including most statins. It has been suggested that patients being treated with statins should be routinely genotyped for this variant and that an upper limit on statin doses should be applied according to genotype (NiemL 200£s).
  • the ⁇ 4149056 variant is located on chromosome 12 at position 21,368,722 on forward strand.
  • LDLR LDL receptor
  • novel variants that cause premature stop cod on, frameshift or overlap with splice donor or acceptor sites are expected to be mutations causing FH.
  • Non-synonymous substitutions, in-frame deletions or insertions and variants that overlap splice regions may or may not be causal.
  • These variants should be accessed for their pathogenicity using algorithms that predict possible impact of such variants on protein function.
  • Most commonly used pathogenicity predictive web-sites include SIFT and PoiyPhen (Kumar et aL, 2009; Adzhubei et aL, 2010).
  • variants with unclear pathogenicity should also be followed up by segregation analyses and in vitro functional studies. Functional studies include LDL binding and/or uptake assays (Soutar et. al., 1982; Goldstein et. al., 1972).
  • SNPs single nucleotide polymorphisms located in 11 genes should be genotyped in order to establish the risk of polygenic FH. Identifying such individuals will improve the efficiency of cascade testing, since this type of test will only benefit patients with monogenic FH. Much less than the expected half of children of individuals with polygenic FH are expected to inherit the disease.
  • Table A Single nucleotide polymorphisms identified as risk indicators for polygenic FH
  • Table B The SNPs used to determine predisposition to polygenic FH and their genomic locations are listed in Table B.
  • Table B The position of single nucleotide polymorphisms identified as risk indicators for polygenic FH
  • SNPs in Table A and Table B are the same 12 S Ps, the tables present different information in connection with them.
  • one or more of these SNPs are assayed; suitably two or more; suitably three or more; suitably four or more; suitably five or more; suitably six or more; suitably eight or more; suitably ten or more; suitably all twelve SNPs of Table A or Table B are assayed.
  • statins are prescribed statins. They are typically then sent away with their prescription. At most the patient may be advised to return if they experience side effects such as muscle pain etc. Patients are not automatically given a statin toxicity test.
  • statin toxicity is a serious problem, A certain proportion of the population carries a genetic predisposition to statin toxicity. Symptoms of statin toxicity include muscle weakness, pain such as muscle pain, death of muscle fibres, and kidney trauma which can lead to kidney failure from decomposing muscle fibre. Up to 5% of patients exhibit some form of statin toxicity. As many as 1 in iooo patients can experience the most severe statin toxicity including loss of muscle fibre and kidney trauma or kidney failure.
  • the in ventors teach the parallel assay of the statin toxicity predisposition locus SLCO1B1 at the same time as collecting the information useful in aiding the diagnosis of FH together with the incremental risk factors. As many as 15-20% of the population carry an SLCO1B1 allele which might predispose them to statin toxicity. A proportion of these people will actually go on to experience statin toxicity.
  • SLCOiBi is avoided. More importantly, there is additional value to the physician who is better informed when designing the treatment for the patient under examination, Patients presenting and undergoing the combined tests of the invention showing a predisposition to stain toxicity can be counselled in great detail about the side effects to be alert to.
  • the patient can be prescribed a re-examination at early time points. The patients can be placed under a more frequent surveillance regime. The patient can be prescribed smaller doses of the statin. It is even possible to design a lower dose/better tolerated statin treatment regime based on their SLCO1B1 status.
  • subjects who are heterozygous for an SLCO1B1 allele predisposing to statin toxicity show approximately a three times greater risk of stain toxicity then a patient with no risk allele.
  • a subject who is homozygous for an SLCO1B1 allele predisposing to statin toxicity has a ten times greater risk of statin toxicity.
  • statin dose or treatment regime it is possible to design a statin dose or treatment regime according to the number of copies of an SLCO1B1 allele predisposing to statin toxicity which the patient is carrying.
  • an upper limit on statin doses may be set for subjects in whom a risk of statin toxicity is detected according to the present invention.
  • a particular statin dose may be set for subjects in whom a risk of statin toxicity is detected according to the present invention.
  • a particular statin may be selected for subjects in whom a particular SLCO1B1 mutation is detected.
  • statin choice a measure of statin choice of statin choice.
  • dose choice or dose limits are found in (Niemi, 2009 - Clinical Pharmacology & Therapeutics (2010) 87 1, 130-133), which is incorporated herein by reference expressly for the teachings of alternate statin regimes according to SLCO1B1 genotype, as well as Wilke et al 2012, Clinical Pharmacology and Therapuetics 92:112-7.
  • the invention relates to a method for determining whether a subject has a predisposition for monogenic familial hypercholesterolaemia by virtue of a mutation in one of the genes selected from LDLR, PCSK9, APOB or polygenic familial hypercholesterolaemia by virtue of combination of genotypes in (rs6s 11720) LDLR, ( s2479409) PCSK9, ( ⁇ 1367117) APOB, (rs62930i) CELSR2, 084299376) ABCG8, (rsi504348) SLC22A1, (1-51800562) HFE, ( ⁇ 3757354) MYLIP, (rsii220402) ST3GAL4, (rs8oi7377) NYNRIN, ( ⁇ 429358, rs74i2) APOE and for determining individual's response to statin treatment by virtue of a variant ( ⁇ 4149056) in SLCO1B1 gene comprising:
  • nucleic acid amplification step uses all primer pairs, the primer pairs comprising a forward primer with a forward primer sequence selected from SEQ ID NO: 1 to SEQ ID NO:6o; or a reverse primer with a reverse primer sequence selected from SEQ ID NO: 61 to SEQ ID NO: 120; sequencing at least part of the amplification product, the amplification product being a sequence of at least a part of one of the genes LDLR, PCSK9, APOB,
  • the amplification step uses at least one primer pair, the pair comprising a forward primer with a forward primer sequence selected from SEQ ID NO: 1 to SEQ ID NO: 60; and its accompanying reverse primer, with appropriate sequence selected from SEQ ID NO: 61 to SEQ ID NO: 120.
  • the invention may also relate to assessing a subject for the diagnosis and/or treatment of familial hypercholesterolaemia (FH).
  • the invention may also relate to designing a treatment for familial
  • hypercholesterolaemia FH.
  • the invention may also relate to managing a subject suspected of having familial hypercholesterolaemia (FH).
  • FH familial hypercholesterolaemia
  • the invention may also relate to determining an appropriate programme for the diagnosis and/or treatment of familial hypercholesterolaemia (FH).
  • FH familial hypercholesterolaemia
  • a method for collecting information useful in aiding the diagnosis and treatment of familial hypercholesterolaemia comprising providing a sample of DNA from the subject, assaying said DNA for
  • assaying said DNA comprises the step of contacting said DNA sample with one or more primers for amplification and/ or sequencing of the relevant segment(s) of said DNA
  • FH familial hypercholesterolaemia
  • assaying said DNA comprises the step of contacting said DNA sample with one or more primers for amplification and/or sequencing of the relevant segment(s) of said DNA characterised in that each of said assays of steps (i) and (2) is carried out in a single assay cycle.
  • Figure 1 shows the depth of coverage of primer pairs (SEQ ID NO: 1 - 120), as shown in Table 3, in an in vitro experiment using a sample of human DNA.
  • Figure 3 shows the time improvements of the current test compared to standard methods.
  • Figure 4 shows Figure Si. Family pedigree showing affected individuals as filled black boxes/circles and unaffected individuals as unfilled boxes/circles. The arrow indicates the proband. Total cholesterol (TC) levels (mmol/1) are shown for each individual as well as mutation status. WT, wild type; NA, not available;
  • Micropipettes capable of dispensing volumes in the range of 1-1000 ⁇ 1, with compatible sterile filtered tips.
  • Primer solutions are valid for use for one year after resuspension, stored at -20°C
  • Genomic DNA templates were amplified using the Access Array IFC, according to the manufacturer s instructions (http://www.fluidigram.com).
  • the technique employed a microfluidic chip that systematically combined 48 sample DNAs, along with 120 primer pairs (SEQ ID NOs 1 - 120). PGR reagents were then drawn into the chip reaction chambers prior to PCR cycling. Common flanking sequences on each primer pair permit attachment of barcode indexes and sequencing adaptors. This allows for the attachment of platform-specific adaptors and barcodes pre target enrichment.
  • the multiplex amplicon harvests were recovered for each DNA template, approximately 150! was used to generate barcode and adapter products specific to the MiSeq platform (Alumina, San Diego, CA). Amplicon harvest volume was adjusted to 20 ⁇ using PGR certified water.
  • barcode-fusion PG reactions were prepared using CS tagged primer pairs, for instance, a reaction with A_BC6_CSi and CS2__ . P1. This strategy permitted amplicon sequencing in both orientations.
  • 10 ⁇ of the Fluidigm IFC harvest was added to 86 ⁇ of a Herculase II Fusion PGR mix, as per manufacturer's instructions (Agilent
  • Cycling conditions were as follows: an initial incubation of 98°C for 30 sec, followed by two cycles of 98°C for 30 sec, 54°C for 30 sec and 72°C for 30 sec; after the last cycle reactions were held at 72°C for 2 min, and then at 4°C.
  • Fluidigm sequencing primers FLi and FL2 were diluted to 0.5UM final in a 20ul volume and spiked into the appropriate Miseq cartridge positions ie FLi in positions #12 for Readi and #14 for Read2, FL2 in position #13 for Index Read.
  • the MiSeq cartridge was loaded into Miseq and the run was set up following Illumina MiSeq sequencing standard procedures.
  • Familial hypercholesterolaemia is a common Mendelian disorder associated with early onset coronary heart disease that can be treated by cholesterol lowering drugs. The majority of cases in the UK are currently without a molecular diagnosis partly due to the cost and time associated with standard screening techniques. This study tested the sensitivity and specificity of two next-generation sequencing (NGS) protocols for genetic diagnosis of FH. Methods :
  • LDLR LDLR insertions/deletions in LDLR.
  • One sample was homozygous for LDLR .Gln384Pro and one sample was a compound heterozygote with one missense mutation and one large deletion in LDLR.
  • the remaining 5isamples in the validation cohort had negative molecular diagnoses.
  • 29 were processed using the SureSelect Target Enrichment System alone, 42 using the Access Array System micro fluidic platform alone and the remaining 33 using both platforms.
  • 84 consecutive patients referred for molecular testing by the Hammersmith Hospital lipid clinic over a period of one year were studied by the PCR-based Access Array System microfluidic platform.
  • GTTGTTGTCCAAGCATTCGTT were designed to amplify exons 4 to 7 of LDLR.
  • the genomic co-ordinates of the 18 targeted genes were d etermined using the March 2006 build (NCBl36/hgi8) of the human genome in the Ensembl genome browser 12 .
  • the density of bait tiling was 5-fold and the baits were allowed to overlap into repeat regions by sobp.
  • the total targeted DNA length was 399kb.
  • All libraries were generated from sheared DNA (Covaris, Woburn, MA, USA) with an average insert size of 200bp following the SureSelect Target Enrichment System XT (Agilent, Santa Clara, CA, USA) protocol for Alumina multiplexed sequencing version 1.2. After dilution to 2nM, up to 30 libraries were pooled and sequenced on one lane on the HiSeq2000 platform (Alumina, San Diego, CA, USA) to generate 2xioobp paired-end reads.
  • the design included 43 amplicons covering all exons of LDLR, with the majority of the coding sequence covered by more than one overlapping fragment. Amplicons were also designed to cover exons 2, 4, 7, and 9 of PCSK9 containing the most common gain-of- function pathogenic mutations; APOB (one amplicon covering the most common familial defective apolipoprotein B-100 mutation p.Arg3527Gln); APOE (one amplicon covering the APOE E2 variant site, rs74i2); and SLC01B1 (one amplicon covering 1-84149056, the myopathy-associated variant). The average amplicon length was i84b with 57% GC content. Primer sequences are shown in Table Si.
  • Copy number variant analysis from NGS data was performed for the samples sequenced using targeted capture.
  • a read-depth based method 17 as implemented in R package ExomeDepth, was used to identify deletions and duplications spanning at least one exon.
  • Each sequencing batch of samples was processed separately in order to increase the quality of a reference set for each sample and therefore to maximise the power to detect copy number variants.
  • Read depth was assessed for each exon in the target region and the ratio of expected and observed read count was obtained, as well as a Bayes factor for the copy number variant calls, as implemented in the method.
  • MLPA was performed using the kit LDLR- P062 (MRC-Holland) following the manufacturer's protocol.
  • the novel exon 16 deletion was confirmed by PCR.
  • the previously-described large deletions and duplications are detailed in Tosi et alfi .
  • the sensitivity of an assay was defined as the percentage of pathogenic mutations correctly identified with respect to previous or new Sanger sequencing and MLPA.
  • the specificity is defined as the percentage of mutation negative samples correctly identified as negative with respect to previous or new Sanger sequencing and MLPA.
  • Genotypes of the SLC01B1 myopathy-associated variant 1-84149056 were scored from the Access Array System microf!uidic platform and SureSelect Targeted Enrichment System data in all patients, and any history of adverse effects was obtained by review of medical records. Side effects were defined biochemically (transaminase or creatine kinase levels more than three times the upper limit of a normal range) or
  • Hybridisation-based capture is known to target GC-rich regions poorly; however, all regions containing known FH-causing mutations were covered sufficiently (>25x) for confident variant calling,
  • the initial analysis of the sequencing results was carried out blinded to the gene and mutation details for each sample. All twenty heterozygous and one homozygous short pathogenic mutations, including point mutations and insertions/deletions of less than 15 base pairs, were detected (Table 1). In addition one compound heterozygote and six large
  • LDLR low-density lipoprotein
  • p.Asp227Glu two were large deletions (deletion of exon 16 and deletion of promoter/ exon 1).
  • a novel variant was identified in the LDLR promoter (c. -227G>T, GERP score 3.29, located in the highly-conserved footprint 1 (FPi) site) and two rare variants were identified in APOB in patients without a previous molecular diagnosis.
  • DNA samples from 53 previously characterized patients including 40 with point mutations (39 heterozygotes and one homozygote), 6 with insertions/deletions (all heterozygotes), 6 with large deletions or duplications (all heterozygotes), and one compound heterozygote with one missense mutation and one large deletion in LDLR (Table 1) were amplified together with 22 patients that had previously screened negative.
  • the median coverage per sample was 572X (min 461, max 625). All amplicons except A POE (see Methods) amplified with a mean coverage of 506X.
  • the coverage for individual amplicons is listed in Table S2. Overall, 90% of bases were covered more than 25-fold.
  • Asp227Glu was identified in a sample that previously had no molecular diagnosis. No pathogenic mutations were found in remaining samples that were negative on previous screening. Large deletions could not be detected with the PCR-based Access Array System because no reduction in coverage was observed within deleted regions. The overall sensitivity of this assay compared to SureSelect Target Enrichment System was therefore 82% (47/57).
  • the prospective cohort included six patients with definite FH as defined by the Simon Broome criteria, 65 with possible FH and 13 hypercholesterolaemic patients not fulfilling Simon Broome criteria for FH.
  • the highest defection rate of clearly pathogenic mutations was in the group of patients with a definite FH diagnosis (4/6, 67%) followed by the group with a diagnosis of possible FH (17/65, 26%),
  • One mutation (1/13, 8%) was identified amongst the 13 hypercholesterolaemic patients that did not fulfill FH diagnostic criteria.
  • the SureSelect Target Enrichment System assay included 13 genes that reside on cholesterol metabolism pathways. Rare variants identified in these genes, particularly in hypercholesterolaemic individuals who screened negative for mutations in LDLR, PCSK9 and APOB, are potentially responsible for patients' raised cholesterol. Rare variants (MAF ⁇ o.oi) identified in such individuals are listed in Table S3. In patients with no previously known molecular diagnosis, seven rare non-synonymous variants were found, of which six were not predicted to be functionally significant by SIFT and PolyPhen. The single variant, that was most likely to be of functional significance and therefore potentially pathogenic, was p.ValSogMet in SR EBFL However, this was excluded from further analysis as it did not segregate with the phenotype in the family (data not shown).
  • the single variant that was not detected by the PCR-based Access Array System protocol was an nbp deletion
  • LDLR coding sequence three mutations in the LDLR coding sequence (one single nucleotide variant, p.Asp227Giu, and two large deletions) and one LDLR promoter variant (e.-227G>T) were identified in patients who were previously classified as mutation negative.
  • the SureSelect Target Enrichment System protocol allows for comprehensive co verage of targeted regions (current custom design up to 24Mb) while the Access Array System protocol is limited to 480 amplicons with a maximum length of 40obp when sequenced using the latest MlSeq system. Sequence capture also allows the detection of all types of variants including large deletions and duplications, which was not possible in this study using the PCR-based Access Array System.
  • the Access Array System is considerably cheaper to run 19 > 22 with reagent costs approximately 10-fold lower than for the SureSelect Target Enrichment System protocol 22 and, in addition, the library preparation turnaround time is shorter. In our hands 96 samples can be processed within a day using the Access Array System protocol compared to at least three days needed for the SureSelect Target Enrichment System in-solution capture.
  • the LDLR promoter variant c.-227G>T has not previously been reported in FH patients, or in other populations, but was investigated previously as part of a study delineating the conserved FPi site.
  • a luciferase assay showed that the c.-227G>T variant had around 75% transcription levels compared with the wild-type site 26 . Whilst a 25% reduction is not a definitive decrease in promoter activity, it cannot be excluded that this change is sufficient to cause raised cholesterol levels in this patient.
  • Family members were unavailable for segregation analysis and we therefore classify this variant as being of uncertain significance pending further functional and segregation data.
  • the remaining two novel variants in A FOB, rs.1.2714097 and ⁇ 72653087 were located outside LDLR binding sites, regions currently not associated with
  • hypercholesterolaeniia and their pathogenicity therefore also remains to be elucidated.
  • the types of mutation identified here reflect the distribution of variants published in the LDLR locus specific database ⁇ with exonic substitutions (56%) being the most common followed by short insertions deletions (28%), Most of the mutations identified here were unique with only 20% common among UK FH patients which would be identified using the Elucigene FH20 commercial ARMS kit. In our prospective study, we did not identify any mutations in PCSK9 or large rearrangements of LDLR. These variants are generally rare among patients with FH " and we therefore consider it unlikely that our results are biased in anyway.
  • next-generation assays is flexible and can be readily extended to include full coding regions of APOB and PCSK9 as well as coding regions of other medically relevant genes, such as APOE and SLC01B1 that currently need to be genotyped separately.
  • Wierzbicki AS Humphries SE, Minhas R. Familial hypercholesterolaemia: summary of NICE guidance. BMJ. 2008:337:31095.
  • Soutar AK Naoumova RP. Mechanisms of Disease: genetic causes of familial hypercholesterolemia. Nat Clin Pract Cardiovasc Med. 2007;4(4):2i -225. . Tosi I, Toledo- Leiva P, Neuwirth C, Naoumova RP, Soutar AK. Genetic defects causing familial hypercholesterolaemia: Identification of deletions and duplications in the LDL-receptor gene and summaty of all mutations found in patients attending the Hammersmith Hospital Lipid Clinic. A therosclerosis. 2007;l94(l): 102-111.
  • cytoplasmic tails is required for coated pit-mediated internalization of the low density lipoprotein receptor. Journal of Biological Chem istry . February 25, 1990 I990;205(6):3ii6-3123.
  • TabSe S3. List of rare variants ( AF 0 01), identified in hyperchiiesleralaemic patients with no molecular diag osis, iri genes on cholesterol metabolism pathways umber of Protein Amino acid

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a method for collecting information useful in aiding the diagnosis and treatment of familial hypercholesterolaemia (FH), the method comprising providing a sample of DNA from the subject, assaying said DNA for (i) mutation in one or more genes which is indicative of FH diagnosis (ii) presence of one or more SNPs indicative of incremental risk of high cholesterol; and (iii) mutation in a gene which is indicative of likelihood of statin toxicity; wherein assaying said DNA comprises the step of contacting said DNA sample with one or more primers for amplification and/or sequencing of the relevant segment(s) of said DNA characterised in that each of said assays of steps (i), (ii) and (iii) is carried out in a single assay cycle. The invention also relates to a method of treatment, and to primers.

Description

GENETIC METHOD OF AIDING THE DIAGNOSIS AND TREATMENT OF FAMILIAL
HYPERCHOLERSTEROLAEMIA
FIELD OF THE INVENTION The invention is in the field of hypercholesterolaemia. In particular, the invention relates to the provision of a comprehensive technique for patient management in the field of familial hypercholesterolaemia.
BACKGROUND TO THE INVENTION
Familial hypercholesterolaemia (FH, OMIM #143890) is a common Mendelian disorder that affects 1 in 500 individuals and it is estimated that 12 million of people are affected worldwide (Goldstein et al., 2001). Patients with FH have raised serum cholesterol levels from birth and increased arterial deposition of low density
lipoprotein (LDL) cholesterol leading to premature coronary heart disease (CHD). If untreated or inadequately treated half of men with FH develop heart disease before the age of 55 and one third of women before the age of 60. Despite the fact that early onset CHD can be prevented by cholesterol-lowering drugs such as statins, less than a quarter of FH patients have currently been identified in the UK. (Marks, Thorogood et al. 2004) One of the main reasons for FH being underdiagnosed are the cost and time associated with current diagnostic techniques.
In the UK the clinical diagnosis of FH is based on the Simon Broome criteria of cholesterol levels, presence of tendon xanthomata, family histor and genetic testing. (Scientific Steering Committee on behalf of the Simon Broome Register Group 1991) The UK National Institute for Health and Clinical Excellence (NICE) has recommended molecular diagnosis of FH probands and cascade screening of their families as the most effective way of identifying the estimated 75% of FH patients in the UK who are unaware of their condition and are therefore not on treatment which could reduce their high cardiovascular risks to near population levels (DeMott, 2008; Neil et al., 2000), and a recent cost-benefit analysis indicated that this approach (used together with LDL cholesterol measurement) applied to patients with probable FH was more effective than screening using LD L measurement alone or limiting screening to patients with definite FH (Nherera et al., 2011). Monogenic FH is inherited in an autosomal dominant manner and therefore an affected individual has a 50% chance of
transmitting the disease causing mutation to a child. Most cases of FH are caused by mutations in the LDLR gene that encodes the low density lipoprotein receptor protein, which binds LDL particles at the hepatic cell membrane and internalises them for processing and excretion. FH-causing mutations in LDLR are found throughout the gene and include missense, truncating and splice site mutations, small insertion/deletion mutations, and large insertions/deletions which can encompass multiple exons. Some mutations have been found in many unrelated individuals with FH, while others are found rarely. (Leigh, Foster et al. 2008) Mutations in two other genes, PCSK9 and A POB, can also cause the FH phenotype, but in less than 10% of mutation positive cases. (Taylor, Wang et al. 2010)
Conventional DNA testing of FH disease-causing genes is mostly based on direct capillary sequencing, with multiplex ligation-dependent probe amplification (MLPA) used for the detection of large insertions or deletions (Tosi, Toledo-Leiva et al. 2007). These molecular techniques are sensitive and specific, but due to the cost and time involved, they are impractical for screening large numbers of patients. To overcome some of these limitations, assays such as the Amplification Refractory Mutation System (Elucigene™ FH20, Tepnel Molecular Diagnostics, Abingdon, UK) or array-based sequencing methods (LIPOchip, Progenika Biopharma, Deiio, Spain), have been developed. These assays are tailored to specific mutations and populations, and therefore do not detect less common known mutations or any novel mutations (Taylor, Tabrah et al. 2007, Alonso, Defesche et al. 2009) .
Thus, familial hypercholesterolaemia (FH) is a known condition. Sufferers monogenic FH possess a mutation in one of three known FH diagnostic genes. These genes are APOB, LDLR and PCSK9. Standard molecular diagnostic techniques detect mutations in 40% of FH patients and it is believed that a proportion of remaining cases have raised cholesterol due to a combined, polygenic, effect of several LDL-C-raising common variants. This is discussed in more detail below. The current standard test for FH is a genetic test. This involves the analysis of the three diagnostic genes in an individual for mutations. This is currently accomplished by conventional sequencing techniques. This is most often accomplished using capillary sequencing. This is a very laborious process. This is a very time consuming process. For these reasons, many people lack a genetic diagnosis. These patients who lack a genetic diagnosis are typically handled solely on the basis of the symptoms which they present with. This is a further problem in the art. The gold standard treatment for hypercholesterolaemia is a prescription of statins, Statins control (reduce) cholesterol levels when administered to patients. Statins are a long term treatment. Many patients will be prescribed statins for the rest of their natural lives when presenting with hypercholesterolaemia.
Cholesterol lowering therapy has been very successful in FH and has led to reduced mortality and morbidity. Statin drugs (HMGCoA reductase inhibitors) are the mainstay of treatment for FH, but are not well tolerated by all patients. Muscular side-effects ranging from muscle pain through to life-threatening rhabdo myolysis are among the principal reasons for discontinuation of treatment. The 1-54149056 variant in SLC01B1 (solute carrier organic anion transporter family member 1B1) has been shown to be associated with statin-induced myopathy (The Search Collaborative Group, 2008). Thus, a proportion of the population is predisposed to statin toxicity. In other words, when statins are administered to a cohort of patients, a proportion of those patients will have an underlying statin toxicity issue. Statin toxicity causes a range of harrowing effects, including muscular pain, muscle weakness, death and/or erosion of muscle fibres, and in severe cases a resulting trauma to the kidneys which can result in kidney failure. It is a problem in the art that patients suffering from statin toxicity are typically suffering a long term decline. As the toxicity problem runs on a patient gets weaker and weaker.
It is a problem in the prior art that the effects of statin toxicity are prone to end up as a separate diagnostic investigation unless the physician is alert to the risk and recognises the symptoms early in the treatment.
Casual cholesterol testing is becoming increasingly common outside mainstream medical service provision. As a result of raising of the public awareness of the dangers of hypercholesterolaemia, individuals in the population are becoming concerned about their own cholesterol levels. In response to this concern, third party providers are offering cheap cholesterol testing. These tests can be as simple as a skin prick conducted on a "while you wait" basis by operatives with little or no medical training. Although these tests might be useful as an initial indicator of a cholesterol level, the operatives providing these tests are usually not medically qualified and cannot offer any prescription or treatment recommendations. Therefore, individuals taking a casual cholesterol test and receiving an indication of high cholesterol are referred back to mainstream healthcare providers. This is creating an influx of patients into doctors' surgeries presenting results of casual cholesterol tests and asking for treatment or further investigation. This is placing a large burden on mainstream health service provision. In addition, simple cholesterol levels obtained from such casual prick tests provide no indication of any underlying cause or diagnosis. As indicated above, the current technique for analysing or diagnosing patients presenting with
hypercholesterolaemia is laborious and expensive. The extra demand for these resource intensive tests is creating a further problem to medical healthcare providers. The present invention seeks to overcome problems associated with the prior art.
SUMMARY OF THE INVENTION
In the prior art, the only genetic test for familial hypercholesterolaemia (FH) involves conventional sequencing. There are three main genes which are diagnostic of FH. The prior art screen typically requires PGR amplification of the relevant fragments from these genes. This is followed by con ventional sequencing. The approach used is usually capillary sequencing, which is laborious and costly. This results in many people lacking a genetic diagnosis of their condition. In addition, it means that the physician attempting to treat the patient has a paucity of information about their condition.
The present inventors have studied FH in detail. The invention is based on a combined test which individually examines multiple factors which are involved in FH. In summary, the inventors teach the parallel analysis of three patient attributes - (i) assay of the three main diagnostic genes for FH (APQB, LDLR and PCSK9); (ii) assay of polygenic FH SNPs (a collection of lower penetrance incremental risk indicators); and (iii) assay of the patient's SLCO1B1 genotype (the genetic indicator of statin toxicity). The inventors teach for the first time the combination of these three elements into a single diagnostic test. The advantage of this is that the physician is then appraised with a complete picture of the patient's condition, including their incremental risk indicators, and al so at the same time an indication of whether they are likely to have a negative response to the gold standard statin treatment. This combination has never been attempted in the prior art. This combination has advantages in targeting the treatment to the patient in the correct manner, and also avoiding the extremely negative side effects for that proportion of the population who would typically be placed on statin treatment even though they are at risk of serious side effects from statin toxicity. The present invention advantageously alleviates these problems associated with the prior art.
In addition to this main principle of the invention, the in ventors teach that
advantageously the tests are conducted using a paired approach of micro-fluidics with next generation sequencing. This is also a departure from the prior art techniques which have relied on conventional PCR amplification coupled to ordinary sequencing techniques such as capillary sequencing. By embracing the micro-fluidic and next generation sequencing (NGS) approaches in a combined method, the inventors are able to dramatically increase the efficiency of the test, and at the same time reduce the cost to a fraction of the cost of the current conventional testing.
These and other advantages are explained in more detail below. Thus, in one aspect the invention provides a method for collecting information useful in aiding the diagnosis and treatment of familial hypercholesterolaemia (FH), the method comprising providing a sample of nucleic acid such as DNA from the subject, assaying said nucleic acid such as DNA for
(i) mutation in one or more genes which is indicative of FH diagnosis
(ii) presence of one or more SNPs indicative of incremental risk of high cholesterol; and
(iii) mutation in a gene which is indicative of likelihood of statin toxicity;
w erein assaying said nucleic acid such as DNA comprises the step of contacting said nucleic acid such as DNA sample with one or more primers for amplification and/or sequencing of the relevant segment(s) of said nucleic acid such as DNA
characterised in that each of said assays of steps (i), (ii) and (iii) is carried out in a single assa cycle.
In another aspect, the invention relates to a method as described above wherein assaying said nucleic acid such as DNA further comprises determining the nucleotide sequence of the relevant segment(s) of said nucleic acid such as DNA, and inferring from said nucleic acid such as DNA sequence whether said mutations of steps (i) and (iii), and said one or more SNPs of step (ii), are present. The invention may be applied to any nucleic acid; suitably the nucleic acid is DNA. The invention is described with reference to DNA as an exemplary nucleic acid. By 'single assay cycle' is meant that the assay steps are carried out on the same sample. Suitably this means in a multiplexed assay. Suitably this means at the same time (i.e. simultaneously). Suitably this means that the single assay cycle, which may consist of multiple tubes or reactions as necessary, is carried out as a single coherent test event. Suitably this means that the results of the individual assays of steps (i), (ii) and (iii) are delivered (e.g. produced/ determined) together.
In another aspect, the invention relates to a method as described above wherein said one or more genes indicative of FH diagnosis is selected from the group consisting of APOB, LDLR and PCSK9. Each gene in this group of genes shares the common property of being indicative of monogenic FH.
In another aspect, the invention relates to a method as described above wherein said mutation in one or more genes which is indicative of FH diagnosis is selected from those listed in Table 2.
In another aspect, the invention relates to a method as described above wherein said SNP is selected from Table A or Table B. Each SNP in this group of SNPs shares the common property of being indicative of incremental risk of high cholesterol. Suitably each SNP in this group of SNPs shares the common property of being indicative of polygenic FH.
In another aspect, the invention relates to a method as described above wherein said gene indicative of risk of statin toxicity is SLCO1B1.
Suitably step (iii) comprises determining the presence of the rs.4149056 or 1*54149056 variant of SLCO1B1.
Suitably step (iii) comprises determining the presence of the ^4149056 variant of SLCO1B1. In another aspect, the invention relates to a method as described above wherein said DNA sample is subjected to micro-fluidic PGR amplification of the DNA segment(s) of interest.
Suitably said PCR is carried out using at least one primer selected from Table 3.
Suitably said PCR is carried out using each of the primers in Table 3.
Enrichment is suitably accomplished by PCR. In another aspect, the invention relates to a method as described above wherein sequence information is determined by next generation sequencing (NGS).
In another aspect, the invention relates to a method of treating a subject comprising performing the method according to any preceding claim wherein if an increased likelihood of FH is identified, then cholesterol lowering medicament is administered to said subject, wherein said medicament is selected according to the subject's SLCOiBi genotype.
Suitably selection of the medicament comprises selection of one or more of the upper limit of the dose of said medicament for said subject, the dose of said medicament to be administered to said subject, or the particular medicament to be administered to said subject.
Suitably said medicament is a statin. In another aspect, the invention relates to a primer selected from Table 3.
In another aspect, the invention relates to a set of primers comprising at least one pair of the primers in Table 3. In another aspect, the invention relates to a set of primers according to claim 17 comprising each of the primers in Table 3.
DETAILED DESCRIPTION OF THE INVENTION In one embodiment the invention may relate to a method for determining whether a subject has a predisposition for monogenic familial hypercholesterolaemia by virtue of a mutation in one of the genes selected from LDLR, PCSK9, APOB or polygenic familial hypercholesterolaemia by virtue of combination of genotypes in (rs6511720) LDLR, (rs2479409) PCSK9, (1-8.1.367117) APOB, (TS629301) CELSR2, ({-54299376) ABCG8, (^1564348) SLC22A1, (rsi8oos02) HFE, (^3757354) MYLIP, (1-511220462) ST3GAL4, (rs8oi7377) NYNRIN, ( S429358, 1-57412) APOE and for determining individual's response to statin treatment by virtue of a variant (1-54149056) in SLCO1B1 gene comprising:
carrying out a nucleic acid amplification step on a biological sample from the subject, wherein the nucleic acid amplification step uses all primer pairs, the primer pairs comprising a forward primer with a forward primer sequence selected from SEQ ID NO: i to SEQ ID NO:6o; or a reverse primer with a reverse primer sequence selected from SEQ ID NO: 61 to SEQ ID NO: 120;
sequencing at least part of the amplification product, the amplification product being a sequence of at least a part of one of the genes LDLR, PCSK9, APOB, CELSR2, ABCG8, SLC22A1, HFE, MYLIP, ST3GAL4, NYNRIN, APOE and SLCO1B1
and
determining whether the LDLR, PCSK9 or APOB amplification product represents a sequence that has a mutation that is indicative of a risk for a familial hypercholesterolaemia
determining whether combination of LDLR, PCSK9, APOB, CELSR2, ABCG8, SLC22A1, HFE, MYLIP, ST3GAL4, NYNRIN, APOE amplification products have SNPs that are indicative of a risk for a polygenic familial hypercholesterolaemia determining whether the SLCO1B1 amplification product represents a sequence that has an SNP that is indicative of a risk for adverse statin effect,
In detail the invention may be operated as follows. The exemplary PGR primers described (or alternate primers if desired) may be used to assist in sequencing the full gene LDLR and selected genomic regions CELSR2, ABCG8, SLC22A1, HFE, MYLIP, ST3GAL4, NYNRIN, APOE and SLCOiBiof the subject.
The subject's gene sequence(s) is then compared with known variants of these genes associated with monogenic or polygenic FH. From the comparison, it is determined whether any particular DNA variant or variants exist in the subject. It is then possible to correlate the variants to risk of FH and statin related myopathy.
The comparison of the sequence information of the subject with known allele sequences can be carried out by making comparisons using established and freely available bio- info rmatic techniques (e.g. GATK or platform-specific software) with comparison to the reference human genome, 1000 genomes data and in high-quality controls, which we have established.
After comparing the subject's gene sequences to known variants, an informed diagnostic interpretation of the risk of FH can be made. Whenever a cause of monogenic FH, a mutation, is identified through genetic testing, family-specific genetic testing can also be used to identify relatives at-risk for the disease. Thereafter, a treatment decision can be made. Clinical decision algorithms for assigning
pathogenicity are well established. In short, if a mutation is known to cause the disease from previous publications that have shown segregation of the mutation in a family or enrichment of a mutation in cases versus controls then it is assigned as disease causing. New mutations, not present in the reference human genomes, that segregate in a family may also be assigned pathogenicity in combination with pathogenicity scoring tools (conservation, polyphen and sift). Variants of unknown significance are assigned as such and common benign variants are also identified.
Polygenic predisposition to FH is established by calculating a score, an LDL-c gene score, based on presence or absence of selected variants in LDLR, PCSK9, APOB,
CELSR2, ABCG8, SLC22A1, HFE, MYLIP, ST3GAL4, NYNRIN, APOE.
As described above, the invention provides a method of determining whether a subject has a predisposition for familial hypercholesterolaemia and adverse reaction to statin treatment.
DEFINITIONS
"Amplification" of polynucleotides may utilise methods such as the polymerase chain reaction (PCR), ligation amplification (or ligase chain reaction, LCR) and amplification methods based on the use of Q-beta replicase. Also useful are strand displacement amplification (SDA), thermophilic SDA, and nucleic acid sequence based amplification (3SR or NASBA).
One particularly preferred method using polymerase-driven amplification is the polymerase chain reaction (PCR). The polymerase chain reaction and other
polymerase-driven amplification assays can achieve over a million-fold increase in copy number through the use of polymerase-driven amplification cycles. Once amplified, the resulting nucleic acid can be sequenced or used as a substrate for DNA probes. These methods are well known and widely practiced in the art. See, e.g., U.S. Patents 4,683,195 and 4,683,202 and Innis et al., 1990 (for PCR); Wu and Wallace, 1989 (for LCR); U.S. Patents 5,270,184 and 5,455,166 and Walker et al., 1992 (for SDA); Spargo et al, 1996 (for thermophilic SDA) and U.S. Patent 5,409,818, Fahy et al., 1991 and Compton, 1991 for 3SR and NASBA. Reagents and hardware for conducting PCR are commercially available.
Primers useful to amplify sequences from the LDLR, PCSK9, APOB, CELSR2, ABCG8, SLC22A1, HFE, MYLIP, ST3GAL4, NYNRIN, APOE and SLCO1B1 genes are suitably complementary to, and hybridise specifically to, sequences in the LDLR, PCSK9, APOB, CELSR2, ABCG8, SLC22A1, HFE, MYLIP, ST3GAL4, NYNRIN, APOE and SLCO1B1 genes or in regions that flank a region therein. Sequences in the LDLR, PCSK9, APOB, CELSR.2, ABCG8, SLC22A1, HFE, MYLIP, ST3GAL4, NYNRXN, APOE and SLCO1B1 genes generated by amplification may be sequenced directly. Alternatively, but less desirably, the amplified sequence(s) may be cloned prior to sequence analysis. A method for the direct cloning and sequence analysis of enzymatically amplified genomic segments has been described by Scharf et ah, 1986. The most popular method used today is target amplification. Here, the target nucleic acid sequence is amplified with polymerases.
The term "comprising" as used in this specification and claims means "consisting at least in part of", that is to say when interpreting statements in this specification and claims which include the term, the features, prefaced by that term in each statement, all need to be present but other features can also be present. Related terms such as "comprise" and "comprised" are to be interpreted in a similar manner. The term "fragment" of a polynucleotide sequence provided herein is a subsequence of contiguous nucleotides that is capable of specific hybridisation to a target of interest, e.g., a sequence that is at least 10 nucleotides in length. The fragments may comprise 10, preferably 15 nucleotides, preferably at least 20 nucleotides, more preferably at least 30 nucleotides, more preferably at least 40 nucleotides, more preferably at least 50 nucleotides and most preferably at least 60 nucleotides of contiguous nucleotides of a polynucleotide. A fragment of a polynucleotide sequence can be used as a primer, a probe, included in a mieroarray, or used in polynucleotide-based identification methods. The term "hybridise under stringent conditions", and grammatical equivalents thereof, refers to the ability of a polynucleotide molecule to hybridise to a target polynucleotide molecule (such as a target polynucleotide molecule immobilised on a DNA or RN A blot, such as a Southern blot or Northern blot) under defined conditions of temperature and salt concentration. The ability to hybridise under stringent hybridisation conditions can be determined by initially hybridising under less stringent conditions then increasing the stringency to the desired stringency.
With respect to polynucleotide molecules greater than about 100 bases in length, typical stringent hybridisation conditions are no more than 25 to 30°C (for example, io°C) below the melting temperature (Tm) of the native duplex (see generally,
Sambrook et al, Eds, 1987, Molecular Cloning, A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press; Ausubel et al, 1987, Current Protocols in Molecular Biology, Greene Publishing). Tm for polynucleotide molecules greater than about 100 bases can be calculated by the formula Tm = 81. 5 + o. 41% (G + C-log (Na+) (Sambrook et. al, Eds, 1987, Molecular Cloning, A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press; Bolton and McCarthy, 1962, PNAS 84:1390). Typical stringent conditions for a polynucleotide of greater than 100 bases in length would be hybridisation conditions such as prewashing in a solution of 6X SSC, 0.2% SDS; hybridising at 6s°C, 6X SSC, 0.2% SDS overnight; followed by two washes of 30 minutes each in iX SSC, 0.1% SDS at 65°C and two washes of 30 minutes each in 0.2X SSC, 0.1% SDS at 65°C. In one embodiment stringent conditions use 50% formamide, 5 x SSC, 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 μ§/ητ1), o.i% SDS, and 10% dextran sulphate at 42°C, with washes at 42°C in 0.2 x SSC and 50% formamide at 55°C, followed by a wash comprising of 0.1 x SSC containing EDTA at 55°C.
With respect to polynucleotide molecules having a length less than 100 bases, exemplar stringent hybridisation conditions are 5 to io°C below Tm. On average, the Tm of a polynucleotide molecule of length less than 100 bp is reduced by approximately (500/oligonucleotide length) °C.
The term "nucleic acid" as used herein, means a single or double-stranded
deoxyribonucleotide or ribonucleotide polymer of any length, and include as non- limiting examples, coding and non-coding sequences of a gene, sense and antisense sequences, exons, introns, genomic DNA, cDNA, pre-mRNA, mRNA, rRNA, siRNA, miRNA, tRNA, ribozymes, recombinant polynucleotides, isolated and purified naturally occurring DNA or RNA sequences, synthetic RNA and DNA sequences, nucleic acid probes, primers, and fragments thereof. Reference to a polynucleotide(s) is to be similarly understood. Most suitably nucleic acid is DNA. The term "next generation sequencing" (NGS) is DNA sequencing using high- throughput sequencing technologies that parallelise the sequencing process, so that thousands or millions of sequences can be generated at once. This speed allows for low- cost sequencing of DNA, allowing, for example, for DNA sequencing to be viably used in clinical practice. There are generally three steps in NGS: template preparation, sequencing and imaging, and data analysis. Template preparation commonly requires amplification of the DNA, for example by using PCR. Three commonly used methods of sequencing are classified as cyclic reversible termination (CRT), single-nucleotide addition (SNA) and real-time sequencing. The imaging coupled with these techniques often range from measuring bioluminescent signals to four-colour imaging of single molecular events. Examples of specific NGS technologies include, but are not limited to, Massively Parallel Signature Sequencing (MPSS), polony sequencing, 454 pyrosequencing, Alumina (Solexa) sequencing (sequencing based on reversible dye- terminators), Sequencing by Oligonucleotide Ligation and Detection (SOLID) sequencing, ion semiconductor sequencing, DNA nanoball sequencing, Helioscope™ single scope sequencing, single molecule real time (SMRT) sequencing, single molecule real time (RNAP) sequencing and nanopore DNA sequencing.
The term "oligonucleotide(s)" are nucleic acids that are usually between 5 and 200 contiguous bases, and often between 5-10, 5-20, 10-20, 10-50, 5-50, 15-100, 20-50, 20-100, 20-200, 50-200, or 100-200 contiguous bases. An oligonucleotide that is longer than about 20 contiguo s bases may be referred to as a polynucleotide. A polymorphic site (polymorphism) can occur at any position within an oligonucleotide.
A "polymorphic site" refers the position in a nucleic acid sequence at which a polymorphism occurs. A polymorphic site may be as small as one base pair. The term "polymorphism" refers to a genetic variation, or the occurrence of two or more genetically determined alternative sequences at a single genetic locus in a population. Each version of the sequence with respect to the polymorphic site is referred to as an "allele" of the polymorphic site. Preferred polymorphisms ha ve two alleles, with the minor allele occurring at a frequency of greater than 1%, and more preferably greater than 5% or 10% of a selected population. The allelic form occurring most frequently in a selected population is sometimes referenced as the "wildtype" form. The allelic form occurring less frequently in a selected population is sometimes referenced as the "mutant" form. Diploid organisms may be homozygous or
heterozygous for allelic forms. A biallelic polymorphism has two forms. A triaileiic polymorphism has three forms. Examples of polymorphisms include restriction fragment length polymorphisms (RFLPs), variable number of tandem repeats (VNTRs), single nucleotide polymorphisms (SNPs), dinucleotide repeats, trinucleotide repeats, tetranucleotide repeats, simple sequence repeats, and insertion elements such as Alu. The term "pre-disposition", when used in relation to FH syndrome or any similar phrase such as "propensity" or "susceptibility", means that certain alleles have been discovered to be associated with, or predictive of, FH. These "high-risk" alleles maybe the minor (or mutant) allele, or the major (or wild-type) allele. These alleles are thus over- rep resented in frequency or carriage rate in individuals who are at risk of developing FH compared to individuals who are not susceptible toFH. Hence, the term "an individual's susceptibility to FH" refers to a statistically higher, or lower, frequency of FH in an individual carrying a particular polymorphic allele, or genotype (i.e. allelic or polymorphism pattern) in comparison to the frequency in a member of the population that does not carry the particular polymorphic allele, or genotype.
An individual that carries one or both high-risk alleles at a polymorphic site is said to have a heterozygous or homozygous "high-risk" genotype for that particular
polymorphic site, respectively. An individual that does not cany a particular high-risk allele is said to have a homozygous "low-risk" genotype.
The term "primer" refers to a polynucleotide, usually having a free 3' OH group, that may be hybridised to a template and used for priming polymerisation of a
polynucleotide complementary to the target.
"Probing": In general, it is expected that analysis of the amplification products will take place by sequencing. However, it may also be desirable to analyse the amplification products by "wet" binding probing to detect the presence or absence of specific sequences. Analyte nucleic acid and probe are incubated under conditions which promote stable hybrid formation of the target sequence in the probe with the putative targeted sequence in the analyte. The region of the probes which is used to bind to the analyte can be made completely complementary to the targeted region of the gene of interest such as LDLR, PCSK9, APOB, CELSR2, ABCG8, SLC22A1, HFE, IVfiT.JP,
ST3GAL4, NYNRFN, APOE or SLCO1B1 genes. Therefore, high stringency conditions are desirable in order to prevent false positives. However, conditions of high stringency are used only if the probes are complementary to regions of the chromosome which are unique in the genome. The stringency of hybridization is determined by a number of factors during hybridization and during the washing procedure, including temperature, ionic strength, base composition, probe length, and concentration of formamide. These factors are outlined in, for example, Maniatis et al., 1982 and Sambrook et al., 1989.
The term "SNP" or "single nucleotide polymorphism" is a polymorphism that occurs at a polymorphic site occupied by a single nucleotide. The site of the SNP is usually- preceded by and followed by highly conserved sequences (e. g., sequences that vary in less than 1/100 or 1/ 1000 members of a population). As used herein, "SNPs" is the plural of SNP. SNPs are most frequently diallelic. A most common allele of a SNP is called a "major" or "wild-type" allele and an alternative allele of said SNP is called a "minor" or "mutant" allele. A SNP usually arises due to substitution of one nu cleotide for another at the polymorphic site. A transition is the replacement of one purine by another purine or one pyrimidine by another pyrimidine. A transversion is the replacement of a purine by a pyrimidine or vice versa. SNPs can also arise from a deletion of a nucleotide or an insertion of a nucleotide relative to a reference allele.
SNPs tend to be evolutionarily stable from generation to generation and, as such, can be used to study specific genetic abnormalities throughout a population. If SNPs occur in the protein coding region it can lead to the expression of a variant, sometimes defective, form of the protein that may lead to development of a genetic disease. Such SNPs can therefore serve as effective indicators of the genetic disease. Some SNPs may occur in non-coding regions, but nevertheless, may result in differential or defective splicing, or altered protein expression levels. SNPs can therefore be used as diagnostic tools for identifying individuals with a predisposition for certain diseases, genotyping the individual suffering from the disease in terms of the genetic causes underlying the condition, and facilitating drug development based on the insight revealed regarding the role of target proteins in the pathogenesis process.
A "SNP location" or "SNP locus" is a polymorphic site at which a SNP occurs. SAMPLE
The term "biological sample" as used herein means a biological sample derived from a patient to be screened. The biological sample may be any suitable sample known in the art in which the expression of the selected markers can be detected. Included are individual ceils or cell populations such as obtained from bodily tissues or fluids. The biological sample may comprise for example a blood, tissue, saliva or buccal smear sample,
Suitably the biological sample comprises blood.
Suitably the biological sample comprises saliva.
In one embodiment, a biological sample comprising nucleic acid is obtained from a subject. Nucleic acid is suitably extracted from the biological sample for assay/analysis according to any suitable method known in the art. if further guidance is required, the reader is referred to the examples section. Thus suitably the sample for analysis comprises nucleic acid. Suitably the sample for analysis consists essentially of nucleic acid. Suitably the sample for analysis consists of nucleic acid.
Suitably the sample is an in vitro sample.
Suitably the sample is an extracorporeal sample.
In one embodiment suitably the method is an in vitro method. In one embodiment suitably the method is an extracorporeal method. In one embodiment suitably the actual sampling of the subject (collection of biological sample) is not part of the method of the invention. Suitably the method does not involve collection of the biological sample. Suitably the sample is a sample previously collected. Suitably the method does not require the presence of the subject whose nucleic acid is being assayed. Suitably the sample is an in vitro sample. Suitably the method does not involve the actual medical decision, stricto sensu; such a decision stricto sensu would typically be taken by the physician.
Suitably the method of the invention is conducted in vitro, Suitably the method of the invention is conducted extracorporeally. ADVANTAGES
It is an advantage of the invention that extra information is extracted from a single patient sample compared to the prior art techniques which provide less information per sample,
It is an advantage of the invention that the diagnostic testing is greatly reduced in cost, and is significantly cheaper per patient than existing prior art techniques.
It is an advantage of the invention that performing each of the three tests described in parallel enables the physician to design a more effective treatment regime for each patient. It is an advantage of the invention that a new diagnostic pathway is provided.
It is an ad vantage of the invention that a "one stop" diagnostic suite is provided which enables the diagnosis and management of patients presenting with high cholesterol.
Performing individual tests for the different sections of the analysis described herein according to prior art techniques would require a myriad of separate evaluations to be carried out, mostly by PGR and conventional sequencing. This would be an enormously expensive exercise. Apart from the fact that this combination has never been taught before in the art, the inventors have also made this much more efficient and much more economical by teaching the parallel/ multiplexed analysis of each of these elements in a single analysis.
The inventors teach the application of emerging technologies such as micro-fluidic amplification and next generation sequencing (NGS) in the field of familial
hypercholesterolaemia. It is an advantage of these techniques that the tests can be performed on a small amount of DNA, meaning a smaller sample needing to be collected form the patient. In addition the combined method is more efficient on both time and labour.
The inventors teach for the first time the comprehensive joining together of mutation detection for FH with the assay for SLCO1B1 and the polygenic FH genes. This is a novel approach and has not been taught previously and it is this tripartite assay that provides numerous advantages as set out herein.
The methods taught herein are advantageously both very sensitive and highly specific.
A new level of effectiveness is shown for the combined tests according to the invention which has not been demonstrated in the prior art.
As demonstrated by the accompanying data, the combined method of the invention works very well, in fact it is surprising how well it is shown to work.
The combined method of the invention advantageously provides a comprehensive picture of the patient's need for treatment, coupled to their tolerance of the
conventional statin based therapies. This type of comprehensive picture was not available by any prior art technique. The inventors have broken new ground in combining three types of assays into a single procedure. Nowhere in the prior art has anybody attempted to make such a
combination before. The provision of a single management method for handling patients with hypercholesterolaemia is an advance in the field.
Although certain individual tests are known in the prior art, they each provide only a single answer. Carrying out any one of the individual tests known in the art does not allow the skilled worker to arrive at the invention. It is an advantage of the invention that toxicity/tolerance of the intended therapy is assessed at the same point in time as the diagnosis is facilitated by analysis of the underlying genetic predisposition.
The invention advantageously provides a comprehensive management package for patients with high cholesterol.
MULTIPLEXING
It will be noted that the SLCOiBi statin induced myopathy variant and polygenic FH SNPs are not covered by current diagnostic tests in the art.
The assay of the invention is advantageously carried out as a multiplex. In other words, the separate and individual test which make up the assay of the invention are advantageously carried out on a single DNA sample. Ad vantageously, the assays of the invention are carried out in a single run of a sequence analyser.
Advantageously, the assays of the invention are enriched in a single PCR run, such a micro-fluidic PGR run.
It is a specific advantage of the invention that the assays are conducted in a multiplex format. This provides the advantage of presenting a complete set of information to the physician so that they may diagnose and design a suitable treatment regime on the basis of the output of the multiplexed assay.
A multiplex assay has its normal meaning in the art of molecular biology. In other words, the individual tests being carried out as taught by the invention are performed by a single sample. The individual tests of the invention are performed simultaneously. Suitably the individual tests of the invention are performed in a single PGR assay.
Suitable the assays of the invention are performed in a single sequencing step. The combination of the various tests taught into a single simultaneous (multiplexed) analysis is a departure from the prior art because the phenomenon of familial hypercholesterolaemia (whether monogenic or polygenic) is a separate medical condition from the status of sensitivity to statin toxicity. It is an advantage of the invention that analysis of these two phenomena is brought together in a single step procedure. This is more efficient. This is cheaper. This saves labour. This provides a greater armoury of information to the physician at a single time point, bringing together diagnosis and design of an appropriate treatment regime.
In addition, the cost of multiple sample collection is eliminated since only a single cell ran is required.
In addition, the trauma or inconvenience of multiple sample collection on the patient is also eliminated by performing the invention on a single sample. It is a further advantage of the invention that the patient is assessed for both
monogenic and polygenic FH in a single assay. Of course, the patient will require treatment if they have either monogenic FH or polygenic FH. It is exceptionally rare for a patient to have both monogenic FH and polygenic FH. Even if they do possess both genetic predispositions to FH, in any case the treatment would typically be the same (although clearly the investigation of related family members would be different if they were diagnosed as having monogenic as opposed to polygenic FH). It is a result of the insight of the present inventors that it is taught to carry out the tests for both monogenic FH and polygenic FH in the same multiplexed sample. Clearly, this leads to an inbuilt redundancy since individual patients will typically only have either have only monogenic FH or polygenic FH as explained above. Without the insight of the inventors, this would appear to be a very wasteful process incurring avoidable cost. For example, if the patient has monogenic FH there would appear to be no clinical advantage to also testing them for polygenic FH, and vice versa. However, the inventors teach against this prejudice, with their assay requiring simultaneous examination for both monogenic and polygenic FH, The benefit of this dual approach is the elimination of the labour involved in carrying out the tests separately, as is currently standard in the art. A further benefit is the avoidance of the need to investigate family members if an index case is found not to have a cause of monogenic FH but instead has polygenic FH. Thus, by designing a deliberate element of redundancy into the multiplexed analysis, the invention actually reaps rewards in terms of reduced cost and increased efficiency by eliminating the need for subsequent or alternative tests based on the results of a first test being carried out.
MICRO-FLUIDICS
Micro-fluidics offers a method for conducting highly parallel PGR. Instead of carrying out conventional PGR which allows amplification of (for example) 48 or 96 samples per ran, parallel PGR permits up to approximately 2500 amplifications to be carried out in the same machine. For example, up to approximately 500 primer pairs can be used in a single run of the machine. This technique provides a massively parallel PGR
amplification procedure. The inventors teach use of this technique to prepare patient samples for sequencing.
It should be noted that micro-fluidics/ highly parallel PGR is an especially suitable approach to the enrichment of the sample for sequencing. Other techniques for enrichment may equally be used if desired. For example, there are hybridisation techniques which may be used to enrich the nucleic acids of interest. One example of this is the "Sure Select" hybridisation technique, such as from Agilent. However, this is a lengthy and expensive approach to enrichment. If is an advantage to use micro- fluidic PGR based enrichment as described in more detail herein.
GENETIC TESTING
In many disorders with genetic links, mutations in the exons of genes (the coding regions) have been found to have the greatest effects on disease, and can also act as indicators of disease risk. Mutations in the introns of a gene (the non-coding regions) can also affect disease and indicate disease risk but are less readily interpreted. In order to detect mutations of a gene, it is often desirable or necessary to sequence the genomic DNA. for the gene in question. That, in turn, generally requires the entire genomic DNA for the gene in question to be amplified as a first step. Typically PGR is used for that amplification.
Complete or full coverage of all genes or parts of genes known to predispose to a disease or to modify treatment outcome is optimal for comprehensive genetic testing. During the last few years high-throughput NGS-based methods have become available for DNA analysis. They have not only proven successful in new disease gene
identification, but following the availability of economic "benchtop" sequencers, they are becoming more easily applicable to targeted diagnostic sequencing. The
combination of high-throughput and relatively small DNA target selection allows for many genes and samples to be processed simultaneously, making it an attractive solution for the processing of large sample numbers in a diagnostic laboratory.
We teach the use of "next generation sequencing" ( GS) of genes or gene segments after enrichment such as by amplification (e.g. PGR amplification).
In order for the genomic DNA to be amplified, it is necessary for appropriate primers to be provided. A skilled person working the invention may design their own primers, for example using commercially available software to aid the process. The invention should not be regarded as limited solely to the particular exemplary primer sequences provided herein. However, determining the sequences to be used for such primers is not always simple: long amplicons can incorporate erroneous bases; mutations in the gene can interfere with primer annealing, and tertiary structure of the DNA can make certain sequences inaccessible. Automated platforms for primer design can have variable performance and custom design is often important. In this regard, the inventors have also provided a set of especially useful exemplary primers according to the present invention. These are presented in Table 3.
Thus the present inventors have designed a new series of primers which together provides complete coverage of the LDLR gene and clinically relevant parts of PCSK9, APOB, CELSR2, ABCG8, SLC22A1, HFE, MYLIP, ST3GAL4, NYNRIN, APOE and SLCO1B1 genes. This level of completeness to be achieved by a single genetic assay provided by the complete new series of primer pairs set out in Table 3 has not previously been described. Further, because of the streamlined nature and very low cost of the assay, the assay is applicable to screening large numbers of patients for genetic causes of hypercholesterolaemia where previous assays were unsuitable.
Table 3 - (sometimes referred to as Table Si"!: Exemplar}' Primers
SEQ
SEQ !D
Gene No. Sense primer (F-sp) ID Anti-sense primer (R-sp) Len
NO
NO
ΛΡΟΒ APOB_exa6_3 TGTGG C TCTCCAGCAAAAT ! ACTnTCCAlTGAGTCATCTACCA 61 200
LDLR LDLR_U__17i__2 f GCTATTG GAGGATCTTGAAAGGC 3 GGCAGGCGACTTGATiTGTrGTA 63 175
LDLR LDLR_tl_19 CTTCTGTGGACAACAACAGCAAA 4 GCTTTTTAACCCGTGAAGCTCTG 64 198
LDLR LDLR_tl_21 GGCgACACTTTCGAAGGACTG 5 CCCACGTCATITACAGCATTTCA 65 179
LDLR LDLR _t1_22 TCTTGCAGTGAGGTCAAGAGATTT 6 cCATGCTCGCAGCCTCT 66 UX!
LDLR LDLR_t1_22r_l CAG CTA GG ACA CAG C AGGT 7 GGGGCTCCCTCTCAACCTATTC 67 171
LDLR LDLR_tlO_3 ATCCA C AGCAACATCTA CTG GAG 8 CtCCTfCCTGCTCCCfCCAT C 68 191
LDLR LDLR_tlOr_i CTGATG CCCTTCTCTCCTCCT 9 TTTCCTCTTCACGCCCTTGGTAT 69 197
LDLR LDLR_tll_l GGCTGTT C i CCAGAATTCGTT 10 GTTTTCAGTCACCAGCGAGTAGA 70 179
LDLR LDLR„tll„2 ATGTAC GGACTGACTGGGGAA 1:1 GAGCCACCTGGCAACCC 1 190
LDLR LDLR_ti2_l CtCTGGGACTG G C ATCA G C ■2 CAGCCTClTTfCATCCTCCAAGA 72 162
LDLR LDLR_ti2_2 TACTGGGtTGA CTCCAA ACTTCA '■3 GTCTGTGTCTATCCGCCACCTAA 73 171
LDLR LDLR_tl3_l GCTG'rGTCTCATCCCAGTG'nTA 14 CTCTGGG GACAGT AGGTITTCAG 74 162
LDLR LDLR_tl3_2 TGGACAGATATCATCAACGAAGCC 15 TTTCCACAAGGAGGTTTCAAGGT 75 181
LDLR LDLR_tl4__l CTTCTGGTATAGCTGATGATCTCGT 16 GCAGGCGCAGGTAAACTTGG 76 163
LDLR LDLR_tl4_2 GAGTGAACTGGTgTGAGAGGAC 17 GACACAGGACGCAGAAACAAGG 77 187
LDLR LDLR_tl5_l ATT'AGGCGCACACCTATGAGAAG 18 GGAGGTGTCGGGAA CAG G 78 i8o
LDLR LDLR. n5._ 2 CGTCAGGCTAAAGGTCAGCTC "'9 GACCCGTCTCTGGGTGAAGA 79 181
LDLR LDLR_tl6_l CCATrrC!TGgTGGCCTTCCTrT 20 G GAGgCTGTGACCTGGG 80 180
LDLR LDLR_tl7„l GGAGCTGGGTCTCTGGTCT 21 GACCTCATCC 1 C 1 GTGGl C1TC Γ 81 177
LDLR LDLR__tl7__2 TACAGTGCTCcTCGTCTTCCTTT 22 CCATGGGCTCTGGCTTTCTA 82 198
LDLR LDLR__tl8__ i CgTG'TrCCTUAaTGCTGGACTG 23 CAGUCAA G 1 1 GTCT Id UJ ' 83 185
LDLR LDLR..t2...1 GTCAGTTTCTGA FCTGGCGTTG 24 CTGGG ACTCATC AGAG CCATC 84 167
LDLR LDLR_t2_2 CTCCTITTCCTCTCTCTCAGTGG 25 ataaaTGCATATCATGCCCAAAGG 85 175
LDLR LDLR_t3_l gccTCAGTGGGTCrrrCCITI 26 ACAC'i ACgACAGCCTfGCTC 86 183
LDLR LDLR_t3l'_2 C GTAGTGTCTGTCACCTGCAAA 27 CgTAGAGACAAAGTCAGACCACTC 87 199
LDLR LDLR_t4_l GGTGtTGGGAGACTTCACACG 28 GCTGGCGG GACCACAG 88 197
LDLR LDLR..t4...2 GAAGTGCATCTCTCGGCAGTTC 29 CCACTCATCCGAGCCATCTTC 89 184
LDLR LDLR_t4_3 TTCCAGTGCAACAGCTCC 30 GTGGATGCACTCGCCACTTA 90 177
LDLR LDLR_t4_4 GTAGGGGTCTT ACGTG'rrCCAA 31 GAGCCCAGGGACAGGTGATA 91 198
LDLR LDLR_t5_l CCCTGCTrC'r r rCTCTGG'iTG 32 CA!TAACGCAGCCAACrrCATCG 92 88
LDLR LDLR_t5_2 ACACACTCTGTCCTG lTrCCA 33 CAGCAAGGCACAGAGAATGGG 93 196
LDLR LDLR._t6.._l TGAATGAGTGCCAAGCAAACTGA 34 cgCACTCTTTGATGGGTTCATCT 94 194
LDLR LDLR.J:6...2 GAGGGACCCAACAAGTTCAAGTG 35 CACTCATGTCTCAGTCCCTTTCC 95 178
LDLR LDLR.J7..1 CGGCGAAGGGATGGGTAG 36 CCCACCcGGaAATCACCTTC 96 196
LDLR LDLR_t7T_l CCAACGAATC-CITGGACAACAAC 37 gtttG G'l G CCATGTCAG G AAG 97 179
LDLR LDLR_t8_l I CGAAGGTGTgGGITITGGC 38 CCTi'CCTCACACTGGCACTr "98 Ί78
LDLR LDLR_t8_2 AGCCTCTTTCTCTCtCTTCCAGAT 39 GCCTGCAAGGG GTGAGG 99 196
LDLR LDLR_t9_l GGCACTCTTGGTTCCATCGAC 40 TTCTATTGCTGGCCACCTCC 100 19S
LDLR LDLR_t9_2 CAGGAAGATGACGCTGGAC 41 gCCAGGAGCCCTCATCT 101 188
PC.SK PCSK9_t2_2 TACGTGGTG GTGCTGAAGGAG 42 G AAGTG CCA fCCCAAAAAG G G 102 98
PCSKg PCSK9_t4_2 GCAGCCTGGTGGAGGTG AT 43 ACCTCCAGGATGGGGATATGG 103 185
PCSKg PCSK9„t7_2 GTGACCCTGGGGACTTTGG 44 CCAAAGGGGCTGTTAGCATCA 104 197
PCSKg PCSK9_t9_2 GGcCCTTTTTGCAGGTTGG 45 acacgAAGGAGGGGTACA 105 186
LDLR LDLR_tl_22s_l CCCCCTGCTAGAAACCTCACAMT 47 CGGTCCAGCGCAATITCCAG 107 171
LDLR LDLR_tl_22s_3 GCTG G AAATTG C GCTGGAC 48 CgTGCCATTACCCCACAAGT 108 170
APOE APOE_t3_4 GCCAGAGCACCGAGGaG 2 CGCGGCCCtGTTCCAC 62 189
SLCOlBl SLCOlBl_ex6_ll AAAATGAAACACTCTCTtATCTACATAGGTT 46 AGAATXJTcCTTCTTTAGCgAAATCATC 106 162
APOE APOE_a6_2 GCGGACATGGAGGACGTG 49 GTCATCGGCATCGCGGAG 109 4
APOE APOE__a6„i GGTGGCGGAGGAGACG 50 AGCtCCTCGGTGCTCTGG 110 147
ST3GAL4 rsi 1220462 GCCi l CCAC CTGTTCCA 51 CAACTCCACACACCCAACAC 111 200
APOE rsl367117 TGTACAACATGACTTACCTGGACA 52 TCAATGCTCTGCTACCCTGA 112 191
SLC22A1 1-S1564348 ACCAATTCCATAAATAGTAGCCACA 53 TTTGGGAGGATTCGGTGA 113 ISO
LIFE 1-51800562 CAGGGCTGGATAACCTTGG 54 AGCAGATCCTCATCTCACTGC 114 196
PCSKg TS2479409 CCTCCTGCCTG GTACACAAT
55 CCAGCCTACATGCATTTCAA 210 197
MYLiP TTTACTCGGTCAGCTTTAGCAA 56 AAGTTCAGTGCC'TTCACTGCT 116 ISO
ABCGS 1-34299376 CAAG C CAATG AGCCTTTCTC 57 ATCAGATGTrrACTATGTGCAAGACA 117 194
CELSR2 1562 3OI GCAATfCCTGCAAAGGGTfA 58 TG CTGTACCCG CACAGAAC 118 206
The primers of SEQ ID NO i to SEQ ID NO 46 and SEQ ID NO 61 to SEQ ID N O 106 make up a set of primers for the sequencing of the coding regions of the currently screened genes LDLR, PCSK9 and APOB. That set of primers however does not cover certain genomic regions that are important in determining polygenic FH and/or in outcome of statin treatment. Primers of sequences SEQ ID NO 47 to SEQ ID NO 60 and SEQ ID NO 107 to SEQ ID NO 120 provide coverage of these genomic regions, and are specifically taught to achieve improved and/or complete coverage of the clinically important regions in FH,
Primers SEQ ID NO 1 to SEQ ID NO 120 have been specifically designed to allow simultaneous PGR amplification and subsequent sequencing to achieve a greater than 4-fold reduction in time required for FH genetic testing,
It will be apparent to the skilled reader that individual primer pairs from Table 3 (or subsets of pairs taken from Table 3) also find utility in examination of individual loci of interest (or several loci of interest) independently of the simultaneous (multiplexed) use of the complete set presented in Table 3
MONOGENIC FH
The genes prominent in monogenic FH are discussed in turn below.
All sequences are human sequences unless otherwise stated.
Unless otherwise stated, reference sequences described herein are as deposited in the Gene Sequences Genome Assembly, release number (assembly number): GRCh37.pio, Feb 2009 (database version 71.37 - Feb 2013)
http://www.ensembl.0rg/Homo_sapiens/Info/Annotation#assernbly. LDLR
The LDLR gene encodes low density lipoprotein receptor protein, which binds low density lipoprotein (LDL) particles at the cell membrane and internalises them for hepatic processing and excretion. LDLR spans nearly 45W3 and is made up of 18 exons, with pathogenic mutations found throughout the gene, some of which have been found in many unrelated individuals with FH, while many others are rare. The intronic regions of LDLR contain multiple Alu repeat sequences, which can recombine incorrectly leading to large FH-causing indels which encompass one or many exons. Patients with homozygous or compound heterozygous mutations in LDLR have a severe phenotype with onset of cardiovascular disease in childhood requiring aggressive early treatment of lipid levels. The gene is located on chromosome 19 between base pairs 11,200,225 and 11,241,992 on forward strand.
Figure imgf000028_0001
Autosomal dominant gain-of function dominant mutations in PCSK9 (proprotein convertase subtilin-kexin-type 9) can cause a severe form of FH; the PCSK9 protein is thought to bind LDLR and promote its degradation, although the details of its
mechanism of action are still not fully understood (Soutar. 2011). The identification of this gene and the realisation that loss-of-function variants in PCSK9 lower circulating lipid levels have caused great interest in this protein as a target for alternative lipid- lowering therapies. The gene is located on chromosome 1 between base pairs
55*505,221-55,530,525 on forward strand.
APOB
Two pathogenic mutations in APOB (apolipoprotein B) cause the autosomal dominant condition familial defective apolipoprotein-Bioo (FDB). The defective APOB ligand has reduced affinity for LDLR, reducing LDL clearance and causing hypercholesterolaemia with a similar phenotype to LDLR mutations. APOB is a highly polymorphic gene, complicating identification of pathogenic variants. The gene is located on chromosome 2 between base pairs 21,224,301-21,266,945 on reverse strand.
Regarding monogenic FH, the mutations discussed herein are exemplary. For example there are more than 1000 different mutations reported in LDLR. Many of them are only found in one or two families. It is very likely that more mutations may be employed. See (https://grenadaJumc.nl/L !)VD2/UCL·Heart/home. hp?select_d =LDLR).
STATIN TOXICITY/ SLCOIB 1
The rs4i49056 variant in SLCOIB 1 (solute carrier organic anion transporter family member 1B1) is associated with statin-induced myopathy, particularly in patients on high dose treatment (The Search Collaborative Group. 2008).
It is important to note that due to linkage disequilibrium between SNPs one can get the same answer by genotyping different SNPs. For example 1-84363657 and 1-84149056 give almost identical results. Thus it should be noted that ^4363657 may be used in place of 1-84149056 if convenient - both SNPs give almost identical answers.
Most suitably the ^4149056 variant in SLCOIB 1 is assessed. Statin drugs (HMGCoA reductase inhibitors) are the mainstay of treatment for FH, and muscular side-effects ranging from muscle pa through to life-threatening
rhabdomyolysis are among the principle reasons for discontinuation of treatment. SLC01B1 encodes the organic anion-transporting polypeptide OATPiBi, which mediates hepatic uptake of many drugs including most statins. It has been suggested that patients being treated with statins should be routinely genotyped for this variant and that an upper limit on statin doses should be applied according to genotype (NiemL 200£s). The ^4149056 variant is located on chromosome 12 at position 21,368,722 on forward strand.
LDLR MUTATIONS
As will be apparent to the skilled worker, assessing the mutation status and/or sequences of the various genes or SNPs as taught herein is a matter of routine. The bioinformatics required for this analysis are modest, and are routine in the art.
Occasionally, in particular with the analysis of LDL receptor (LDLR) mutations, it may be necessary for the skilled worker operating the invention to pay attention to the mutation which they have detected. A first step in analysing an LDLR mutation would be to check if it has been reported in the literature or is a novel variant defected for the first time. Clearly if the mutation has been reported before in the literature, then it is a simple matter of routine for the skilled operator to consult the literature to know if the mutation is associated with FH or not. If the variant is new, then a judgement may need to be made as to whether or not if is likely to be a mutation predisposing to FH. In case further guidance is required, novel variants that cause premature stop cod on, frameshift or overlap with splice donor or acceptor sites are expected to be mutations causing FH. Non-synonymous substitutions, in-frame deletions or insertions and variants that overlap splice regions may or may not be causal. These variants should be accessed for their pathogenicity using algorithms that predict possible impact of such variants on protein function. Most commonly used pathogenicity predictive web-sites include SIFT and PoiyPhen (Kumar et aL, 2009; Adzhubei et aL, 2010). Where possible, variants with unclear pathogenicity should also be followed up by segregation analyses and in vitro functional studies. Functional studies include LDL binding and/or uptake assays (Soutar et. al., 1982; Goldstein et. al., 1972). POLYGENIC FH
Currently 12 single nucleotide polymorphisms, SNPs, (Table A) located in 11 genes should be genotyped in order to establish the risk of polygenic FH. Identifying such individuals will improve the efficiency of cascade testing, since this type of test will only benefit patients with monogenic FH. Much less than the expected half of children of individuals with polygenic FH are expected to inherit the disease.
Table A: Single nucleotide polymorphisms identified as risk indicators for polygenic FH
Figure imgf000030_0001
The SNPs used to determine predisposition to polygenic FH and their genomic locations are listed in Table B. Table B: The position of single nucleotide polymorphisms identified as risk indicators for polygenic FH
Figure imgf000030_0002
IM229326 ABCG8 2 Z25Z6
CELSIUS 1
rs6SM720 LDLR IS 11202306
APOE IS 45412023
rssmzazz NYNRIN
It will be appreciated that the SNPs in Table A and Table B are the same 12 S Ps, the tables present different information in connection with them. Suitably one or more of these SNPs are assayed; suitably two or more; suitably three or more; suitably four or more; suitably five or more; suitably six or more; suitably eight or more; suitably ten or more; suitably all twelve SNPs of Table A or Table B are assayed.
STATINS Approximately 99.9% of patients who receive a diagnosis of familial
hypercholesterolaemia are prescribed statins. They are typically then sent away with their prescription. At most the patient may be advised to return if they experience side effects such as muscle pain etc. Patients are not automatically given a statin toxicity test. However, statin toxicity is a serious problem, A certain proportion of the population carries a genetic predisposition to statin toxicity. Symptoms of statin toxicity include muscle weakness, pain such as muscle pain, death of muscle fibres, and kidney trauma which can lead to kidney failure from decomposing muscle fibre. Up to 5% of patients exhibit some form of statin toxicity. As many as 1 in iooo patients can experience the most severe statin toxicity including loss of muscle fibre and kidney trauma or kidney failure.
The in ventors teach the parallel assay of the statin toxicity predisposition locus SLCO1B1 at the same time as collecting the information useful in aiding the diagnosis of FH together with the incremental risk factors. As many as 15-20% of the population carry an SLCO1B1 allele which might predispose them to statin toxicity. A proportion of these people will actually go on to experience statin toxicity.
Currently in the art, typically no assessment of SLCO1B1 is made. The current thinking in the art is that it does not justify the cost of a separate laborious test for the SLCO1B1 locus. The inventors teach incorporation of the SLCOiBi assay in to the multiplexed PGR and sequencing approach as set out herein. By incorporating this test into the main information collection procedure, the results for the SLCOiBi locus are obtained at a minimal or negligible extra cost (at most the cost of the extra primer pair included in the assay). By contrast, the advantages reaped in i formation for this miniscule extra investment are enormous. Firstly, the cost of a further separate genetic test for
SLCOiBi is avoided. More importantly, there is additional value to the physician who is better informed when designing the treatment for the patient under examination, Patients presenting and undergoing the combined tests of the invention showing a predisposition to stain toxicity can be counselled in great detail about the side effects to be alert to. In addition, the patient can be prescribed a re-examination at early time points. The patients can be placed under a more frequent surveillance regime. The patient can be prescribed smaller doses of the statin. It is even possible to design a lower dose/better tolerated statin treatment regime based on their SLCO1B1 status. For example, subjects who are heterozygous for an SLCO1B1 allele predisposing to statin toxicity show approximately a three times greater risk of stain toxicity then a patient with no risk allele. Furthermore, a subject who is homozygous for an SLCO1B1 allele predisposing to statin toxicity has a ten times greater risk of statin toxicity.
Thus, in one embodiment, it is possible to design a statin dose or treatment regime according to the number of copies of an SLCO1B1 allele predisposing to statin toxicity which the patient is carrying. For example, an upper limit on statin doses may be set for subjects in whom a risk of statin toxicity is detected according to the present invention. For example, a particular statin dose may be set for subjects in whom a risk of statin toxicity is detected according to the present invention. For example, a particular statin may be selected for subjects in whom a particular SLCO1B1 mutation is detected. Guidance on statin choice, dose choice or dose limits ma be found in (Niemi, 2009 - Clinical Pharmacology & Therapeutics (2010) 87 1, 130-133), which is incorporated herein by reference expressly for the teachings of alternate statin regimes according to SLCO1B1 genotype, as well as Wilke et al 2012, Clinical Pharmacology and Therapuetics 92:112-7.
Thus it can be appreciated that there are many important advantages provided by collating all of the information including SLCO1B1 together at the outset according to the methods of the invention. It is a problem in the art that a large proportion of patients (millions of patients per annum) are currently treated in the primary care setting by their physician or general practitioner, In this setting, the cost of routinely conducting statin toxicity tests on each patient presenting with hypercholesterolaemia is a significant barrier. This problem is alleviated by the present invention, which provides a combined
comprehensive information set at a fraction of the cost of the current standard analytical method.
FURTHER EMBODIMENTS AND APPLICATIONS
In one embodiment the invention relates to a method for determining whether a subject has a predisposition for monogenic familial hypercholesterolaemia by virtue of a mutation in one of the genes selected from LDLR, PCSK9, APOB or polygenic familial hypercholesterolaemia by virtue of combination of genotypes in (rs6s 11720) LDLR, ( s2479409) PCSK9, (^1367117) APOB, (rs62930i) CELSR2, 084299376) ABCG8, (rsi504348) SLC22A1, (1-51800562) HFE, (^3757354) MYLIP, (rsii220402) ST3GAL4, (rs8oi7377) NYNRIN, (^429358, rs74i2) APOE and for determining individual's response to statin treatment by virtue of a variant (^4149056) in SLCO1B1 gene comprising:
carrying out a nucleic acid amplification step on a biological sample from the subject, wherein the nucleic acid amplification step uses all primer pairs, the primer pairs comprising a forward primer with a forward primer sequence selected from SEQ ID NO: 1 to SEQ ID NO:6o; or a reverse primer with a reverse primer sequence selected from SEQ ID NO: 61 to SEQ ID NO: 120; sequencing at least part of the amplification product, the amplification product being a sequence of at least a part of one of the genes LDLR, PCSK9, APOB,
CELSR2, ABCG8, SLC22A1, HFE, MYLIP, ST3GAL4, NYNRIN, APOE and
SLCO1B1;
and
determining whether the LDLR, PCSK9 or APOB amplification product represents a sequence that has a mutation that is indicative of a risk for a familial hypercholesterolaemia
- determining whether combination of LDLR, PCSK9, APOB, CELSR2, ABCGS,
SLC22A1, HFE, MYLIP, ST3GAL4, NYNRIN, APOE amplification products have
SNPs that are indicative of a risk for a polygenic familial hypercholesterolaemia - determining whether the SLCO1B1 amplification product represents a sequence that has a SNP that is indicati ve of a risk for adverse statin effect. Suitably the amplification step uses at least one primer pair, the pair comprising a forward primer with a forward primer sequence selected from SEQ ID NO: 1 to SEQ ID NO: 60; and its accompanying reverse primer, with appropriate sequence selected from SEQ ID NO: 61 to SEQ ID NO: 120. The invention may also relate to assessing a subject for the diagnosis and/or treatment of familial hypercholesterolaemia (FH).
The invention may also relate to designing a treatment for familial
hypercholesterolaemia (FH).
The invention may also relate to managing a subject suspected of having familial hypercholesterolaemia (FH).
The invention may also relate to determining an appropriate programme for the diagnosis and/or treatment of familial hypercholesterolaemia (FH).
A method for collecting information useful in aiding the diagnosis and treatment of familial hypercholesterolaemia (FH), the method comprising providing a sample of DNA from the subject, assaying said DNA for
(a) mutation in one or more genes which is indicative of FH diagnosis
and
(b) mutation in a gene which is indicative of likelihood of statin toxicity;
wherein assaying said DNA comprises the step of contacting said DNA sample with one or more primers for amplification and/ or sequencing of the relevant segment(s) of said DNA
characterised in that each of said assays of steps (a) and (b) is carried out in a single assay cycle. A method for collecting information useful in aiding the diagnosis and treatment of familial hypercholesterolaemia (FH), the method comprising providing a sample of DNA from the subject, assaying said DNA for
(1) presence of one or more SNPs indicative of incremental risk of high cholesterol; and
(2) mutation in a gene which is indicative of likelihood of statin toxicity;
wherein assaying said DNA comprises the step of contacting said DNA sample with one or more primers for amplification and/or sequencing of the relevant segment(s) of said DNA characterised in that each of said assays of steps (i) and (2) is carried out in a single assay cycle.
Further particular and preferred aspects are set out in the accompanying independent and dependent claims, Features of the dependent claims may be combined with features of the independent claims as appropriate, and in combinations other than those explicitly set out in the claims.
Where an apparatus feature is described as being operable to provide a function, it will be appreciated that this includes an apparatus feature which provides that function or which is adapted or configured to provide that function.
BRIEF DESCRIPTION OF THE DRAWINGS Embodiments of the present invention will now be described further, with reference to the accompanying drawings, in which:
Figure 1 shows the depth of coverage of primer pairs (SEQ ID NO: 1 - 120), as shown in Table 3, in an in vitro experiment using a sample of human DNA.
Figure 2 shows the quality of sequence data shown in Figure 1. 96.1% of bases passed standard quality filter (>=Q3o).
Figure 3 shows the time improvements of the current test compared to standard methods.
Figure 4 shows Figure Si. Family pedigree showing affected individuals as filled black boxes/circles and unaffected individuals as unfilled boxes/circles. The arrow indicates the proband. Total cholesterol (TC) levels (mmol/1) are shown for each individual as well as mutation status. WT, wild type; NA, not available;
Examples of the invention are disclosed in detail herein, with reference to the accompanying drawings. It is understood that the invention is not limited to the precise embodiments described in the examples and that various changes and modifications can be effected therein by one skilled in the art without departing from the scope of the invention as defined by the appended claims and their equivalents. EXAMPLES
Exam ple 1 : Standard Procedure for Targe t En richm en t Target enrichment of the genes involved in FH is undertaken using the micro-fluidic PGR amplification 48.480 Access Array IFC (Fluidigm Inc).
Equipm ent:
Micropipettes capable of dispensing volumes in the range of 1-1000μ1, with compatible sterile filtered tips.
Nitrile gloves and laboratory coat dedicated for use in each area
Assorted sterile racks
Sterile 1.5 ml micro-tubes
IFC Controller AX, pre- and Post-PCR units (Fluidigm)
IFC thermal cycler (Fluidigm)
48.48 Access Array chip (Fluidigm)
0.2ml thin walled micro-reaction PGR plates
Large bench-top centrifuge with plate rotors, microcentrifuge and vortex mixer Yellow discard bins and fume cupboard
Adhesive plate sealer
Ice bath
Class II biosafety air-flow hood- Reagents:
Sterile, nuclease-free water
5x primer stock multiplex plates (Fluidigm)
Control line fluid (Fluidigm)
lx Access array harvest solution (Fluidigm)
20X Access array loading reagent (Fluidigm)
FastStart High fidelity PGR system with dNTPs kit (Roche)
Access Array oligonucleotide multiplex primer plates (Fluidigm)
Oligonucleotide primers, individual tubes (Sigma)
Fk ce dines:
Prim er preparation 1.1 Working in the Class II DNA free hood, appropriately label a fresh 0.2ml PCR plate,
12 Resuspend the primers in individual tubes to a
concentration of lOOmM, as per manufacturer's instructions.
1.3 For each primer pair, add 5μ1 from each tube to a single well of a fresh 0.2ml PCR plate. This will give Ι ΟμΙ of
I A Add ΙΟμΙ molecular biology grade water to wells
containing the primer pairs. This will give 50μηι stock of each primer pair.
1.5 To prepare the 20x primer solutions. In a fresh 0.2ml PCR plate, add 20μ1 of the primer stock to each well, along with 5μ1 20x Access Array loading buffer and 75 μΐ water.
1.6 Seal, vortex and briefly centrifuge. Label ail plates with the date, assay name and concentration .
Primer solutions are valid for use for one year after resuspension, stored at -20°C
1.8 Remove an Access Array chip from its packaging.
1.9 Inject control line fluid into each of the ports on either side of the chip. Tilt the chip to 45° whilst injecting the chip. Ensure the port is firmly pushed in.
Add 500 μΐ of Ix Access array harvest solution to wells
1.1 1 Place the chip into the Pre-PCR IFC AX controller. Run Prime (15 Ix) Into a fresh 1.5ml microtube, make the amplification mastermix of (per 60 reactions) 30 μΐ FastStart l Ox reaction buffer, 54 μΐ 25mM MgCl2, 5 μΐ DMSO, 6 μΐ lOmM dNTPs, 3 μΐ FastStart enzyme blend, 15 μΐ 20x Access array loading reagent and 57 μΐ Nuclease free water, in the Class II air-hood. V ortex and briefly centrifuge the tube. In a fresh 0.2ml PGR plate, mix 3 μΐ of master mix along with 1 μΐ genomic DNA (50 ng/μΐ) and I μΐ water into 48 separate wells. Pipette 4 μΐ 20x primer solution into the primer inlets. Pipette 4 μΐ sample/master mix into the sample inlets, appropriate positive and one negative control (water) should be included in each run.
Load the chip into the Pre-PCR AX controller. Run mix (151x): l:
Temp Time Cycles
50°C 2 min 1
70°C 20 min 1
95°C io min 1
Figure imgf000038_0001
72°C 1 mm
95°C 15 sec
6o°C 30 sec
72°C 1 min
Figure imgf000039_0001
1.18 After the PCR has completed, remove the plate and move
to the post-PCR area.
1.19 Remove the remaining fluid in HI -4 and discard.
1 .20 Pipette 600 μΐ of lx Access Array Harvest Reagent into
wells HI -4 and 2 μΐ into 1-48 sample inlets.
1.21 Place chip into the post-PCR IPC AX and run programme
"Harvest (151 x)".
1.22 Once complete, remove chip from IPC AX and transfer
the harvest volume (approx. 10-15 μΐ) into columns 1 -6 of a fresh 0.2ml PCR plate,
1.23 Perform QC by running the harvests on the Bioanalyzer. Exam ple 2 i Target enrichm ent of sam le DNAs
Overall the region of interest (ROI) in the study covered 8497 base pairs from the LDLR, PCSK9, APOB, CELSR2, ABCG8, SLC22A1, HFE, MYLIP, ST3GAL4, NYNRIN, APOE and SLCOiBigenes. Genomic DNA templates were amplified using the Access Array IFC, according to the manufacturer s instructions (http://www.fluidigram.com).
Briefly, the technique employed a microfluidic chip that systematically combined 48 sample DNAs, along with 120 primer pairs (SEQ ID NOs 1 - 120). PGR reagents were then drawn into the chip reaction chambers prior to PCR cycling. Common flanking sequences on each primer pair permit attachment of barcode indexes and sequencing adaptors. This allows for the attachment of platform-specific adaptors and barcodes pre target enrichment. The multiplex amplicon harvests were recovered for each DNA template, approximately 150! was used to generate barcode and adapter products specific to the MiSeq platform (Alumina, San Diego, CA). Amplicon harvest volume was adjusted to 20 μΐ using PGR certified water. For each harvest, barcode-fusion PG reactions were prepared using CS tagged primer pairs, for instance, a reaction with A_BC6_CSi and CS2__.P1. This strategy permitted amplicon sequencing in both orientations. For each reaction, 10 μΐ of the Fluidigm IFC harvest was added to 86 μΐ of a Herculase II Fusion PGR mix, as per manufacturer's instructions (Agilent
Technologies Inc, Santa Clara, CA) along with 20 pmol each primer. Cycling conditions were as follows: an initial incubation of 98°C for 30 sec, followed by two cycles of 98°C for 30 sec, 54°C for 30 sec and 72°C for 30 sec; after the last cycle reactions were held at 72°C for 2 min, and then at 4°C.
Exam ple 3 : Ilium ina se quencing
Three microliters of 2nM Fluidigm library were denatured by adding 311I of 0.1N NaOH and incubated for 5mm at room temperature. Denatured library was then diluted to 2opM by adding 29411! of HTi buffer (Illumina MiSeq sequencing kit). The library was further diluted to 6pM in a lml final volume using HTi buffer prior to loading into the Miseq sequencing cartridge (sample position #17).
Fluidigm sequencing primers FLi and FL2 (50UM stock) were diluted to 0.5UM final in a 20ul volume and spiked into the appropriate Miseq cartridge positions ie FLi in positions #12 for Readi and #14 for Read2, FL2 in position #13 for Index Read.
The MiSeq cartridge was loaded into Miseq and the run was set up following Illumina MiSeq sequencing standard procedures.
Exam ple 4 : The use of next generation sequencing in clinical diagnosis of fam ilial hypercholesterolaem ia
Sum m ary:
Familial hypercholesterolaemia (FH) is a common Mendelian disorder associated with early onset coronary heart disease that can be treated by cholesterol lowering drugs. The majority of cases in the UK are currently without a molecular diagnosis partly due to the cost and time associated with standard screening techniques. This study tested the sensitivity and specificity of two next-generation sequencing (NGS) protocols for genetic diagnosis of FH. Methods :
Libraries were prepared for NGS by two target enrichment protocols; one using the SureSelect Target Enrichment System and the other using the PCR-based Access Array platform.
Res ults :
In the validation cohort, both protocols show-ed 100% specificity while the sensitivity for short variant detection was 100% for the SureSelect Target Enrichment and 98% for the Access Array protocol. Large deletions/duplications were only detected using the SureSelect Target Enrichment protocol. In the prospective cohort, the mutation detection rate using the Access Array was highest in patients with clinically definite FH (67%) followed by patients with possible FH (26%).
Conclusions :
We have shown the potential of target enrichment methods combined with NGS for molecular diagnosis of FH. Adopting these assays for patients with suspected FH could improve cost-effectiveness and increase the overall number of patients with a molecular diagnosis.
In this study, two target enrichment protocols, the hybridisation-based SureSelect Target Enrichment System (Agilent, Santa Clara, CA, USA) and the PCR-based Access Array System platform (Fluidigm, South San Francisco, CA, USA), followed by NGS sequencing, have been validated for detection of FH-causing mutations. We show excellent performance for both approaches and discuss their potential for clinical screening programs and discovery of novel FH-causing genes. MATERIALS AND METHODS
Patients
We studied two groups of patients, a validation group including patients with known molecular diagnosis, and a prospective cohort of previously unscreened FH patients. In the validation group, DNA from 104 patients from the Hammersmith Hospital lipid clinic was analysed , All 104 samples had previously undergone complete or partial screening of LDLR coding regions and exon/intron boundaries, p.Asp374Tyr in PCSK9 and p.Arg3527Gln in A POB exon 26 using Sanger sequencing. In addition, MLPA was used to detect large deletions and duplications in a subset (>8o%) of the patients in the validation cohort, as described in Tosi et al. 9 Forty-five samples were heterozygous and were known to carry FH-causing point mutations or small insertions/deletions (less than 20 base pairs) in LDLR, PCSK9 or APOB and six had large
insertions/deletions in LDLR. One sample was homozygous for LDLR .Gln384Pro and one sample was a compound heterozygote with one missense mutation and one large deletion in LDLR. The remaining 5isamples in the validation cohort had negative molecular diagnoses. Of the 104 samples, 29 were processed using the SureSelect Target Enrichment System alone, 42 using the Access Array System micro fluidic platform alone and the remaining 33 using both platforms. In the prospective cohort, 84 consecutive patients referred for molecular testing by the Hammersmith Hospital lipid clinic over a period of one year were studied by the PCR-based Access Array System microfluidic platform. Fifteen of the 84 samples were also analysed usi g the SureSelect Target Enrichment System. One individual was referred with suspected homozygous FH. All the remaining 83 were suspected to be heterozygous. Six patients had a diagnosis of definite FH based on Simon Broome criteria. The median highest total cholesterol in this group was 9.7 mmof/1 (min 7,9 mmol/i, max 15.9 mmof/1). Sixty five individuals had a diagnosis of possible FH with a median highest total cholesterol levels 8.7 mmol/1 (min 5.2 mmol/1, max 13 mmol/1) and thirteen patients did not fulfil Simon Broome criteria. The median highest total cholesterol in this group was 8.3 mrnol/1 (min 6.3 mmol/1, max 9.6 mmol/1).
The study was approved under ethics committee references: REC2002/6451 and RECii/LO/0883. All patients provided informed consent. DNA Extraction
DNA was extracted from blood using a standard phenol-chloroform protocol or the Maxwell 16 system (Promega, Madison, WI, USA) or from saliva samples using the Oragene (Genotek Inc, Ottawa, ON, Canada) protocol. Both protocols followed the manufacturer's recommendations.
RN A Extraction and Re verse Tran scription PCR
Blood for RNA extraction was collected in Tempus blood RNA tubes (Applied
Biosystems, Foster City, CA, USA) and extracted using the Paxgene blood RNA kit (Qiagen, Hilden, Germany) following the manufacturer's protocol. Reverse transcription was performed using the iScript cDNA synthesis kit (BioRad, Hercules, CA, USA). Primers (forward TCGAGTTCCACTGCCTAAGTG and reverse
GTTGTTGTCCAAGCATTCGTT) were designed to amplify exons 4 to 7 of LDLR. Custom Sure Se lect Target Enrichm ent System
Four genes with mutations known to cause FH {LDLR, A FOB, PCSK9, LDLR A PI), a myopathv-associated variant in SLC01B1, and 13 genes (APOE, HMGCR, HNRNPD, INS!Gl, KHSRP, NPCILI, PTBPl, SREBF1, SREBF2, MESDC2, SCAP, INSIG2, CYP7A1) functioning within cholesterol-processing pathways were included in the SureSelect Target Enrichment System design (Agilent, Santa Clara, CA, USA). The design contained 120-mer baits spanning the entire non-repetitive sequence of the selected genes including exons and introns, 2 kb of upstream sequence (lokb for the four known FH genes) and 1 kb of downstream sequence.
The genomic co-ordinates of the 18 targeted genes were d etermined using the March 2006 build (NCBl36/hgi8) of the human genome in the Ensembl genome browser12. The density of bait tiling was 5-fold and the baits were allowed to overlap into repeat regions by sobp. The total targeted DNA length was 399kb. All libraries were generated from sheared DNA (Covaris, Woburn, MA, USA) with an average insert size of 200bp following the SureSelect Target Enrichment System XT (Agilent, Santa Clara, CA, USA) protocol for Alumina multiplexed sequencing version 1.2. After dilution to 2nM, up to 30 libraries were pooled and sequenced on one lane on the HiSeq2000 platform (Alumina, San Diego, CA, USA) to generate 2xioobp paired-end reads.
PCR-base Access Array System
The design included 43 amplicons covering all exons of LDLR, with the majority of the coding sequence covered by more than one overlapping fragment. Amplicons were also designed to cover exons 2, 4, 7, and 9 of PCSK9 containing the most common gain-of- function pathogenic mutations; APOB (one amplicon covering the most common familial defective apolipoprotein B-100 mutation p.Arg3527Gln); APOE (one amplicon covering the APOE E2 variant site, rs74i2); and SLC01B1 (one amplicon covering 1-84149056, the myopathy-associated variant). The average amplicon length was i84b with 57% GC content. Primer sequences are shown in Table Si. Samples were processed using the Access Array System (Fluidigm, South San Francisco, CA, USA) according to the manufacturer's 4-Primer amplicon tagging protocol generating paired-end libraries for Alumina sequencing. Purified pooled products of 47 barcoded samples and one negative control were sequenced in one run using the MiSeq
sequencer (Alumina, San Diego, CA, USA). One amplicon, a GC rich (75%) amplicon in APOE targeting rs74i2 failed to amplify and was excluded from subsequent data analysis.
Data An lysis
Sequences were mapped to the GRCh37/hgi9 human reference sequence using
Burrows Wheeler Aligner vo.6.113. PGR duplicate reads were removed from SureSelect Target Enrichment System data (Picard tools vi.35). Sequence reads from both datasets were further processed and variants were called using GATK vi.0.6 with hard filtering options. Variant annotation was carried out with Ensembl's Variant Effect Predictor tool 12 and was based on transcripts ENST00000558518 (LDLR), ENST00000233242 (APOB), and ENST00000302118 (PCSK9). The annotation included Sorting Tolerant From Intolerant (SIFT), Condel and PolyPhen. Conservation scores (Genomic
Evolutionar ' Rate Profiling, GERP) were obtained from Ensembl12 version 68. To identify potentially pathogenic mutations, all non-synonymous, splice site, frameshift and truncating mutations were examined and compared to an FH locus-specific databases 6·14 as a guide to interpretation of variant pathogenicity. Synonymous and intronic variants located outside exon/intron boundaries as well as single nucleotide polymorphisms with minor allele frequency (MAF) above 1% in the International HapMap Project1" or the 1000 Genomes Project 16 were excluded from further analysis. All single nucleotide variants and short insertions/deletions that were potentially disease-causing were verified by conventional Sanger sequencing. Novel variants were followed up by segregation analysis where possible. Copy Num ber Varian t An alysis
Copy number variant analysis (CNV) from NGS data was performed for the samples sequenced using targeted capture. A read-depth based method 17 , as implemented in R package ExomeDepth, was used to identify deletions and duplications spanning at least one exon. Each sequencing batch of samples was processed separately in order to increase the quality of a reference set for each sample and therefore to maximise the power to detect copy number variants. Read depth was assessed for each exon in the target region and the ratio of expected and observed read count was obtained, as well as a Bayes factor for the copy number variant calls, as implemented in the method. As an independent method of CNV analysis, MLPA was performed using the kit LDLR- P062 (MRC-Holland) following the manufacturer's protocol. The novel exon 16 deletion was confirmed by PCR. The previously-described large deletions and duplications are detailed in Tosi et alfi . Statistical Analysis
The sensitivity of an assay was defined as the percentage of pathogenic mutations correctly identified with respect to previous or new Sanger sequencing and MLPA. The specificity is defined as the percentage of mutation negative samples correctly identified as negative with respect to previous or new Sanger sequencing and MLPA.
Myo p ath y-ass o cia te d variant in SLCO IB 1
Genotypes of the SLC01B1 myopathy-associated variant 1-84149056 were scored from the Access Array System microf!uidic platform and SureSelect Targeted Enrichment System data in all patients, and any history of adverse effects was obtained by review of medical records. Side effects were defined biochemically (transaminase or creatine kinase levels more than three times the upper limit of a normal range) or
symptomatically for myalgia and other side effects that coincided temporally with statin treatment. Tests for deviation from Hardy- Weinberg equilibrium and association tests were performed using the DeFinetti software (http://ihg.gsf.de/cgi-
Figure imgf000046_0001
RESULTS
Validation Study
Custom SureSelect Target Enrichment System
To validate the assay, DNA was analysed from 62 previously screened individuals who either had a confirmed molecular diagnosis of FH (n=28) or were mutation negative (n=34). An average of 330 Gb (191-381 Gb) of sequence was obtained per sample with an average coverage of 827X. Overall 64% of total mapped reads aligned within the target region and 99.8% and 98.8% of nucleotides were covered at 4 and 25X, respectively. The insufficiently covered regions are consistent among runs and were found mostly outside coding regions. Hybridisation-based capture is known to target GC-rich regions poorly; however, all regions containing known FH-causing mutations were covered sufficiently (>25x) for confident variant calling, The initial analysis of the sequencing results was carried out blinded to the gene and mutation details for each sample. All twenty heterozygous and one homozygous short pathogenic mutations, including point mutations and insertions/deletions of less than 15 base pairs, were detected (Table 1). In addition one compound heterozygote and six large
insertions/deletions in the LDLR gene were detected resulting in 100% sensitivity for this assay. No false positives were detected and specificity for this assay was also 100%. A further three mutations were identified in LDLR in patients without a previous molecular diagnosis. One was a known single nucleotide substitution p.Asp227Glu and two were large deletions (deletion of exon 16 and deletion of promoter/ exon 1). In addition, a novel variant was identified in the LDLR promoter (c. -227G>T, GERP score 3.29, located in the highly-conserved footprint 1 (FPi) site) and two rare variants were identified in APOB in patients without a previous molecular diagnosis. The two variants, p.Pro877Leu (^12714097) and p. Asp22i3_Glu 22i4delinsGlu (^72653087), have not been described previously in FH patients and are not reported in either the 1000 Genomes Project16 or the International HapMap Project^ databases. No other rare missense variants were detected in the known FH genes in individuals without a molecular diagnosis.
PCR-based Access Array System
DNA samples from 53 previously characterized patients including 40 with point mutations (39 heterozygotes and one homozygote), 6 with insertions/deletions (all heterozygotes), 6 with large deletions or duplications (all heterozygotes), and one compound heterozygote with one missense mutation and one large deletion in LDLR (Table 1) were amplified together with 22 patients that had previously screened negative. The median coverage per sample was 572X (min 461, max 625). All amplicons except A POE (see Methods) amplified with a mean coverage of 506X. The coverage for individual amplicons is listed in Table S2. Overall, 90% of bases were covered more than 25-fold. LDLR had a mean coverage 656X and more than 98% of bases were above 25X. All single nucleotide changes in the coding sequence and intron/exon boundaries were correctly identified (Table 1) including one mutation in PCSK9 exon 2 and one in APOB, despite the lower sequencing coverage of these amplicons with 13 and 15 reads respectively (the percentage of mutated alleles was 54% and 53%). One variant was not detected. This nbp deletion (p.Lys730Hisfs*48) was not present in any aligned reads as the deletion overlapped with a forward primer, which prevented amplification of the mutated allele. The sensitivity for short variant detection was 98% (47/48) and specificity 100%. Similarly to the SureSelect Target Enrichment System results one mutation, the p. Asp227Glu, was identified in a sample that previously had no molecular diagnosis. No pathogenic mutations were found in remaining samples that were negative on previous screening. Large deletions could not be detected with the PCR-based Access Array System because no reduction in coverage was observed within deleted regions. The overall sensitivity of this assay compared to SureSelect Target Enrichment System was therefore 82% (47/57).
Prospective Cohort
To test the feasibility of an NGS-based mutation screen in a clinical setting, a
consecutive cohort of 84 unrelated patients referred for genetic screening over a single year was analysed. Sixty-nine of these patients were screened using the Access Array System assay alone and fifteen were processed using both protocols. Sequencing and coverage metrics are provided in Table S2. In total 23 variants that have previously been reported as pathogenic in FH patients were identified in 22 individuals (Table 2) including 13 single nucleotide changes, 4 variants predicted to affect splicing and 6 short insertions/deletions. In addition, two novel variants (p.Ala52iThr and
p.Asn3i6Lysfs*54) were identified that had not been previously reported (Table 2). There was a good correlation between the results obtained from the Access Array System assay and SureSelect Target Enrichment System with 5 of 6 mutations concordant between the datasets. The discordant variant, p.Lys730Hisfs*48, is the same one that was not detected using the Access Array System protocol in the validation cohort. Despite the presence of the same variant, these patients in the validation and prospective cohort were not known to be related. No additional mutations were identified using MLPA.
Of the two previously unreported variants (Table 2), the first was a missense change, p.Ala52iThr. This variant is conserved (GERP score 2.66), is predicted to be damaging (PolyPhen score 0.67, SIFT score 0.01, and Condel score 0.643) and segregates with affected status in the family (Figure Sia). The second variant was a single nucleotide deletion in exon 7 oi LDLR, p.Asn3i6Lysfs*54. This frameshift mutation creates a premature stop codon and also segregates with hypercholesterolaemia in this family (Figure Sib).
Two (c.8i7+iG>A and c.94i-4G>A) of the four splice site variants identified (Table 2) were previously detected in FH patients6 , but their pathogenicity had not been experimentally validated before. An RNA sample was available for one of them (patient ID 35) and RT-PCR in this patient showed that the c.8i7+iG>A variant disrupted correct splicing (data not shown). Alternative splice products were generated by partial intron retention that led to tmncation of the protein, and by exon skipping that caused the loss of exon 5 sequence and a predicted frameshift of the remaining protein. Of the remaining variants previously identified in FH patients, one missense variant p.Val827lle was conservative, without a published proof of pathogenicity and therefore was considered to be of unknown significance. Two children of this index case were available for segregation analysis and the results showed that an unaffected daughter (total cholesterol 4.6 mmol/'l age 27) of the proband had inherited the p.Val827lle variant. Mutatio n Detectio n Sates
The prospective cohort included six patients with definite FH as defined by the Simon Broome criteria, 65 with possible FH and 13 hypercholesterolaemic patients not fulfilling Simon Broome criteria for FH. The highest defection rate of clearly pathogenic mutations was in the group of patients with a definite FH diagnosis (4/6, 67%) followed by the group with a diagnosis of possible FH (17/65, 26%), One mutation (1/13, 8%) was identified amongst the 13 hypercholesterolaemic patients that did not fulfill FH diagnostic criteria.
Variants in Genes Involved in Cholesterol Me tabolism
In addition to the three known FH causing genes and SLC01B1 the SureSelect Target Enrichment System assay included 13 genes that reside on cholesterol metabolism pathways. Rare variants identified in these genes, particularly in hypercholesterolaemic individuals who screened negative for mutations in LDLR, PCSK9 and APOB, are potentially responsible for patients' raised cholesterol. Rare variants (MAF<o.oi) identified in such individuals are listed in Table S3. In patients with no previously known molecular diagnosis, seven rare non-synonymous variants were found, of which six were not predicted to be functionally significant by SIFT and PolyPhen. The single variant, that was most likely to be of functional significance and therefore potentially pathogenic, was p.ValSogMet in SR EBFL However, this was excluded from further analysis as it did not segregate with the phenotype in the family (data not shown).
SLCOIBI Myopathy-associated Varian t
Data on exposure to statins was available for 149 patients. Twenty-seven individuals were heterozygous for SLCOIBI ^4149056 and two were homozygous. One patient (a heterozygote) had suffered severe biopsy-proven hepatitis while taking statin drugs. A further 48 patients had suffered less severe side-effects, either patient-reported clinical effects or asymptomatic biochemical disturbances (Table 3). On association testing for ^4149056 in all individuals who had suffered side effects (n=49) versus those who had experienced no adverse effects on statins (11=65), the odds ratio was 3.95 (p=0.002, 1.58-9.89). DISCUSSION
We demonstrated the sensitivity and specificity of two target enrichment protocols, combined with NGS, for detection of disease-causing mutations in patients with proven or suspected FH. Using the SureSelect Target Enrichment System and the HiSeq 2000 system, 98.8% of targeted regions were covered at more than 25X compared to the PCR-based Access Array System followed by MiSeq sequencing where on average 10% of nucleotides failed to reach this coverage. Regions with low coverage were found outside the coding sequence of LDLR and mutation hotspots in APOB and PCSK9 and therefore did not affect the overall success of mutation detection. Both techniques showed high sensitivity and specificit}' for the detection of single base substitutions and short insertions/deletions. In the validation part of the study, 100% of previously detected mutations were correctly identified using the SureSelect/HiSeq protocol. In comparison, the Access Array System/MiSeq approach led to correct identification of 98% of all variants detected previously by Sanger sequencing, though large
insertions/deletions could not be detected (see below). The single variant that was not detected by the PCR-based Access Array System protocol was an nbp deletion
(p.Lys730Hisfs*48) that overlapped a primer site. However, the recent availability of longer sequencing reads, currently up to 2sob when using MiSeq, will be anticipated in most cases to eliminate the need to have primer sites within coding regions, or allow design modification to include longer overlaps between amplicons.
Three mutations in the LDLR coding sequence (one single nucleotide variant, p.Asp227Giu, and two large deletions) and one LDLR promoter variant (e.-227G>T) were identified in patients who were previously classified as mutation negative.
Inspection of the previous laboratory database indicated that the p.Asp227Glu variant and the two large deletions had not been detected because of incomplete capillary sequencing in the case of the p.Asp227Glu and promoter variants, and absence of MLPA data in the case of the two deletions. A small proportion of FH cases are caused by large deletions or duplications of LDLR , 18 The current standard screening is based on MLPA, a technique that is highly reliable, but is a costly and time-consuming addition to sequencing. The detection of large variants from NGS data has been shown previously, but its use in FH diagnostics has not been investigated. ∞ Here, the combination of SureSelect Target Enrichment System/HiSeq and data analysis using ExomeDepth software 17 led to correct identification of all eight large deletions and one large duplication. This shows the potential of using hybrid capture for the detection of both short and large sequence variants in FH. The read depth from the PGR- based Access Array System assay was not used for this analysis method as read depth in this study did not correlate with exon deletions, although it has recently been shown that amplicon multiplex PGR can be optimised for copy number variant detection. 21
When testing a new molecular workflow for routine diagnostics, in addition to sensitivity and specificity it is important to consider the cost and time efficiency of the protocol. The SureSelect Target Enrichment System protocol allows for comprehensive co verage of targeted regions (current custom design up to 24Mb) while the Access Array System protocol is limited to 480 amplicons with a maximum length of 40obp when sequenced using the latest MlSeq system. Sequence capture also allows the detection of all types of variants including large deletions and duplications, which was not possible in this study using the PCR-based Access Array System. On the other hand, the Access Array System is considerably cheaper to run 19>22 with reagent costs approximately 10-fold lower than for the SureSelect Target Enrichment System protocol 22 and, in addition, the library preparation turnaround time is shorter. In our hands 96 samples can be processed within a day using the Access Array System protocol compared to at least three days needed for the SureSelect Target Enrichment System in-solution capture. Initial DNA requirements of the Access Array
System/MiSeq protocol are also low (song vs lug) and most of the process is automated, reducing the risks of contamination and human error to a minimum. Recently Hollants et al 23 published a protocol for FH mutation detection that was also based on the Access Array System, but the amplicons were sequenced using the pyrosequencing based GS-FLX (Roche) platform. They successfully identified all short variants but, as with our study, could not detect large rearrangements. Our Access Array System protocol is here combined with the MiSeq sequencing platform (a benchtop personal NGS system specifically developed to suit the needs of the routine laboratory setting), and offers similar quality to GS-FLX (Roche), but at a lower sequencing cost. 24 The use of the MiSeq system is also reported to limit errors of variant calls within homopolymer regions that are known to occur in pyrosequencing.25
Novel variants identifie d in the validatio n study
The LDLR promoter variant c.-227G>T has not previously been reported in FH patients, or in other populations, but was investigated previously as part of a study delineating the conserved FPi site. A luciferase assay showed that the c.-227G>T variant had around 75% transcription levels compared with the wild-type site 26. Whilst a 25% reduction is not a definitive decrease in promoter activity, it cannot be excluded that this change is sufficient to cause raised cholesterol levels in this patient. Family members were unavailable for segregation analysis and we therefore classify this variant as being of uncertain significance pending further functional and segregation data. The remaining two novel variants in A FOB, rs.1.2714097 and ^72653087 were located outside LDLR binding sites, regions currently not associated with
hypercholesterolaeniia, and their pathogenicity therefore also remains to be elucidated.
Genotype -ph enotype Correlation hi the Prospective Cohort
In the UK, FH diagnosis is made based on the Simon Broome criteria that identify patients with definite or possible FH. Following NICE guidelines 5, genetic testing is recommended for all suspected index cases and should be followed by family cascade screening if a mutation is found. Our study focused on a group of consecutive patients referred for genetic screening by a local lipid clinic over the course of one year.
To assess clinical significance, all rare variants (MAF<o.oi) that were identified in LDLR, APOB or PCSK9 were compared against a locus specific FH databases6'14. All nonsense variants and insertion/ deletion variants that have been found previously among FH patients were also considered pathogenic. Missense variants were considered to be pathogenic if they were predicted by SIFT and PolyPhen to be deleterious and probably damaging respectively, and were previously identified in FH patients. Based on these criteria a missense change p.Val827lle was included among the list of pathogenic variants, although the conservative valine to isoleucine substitution may not affect protein function. This residue is the third amino acid within the inter alisation signal for LDLR, NPVY, a position generally not necessary for correct internalisation. 27 In addition, our segregation data suggest that this variant may not be disease-causing and we therefore classified this variant as being of unknown significance. Of the four splice site variants, three (c.3i3+iG>A, c.i90+4A>T, c.8i7+iG>A) were shown experimentally to disrupt splicing, two in published data28-2?, and one within this study, and are therefore listed as pathogenic. The remaining splice variant, C.941-4GXA was described previously in FH patients, but its pathogenicity remains to be experimentally confirmed. An RNA sample from this individual was not available for confirmation within this study.
The mutation detection rates among patients with definite (66%) and possible (26%) FH are comparable to previously published studies.7 One mutation was identified among 13 patients that did not fulfill Simon Broome criteria. This suggests that a number of patients with high cholesterol in the general population who do not fulfill formal clinical criteria for FH diagnosis may have FH-causing mutations. Such patients may therefore be diagnosed by the assays developed here and, as these mutations are dominantly inherited, family cascade screening would likely identify the same mutations in 50% of their first degree relatives. The types of mutation identified here reflect the distribution of variants published in the LDLR locus specific database ^ with exonic substitutions (56%) being the most common followed by short insertions deletions (28%), Most of the mutations identified here were unique with only 20% common among UK FH patients which would be identified using the Elucigene FH20 commercial ARMS kit. In our prospective study, we did not identify any mutations in PCSK9 or large rearrangements of LDLR. These variants are generally rare among patients with FH " and we therefore consider it unlikely that our results are biased in anyway.
Recently the importance of screening additional regions of APOB has been highlighted by Motazacker et al. 3° who identified two patients with novel mutations located outside the commonly sequenced region of APOB exon 26. Screening of entire coding regions instead of focusing on mutation hot spots is therefore likely to enhance the discovery of FH-causing mutations. The format of next-generation assays is flexible and can be readily extended to include full coding regions of APOB and PCSK9 as well as coding regions of other medically relevant genes, such as APOE and SLC01B1 that currently need to be genotyped separately.
Our current Access Array System covers the same regions that would be screened using conventional Sanger sequencing and therefore the number of variants identified would be no larger than after Sanger sequencing. The SureSelect Target Enrichment System design also included genes in cholesterol metabolism pathways and regions of APOB and PCSK9 outside those known to be causative of FH. To establish the pathogenicity of such variants, further in silico and experimental analysis will be required. For detection of variants outside known FH-causing genes or gene regions, we focused on variants that are rare (MAF < 0.01), likely pathogenic (i.e. located in coding regions, promoters and exon/intron boundaries) and are present only in individuals without an existing molecular diagnosis of FH. Using these filters we were left with a manageable list of variants (less than 10) that we decided to follow up. When screening larger regions in more patients the identification of large numbers of variants of unknown significance will necessitate further extensive family segregation and functional assays. However the increase of data available in public databases and improvements of bioinformatics tools will allow more efficient filtering of variants than is available at present.
Statin In duced Myo pathy
Previous published data on larger cohorts show an odds ratio of 4.5 for association of rs4i49056 with myopathy 31 and on that basis, guidelines have been recommended avoiding higher doses of simvastatin in heterozygotes or homozygotes for ^4149056. 32 Association testing restricted to more severe side effects (transaminases or creatine kinase greater than three times the upper limit of normal) was not informative in our cohort due to the small sample size. However, less severe patient-reported adverse effects to statin treatment such as myalgia have an effect on patient adherence to treatment in this high-risk population. Therefore the association identified here between SLC01B1 genotype and a wider range of milder adverse effects in this lipid clinic cohort gives an insight into the potential benefits of prospective genotyping prior to initiation of statin treatment.
In conclusion, we have shown the utility of sequence target enrichment methods in combination with NGS in molecular diagnostics of FH. Due to the comprehensive coverage, SureSelect Target Enrichment System protocols (either whole-exome or region specific) may provide the most benefit for studies that aim to identify novel disease-causing genes and for diseases where the number of genes needing to be screened is very large. In FH diagnostics where less than five genes need to be analysed, PCR-based enrichment techniques offer more streamlined protocols that provide high sensitivity for mutation detection and may offer an affordable option for clinical screening of large numbers of patients with suspected FH. If adopted, greater numbers of FH patients and their relatives may potentially benefit from early diagnosis and treatment.
Marks D, Thorogood M, Farrer JM, Humphries SE. Census of clinics providing specialist lipid sendees in the United Kingdom. ./ Public Health (Oxf). Dec 2004;26(4):353-354-
Defesche JC. Familial hypercholesterolemia. In: Betteridge DJ, ed. Lipids and Vascular Disease. London: Martin Dunitz Ltd; 2000:65-76.
Williams RR, Hunt SC, Schumacher MC, et al. Diagnosing heterozygous familial hypercholesterolemia using new practical criteria validated by molecular genetics. Am J Cardiol Jul 15 I993;72(2):l7l~l76.
Scientific Steering Committee on behalf of the Simon Broome Register Group. Risk of fatal coronary heart disease in familial h^ercholesterolaemia. BMJ. i99i;303(6807):893-896.
Wierzbicki AS, Humphries SE, Minhas R. Familial hypercholesterolaemia: summary of NICE guidance. BMJ. 2008:337:31095.
Leigh SE, Foster AH, Whittall RA, Hubbart CS, Humphries SE. Update and analysis of the University College London low density lipoprotein receptor familial h^ercholesterolemia database. Ann Hum Genet. Jul 20o8;72(Pt 43:485-498.
Taylor A, Wang D, Patel K, et al. Mutation detection rate and spectrum in familial hypercholesterolaemia patients in the UK pilot cascade project. Clin Genet. Jun 20iO;77(6):572-58o.
Soutar AK, Naoumova RP. Mechanisms of Disease: genetic causes of familial hypercholesterolemia. Nat Clin Pract Cardiovasc Med. 2007;4(4):2i -225. . Tosi I, Toledo- Leiva P, Neuwirth C, Naoumova RP, Soutar AK. Genetic defects causing familial hypercholesterolaemia: Identification of deletions and duplications in the LDL-receptor gene and summaty of all mutations found in patients attending the Hammersmith Hospital Lipid Clinic. A therosclerosis. 2007;l94(l): 102-111.
10. Taylor A, Tabrah S, Wang D, et al. Multiplex ARMS analysis to detect 13
common mutations in familial hypercholesterolaemia. Clin Genet.
2007;7ΐ(ό):50ΐ-508.
11. Alonso R, Defesche JC, Tejedor D, et al. Genetic diagnosis of familial
hypercholesterolemia using a DNA-array based platform. Clin ical Biochem istry.
2009542(9):899-903.
12. Flicek P, Amode MR, Barrell D, et al. Ensembl 2012. Nucleic Acids Res. Jan
20i2;40(Database issue): D84-90.
13. Li H, Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinform atics. Jul 15 2009525(14): 1754-1760.
14. Usifo E, Leigh SE, Whittall RA, et al. Low-density lipoprotein receptor gene familial hypercholesterolemia variant database: update and pathological assessment. Ann Hum Genet. Sep 2012;76(5):387-40l.
15. The International HapMap Project. Nature. Dec 18 2003;426(6968):7δ9-79ό. 1 . Abecasis GR, Aitshuler D, Auton A, et al. A map of human genome variation from population-scale sequencing. Nature. Oct 28 20io;407(73i9):io6i-i073. 17. Plagnol V, Curtis J, Epstein M, et al. A robust model for read count data in
exome sequencing experiments and implications for copy number variant calling. Bioinform atics. Aug 31 2012.
18 , Taylor A, Martin B, Wang D, Patel K, Humphries SE, Norbury G. Multiplex ligation-dependent probe amplification analysis to screen for deletions and duplications of the LDLR gene in patients with familial hypercholesterolaemia. Clin Genet. Jul 2009;76(l):69-75. 1 . Walsh T, Lee MK, Casadei S, et al. Detection of inherited mutations for breast and ovarian cancer using genomic capture and massively parallel sequencing. Proc Natl Acad Sci U S A. Jul 13 2Q1Q;1Q7(28):12029-12633.
20. Redin C, Le Gras S, Mhamdi O, et al. Targeted high-throughput sequencing for diagnosis of genetically heterogeneous diseases: efficient mutation detection in
Bardet-Biedl and Alstrom Syndromes. J Med Genet. Aug 2012;49(8):502-512.
21. Goossens D, Moens LN, Nelis E, et al. Simultaneous mutation and copy number variation (CNV) detection by multiplex PCR-based GS-FLX sequencing. Hum Mut at. Mar 2009530(3) :472~470.
22. Ware JS, John S, Roberts AM, et al. Next Generation Diagnostics in Inherited Arrhythmia Syndromes : A Comparison of Two Approaches. Cardiovasc Transl Res. Sep 7 2012.
23. Hollants S, Redeker EJ, Matthijs G. Microfluidic amplification as a tool for massive parallel sequencing of the familial hypercholesterolemia genes. Clin Chem . Apr 20l2;s8(4 :7i7-724.
24. Loman NJ, Misra RV, Dallman TJ, et al. Performance comparison of benchtop high-throughput sequencing platforms. Nat Biotechnol. May 20i2;30(s):434- 439·
25. Gilles A, Meglecz E, Pech N, Ferreira S, Malausa T, Martin JF. Accuracy and quality assessment of 454 GS-FLX Titanium pyrosequencing. BM C Genom ics.
2011512:245.
26. Dhawan P, Chang R, Mehta KD. Identification of essential nucleotides of the FPi element responsible for enhancement of low density lipoprotein receptor gene transcription. Nucleic Acids Research. October 1, 1997 1997;25(20):4132- 4138.
27. Chen WJ, Goldstein JL, Brown MS. NPXY, a sequence often found in
cytoplasmic tails, is required for coated pit-mediated internalization of the low density lipoprotein receptor. Journal of Biological Chem istry . February 25, 1990 I990;205(6):3ii6-3123.
28. Jensen HK, Jensen LG, Hansen PS, Faergeman O, Gregersen N. Two point mutations (313 + iG ~ > A and 313 + lG ~ > T) in the splice donor site of intron 3 of the low-density lipoprotein receptor gene are associated with familial hypercholesterolemia. Hum Mutat. 1996;7(3):209-271.
29. Holla OL, Nakken S, Mattingsdal M, et al. Effects of intronic mutations in the LDLR gene on pre-mRNA splicing: Comparison of wet-lab and bioinformatics analyses. Mol Genet Metab. Apr 2009;96(4):245-252.
30. Motazacker MM, Pirruccello J, Huijgen R, et al. Advances in genetics show the need for extending screening strategies for autosomal dominant
hypercholesterolaemia. Eur Heart J. Jim 20i2;33(ii):i36o-i366.
31. Link E, Parish S, Armitage J, et al. SLCO1B1 variants and statin-induced
myopathy— a genomewide study. N Engl J Med. Aug 21 2θθ8;359(8):789-799· 32. Wilke RA, Ramsey LB, Johnson SG, et al. The clinical pharmacogenomics implementation consortium: CPIC guideline for SLCO1B1 and simvastatin- induced myopathy. Clin Pharm acol Ther. Jul 2012592(1): 112-117.
Tabic 1. Mutations identified in the validation study
Detected by Detected by
ID Gene cDNA Protein Sure Select Access Array
990 ND Yes APOB C.10580G>A p.Arg3527Gln
747 Yes Yes APOB e.l0580G>A p.Arg3527Gln
1086 ND Yes APOB C.10580G>A p.Arg3527Gln
667 ND Yes PCSK9 c.385G>A p.Aspl29Asn
735 ND Yes LDLR C.1618G>A p.A1a540Thr
604 Yes Yes LDLR C.1880OA p.Ala627Asp
660 ND Yes LDLR C.1048OT p.Arg350X
728 Yes Yes LDLR C.1048OT p.Arg350X
631 Yes Yes LDLR c.2231G>A p.Arg744Gln
384 Yes Yes LDLR C.1217G>A p.ArgR406Gln
895 ND Yes LDLR C.169IA>G p.Asn564Ser
896 ND Yes LDLR c,1691A>G p.Asn564Ser
766 Yes LDLR c.206idupC p.Asn688Glnfs*29
430 Yes LDLR e.661G A p.Asp221Asn
570# Yes LDLR .6S10G p.Asp227Giu
862 ND Yes LDLR .6 10G p.Asp227Glu
1095 ND Yes LDLR .1444G>A p.Asp482Asn
438 Yes Yes LDLR c.l444G C p.Asp482His
1031 ND Yes LDLR c.401G A p.Cysl34Tyi
7Ϊ4 Yes Yes LDLR .9390A p.Cys 13X
1067 ND Yes LDLR .11 0G A p.Cys377Tyr
1068 ND Yes LDLR .1130G>A p.Cys377Tyr
819 Yes Yes LDLR .2029T>C p.Cys677Arg
8 8 ND Yes LDLR .2043OA p.Cys681X
450 Yes LDLR .2043OA p.Cys681X
814 Yes LDLR .2043OA p.Cys681X
41 Yes LDLR e.j 151 A>C] ;[1351 A>C p.Gln384Pro
813 ND Yes LDLR c.303delG p.Glul01Aspfs*105
996 ND LDLR c.301G>A p.GhilOlL s
771 ND LDLR c.301G>A p.GhilOlLys
820 ND LDLR c.420G>C p.Glul40Asp
770 Yes Yes LDLR c.654 656deiTGG p.Gii]219dei
586 Yes Yes LDLR c.682G>T p.Ghi228X
1071 ND Yes LDLR c.l646G A p.Gly549Asp
853 Yes Yes LDLR .1436T>C p.Lei!479Pro
857 Yes No LDLR c.2184_2194dslGCTAAAGGTCA p.Lys730ffisfs*48
743 ND Yes LDLR .1A>T p et?
663 Yes Yes LDLR cJ 118 1121 dupGTGG p.Tyr.75Tipfs*7
764 Yes Yes LDLR c.ll 18 _1121dupGTGG p. yr375Tipfs*7
1102 ND Yes LDLR .12S5G A p.Val429Met
1 04 ND Yes LDLR e.l285G>A p.Val429Met
666 Yes LDLR c.l285G A .Val429Met
6i
852 ND Yes LDLR c.l586+5G>C
1011 ND LDLR c.l706-3 G>T
1094 ND LDLR c.1845+1 G>A
721 ND LDLR c.1845+ HOG
566 Yes LDLR c.313 + 1 G>A
556 Yes;Yes LDLR c.[266G>A] ;[2312-?_2
683 Yes No LDLR c.-187-?_67+?del promoter and exon 1 deletion
836# Yes No LDLR c.-1 87-?_67+?del promoter and exon I deletion
547 Yes No LDLR C.-187-? _67+?del promoter and exon ! deletion
Yes No LDLR c.2312-?_2389+?del exon 16 deletion
436 Yes No LDLR c.695-?__817+?dei exon 5 deletion
564 Yes No LDLR c.68-?_2583+?del exons 2-1 deletion
565 Yes No LDLR c.68-?_940+?del exons 2-6 deletion
7 2 Yes No LDLR c.l 187-?J21 0+?dnp exons 9-14 duplication
bold, novel variants thai were not previously identified. ND, not done. #, new diagnosis in samples that had previous!}' undergone partial screening only.
6a
Table 2. Previously reported and novel variants identified in known -causing genes in the prospective cohort
D A Detected Detected Gene cDNA Protein Simon Age at Highest
ID by by Broome measurement total
SureSe!ect Access criteria cholesterol Array (mmol/1) Yes Yes LDLR c.938G>A p.Cys3 ! 3Tyr definite 48 TsT~ ND Yes LDLR c.948delC p.Asn316L sfs*54 definite 12 11.2 ND Yes LDLR .190+4A T definite 44
ND Yes LDLR c.2479G>A p.Val827Ile definite
p.Pro685Leu/
ND Yes LDLR c.2054C>T/ c.736delG definite
p.Gly246Giufs*19
Yes LDLR c.1476 1477deiCT p.Ser493Cysfs*42 possible 9.2 Y'es LDLR c.2187_2197delAAAGGTCAGCT p.Lys73GHisfs*48 possible 13,0
14 ND Yes LDLR .204OA p.CysbS* possible 8.6 15 ND Yes LDLR .16810T p.Gln561 * possible
ND Yes APOB C.10579OT p.Arg3 27Trp possible 9.2 ND Yes LDLR c, i476_ 1477deiCT p.Ser493Cysfs*42 possible 8.1 Yes Yes LDLR c.283T>C p.Cys95Arg possible 9.0 Yes Yes LDLR t,1561G>A p.Ala521Thr possible 33 10.0 Yes Yes LDLR c.817+lG>A possible 13 10,5 ND Yes LDLR c.670_675deiinsTTT p.Asp224_Lys225d :iinsPhe possible 41 11.6 ND Yes LDLR C.1730OA p.Trp577* possible 56 10.3 ND Yes LDLR C.906OG p.Cys302Trp possible NA NA ND Yes APOB c. i0580G>A p.Arg3527Gln possible 23 9.2 ND Yes LDLR c.266G>A p.Cys89Tyi possible IN A NA ND Yes LDLR c.654_656delTGG p.Gly219del possible 40 9,6 ND Yes LDLR c.941-4G>A possible 43 NA ND Yes LDLR C.2054OT p.Pro685Leu possible 11 9.0 ND Yes LDLR C.1130G>A p.Cys377Tyr possible 12 7.0 ND Yes LDLR C,313+1G>A not 47 9.6
fulfilling
criteria
In boid, novel, not previoasly identilied variants. These variants are expected to cause and were shown to segregate with the disease.
In italic, variants of unknown significance. These rare variants were previously reported in patients, but their pathogenicity has not been established. ND, not done; NA, not available
Table 3. The frequency of side effects of statin drags inFH patients stratified by rs4149056
Total Heterozygous Homozygosis Wild type
Creatine kinase >3 times the upper limit of normal range
Creatine kinase <3 times the upper limit of normal range 5 1 1 3 M algia 12 3 1 8
Transaminase levels >3 times the upper limit of normal range 3 1 0 2 Transaminase levels <3 times the upper limit of normal range 9 2 0 ? Transaminase levels unknown 3 1 0 2 Other patient-reported side effects 11 4 0 7 Total 49 14 2 33
Table S2. Average ampiicoii coverage for FCR-based Fluidigm runs sequenced using the MiSeq system
Gene Exori Chromosome Start End Average coverage
PCSK9 35509540 55509737
PCSK9 55517957 55518141 664.2
PCSK9 55523043 55523239 173.3
PCSK9 55524158 55524343 450.7
APOB 21229075 21229274 37.2
SLC01B1 12 21331482 21331643 163.3
LDLR 19 11199777 11200413 794.1
LDLR 19 11210845 11211053 839.8
LDLR 19 11213288 11213532 807.0
LDLR 19 11215842 11216330 231.8
LDLR 19 1 1217176 1 1217413 885.9
LDLR 19 11217997 11218256 41 1.8
LDLR 1 1221268 1 1221509 533.5
LDLR 11 222097 11222363 176. S
LDLR 11223891 ! 1224181 446.5
LDLR 10 19 11224183 11224492 636.8
LDLR 11 19 11226682 11226963 279,8
LDLR 12 19 11227483 11227725 661.8
LDLR 13 19 11230711 11230960 654,1
LDLR 14 19 11230990 11231232 670.6
LDLR !5 19 11233780 11234067 426, S
LDLR 16 19 11238627 11238806 740.9
LDLR !7 19 11240131 11240381 751,7
LDLR 18 19 11241903 ! 1242087 S17.9
TabSe S3. List of rare variants ( AF 0 01), identified in hyperchiiesleralaemic patients with no molecular diag osis, iri genes on cholesterol metabolism pathways umber of Protein Amino acid
Gene Variant heterozygotcs Consequence position change PoSjPher
SCAP 3 47467597 C/T 1 NON SYNONYMOUS CODING 267 R/Q bemgn(0.006)
NPCILI 7 44579062 C/G 1 NON SYNONYMOUS CODING 312 D/H benign(0.003)
!NSiGl 7 155090174 C/G 1 NON_.SYNONYMOUS. CODING 60 R'R benign(0)
CYP7A 1 8 59404257 T/C I NON SYNONYMOUS CODING 43 K/R benigniO.1 1}
SREBF1 1 7 J77I8592 C T 1 NON_SY O YMOUS_ CODING 842 R/Q benign(0.015)
SRF.BF1 17J 7719222_C/T I NON S YNON YMO US CODING «09 V M possibly _damagiiig(0.801 )
PTBP1 19 S06440 G A 1 NON SYNONYMOUS CODING 335 A/T benign(O)
All publications mentioned in the above specification are herein incorporated by reference, Various modifications and variations of the described aspects and embodiments of the present invention will be apparent to those skilled in the art without departing from the scope of the present invention. Although the present invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are apparent to those skilled in the art are intended to be within the scope of the following claims.

Claims

CLAI S
1. A method for collecting information useful in aiding the diagnosis and treatment of familial hyper cholesterolaemia(FH), the method comprising providing a sample of DNA from the subject, assaying said DNA for
(i) mutation in oneor moregeneswhich is indicative of FH diagnosis
(ii) presence of oneor more SNPs indicative of incremental risk of high cholesterol; and
(iii) mutation in a gene which is indicative of likelihood of statin toxicity;
wherein assaying said DNA comprises the step of contacting said DNA samplewifh one or more primers for amplification and/ or sequencing of the relevant segment(s) of said DNA
characterised in that each of said assaysof steps (i), (ii) and (iii) iscarried out in a single assay cycle,
2. A method according to claim 1 wherein assaying said DNA further comprises determining thenucleotide sequence of the relevant segment(s) of said DNA, and inferring from said DNA sequence whether said mutations of steps (i) and (iii), and said oneor more SNPs of step (ii), are present.
3. A method according to claim 1 or claim 2 wherein said oneor moregenes indicativeof FH diagnosis is selected from the group consisting of APOB, LDLRand PGSK9.
4. A method according to any preceding claim wherein said mutation in oneor moregeneswhich isindicativeof FH diagnosis is selected from thoseiisted in Table 2.
5. A method according to any preceding claim wherein said SNP is selected from Table A or Table B.
6. A method according to any preceding claim wherein said gene indicative of risk of statin toxicity isSLCO Bl
7. A method according to claim 6 wherein step (iii) comprisesdetermining the presence of thers4149056 or rs4363657 variant of SLC01B1.
8. A method according to claim 7 wherein step (iii) comprisesdetermining the presence of thers4149056 variant of SLC01B1.
9. A method according to any preceding claim wherein said DNA sample is subjected to rnicro-fiuidic PCR amplification of the DNA segment(s) of interest.
10. A method according to claim 9 wherein said PCR is carried out using at least one primer selected from Table 3.
11. A method according to claim 10 using wherein said PCR is carried out using each of theprimersin Table 3.
12. A method according to any preceding claim wherein sequence information is determined by next generation sequencing (NGS).
13. A method of treating a subject comprising performing the method according to any preceding claim wherein if an increased likelihood of FH is identified, then cholesterol lowering medicament is administered to said subject, wherein said medicament is selected according to the subject's SLC01B1 genotype.
14. A method according to claim 13 wherein selection of the medicament comprises selection of oneor moreof theupper limit of thedoseof said medicament for said subject, thedoseof said medicament to be administered to said subject, or the particular medicament to be administered to said subject.
15. A method according to claim 14 wherein said medicament is a statin.
16. A primer selected from Tables.
17. Aset of primerscornprising at least onepair of theprimersin Table 3.
18. Aset of primers according to claim 17 comprising each of theprimersin Table 3.
PCT/GB2014/051399 2013-05-09 2014-05-08 Genetic method of aiding the diagnosis and treatment of familial hypercholersterolaemia Ceased WO2014181107A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB1308313.4 2013-05-09
GB201308313A GB201308313D0 (en) 2013-05-09 2013-05-09 Assay Method

Publications (2)

Publication Number Publication Date
WO2014181107A1 true WO2014181107A1 (en) 2014-11-13
WO2014181107A9 WO2014181107A9 (en) 2015-02-12

Family

ID=48672015

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2014/051399 Ceased WO2014181107A1 (en) 2013-05-09 2014-05-08 Genetic method of aiding the diagnosis and treatment of familial hypercholersterolaemia

Country Status (2)

Country Link
GB (1) GB201308313D0 (en)
WO (1) WO2014181107A1 (en)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105803099A (en) * 2016-05-16 2016-07-27 钟诗龙 Kit for simultaneously detecting SLCO1B1, APOE and LDLR gene multisite mutation
CN109055527A (en) * 2018-08-21 2018-12-21 潍坊德诺泰克生物科技有限公司 For detecting the primed probe group and its application of rs4149056
CN109251977A (en) * 2018-02-14 2019-01-22 重庆京因生物科技有限责任公司 SLCO1B1 genotype quick detection kit based on POCT mode
CN110295224A (en) * 2019-05-28 2019-10-01 南京派森诺基因科技有限公司 Primer combination of probe and kit and application for instructing Rosiglitazone drug personalized medicine related gene to detect
CN110592185A (en) * 2018-12-25 2019-12-20 首都医科大学附属北京安贞医院 A hypercholesterolemia disease-causing gene screening probe design method and its gene chip
CN113584146A (en) * 2021-06-15 2021-11-02 湖南菲思特精准医疗科技有限公司 Detection kit for statin metabolic marker, detection method and application thereof
CN113684270A (en) * 2021-08-19 2021-11-23 江苏百世诺医疗科技有限公司 Multiple-target capture kit for familial hypercholesterolemia and detection method thereof
CN113684269A (en) * 2021-08-19 2021-11-23 江苏百世诺医疗科技有限公司 A familial hypercholesterolemia gene detection library, its construction method and kit
CN114908155A (en) * 2022-05-30 2022-08-16 深圳华大基因股份有限公司 Kit for detecting familial hypercholesterolemia and statin drug genes
CN117987539A (en) * 2024-04-07 2024-05-07 北京诺禾致源科技股份有限公司 Use of a reagent for detecting ABCG8 mutant gene in preparing a kit for detecting sitosterolemia type 1 patients or carriers
US20240371472A1 (en) * 2017-02-01 2024-11-07 The Translational Genomics Research Institute Methods of detecting somatic and germline variants in impure tumors

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114410769A (en) * 2021-12-14 2022-04-29 上海大格生物科技有限公司 A kind of SNP marker, kit and application related to hypercholesterolemia based on SOD3 gene

Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US5270184A (en) 1991-11-19 1993-12-14 Becton, Dickinson And Company Nucleic acid target generation
US5409818A (en) 1988-02-24 1995-04-25 Cangene Corporation Nucleic acid amplification process
US5455166A (en) 1991-01-31 1995-10-03 Becton, Dickinson And Company Strand displacement amplification
WO2005072151A2 (en) * 2004-01-22 2005-08-11 Genaissance Pharmaceuticals, Inc. Apoe genetic markers associated with age of onset of alzheimer's disease
JP2010200701A (en) * 2009-03-04 2010-09-16 Fukuoka Prefecture Nucleic acid hybridization method, method for determination of single nucleotide polymorphism, and reaction vessel and determination apparatus for determination of single nucleotide polymorphism
WO2011027219A1 (en) * 2009-09-04 2011-03-10 Progenika Biopharma, S.A. High throughput detection of small genomic deletions and insertions
WO2013043041A2 (en) * 2011-09-21 2013-03-28 Infovalley® Group Of Companies Methods and compositions for diagnosing familial hypercholesterolemia

Patent Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4683202B1 (en) 1985-03-28 1990-11-27 Cetus Corp
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4683195B1 (en) 1986-01-30 1990-11-27 Cetus Corp
US5409818A (en) 1988-02-24 1995-04-25 Cangene Corporation Nucleic acid amplification process
US5455166A (en) 1991-01-31 1995-10-03 Becton, Dickinson And Company Strand displacement amplification
US5270184A (en) 1991-11-19 1993-12-14 Becton, Dickinson And Company Nucleic acid target generation
WO2005072151A2 (en) * 2004-01-22 2005-08-11 Genaissance Pharmaceuticals, Inc. Apoe genetic markers associated with age of onset of alzheimer's disease
JP2010200701A (en) * 2009-03-04 2010-09-16 Fukuoka Prefecture Nucleic acid hybridization method, method for determination of single nucleotide polymorphism, and reaction vessel and determination apparatus for determination of single nucleotide polymorphism
WO2011027219A1 (en) * 2009-09-04 2011-03-10 Progenika Biopharma, S.A. High throughput detection of small genomic deletions and insertions
WO2013043041A2 (en) * 2011-09-21 2013-03-28 Infovalley® Group Of Companies Methods and compositions for diagnosing familial hypercholesterolemia

Non-Patent Citations (44)

* Cited by examiner, † Cited by third party
Title
"Molecular Cloning, A Laboratory Manual", 1987, COLD SPRING HARBOR PRESS
"Scientific Steering Committee on behalf of the Simon Broome Register Group. Risk of fatal coronary heart disease in familial hypercholesterolaemia", BMJ, vol. 303, no. 6807, 1991, pages 893 - 896
"The International HapMap Project", NATURE, vol. 426, no. 6968, 18 December 2003 (2003-12-18), pages 8 - 6
ABECASIS GR; ALTSHULER D; AUTON A ET AL.: "A map of human genome variation from population-scale sequencing", NATURE, vol. 467, no. 7319, 8 October 2010 (2010-10-08), pages 1061 - 1073, XP055048531, DOI: doi:10.1038/nature09534
ALONSO R; DEFESCHE JC; TEJEDOR D ET AL.: "Genetic diagnosis of familial hypercholesterolemia using a DNA-array based platform", CLINICAL BIOCHEMISTRY, vol. 42, no. 9, 2009, pages 899 - 903, XP026109392, DOI: doi:10.1016/j.clinbiochem.2009.01.017
AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 1987, GREENE PUBLISHING
BOLTON; MCCARTHY, PNAS, vol. 84, 1962, pages 1390
CHEN WJ; GOLDSTEIN JL; BROWN MS: "NPXY, a sequence often found in cytoplasmic tails, is required for coated pit-mediated internalization of the low density lipoprotein receptor", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 265, no. 6, February 1990 (1990-02-01), pages 3116 - 3123
DEFESCHE JC: "Lipids and Vascular Disease", 2000, MARTIN DUNITZ LTD, article "Familial hypercholesterolemia", pages: 65 - 76
DHAWAN P; CHANG R; MEHTA KD: "Identification of essential nucleotides of the FP1. element responsible for enhancement of low density lipoprotein receptor gene transcription", NUCLEIC ACIDS RESEARCH, vol. 25, no. 20, 1 October 1997 (1997-10-01), pages 4132 - 4138
FLICEK P; AMODE MR; BARRELL D ET AL.: "Ensembl 2012", NUCLEIC ACIDS RES., vol. 40, January 2012 (2012-01-01), pages D84 - 90
G. K. HOVINGH ET AL: "Diagnosis and treatment of familial hypercholesterolaemia", EUROPEAN HEART JOURNAL, vol. 34, no. 13, 1 April 2013 (2013-04-01), pages 962 - 971, XP055133938, ISSN: 0195-668X, DOI: 10.1093/eurheartj/eht015 *
GILLES A; MEGLECZ E; PECH N; FERREIRA S; MALAUSA T; MARTIN JF: "Accuracy and quality assessment of 454 GS-FLX Titanium pyrosequencing", BMC GENOMICS, vol. 12, 2011, pages 245, XP021100261, DOI: doi:10.1186/1471-2164-12-245
GOOSSENS D; MOENS LN; NELIS E ET AL.: "Simultaneous mutation and copy number variation (CNV) detection by multiplex PCR-based GS-FLX sequencing", HUM MUTAT., vol. 30, no. 3, March 2009 (2009-03-01), pages 472 - 476, XP055214535, DOI: doi:10.1002/humu.20873
HOLLA OL; NAKKEN S; MATTINGSDAL M ET AL.: "Effects of intronic mutations in the LDLR gene on pre-mRNA splicing: Comparison of wet-lab and bioinformatics analyses", MOL GENET METAB, vol. 96, no. 4, April 2009 (2009-04-01), pages 24 - 2 2, XP026194620, DOI: doi:10.1016/j.ymgme.2008.12.014
HOLLANTS S; REDEKER EJ; MATTHIJS G: "Microfluidic amplification as a tool for massive parallel sequencing of the familial hypercholesterolemia genes", CLIN CHEM, vol. 58, no. 4, April 2012 (2012-04-01), pages 717 - 724, XP055080574, DOI: doi:10.1373/clinchem.2011.173963
JENSEN HK; JENSEN LG; HANSEN PS; FAERGEMAN 0; GREGERSEN N: "Two point mutations ( + 1G -- A and + 1G -- T) in the splice donor site of intron of the low-density lipoprotein receptor gene are associated with familial hypercholesterolemia", HUM MUTAT., vol. 7, no. 3, 1996, pages 269 - 271
LEIGH SE; FOSTER AH; WHITTALL RA; HUBBART CS; HUMPHRIES SE: "Update and analysis of the University College London low density lipoprotein receptor familial hypercholesterolemia database", ANN HUM GENET., vol. 72, July 2008 (2008-07-01), pages 485 - 498, XP055133978, DOI: doi:10.1111/j.1469-1809.2008.00436.x
LI H; DURBIN R.: "Fast and accurate short read alignment with Burrows-Wheeler transform", BIOINFORMATISC, vol. 25, no. 14, 15 July 2009 (2009-07-15), pages 1754 - 1760, XP055287430, DOI: doi:10.1093/bioinformatics/btp324
LINK E; PARISH S; ARMITAGE J ET AL.: "SLCO1B1 variants and statin-induced myopathy--a genomewide study", N ENGL J MED., vol. 359, no. 8, 21 August 2008 (2008-08-21), pages 789 - 799, XP009116022
LITTLE DANIEL P ET AL: "Identification of apolipoprotein E polymorphisms using temperature cycled primer oligo base extension and mass spectrometry", EUROPEAN JOURNAL OF CLINICAL CHEMISTRY AND CLINICAL BIOCHEMISTRY, WALTER DE GRUYTER, BERLIN, DE, vol. 35, no. 7, 1 January 1997 (1997-01-01), pages 545 - 548, XP009107192, ISSN: 0939-4974 *
LOMAN NJ; MISRA RV; DALLMAN TJ ET AL.: "Performance comparison of benchtop high-throughput sequencing platforms", NAT BIOTECHNOL, vol. 30, no. 5, May 2012 (2012-05-01), pages 434 - 439, XP002735884, DOI: doi:10.1038/nbt.2198
LOURDES PALACIOS ET AL: "Molecular characterization of familial hypercholesterolemia in Spain", ATHEROSCLEROSIS, vol. 221, no. 1, 1 March 2012 (2012-03-01), pages 137 - 142, XP055133996, ISSN: 0021-9150, DOI: 10.1016/j.atherosclerosis.2011.12.021 *
MARKS D; THOROGOOD M; FARRER JM; HUMPHRIES SE: "Census of clinics providing specialist lipid services in the United Kingdom", J PUBLIC HEALTH (OXF, vol. 26, no. 4, December 2004 (2004-12-01), pages 353 - 354
MOTAZACKER MM; PIRRUCCELLO J; HUIJGEN R ET AL.: "Advances in genetics show the need for extending screening strategies for autosomal dominant hypercholesterolaemia", EUR HEART J., vol. 33, no. 11, June 2012 (2012-06-01), pages 1360 - 1366
NIEMI, CLINICAL PHARMACOLOGY & THERAPEUTICS, vol. 871, 2009, pages 130 - 133
PHILIPPA J TALMUD ET AL: "Use of low-density lipoprotein cholesterol gene score to distinguish patients with polygenic and monogenic familial hypercholesterolaemia: a case-control study", THE LANCET, vol. 381, no. 9874, 22 February 2013 (2013-02-22), pages 1293 - 1301, XP055133974, ISSN: 0140-6736, DOI: 10.1016/S0140-6736(12)62127-8 *
PLAGNOL V; CURTIS J; EPSTEIN M ET AL.: "A robust model for read count data in exome sequencing experiments and implications for copy number variant calling", BIOINFORMATICS, 31 August 2012 (2012-08-31)
R A WILKE ET AL: "The Clinical Pharmacogenomics Implementation Consortium: CPIC Guideline for SLCO1B1 and Simvastatin-Induced Myopathy", CLINICAL PHARMACOLOGY & THERAPEUTICS, vol. 92, no. 1, 23 May 2012 (2012-05-23), pages 112 - 117, XP055134179, ISSN: 0009-9236, DOI: 10.1038/clpt.2012.57 *
REDIN C; LE GRAS S; MHAMDI 0 ET AL.: "Targeted high-throughput sequencing for diagnosis of genetically heterogeneous diseases: efficient mutation detection in Bardet-Biedl and Alstrom Syndromes", J MED GENET., vol. 49, no. 8, August 2012 (2012-08-01), pages 502 - 512
S. HOLLANTS ET AL: "Microfluidic Amplification as a Tool for Massive Parallel Sequencing of the Familial Hypercholesterolemia Genes", CLINICAL CHEMISTRY, vol. 58, no. 4, 1 April 2012 (2012-04-01), pages 717 - 724, XP055080574, ISSN: 0009-9147, DOI: 10.1373/clinchem.2011.173963 *
SAMBROOK: "Molecular Cloning, A Laboratory Manual", 1987, COLD SPRING HARBOR PRESS
SOUTAR AK; NAOUMOVA RP: "Mechanisms of Disease: genetic causes of familial hypercholesterolemia", NAT CLIN PRACT CARDIOVASC MED., vol. 4, no. 4, 2007, pages 214 - 225, XP009131428, DOI: doi:10.1038/ncpcardio0836
TAYLOR A; MARTIN B; WANG D; PATEL K; HUMPHRIES SE; NORBURY G: "Multiplex ligation-dependent probe amplification analysis to screen for deletions and duplications of the LDLR gene in patients with familial hypercholesterolaemia", CLIN GENET., vol. 76, no. 1, July 2009 (2009-07-01), pages 69 - 75
TAYLOR A; TABRAH S; WANG D ET AL.: "Multiplex ARMS analysis to detect common mutations in familial hypercholesterolaemia", CLIN GENET., vol. 71, no. 6, 2007, pages 561 - 568
TAYLOR A; WANG D; PATEL K ET AL.: "Mutation detection rate and spectrum in familial hypercholesterolaemia patients in the UK pilot cascade project", CLIN GENET., vol. 77, no. 6, June 2010 (2010-06-01), pages 572 - 580
TOSI I; TOLEDO-LEIVA P; NEUWIRTH C; NAOUMOVA RP; SOUTAR AK: "Genetic defects causing familial hypercholesterolaemia: Identification of deletions and duplications in the LDL-receptor gene and summary of all mutations found in patients attending the Hammersmith Hospital Lipid Clinic", ATHEROSCLEROSIS, vol. 194, no. 1, 2007, pages 102 - 111, XP022276609, DOI: doi:10.1016/j.atherosclerosis.2006.10.003
USIFO E; LEIGH SE; WHITTALL RA ET AL.: "Low-density lipoprotein receptor gene familial hypercholesterolemia variant database: update and pathological assessment", ANN HUM GENET., vol. 76, no. 5, September 2012 (2012-09-01), pages 387 - 401
WALSH T; LEE MK; CASADEI S ET AL.: "Detection of inherited mutations for breast and ovarian cancer using genomic capture and massively parallel sequencing", PROC NATL ACAD SCI U S A., vol. 107, no. 28, 13 July 2010 (2010-07-13), pages 12629 - 12633, XP055128035, DOI: doi:10.1073/pnas.1007983107
WARE JS; JOHN S; ROBERTS AM ET AL.: "Next Generation Diagnostics in Inherited Arrhythmia Syndromes: A Comparison of Two Approaches", J CARDIOVASC TRANSL RES., September 2012 (2012-09-01)
WIERZBICKI AS; HUMPHRIES SE; MINHAS R: "Familial hypercholesterolaemia: summary of NICE guidance", BMJ, vol. 337, 2008, pages A1095
WILKE ET AL., CLINICAL PHARMACOLOGY AND THERAPUETICS, vol. 92, 2012, pages 112 - 7
WILKE RA; RAMSEY LB; JOHNSON SG ET AL.: "The clinical pharmacogenomics implementation consortium: CPIC guideline for SLCO1B1 and simvastatin-induced myopathy", CLIN. PHAMWCOL THER, vol. 92, no. 1, July 2012 (2012-07-01), pages 112 - 117, XP055134179, DOI: doi:10.1038/clpt.2012.57
WILLIAMS RR; HUNT SC; SCHUMACHER MC ET AL.: "Diagnosing heterozygous familial hypercholesterolemia using new practical criteria validated by molecular genetics", AM J CARDIOL., vol. 72, no. 2, 15 July 1993 (1993-07-15), pages 171 - 176, XP023208386, DOI: doi:10.1016/0002-9149(93)90155-6

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105803099A (en) * 2016-05-16 2016-07-27 钟诗龙 Kit for simultaneously detecting SLCO1B1, APOE and LDLR gene multisite mutation
US20240371472A1 (en) * 2017-02-01 2024-11-07 The Translational Genomics Research Institute Methods of detecting somatic and germline variants in impure tumors
CN109251977A (en) * 2018-02-14 2019-01-22 重庆京因生物科技有限责任公司 SLCO1B1 genotype quick detection kit based on POCT mode
CN109055527A (en) * 2018-08-21 2018-12-21 潍坊德诺泰克生物科技有限公司 For detecting the primed probe group and its application of rs4149056
CN110592185A (en) * 2018-12-25 2019-12-20 首都医科大学附属北京安贞医院 A hypercholesterolemia disease-causing gene screening probe design method and its gene chip
CN110295224A (en) * 2019-05-28 2019-10-01 南京派森诺基因科技有限公司 Primer combination of probe and kit and application for instructing Rosiglitazone drug personalized medicine related gene to detect
CN113584146A (en) * 2021-06-15 2021-11-02 湖南菲思特精准医疗科技有限公司 Detection kit for statin metabolic marker, detection method and application thereof
CN113684270A (en) * 2021-08-19 2021-11-23 江苏百世诺医疗科技有限公司 Multiple-target capture kit for familial hypercholesterolemia and detection method thereof
CN113684269A (en) * 2021-08-19 2021-11-23 江苏百世诺医疗科技有限公司 A familial hypercholesterolemia gene detection library, its construction method and kit
CN114908155A (en) * 2022-05-30 2022-08-16 深圳华大基因股份有限公司 Kit for detecting familial hypercholesterolemia and statin drug genes
CN117987539A (en) * 2024-04-07 2024-05-07 北京诺禾致源科技股份有限公司 Use of a reagent for detecting ABCG8 mutant gene in preparing a kit for detecting sitosterolemia type 1 patients or carriers

Also Published As

Publication number Publication date
WO2014181107A9 (en) 2015-02-12
GB201308313D0 (en) 2013-06-19

Similar Documents

Publication Publication Date Title
WO2014181107A1 (en) Genetic method of aiding the diagnosis and treatment of familial hypercholersterolaemia
Vandrovcova et al. The use of next-generation sequencing in clinical diagnosis of familial hypercholesterolemia
US20200270692A1 (en) Predicting age-related macular degeneration with single nucleotide polymorphisms within or near the genes for complement component c2, factor b, plekha1, htra1, prelp, or loc387715
US11542556B2 (en) Single nucleotide polymorphism in HLA-B*15:02 and use thereof
JP4140329B2 (en) Hypertension risk diagnosis method
KR102189143B1 (en) Composition and method for prognosing chronic kidney disease
KR102189142B1 (en) SNP as a marker for predicting exacerbation of chronic kidney disease and uses thereof
US20160053333A1 (en) Novel Haplotype Tagging Single Nucleotide Polymorphisms and Use of Same to Predict Childhood Lymphoblastic Leukemia
WO2008107377A2 (en) Combinations of markers for sepsis risk assessment
KR102189144B1 (en) Marker for predicting exacerbation of chronic kidney disease and method for predicting exacerbation using the same
JP6233022B2 (en) HLA-A * 24 group judgment method
KR101304535B1 (en) Method for predicting susceptibility to cardiovascular disease using SNP of klotho genes
KR102511596B1 (en) A single nucleotide polymorphism marker composition for diagnosing an adverse reactions with angiotensin converting enzyme inhibitor and a method using the same
CN104711255B (en) Detection of THSD7A gene sequence and expression changes and its application in the prediction of coronary heart disease
WO2015168252A1 (en) Mitochondrial dna copy number as a predictor of frailty, cardiovascular disease, diabetes, and all-cause mortality
JP7759081B2 (en) Method for determining the presence or absence of a genetic predisposition for high serum uric acid levels after menopause, method for detecting single nucleotide polymorphism (SNP) alleles, composition, and kit
KR102879756B1 (en) SNP markers for dyslipidemia and use thereof)
WO2011043465A1 (en) Method for prediction of risk of polypoidal choroidal vasculopathy
US20120289593A1 (en) Methods for risk assessment, treating, and diagnosing myocardial infarction
KR20250040125A (en) Method for determining the risk of developing high risk open angle glaucoma in Koreans specific by polygenic risk score analysis
Mbele Molecular genetics of arrhythmogenic right ventricular and dilated cardiomyopathy in South Africans
WO2022080882A1 (en) Snp as marker for predicting exacerbation of chronic kidney disease, and uses thereof
WO2015037681A1 (en) Test method for evaluating the risk of anti-thyroid drug-induced agranulocytosis, and evaluation kit
Stephen et al. Positive association of ACE I/D gene polymorphism with genetic predisposition to diabetes in the Semi Bantu ethnic group of Cameroon
Jafar-Mohammadi The evaluation of the contribution of low frequency, intermediate penetrance sequence variants to the pathogenesis of Type 2 Diabetes

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14723855

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 14723855

Country of ref document: EP

Kind code of ref document: A1