WO2014180820A2 - Gpd- yeast strains with improved osmotolerance - Google Patents

Gpd- yeast strains with improved osmotolerance Download PDF

Info

Publication number
WO2014180820A2
WO2014180820A2 PCT/EP2014/059193 EP2014059193W WO2014180820A2 WO 2014180820 A2 WO2014180820 A2 WO 2014180820A2 EP 2014059193 W EP2014059193 W EP 2014059193W WO 2014180820 A2 WO2014180820 A2 WO 2014180820A2
Authority
WO
WIPO (PCT)
Prior art keywords
yeast cell
yeast
strain
nad
dependent
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2014/059193
Other languages
French (fr)
Other versions
WO2014180820A3 (en
Inventor
Victor Gabriel Guadalupe Medina
Benjamin METZ
Bart OUD
VAN DER Charlotte M GRAAF
Robert MANS
Jacobus Thomas Pronk
Van Antonius Jeroen Adriaan Maris
Paul Klaassen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
DSM IP Assets BV
Original Assignee
DSM IP Assets BV
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by DSM IP Assets BV filed Critical DSM IP Assets BV
Publication of WO2014180820A2 publication Critical patent/WO2014180820A2/en
Publication of WO2014180820A3 publication Critical patent/WO2014180820A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0006Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14Fungi; Culture media therefor
    • C12N1/16Yeasts; Culture media therefor
    • C12N1/18Baker's yeast; Brewer's yeast
    • C12N1/185Saccharomyces isolates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/36Adaptation or attenuation of cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/01Preparation of mutants without inserting foreign genetic material therein; Screening processes therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0008Oxidoreductases (1.) acting on the aldehyde or oxo group of donors (1.2)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/02Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/06Ethanol, i.e. non-beverage
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y101/00Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01008Glycerol-3-phosphate dehydrogenase (NAD+) (1.1.1.8)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y102/00Oxidoreductases acting on the aldehyde or oxo group of donors (1.2)
    • C12Y102/01Oxidoreductases acting on the aldehyde or oxo group of donors (1.2) with NAD+ or NADP+ as acceptor (1.2.1)
    • C12Y102/0101Acetaldehyde dehydrogenase (acetylating) (1.2.1.10)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y301/00Hydrolases acting on ester bonds (3.1)
    • C12Y301/03Phosphoric monoester hydrolases (3.1.3)
    • C12Y301/03021Glycerol-1-phosphatase (3.1.3.21)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12RINDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00Microorganisms ; Processes using microorganisms
    • C12R2001/645Fungi ; Processes using fungi
    • C12R2001/85Saccharomyces
    • C12R2001/865Saccharomyces cerevisiae
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02EREDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00Technologies for the production of fuel of non-fossil origin
    • Y02E50/10Biofuels, e.g. bio-diesel

Definitions

  • the present invention relates to metabolic engineering in microorganisms such as yeast.
  • the invention relates to GPD " yeast strains.
  • the invention further relates to the processes wherein the engineered strains to produce fermentation product such as ethanol.
  • Bioethanol production with Saccharomyces cerevisiae is the single largest fermentation process in industrial biotechnology with an annual global product volume of ca. 8.6 x 10 10 litres (Renewable Fuels Association, 2012). This puts S. cerevisiae at the centre of a global research effort to improve its productivity, robustness under process conditions, substrate range and product yield (van Maris et al., 2006). Anaerobic fermentation of sugars to ethanol and C0 2 is a redox-neutral process. However, in anaerobic cultures of S.
  • an 'excess' of NADH is generated from biosynthetic reactions such as oxidative decarboxylations in amino-acid and lipid synthesis (van Dijken and Scheffers, 1986; Bakker et al., 2001 ).
  • this 'excess' NADH is reoxidized through glycerol formation via NADH-dependent reduction of dihydroxyacetone phosphate to glycerol-3-phosphate, which is subsequently dephosphorylated to glycerol.
  • Glycerol production has been estimated to account for a loss of 4 % of the consumed sugar in industrial ethanol production (Nissen et al., 2000).
  • deletion of the GPD1 and GPD2 genes encoding NAD + - dependent glycerol-3-phosphate dehydrogenase (EC 1 .1 .1.8) eliminates glycerol formation (Bjorkqvist et al., 1997).
  • double deletion also completely blocks growth under anaerobic conditions unless an external electron acceptor for NADH reoxidation, such as acetoin or acetaldehyde, is provided (Scheffers, 1966; Bjorkqvist et al., 1997; Ansell et al., 1997).
  • a (yeast) strain or (yeast) cell wherein NAD + -dependent glycerol-3-phosphate dehydrogenase expression is reduced or eliminated is herein designated as "Gpd " (yeast) strain” or "Gpd " (yeast) cell”.
  • This strategy encompasses expression of an (acetylating) acetaldehyde dehydrogenase (EC 1 .2.1 .10) m pF gene (EMBL: CAA70751 ) from Escherichia coli in a gpdIA gpd2A (Gpd " ) S. cerevisiae strain. After activation of acetate by S.
  • acetyl-Coenzyme A synthetase (van den Berg et al., 1996)
  • the resulting acetyl-Coenzyme A can be reduced to ethanol by the combined activity of the NADH-dependent acetylating acetaldehyde dehydrogenase and yeast alcohol dehydrogenases.
  • Anaerobic growth of the resulting engineered yeast strain on glucose was coupled to acetate reduction, glycerol production was eliminated and the ethanol yield increased by 13 % relative to that of a GPD1 GPD2 (Gpd + ) reference strain (Guadalupe Medina et al., 2010).
  • Glycerol formation is not only crucial for redox balancing in anaerobic cultures of wild-type S. cerevisiae but, as its main compatible solute, is also required for osmotolerance. Osmotolerance is essential in industrial ethanol production due to the high sugar concentrations present at the start of fermentation processes (Blomberg and Adler, 1989; Albertyn et al., 1994; Nevoigt and Stahl, 1997).
  • the response of S. cerevisiae to high osmolarity is regulated by the High-Osmolarity Glycerol (HOG) pathway and involves not only intracellular glycerol accumulation but also regulation of other stress-related genes (Hohmann, 2002).
  • HOG High-Osmolarity Glycerol
  • Another object is to provide strains that have an improved production of fermentation product.
  • yeast cell that is genetically modified comprising: a) a deletion or disruption of one or more nucleotide sequence selected from the group of GPD1, GPD2, GPP1 and GPP2 and b) presence of one or more heterologous nucleotide sequence encoding a NAD+-dependent acetylating acetaldehyde dehydrogenase (E.C. 1 .2.1.10.), wherein the yeast cell has an osmotolerance of 0.5 OsM or more.
  • the yeast cell comprises one or more heterologous nucleic acid sequences encoding an NAD+-dependent acetylating acetaldehyde dehydrogenase represented by SEQ ID NO: 2 or a functional homologue of SEQ ID NO: 2 having sequence identity of at least 40% with SEQ ID NO 2, wherein the NAD+-dependent acetylating acetaldehyde dehydrogenase has a mutation at position corresponding to D38 of SEQ ID NO: 2.
  • FIG. 1 shows the osmotolerance of evolved strain IMZ333 (evolved Gpd " ), ancestral strain IMZ160 (unevolved Gpd " ) and the reference strain IME076 (Gpd + ). Spot assay experiments were performed on synthetic medium agar plates with 0.1 -1 .0 M glucose under aerobic and anaerobic conditions. Pictures were taken after 3 days (panel A) and 7 days (panel B) of incubation at 30 °C.
  • FIG. 2 Figure 2 shows the results of anaerobic batch cultivation of the evolved osmotolerant strain S. cerevisiae IMZ333 (evolved Gpd " ) and the reference strain IME076 (Gpd + ) on synthetic medium with 1 M glucose. Both strains were grown at pH 5.0 and at 30 °C.
  • Panel A IMZ333, 2 g I "1 acetic acid.
  • Panel B I ME076, 2 g I "1 acetic acid.
  • Panel C IMZ333, 3 g ⁇ 1 acetic acid. Symbols: ⁇ , Dry weight; ⁇ , glucose; O, ethanol (not corrected for evaporation); ⁇ , acetate; ⁇ , glycerol.
  • Each graph represents values for one of two independent replicates, which differ less than 5% in growth kinetics.
  • FIG. 3 shows the analysis of the contributions of genomic and/or plasmid based mutations to the evolved osmotolerant phenotype of Gpd " S. cerevisiae. Aerobic (black bars) and anaerobic (grey-bars) shake-flask cultures were both incubated at 30 °C and at 200 rpm with an initial glucose concentration of 1 M.
  • the optical density (OD 660 nm) was measured after 48 h for strains IME076 (Gpd + with empty-vector p426_GPD) and IMZ333 (evolved Gpd " with evolved pUDE043 population) or after 72 h for strains IMJ004 (evolved Gpd " pUDE043), IMJ005 (evolved Gpd " and pUDE043ev1 ), IMJ006 (evolved Gpd " and pUDE043ev2) and IMJ009 (evolved Gpd " with empty-vector pRS426).
  • Sequences 3-6 are used as primers in resequencing (see example).
  • the invention relates to a yeast cell that is genetically modified comprising: a) a deletion or disruption of one or more nucleotide sequence selected from the group of GPD1, GPD2, GPP1 and GPP2 and b) presence of one or more heterologous nucleotide sequence encoding a NAD+-dependent acetylating acetaldehyde dehydrogenase (E.C. 1 .2.1.10.), wherein the yeast cell has an osmotolerance of 0.5 OsM or more. In an embodiment, the yeast cell has an osmotolerance of 1 .0 OsM or more.
  • E.C. 1 .2.1.10 NAD+-dependent acetylating acetaldehyde dehydrogenase
  • Osmotolerance of the yeast cell is herein expressed as Osmolarity" as measured with the spot assay method disclosed in the examples.
  • Osmolarity is defined as the concentration of a solution expressed in terms of osmotically active particles, or osmoles (osmol/L or OsM).
  • Osmotically active particles are any solutes that contribute to a concentration gradient. These can be either intact, uncharged molecules or charged ions.
  • osmolarity is calculated by multiplication of molarity with the dissociation constant:
  • the yeast cell according to the invention has an osmotolerance of 0.5 OsM or more, in embodiments 0.7 OsM or more or 1 .0 OsM or more, measured under anaerobic conditions after 3 days growth at 0.5M glucose (Fig. 1 ).
  • the osmotolerance is determined herein, as in the examples by spot assay, by spotting 5 ⁇ of serial dilution of 10 6 , 10 5 , 10 4 cells ml "1 of exponentially growing cultures onto 0.1 , 0.5, and/or 1 M glucose synthetic media agar plates (1 % w/v). The plates are incubated at 30 °C under anaerobic and aerobic conditions for 7 days and pictures were taken after 3 and 7 days. The osmotolerance values are determined under anaerobic conditions after 3 days growth at 0.5M glucose (Fig. 1 ).
  • the osmotolerance may be confirmed by specific growth of the yeast cell as in examples, under anaerobic conditions at high (1 M) glucose concentration at the presence of acetate in a concentration of 2 g/l. Under these conditions strain IMZ333 has a specific growth rate 0.12 h "1 (Fig. 2).
  • acetaldehyde dehydrogenase polypeptide is also designated herein as “polypeptide acetaldehyde dehydrogenase” or “polypeptide”.
  • “Acetaldehyde dehydrogenase polypeptide polynucleotide” is herein a polynucleotide that encodes the acetaldehyde dehydrogenase polypeptide.
  • the acetaldehyde dehydrogenase has at least 50% sequence identity with SEQ ID NO: 2, and wherein the polypeptide has acetaldehyde dehydrogenase activity.
  • the mutations at the positions corresponding to D38 may be a substitution with C, P, G, A, V, L, I, M, F, W,Y, H, S, T, N, Q, D, E, K, R or a deletion.
  • X may be any aminoacid, X (2) means two X.
  • the NAD+-dependent acetylating acetaldehyde dehydrogenase has the substitution D38N or D38Q, in particular D38N.
  • A6 indicates an amino acid (one letter code) at a certain position in SEQ ID NO: 2, here A (Alanine) at position 6 of the protein.
  • A6 (L/N/Q/GA /I Y/S/E/K) indicates herein mutation of amino acid at a certain position, here A (Alanine) at position 6 of the protein is exchanged for any of L (Leucine), N (Asparagine), Q (Glutamine), G (Glycine), V (Valine), I (Isoleucine), Y (Tyrosine), S (Serine), E (Glutamic acid) or K (Lysine).
  • the yeast cell is a yeast cell wherein the genome of the yeast cell comprises a mutation in at least one gene selected from the group of GPD1, GPD2, GPP1 and GPP2, which mutation may be a knock-out mutation, which knock-out mutation may be a complete deletion of at least one of said genes in comparison to the yeast cell's corresponding wild-type yeast gene.
  • the invention further relates to a polynucleotide encoding such polypeptide, a nucleic acid construct comprising the polynucleotide encoding the polypeptide and to a vector for the functional expression of a heterologous polypeptide in a yeast cell, said expression vector comprising a heterologous nucleic acid sequence operably linked to a promoter functional in the yeast cell and said heterologous nucleic acid sequence encoding a polypeptide having enzymatic activity for converting acetyl-Coenzyme A into acetaldehyde in (the cytosol of) said yeast cell, wherein said polypeptide preferably comprises a sequence according to SEQ ID NO: 2, having a mutation at position corresponding to D38 of SEQ ID NO: 2 or a functional homologue of any of said sequences and to a host cell transformed with the nucleic acid construct or with the vector above.
  • the yeast cell is free of genes encoding NADH-dependent glycerol 3-phosphate dehydrogenases.
  • the yeast cell comprises one or more nucleic acid sequences encoding an acetyl-Coenzyme A synthetase activity (EC 6.2.1 .1 ) and one or more nucleic acid sequences encoding NAD+-dependent alcohol dehydrogenase activity (EC 1 .1.1 .1 ).
  • the yeast cell is selected from Saccharomycetaceae, in particular from the group of Saccharomyces, such as Saccharomyces cerevisiae; Kluyveromyces, such as Kluyveromyces marxianus; Pichia, such as Pichia stipitis or Pichia angusta; Zygosaccharomyces, such as Zygosaccharomyces bailii; and Brettanomyces, such as Brettanomyces intermedius, Issachenkia, such as Issachenkia orientalis.
  • Saccharomyces such as Saccharomyces cerevisiae
  • Kluyveromyces such as Kluyveromyces marxianus
  • Pichia such as Pichia stipitis or Pichia angusta
  • Zygosaccharomyces such as Zygosaccharomyces bailii
  • Brettanomyces such as Brettanomyces intermedius, Issachenkia, such
  • the yeast cell is the Saccharomyces cerevisiae strain IMZ333 deposited on 7 May 2013 having deposit number CBS135134 at the Centraal Bureau voor Schimmelcultures, Uppsalalaan 8, 3584 CT UTRECHT, The Netherlands.
  • the invention further relates to a process for the production of an osmotolerant yeast cell comprising the following steps:
  • step b) is repeated on an isolate of previous step b); c) isolating a second yeast strain from a culture of step b);
  • step d) is repeated on an isolate of previous step d); e) isolating an osmotolerant yeast cell from step d), wherein, one or more NAD+-dependent acetylating acetaldehyde dehydrogenase gene is introduced into the host yeast strain, or into any yeast strain isolated in any of steps a), b) and c), and the resulting strain is returned to that step.
  • the first yeast strain is produced starting from a host yeast strain by deleting or disrupting one or more NAD-dependent glycerol-3-phosphate encoding gene.
  • the first yeast strain is produced starting from a host yeast strain by deleting or disrupting one or more NAD-dependent glycerol-3-phosphate encoding gene and by introducing one or more NAD+-dependent acetylating acetaldehyde dehydrogenase gene.
  • step b) the first yeast strain is grown under aerobic growth conditions in the presence of one or more solute.
  • the solute may herein be chosen from the group consisting of salt, sugar, protein, RNA and sugar. Any salt that provides sufficient osmotic pressure for the yeast may be used as solute. Suitable examples of salts are sodium chloride and potassium chloride. Any sugar that provides sufficient osmotic pressure for the yeast may be used as solute. Suitable examples of sugars are glucose, xylose or arabinose, mannose, sorbitol. In an embodiment, the solute comprises one or more sugars that cannot be metabolized by the yeast cells, for example sorbitol.
  • step b) is repeated on an isolate of previous step b).
  • an isolate for instance a single colony isolate may be taken from culture in the reactor and that isolate may be used to seed a new batch.
  • the concentration of solute may be higher in the new batch. This may be repeated until an isolate is obtained that has sufficient osmotolerance. This strain can be used in step c).
  • step b If the NAD+-dependent acetylating acetaldehyde dehydrogenase gene was not introduced into the yeast cell in a previous step, it may be introduced in step b).
  • step c) a yeast strain, (the second yeast strain) is isolated from a culture of step b). If the NAD+-dependent acetylating acetaldehyde dehydrogenase gene was not introduced into the yeast cell in a previous step, it may be introduced in step c).
  • step d) the second yeast strain is grown under anaerobic growth conditions in the presence of acetic acid or acetate and one or more solute.
  • Anaerobic growth conditions are herein anaerobic or oxygen limited. Anaerobic is here defined as a growth process run in the absence of oxygen or in which substantially no oxygen is consumed, preferably less than about 5, about 2.5 or about 1 mmol/L/h, and wherein organic molecules serve as both electron donor and electron acceptors.
  • An oxygen-limited growth process is a process in which the oxygen consumption is limited by the oxygen transfer from the gas to the liquid.
  • the degree of oxygen limitation is determined by the amount and composition of the ingoing gasflow as well as the actual mixing/mass transfer properties of the fermentation equipment used.
  • the rate of oxygen consumption is at least about 5.5, more preferably at least about 6, such as at least 7 mmol/L/h.
  • a process of the invention comprises recovery of the fermentation product.
  • step d) similar solutes and solute conditions, such as concentration may be used as in step b).
  • Acetic acid or acetate (both herein considered equivalent and for both "acetate” may be used) is added in step d).
  • Ratio of acetic acid/.acetate will depend on pH.
  • the concentration of acetate in step d) may be chosen similar to the concentration the yeast strain meets in its end use (e.g. in fermentation of lignocellulosic hydrolysate.to fermentation product, such hydrolyate may contain 1 -10 g/l acetate, e.g. 2 g/l acetate.
  • the growing process in step b) and d) may also be called adaptive evolution herein.
  • the adaptive evolution may be conducted by growth of cultures in sequential batch reactors.
  • concentration of solute may sequentially be increased.
  • the concentration may be 0.5 OsM solute (e.g. sorbitol)
  • the concentration may be 1 .0 OsM solute
  • the concentration may be 2.0 OsM solute.
  • Cells will be able to grow since they will gradually adapt to higher osmolarity.
  • acetic acid (or acetate) is added, since this is necessary for growth under anaerobic conditions.
  • the yeast cells may be cultivated in repeated batches by repeated replacement of the culture with fresh medium with increased concentration of one or more solute chosen from the group consisting of salt, sugar, protein, RNA and sugar. Also herein the concentration of solute may be increased gradually.
  • the molarity of the solute may be 1 M or more.
  • the molality may be 1 osM or more.
  • Molality is defined as the number of moles per liter of solution (mol/L or M).
  • the weight of a mole is equal to the atomic mass or molecular weight of the substance, expressed in grams (gram molecular weight). Molecular weight is obtained by adding the atomic weights of each atom in the molecule.
  • the term Molality herein is the number of moles of solute in 1 Kg of solvent (not total solution).
  • Osmotolerance of the yeast cell is herein expressed as Osmolarity" as measured with the spot assay method disclosed in the examples.
  • Osmolarity is defined as the concentration of a solution expressed in terms of osmotically active particles, or osmoles (osmol/L or OsM).
  • Osmotically active particles are any solutes that contribute to a concentration gradient. These can be either intact, uncharged molecules or charged ions. To convert between molarity and osmolarity, the following equation is used:
  • osmolarity is calculated by multiplication of molarity with the dissociation constant:
  • the yeast cell according to the invention has an osmotolerance of 0.5 OsM or more, in embodiments 0.7 OsM or more or 1 .0 OsM or more, measured under anaerobic conditions after 3 days growth at 0.5M glucose (Fig. 1 ).
  • the osmotolerance of a strain is determined herein, as in the examples by spot assay, by spotting 5 ⁇ of serial dilution of 10 6 , 10 5 , 10 4 cells ml "1 of exponentially growing cultures onto 0.1 , 0.5, and/or 1 M glucose synthetic media agar plates (1 % w/v). The plates are incubated at 30 °C under anaerobic and aerobic conditions for 7 days and pictures were taken after 3 and 7 days. The osmotolerance values are determined under anaerobic conditions after 3 days growth at 0.5M glucose (Fig. 1 ).
  • the osmotolerance may be supported by specific growth of the yeast cell as in examples, under anaerobic conditions at high (1 M) glucose concentration at the presence of acetate in a concentration of 2 g/l. Under these conditions strain IMZ333 has a specific growth rate 0.12 h "1 (Fig. 2).
  • the invention further relates to the use of a yeast cell according to the invention for the preparation of fermentation product, preferably ethanol.
  • the invention further raltes to a rocess for preparing fermentation product, comprising preparing fermentation product from acetate and from a fermentable carbohydrate - in particular a carbohydrate selected from the group of glucose, fructose, sucrose, maltose, xylose, arabinose, galactose and mannose - which preparation is carried out under anaerobic conditions using a yeast cell according to the invention.
  • the preparation is carried out in a fermentation medium comprising the acetate and the carbohydrate in a molar ratio is 0.7 or less, in particular at least 0.004 to 0.5, more in particular 0.05 to 0.3.
  • at least part of the carbohydrate and at least part of the acetate has been obtained by hydrolysing a polysaccharide selected from the group of lignocelluloses, celluloses, hemicelluloses, and pectins.
  • the lignocellulose is preferably lignocellulosic biomass that has been hydrolysed thereby obtaining the fermentable carbohydrate and acetate.
  • the ligno-cellulosic or hemi-cellulosic material is contacted with an enzyme composition, wherein one or more sugar is produced, and wherein the produced sugar is fermented to give a fermentation product, wherein the fermentation is conducted with a yeast cell according to the invention.
  • the fermentation product of the invention may be any useful product.
  • it is a product selected from the group consisting of ethanol, n-butanol, isobutanol, lactic acid, 3-hydroxy-propionic acid, acrylic acid, acetic acid, succinic acid, adipic acid, fumaric acid, malic acid, itaconic acid, maleic acid, citric acid, adipic acid, an amino acid, such as lysine, methionine, tryptophan, threonine, and aspartic acid, 1 ,3- propane-diol, ethylene, glycerol, a ⁇ -lactam antibiotic and a cephalosporin, vitamins, pharmaceuticals, animal feed supplements, specialty chemicals, chemical feedstocks, plastics, solvents, fuels, including biofuels and biogas or organic polymers, and an industrial enzyme, such as a protease, a cellulase, an amylase, a glucanase, a lact
  • the fermentation product may be one or more of ethanol, butanol, lactic acid, a plastic, an organic acid, a solvent, an animal feed supplement, a pharmaceutical, a vitamin, an amino acid, an enzyme or a chemical feedstock.
  • ethanol when in accordance with the invention ethanol is produced, it is produced in a molar ratio of glycerohethanol of less than 0.04:1 , in particular of less than 0.02:1 , preferably of less than 0.01 :1 .
  • Glycerol production may be absent (undetectable), although at least in some embodiments (wherein NADH-dependent glycerol synthesis is reduced yet not completely prohibited) some glycerol may be produced as a side product, e.g. in a ratio glycerol to ethanol of 0.001 :1 or more.
  • the present invention allows complete elimination of glycerol production, or at least a significant reduction thereof, by providing a recombinant yeast cell, in particular S. cerevisiae, such that it can reoxidise NADH by the reduction of acetic acid to ethanol via NADH-dependent reactions.
  • a method of the invention may also offer an increased product yield (determined as the wt.% of converted feedstock, i.e. carbohydrate plus acetic acid, that is converted into ethanol). Since acetic acid is generally available at significant amounts in lignocellulosic hydrolysates, this makes the present invention particularly advantageous for the preparation of ethanol using lignocellulosic biomass as a source for the fermentable carbohydrate.
  • carbohydrate sources that may contain a considerable amount of acetate include sugar beet molasses (hydrolysates of) and starch containing (e.g. waste products from corn dry milling processes , from corn wet milling processes; from starch wastes processes , e.g. with stillage recycles).
  • starch containing e.g. waste products from corn dry milling processes , from corn wet milling processes; from starch wastes processes , e.g. with stillage recycles.
  • the invention contributes to a decrease of the levels of the inhibiting compound acetic acid and a larger fraction of the hydrolysate actually becomes a substrate for the production of the ethanol. Good results have been achieved with a yeast cell without noticeable enzymatic activity needed for the NADH-dependent glycerol synthesis, as illustrated in the example.
  • a yeast cell according to the invention having NADH-dependent glycerol synthesis activity may advantageously be used for, e.g., ethanol production. It is contemplated that such cell can use acetate to re-oxidise at least part of the NADH. Thereby the acetate may compete with the NADH-dependent glycerol synthesis pathway and thus potentially reduce the glycerol synthesis.
  • acetate present in a feedstock used for the production of ethanol can be converted into ethanol, thereby increasing product yield
  • preferred cell according to the invention is free of enzymatic activity needed for the NADH-dependent glycerol synthesis or has a reduced enzymatic activity with respect to the NADH- dependent biochemical pathway for glycerol synthesis from a carbohydrate compared to its corresponding wild-type yeast cell.
  • a reduced enzymatic activity can be achieved by modifying one or more genes encoding a NAD-dependent glycerol 3-phosphate dehydrogenase activity (GPD) or one or more genes encoding a glycerol phosphate phosphatase activity (GPP), such that the enzyme is expressed considerably less than in the wild-type or such that the gene encoded a polypeptide with reduced activity.
  • GPD NAD-dependent glycerol 3-phosphate dehydrogenase activity
  • GPP glycerol phosphate phosphatase activity
  • Such modifications can be carried out using commonly known biotechnological techniques, and may in particular include one or more knock-out mutations or site-directed mutagenesis of promoter regions or coding regions of the structural genes encoding GPD and/or GPP.
  • yeast strains that are defective in glycerol production may be obtained by random mutagenesis followed by selection of strains with reduced or absent activity of GPD and/or GPP.
  • S. cerevisiae GPD1, GPD2, GPP1 and GPP2 genes are shown in WO201 1010923, and are disclosed in SEQ ID NO: 24-27.
  • Preferably at least one gene encoding a GPD or at least one gene encoding a GPP is entirely deleted, or at least a part of the gene is deleted that encodes a part of the enzyme that is essential for its activity.
  • good results have been achieved with a S. cerevisiae cell, wherein the open reading frames of the GPD1 gene and of the GPD2 gene have been inactivated.
  • Inactivation of a structural gene can be accomplished by a person skilled in the art by synthetically synthesizing or otherwise constructing a DNA fragment consisting of a selectable marker gene flanked by DNA sequences that are identical to sequences that flank the region of the host cell's genome that is to be deleted.
  • good results have been obtained with the inactivation of the GPD1 and GPD2 genes in Saccharomyces cerevisiae by integration of the marker genes kanMX and hphMX4. Subsequently this DNA fragment is transformed into a host cell. Transformed cells that express the dominant marker gene are checked for correct replacement of the region that was designed to be deleted, for example by a diagnostic polymerase chain reaction or Southern hybridization.
  • a cell according to the invention comprises a heterologous nucleic acid sequence encoding an NADC- dependent, acetylating acetaldehyde dehydrogenase (EC 1 .2.1.10).
  • This enzyme catalyses the conversion of acetyl-Coenzyme A to acetaldehyde.
  • This conversion can be represented by the equilibrium reaction formula: acetyl-Coenzyme A + NADH + H+ ⁇ -> acetaldehyde + NAD+ + Coenzyme A.
  • this enzyme allows the re-oxidation of NADH when acetyl-Coenzyme A is generated from acetate present in the growth medium, and thereby glycerol synthesis is no longer needed for redox cofactor balancing.
  • the nucleic acid sequence encoding the NADC-dependent acetylating acetaldehyde dehydrogenase may in principle originate from any organism comprising a nucleic acid sequence encoding said dehydrogenase.
  • NAD+-dependent acetylating acetaldehyde dehydrogenases that can catalyse the NADH-dependent reduction of acetyl-Coenzyme A to acetaldehyde may in general be divided in three types of NADC-dependent acetylating acetaldehyde dehydrogenase functional homologues:
  • Bifunctional proteins that catalyse the reversible conversion of acetyl-Coenzyme A to acetaldehyde, and the subsequent reversible conversion of acetaldehyde to ethanol.
  • An example of this type of proteins is the AdhE protein in E.coli (Gen Bank No: NP-415757). AdhE appears to be the evolutionary product of gene fusion.
  • the NH2- terminal region of the AdhE protein is highly homologous to aldehyde:NADC oxidored uctases, whereas the COOH-terminal region is homologous to a family of Fe2+- dependent ethanohNADC oxidoreductases (Membrillo-Hernandez et al., (2000) J. Biol. Chem. 275: 33869-33875).
  • the E. co// AdhE is subject to metal- catalyzed oxidation and therefore oxygen-sensitive (Tamarit et al. (1998) J. Biol. Chem. 273:3027-32).
  • a homologous protein AcdH is identified in the genome of Lactobacillus plantarum (GenBank No: NP-784141 ). Another example of this type of proteins is the said gene product in Clostridium beijerinckii NRRL B593 (Toth et al. (1999) Appl. Environ. Microbiol. 65: 4973-4980, GenBank No: AAD31841 ).
  • 4-Hydroxy-2- ketovaleraties first converted by 4-hydroxy- 2-ketovalerate aldolase to pyruvate and acetaldehyde, subsequently acetaldehyde is converted by acetylating acetaldehyde dehydrogenase to acetyl-CoA.
  • An example of this type of acetylating acetaldehyde dehydrogenase is the DmpF protein in Pseudomonas sp CF600 (GenBank No: CAA43226) (Shingler et al. (1992) J. Bacteriol. 174:71 1 -24).
  • the £. coli MphF protein (Ferrandez et al. (1997) J. Bacteriol. 179: 2573- 2581 , GenBank No: NP-414885) is homologous to the DmpF protein in Pseudomonas sp. CF600.
  • a suitable nucleic acid sequence may in particular be found in an organism selected from the group of Escherichia, in particular E. coli; Mycobacterium, in particular Mycobacterium marinum, Mycobacterium ulcerans, Mycobacterium tuberculosis; Carboxydothermus, in particular Carboxydothermus hydrogenoformans; Entamoeba, in particular Entamoeba histolytica; Shigella, in particular Shigella sonnei; Burkholderia, in particular Burkholderia pseudomallei, Klebsiella, in particular Klebsiella pneumoniae; Azotobacter, in particular Azotobacter uinelandii; Azoarcus sp; Cupriauidus, in particular Cupriauidus taiwanensis; Pseudomonas, in particular Pseudomonas sp.
  • the nucleic acid sequence encoding the NADCdependent acetylating acetaldehyde dehydrogenase originates from Escherichia, mote preferably from E. coii.
  • mhpF gene from E. coii, or a functional homologue thereof. This gene is described in Ferrandez et al. (1997) J. Bacteriol. 179:2573-2581. Good results have been obtained with S. cereuisiae, wherein an mhpF gene from E. coii has been incorporated.
  • nucleic acid sequence encoding an (acetylating) acetaldehyde dehydrogenase is from, in particular Pseudomonas.
  • the nucleic acid sequence encoding the NAD+-dependent, acetylating acetaldehyde dehydrogenase may be a wild type nucleic acid sequence.
  • a preferred nucleic acid sequence encodes the NAD+-dependent, acetylating acetaldehyde dehydrogenase represented by SEQ ID NO: 2, SEQ ID NO: 29 in WO201 1010923, or a functional homologue of SEQ ID NO: 2 or SEQ ID NO: 29.
  • the nucleic acid sequence comprises a sequence according to SEQ ID NO: 1.
  • an acetylating acetaldehyde dehydrogenase may in for instance be selected from the group of Escherichia coii adhE, Entamoeba histolytica adh2, Staphylococcus aureus adhE, Piromyces sp.E2 adhE, Clostridium kluyveri EDK33116, Lactobacillus plantarum acdH, and Pseudomonas putida YP 001268189.
  • a cell according to the invention also comprises an acetyl-Coenzyme A synthetase, which enzyme catalyses the formation of acetyl- coenzyme A from acetate.
  • This enzyme may be present in the wild-type cell, as is for instance the case with S.
  • cerevisiae which contains two acetyl-Coenzyme A synthetase isoenzymes encoded by the ACSI [SEQ ID NO: 171 and ACS2 [SEQ ID NO: 181 genes (van den Berg et a1 (1996) J. Biol. Chem. 271 :28953-28959), or a host cell may be provided with one or more heterologous gene(s) encoding this activity, e.g. the ACSI andlor ACS2 gene of S. cerevisiae or a functional homologue thereof may be incorporated into a cell lacking acetyl-Coenzyme A synthetase isoenzyme activity.
  • the yeast cell comprises an NAD+ dependent alcohol dehydrogenase (EC 1 .1 .1.1 ).
  • This enzyme catalyses the conversion of acetaldehyde into ethanol.
  • the yeast cell may naturally comprise a gene encoding such a dehydrogenase, as is de case with S. cerevisiae (ADH1 -5) [SEQ ID NO: 19-23], see 'Lutstorf and Megnet. 1968 Arch. Biochem. Biophys. 126:933-944', or 'Ciriacy, 1975, Mutat. Res.
  • a host cell may be provided with one or more heterologous gene(s) encoding this activity, e.g. any or each of the ADH1 -5 genes of S. cerevisiae or functional homologues thereof may be incorporated into a cell lacking NAD+ dependent alcohol dehydrogenase activity.
  • An acetaldehyde dehydrogenase polypeptide of the invention may have one or more alternative and/or additional activities other than that of acetaldehyde dehydrogenase activity.
  • an acetaldehyde dehydrogenase polypeptide of the invention will typically have acetylating acetaldehyde dehydrogenase activity.
  • a acetaldehyde dehydrogenase polypeptide of the invention may have one or more of the activities set out above in addition to or alternative to that activity.
  • the host cell of the invention has at least one of: a) the ability of isomerising xylose to xylulose; and, b) the ability to convert L-arabinose into D-xylulose 5-phosphate.
  • the yeast cell preferably has a functional exogenous xylose isomerase gene, which gene confers to the yeast cell the ability to isomerise xylose into xylulose.
  • the yeast cell preferably has functional exogenous genes coding for a L-arabinose isomerase, a L-ribulokinase and a L-ribulose-5-phosphate 4-epimerase, which genes together confers to the yeast cell the ability to isomerise convert L-arabinose into D-xylulose 5-phosphate.
  • Fungal host cells having the ability of isomerising xylose to xylulose as e.g. described in WO 03/0624430 and in WO 06/009434.
  • the ability of isomerising xylose to xylulose is preferably conferred to the yeast cell by transformation with a nucleic acid construct comprising a nucleotide sequence encoding a xylose isomerase.
  • the yeast cell thus acquires the ability to directly isomerise xylose into xylulose.
  • the yeast cell thus acquires the ability to grow aerobically and/or anaerobically on xylose as sole energy and/or carbon source though direct isomerisation of xylose into xylulose (and further metabolism of xylulose).
  • direct isomerisation of xylose into xylulose occurs in a single reaction catalysed by a xylose isomerase, as opposed to the two step conversion of xylose into xylulose via a xylitol intermediate as catalysed by xylose reductase and xylitol dehydrogenase, respectively.
  • xylose isomerases (and their amino acid and coding nucleotide sequences) that may be successfully used to confer to the yeast cell of the invention the ability to directly isomerise xylose into xylulose have been described in the art. These include the xylose isomerases of Piromyces sp.
  • Neocallimastix a group consisting of Bacteroides, including e.g. B.thetaiotaomicron (WO 06/009434), B. fragilis, and B.
  • the ability of to converting L-arabinose into D-xylulose 5-phosphate is preferably conferred to the yeast cell by transformation with a nucleic acid construct(s) comprising nucleotide sequences encoding a) an arabinose isomerase; b) a ribulokinase, preferably a L-ribulokinase a xylose isomerase; and c) a ribulose-5-P-4-epimerase, preferably a L-ribulose-5-P-4-epimerase.
  • the ability to convert L-arabinose into D-xylulose 5-phosphate is the ability to convert L-arabinose into D-xylulose 5-phosphate through the subsequent reactions of 1 ) isomerisation of arabinose into ribulose; 2) phosphorylation of ribulose to ribulose 5-phosphate; and, 3) epimerisation of ribulose 5-phosphate into D-xylulose 5- phosphate.
  • Suitable nucleotide sequences encoding arabinose isomerases, a ribulokinases and ribulose-5-P-4-epimerases may be obtained from Bacillus subtilis, Escherichia coli (see e.g.
  • EP 1 499 708 Lactobacilli, e.g. Escherichia coli (see e.g. Wisselink et al. supra; WO2008/041840), or species of Clavibacter, Arthrobacter and Gramella, of which preferably Clavibacter michiganensis, Arthrobacter aurescens and Gramella forsetii (see WO2009/01 1591 ).
  • the transformed host cell of the invention further preferably comprises xylulose kinase activity so that xylulose isomerised from xylose may be metabolised to pyruvate.
  • the yeast cell contains endogenous xylulose kinase activity.
  • a cell of the invention comprises a genetic modification that increases the specific xylulose kinase activity.
  • the genetic modification causes overexpression of a xylulose kinase, e.g. by overexpression of a nucleotide sequence encoding a xylulose kinase.
  • the gene encoding the xylulose kinase may be endogenous to the yeast cell or may be a xylulose kinase that is heterologous to the yeast cell.
  • a nucleotide sequence that may be used for overexpression of xylulose kinase in the yeast cells of the invention is e.g. the xylulose kinase gene from S. cerevisiae (XKS1) as described by Deng and Ho (1990, Appl. Biochem. Biotechnol. 24-25: 193-199).
  • xylulose kinase is a xylose kinase that is related to the xylulose kinase from Piromyces ⁇ xylB; see WO 03/0624430).
  • This Piromyces xylulose kinase is actually more related to prokaryotic kinase than to all of the known eukaryotic kinases such as the yeast kinase.
  • the eukaryotic xylulose kinases have been indicated as non-specific sugar kinases, which have a broad substrate range that includes xylulose.
  • xylulose kinases to which the Piromyces kinase is most closely related, have been indicated to be more specific kinases for xylulose, i.e. having a narrower substrate range.
  • a xylulose kinase to be overexpressed is overexpressed by at least a factor 1 .1 , 1 .2, 1 .5, 2, 5, 10 or 20 as compared to a strain which is genetically identical except for the genetic modification causing the overexpression. It is to be understood that these levels of overexpression may apply to the steady state level of the enzyme's activity, the steady state level of the enzyme's protein as well as to the steady state level of the transcript coding for the enzyme.
  • a cell of the invention further preferably comprises a genetic modification that increases the flux of the pentose phosphate pathway as described in WO 06/009434.
  • the genetic modification comprises overexpression of at least one enzyme of the (non-oxidative part) pentose phosphate pathway.
  • the enzyme is selected from the group consisting of the enzymes encoding for ribulose-5-phosphate isomerase, ribulose-5-phosphate 3-epimerase, transketolase and transaldolase.
  • a further preferred cell of the invention comprises a genetic modification that reduces unspecific aldose reductase activity in the yeast cell.
  • unspecific aldose reductase activity is reduced in the host cell by one or more genetic modifications that reduce the expression of or inactivates a gene encoding an unspecific aldose reductase.
  • the genetic modifications reduce or inactivate the expression of each endogenous copy of a gene encoding an unspecific aldose reductase that is capable of reducing an aldopentose, including, xylose, xylulose and arabinose, in the yeast cell's genome.
  • a given cell may comprise multiple copies of genes encoding unspecific aldose reductases as a result of di-, poly- or aneuploidy, and/or a cell may contain several different (iso)enzymes with aldose reductase activity that differ in amino acid sequence and that are each encoded by a different gene. Also in such instances preferably the expression of each gene that encodes an unspecific aldose reductase is reduced or inactivated.
  • the gene is inactivated by deletion of at least part of the gene or by disruption of the gene, whereby in this context the term gene also includes any non- coding sequence up- or down-stream of the coding sequence, the (partial) deletion or inactivation of which results in a reduction of expression of unspecific aldose reductase activity in the host cell.
  • a nucleotide sequence encoding an aldose reductase whose activity is to be reduced in the yeast cell of the invention and amino acid sequences of such aldose reductases are described in WO 06/009434 and include e.g. the (unspecific) aldose reductase genes of S. cerevisiae GRE3 gene (Traff et al., 2001 , Appl. Environm. Microbiol. 67: 5668-5674) and orthologues thereof in other species.
  • the yeast cell according to the invention may comprise further genetic modifications that result in one or more of the characteristics selected from the group consisting of (a) increased transport of xylose and/or arabinose into the yeast cell; (b) decreased sensitivity to catabolite repression; (c) increased tolerance to ethanol, osmolarity or organic acids; and, (d) reduced production of by-products.
  • By-products are understood to mean carbon-containing molecules other than the desired fermentation product and include e.g. xylitol, arabinitol, glycerol and/or acetic acid.
  • any genetic modification described herein may be introduced by classical mutagenesis and screening and/or selection for the desired mutant, or simply by screening and/or selection for the spontaneous mutants with the desired characteristics.
  • the genetic modifications may consist of overexpression of endogenous genes and/or the inactivation of endogenous genes.
  • Genes the overexpression of which is desired for increased transport of arabinose and/or xylose into the yeast cell are preferably chosen form genes encoding a hexose or pentose transporter.
  • Another preferred transporter for expression in yeast is the glucose transporter encoded by the P. stipitis SUT1 gene (Katahira et al., 2008, Enzyme Microb. Technol. 43: 1 15-1 19). Similarly orthologues of these transporter genes in other species may be overexpressed.
  • genes that may be overexpressed in the yeast cells of the invention include genes coding for glycolytic enzymes and/or ethanologenic enzymes such as alcohol dehydrogenases.
  • Preferred endogenous genes for inactivation include hexose kinase genes e.g. the S. cerevisiae HXK2 gene (see Diderich et al., 2001 , Appl. Environ. Microbiol. 67: 1587- 1593); the S. cerevisiae MIG1 or MIG2 genes; genes coding for enzymes involved in glycerol metabolism such as the S.
  • yeast cells of the invention are, in as far as possible, preferably introduced or modified by self-cloning genetic modification.
  • a preferred host cell according to the invention has the ability to grow on at least one of xylose and arabinose as carbon/energy source, preferably as sole carbon/energy source, and preferably under anaerobic conditions, i.e. conditions as defined herein below for anaerobic fermentation process.
  • the host cell when grown on xylose as carbon/energy source the host cell produces essentially no xylitol, e.g. the xylitol produced is below the detection limit or e.g. less than 5, 2, 1 , 0.5, or 0.3% of the carbon consumed on a molar basis.
  • the yeast cell when grown on arabinose as carbon/energy source, the yeast cell produces essentially no arabinitol, e.g. the arabinitol produced is below the detection limit or e.g. less than 5, 2, 1 , 0.5, or 0.3 % of the carbon consumed on a molar basis.
  • a preferred host cell of the invention has the ability to grow on at least one of a hexose, a pentose, glycerol, acetic acid and combinations thereof at a rate of at least 0.01 , 0.02, 0.05, 0.1 , 0.2, 0,25 or 0,3 h "1 under aerobic conditions, or, more preferably, at a rate of at least 0.005, 0.01 , 0.02, 0.05, 0.08, 0.1 , 0.12, 0.15 or 0.2 h "1 under anaerobic conditions.
  • the host cell has the ability to grow on at least one of xylose and arabinose as sole carbon/energy source at a rate of at least 0.01 , 0.02, 0.05, 0.1 , 0.2, 0,25 or 0,3 h "1 under aerobic conditions, or, more preferably, at a rate of at least 0.005, 0.01 , 0.02, 0.05, 0.08, 0.1 , 0.12, 0.15 or 0.2 h "1 under anaerobic conditions. More preferably, the host cell has the ability to grow on a mixture of a hexose (e.g.
  • the host cell has the ability to grow on a mixture of a hexose (e.g.
  • yeast species as host cells include S. cerevisiae, S. bulderi, S. barnetti, S. exiguus, S. uvarum, S. diastaticus, K. lactis, K. marxianus or K fragilis.
  • a yeast cell of the invention may be able to convert plant biomass, celluloses, hemicelluloses, pectins, rhamnose, galactose, frucose, maltose, maltodextrines, ribose, ribulose, or starch, starch derivatives, sucrose, lactose and glycerol, for example into fermentable sugars.
  • a cell of the invention may express one or more enzymes such as a cellulase (an endocellulase or an exocellulase), a hemicellulase (an endo- or exo-xylanase or arabinase) necessary for the conversion of cellulose into glucose monomers and hemicellulose into xylose and arabinose monomers, a pectinase able to convert pectins into glucuronic acid and galacturonic acid or an amylase to convert starch into glucose monomers.
  • a cellulase an endocellulase or an exocellulase
  • hemicellulase an endo- or exo-xylanase or arabinase
  • an amylase to convert starch into glucose monomers.
  • the yeast cell further preferably comprises those enzymatic activities required for conversion of pyruvate to a desired fermentation product, such as ethanol, butanol, lactic acid, 3 -hydroxy- propionic acid, acrylic acid, acetic acid, succinic acid, citric acid, fumaric acid, malic acid, itaconic acid, an amino acid, 1 ,3- propane-diol, ethylene, glycerol, a ⁇ - lactam antibiotic or a cephalosporin.
  • a desired fermentation product such as ethanol, butanol, lactic acid, 3 -hydroxy- propionic acid, acrylic acid, acetic acid, succinic acid, citric acid, fumaric acid, malic acid, itaconic acid, an amino acid, 1 ,3- propane-diol, ethylene, glycerol, a ⁇ - lactam antibiotic or a cephalosporin.
  • a preferred cell of the invention is a cell that is naturally capable of alcoholic fermentation, preferably, anaerobic alcoholic fermentation.
  • a cell of the invention preferably has a high tolerance to ethanol, a high tolerance to low pH (i.e. capable of growth at a pH lower than about 5, about 4, about 3, or about 2.5) and towards organic acids like lactic acid, acetic acid or formic acid and/or sugar degradation products such as furfural and hydroxy- methylfurfural and/or a high tolerance to elevated temperatures.
  • any of the above characteristics or activities of a cell of the invention may be naturally present in the yeast cell or may be introduced or modified by genetic modification.
  • a cell of the invention may be a cell suitable for the production of ethanol.
  • a cell of the invention may, however, be suitable for the production of fermentation products other than ethanol.
  • Such non-ethanolic fermentation products include in principle any bulk or fine chemical that is producible by a eukaryotic microorganism such as a yeast or a filamentous fungus.
  • the fermentation process is preferably run at a temperature that is optimal for the yeast cell.
  • the fermentation process is performed at a temperature which is less than about 42°C, preferably less than about 38°C.
  • the fermentation process is preferably performed at a temperature which is lower than about 35, about 33, about 30 or about 28°C and at a temperature which is higher than about 20, about 22, or about 25°C.
  • the ethanol yield on xylose and/or glucose in the process preferably is at least about 50, about 60, about 70, about 80, about 90, about 95 or about 98%.
  • the ethanol yield is herein defined as a percentage of the theoretical maximum yield.
  • the invention also relates to a process for producing a fermentation product.
  • the fermentation processes may be carried out in batch, fed-batch or continuous mode.
  • a separate hydrolysis and fermentation (SHF) process or a simultaneous saccharification and fermentation (SSF) process may also be applied.
  • SHF hydrolysis and fermentation
  • SSF simultaneous saccharification and fermentation
  • a combination of these fermentation process modes may also be possible for optimal productivity.
  • the fermentation process according to the present invention may be run under aerobic and anaerobic conditions.
  • the process is carried out under micro- aerophilic or oxygen limited conditions.
  • An anaerobic fermentation process is herein defined as a fermentation process run in the absence of oxygen or in which substantially no oxygen is consumed, preferably less than about 5, about 2.5 or about 1 mmol/L/h, and wherein organic molecules serve as both electron donor and electron acceptors.
  • An oxygen-limited fermentation process is a process in which the oxygen consumption is limited by the oxygen transfer from the gas to the liquid.
  • the degree of oxygen limitation is determined by the amount and composition of the ingoing gasflow as well as the actual mixing/mass transfer properties of the fermentation equipment used.
  • the rate of oxygen consumption is at least about 5.5, more preferably at least about 6, such as at least 7 mmol/L/h.
  • a process of the invention comprises recovery of the fermentation product.
  • IMK006 cerevisiae IMK006, obtained by removing the KanMX marker from the gpdIA gpd2A strain RWB0094 (Guadalupe Medina et al., 2010) by expression of Cre recombinase (Guldener et al., 1996), was transformed with the Z.EL/2-bearing plasmid pRS405, linearized with BstEII (NEB, Massachusetts, USA), yielding strain IMX031.
  • Transformation of strain IMX031 with the L/R/ ⁇ 3-bearing mfrpF-expression plasmid pUDE43 yielded the prototrophic, gpcT mhpF-expressing strain IMZ160.
  • Plasmid(s) were isolated from S. cerevisiae IMZ333 with the Sigma GenElute plasmid miniprep kit (Sigma-Aldrich Chemie Gmbh, Kunststoff, Germany) according to manufacturer's instructions. Plasmids were transformed into £.
  • strain IMJ004 was constructed by transforming strain IMS343 with the original pUDE43 plasmid.
  • Strains IMZ380 and IMZ381 , and IMJ005 and IMJ006 were constructed by transforming pUDE043ev1 and pUDE043ev2 into the unevolved parent strain IMX031 and the evolved plasmid-cured strain IMS343, respectively.
  • Strain IMJ009 was constructed by transforming plasmid p426_GPD (URA3) into IMS343.
  • Shake flask cultivation was performed as described previously (Guadalupe Medina et al., 2010) using synthetic media (Verduyn et al., 1990b).
  • synthetic media with urea as the nitrogen source were used (Verduyn et al., 1990b).
  • Glucose and sorbitol were autoclaved separately at 1 10 °C and afterwards added to sterile synthetic medium according to their desired concentrations (2 g ⁇ 1 for glucose, and 1 M, 1 .5 M, and 2 M sorbitol).
  • Three parallel evolution experiments were performed by serial transfer in aerobic shake flasks.
  • Sequencing batch reactors were operated as described previously (Wisselink et al., 2009).
  • the medium vessels were prepared by autoclaving 18 I of demineralized water containing sugar (1 .1 1 M), and subsequently adding 2 I of 10-fold concentrated synthetic media containing acetic acid (20 g ⁇ 1 ), antifoam, ergosterol (0.1 g ⁇ 1 ) and Tween 80 (4.2 g ⁇ 1 ).
  • the pH of the 10-fold concentrated synthetic medium containing acetic acid was adjusted to pH 4.8 with KOH before autoclaving.
  • carbon dioxide concentrations in the exhaust gas were used to determine the moment to start a new batch.
  • a control routine was programmed in MFCS/win 3.0 (Sartorius AG, Gottingen, Germany) to initiate the switch to a new batch cycle. Fermenters were automatically emptied, leaving ca. 1 .5 ml of remaining culture volume, and refilled when the C0 2 % in the off gas reached 1 .2 %. When growth accelerated after the first three cycles, this threshold was gradually increased to 3.2 % C0 2 .
  • Single colony isolates were obtained by streaking a sample taken from the sequential batch reactors on synthetic media agar plates (1 % w/v) containing 1 M glucose as carbon source, 2 g ⁇ 1 acetic acid and anaerobic growth factors. The plates were placed under anaerobic environment in a BactronX anaerobic chamber (Shell Lab, Oregon, USA) and kept at 30 °C. After two transfers of single isolates to fresh agar plates, one colony was inoculated in 1 M glucose synthetic media for stock and named IMZ333. Before characterization in bioreactors, the evolved strains IMZ333 and IMJ006 were precultured anaerobically in synthetic media shake flasks with 1 M glucose as carbon source.
  • anaerobic sequential batch cultivation was performed on synthetic media supplemented with 2 g ⁇ 1 acetic acid and with 1 .0 M glucose as source of carbon and to increase osmolarity.
  • the sequential batch culture showed a continuously increasing specific growth rate until, after 187 sequential batch cultures, a specific growth rate of 0.13 h "1 was reached.
  • Glycerol which was not detected during the initial cycles, was detected in culture supernatants later in the evolution experiments, albeit at much lower levels than in cultures of the Gpd + reference strain grown under identical conditions (data not shown).
  • IMZ333 evolved gpdIA gpd2A mhpF. Spot assay experiments under aerobic and anaerobic conditions at 0.1 , 0.5 and 1 .0 M glucose confirmed that, in contrast to the parental strain S. cerevisiae IMZ160, the evolved strain IMZ333 was able to grow at a concentration of 1 M glucose, albeit slower than the Gpd + reference strain IME076 (Fig. 1 ).
  • IMZ333 was deposited on 7 May 2013 having deposit number CBS135134 at the Centraal Bureau voor Schimmelcultures, Uppsalalaan 8, 3584 CT UTRECHT, The Netherlands.
  • the evolved osmotolerant strain IMZ333 was not only able to grow at 1 M glucose, but also converted this sugar to ethanol at increased yields relative to a GPD1 GPD2 reference strain (1 1 and 15 % increases in cultures grown at 2 and 3 g ⁇ 1 acetic acid, respectively). Part of the increased ethanol yield arises from the elimination of glycerol formation (80 mM in the reference strain), which releases glucose that can be converted to additional ethanol.
  • This detoxifying effect may be particularly relevant when high initial acetate concentrations are prevented by gradual feeding, for example by simultaneous saccharification and fermentation or by fed-batch feeding of hydrolysates to yeast fermentation processes (Taherzadeh et al., 2001 ; Rudolf et al., 2005).
  • the evolved strain IMZ333 grew with a specific growth rate of 0.12 h "1 (Fig. 2A).
  • its parental strain IMZ160 did not grow during a 10 day incubation, while the Gpd + reference strain grew at 0.24 h "1 (Fig. 2B), which is in accordance with the better growth observed in the spot plate experiments (Fig. 1 ).
  • glycerol concentration in these cultures remained at least 10-fold lower than those observed in cultures of the Gpd + reference strain (7.4 ⁇ 0.37 g I "1 at 19.5 h) (Fig. 2A and 2B).
  • the concentration of glycerol measured at the end of the batch cultures supplemented with 3 g I "1 acetate (0.53 ⁇ 0.02 g I "1 at 93.6 h) was slightly lower than the concentration measured when 2 g I "1 acetate were used (Fig. 2).
  • Enzyme activity assays in cell extracts of strain IMZ333 confirmed that glycerol-3- phosphate dehydrogenase activity remained below the detection level of 0.002 ⁇ min "1 (mg protein) "1 .
  • the activity of acetylating acetaldehyde dehydrogenase in IMZ333 was 0.01 1 ⁇ 0.005 ⁇ mg protein "1 min "1 , which is not significantly different from the value previously observed for the non-evolved strain IMZ132 (0.020 ⁇ 0.004 ⁇ mg protein "1 min "1 (Guadalupe Medina et al., 2010)).
  • Glycerolipids are essential for the growth of S. cerevisiae and are formed by acylation of glycerol-3-phosphate (Racenis et al., 1992).
  • glycerolipids can also be obtained by acylation of dihydroxyacetone (DHAP) by the same G3P/DHAP acyltransferase, producing acyl-DHAP, which is later reduced to acyl-G3P by 1 -acyldihydroxyacetone-phosphate reductase (EC 1.1 .1 .101 ), encoded by AYR1 (Athenstaedt and Daum, 2000).
  • DHAP dihydroxyacetone
  • AYR1 1 -acyldihydroxyacetone-phosphate reductase
  • the evolved strain IMZ333 was mated with its osmosensitive ancestral strain IMX031 , after mating-type switching of the latter.
  • Interpretation of results from crossing and segregation requires that causal mutation(s) reside on the chromosomes rather than on plasmids and, secondly, that the evolved strain should contain the same plasmids as the ancestral strain to avoid random segregation of different plasmids in the spores.
  • a subset of ten plasmids isolated from IMZ333 was characterized by restriction analysis with Xmnl.
  • the first cross was performed with ancestral (IMK527) and evolved strains (IMS343) and osmotolerance was tested under aerobic conditions only.
  • the resulting diploid IMD01 1 was able to grow on a 1 M glucose plate, indicating that the causal mutation(s) conferring aerobic osmotolerance was (were) dominant.
  • Sporulation of this diploid strain revealed a 2:2 segregation of growth on 1 M glucose plates in 19 out of 19 tetrads, indicating that aerobic osmotolerance in the evolved strain is caused by a single mutation (assuming that there are no multiple, physically linked mutations).
  • the mating type of the MATa strain IMX031 was switched by transforming plasmid pHO (Herskowitz and Jensen, 1991 ; Sugawara and Haber, 2012) into this strain, and later diploidized and sporulated, yielding the MATa strain IMK527.
  • Sporulation was performed as described by Bahalul et al. (2010). Strains were inoculated in complex medium with 10 g ⁇ 1 acetate as carbon source. After incubation at 30°C for 24 h, cultures were washed and resuspended in sporulation medium (20 g ⁇ 1 potassium acetate). After 48 h at 30 °C, spore formation was checked microscopically.
  • a culture sample (1 mL) was incubated with 2 ⁇ zymolyase (1000 U ml "1 ) in a 200 ⁇ 0.5M sorbitol solution at 37 °C for 10 min.
  • Tetrad dissection on complex media plates with 20 g ⁇ 1 glucose was performed with a dissection microscope (Singer MSM System 300, Singer Instruments, Somerset, UK). Plates were incubated at 30 °C.
  • IMK527 (MATa) was crossed with haploid strains IMS343 (MATa) and IMZ333 (MATa) by streaking cultures over each other on selective synthetic medium agar plates containing G418 (100 mg ⁇ 1 ) on which only diploids could grow.
  • uracil (20 g ⁇ 1 ) was added to the medium. The resulting diploids were re-streaked and single colonies were isolated, yielding strain IMD01 1 (IMS343xlMK527) and IMD012 (IMZ333xlMK527).
  • IMK527 MATa
  • haploid strains IMS343 (MATa) and IMZ333 (MATa) by streaking cultures over each other on selective synthetic medium agar plates containing G418 (100 mg ⁇ 1 ) on which only diploids could grow.
  • uracil 20 g ⁇ 1
  • the resulting diploids were re-streaked and single colonies were isolated, yielding strain IMD01 1 (IMS343xlMK527) and IMD012 (IMZ333xlMK527).
  • the present application provides valuable information for experimental design towards improved osmotolerance.
  • the results indicate that mutations which confer osmotolerance under aerobic conditions are not necessarily sufficient to enable growth at high glucose concentrations in anaerobic cultures.
  • future evolution experiments should therefore preferably be performed under anaerobic conditions.
  • our results indicate that mutations on the mphF expression plasmid contributed to anaerobic osmotolerance. This result indicates that mutagenesis of mhpF and/or expression of other (variant) acetylating acetaldehyde dehydrogenase genes may contribute to osmotolerance in anaerobic cultures
  • GPD1 which encodes glycerol-3-phosphate dehydrogenase, is essential for growth under osmotic stress in Saccharomyces cerevisiae, and its expression is regulated by the high- osmolarity glycerol response pathway. Mol Cell Biol 14:4135-4144.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Mycology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Botany (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

Yeast cell that is genetically modified comprising: a) a deletion or disruption of one or more nucleotide sequence selected from the group of GPD1, GPD2, GPP1and GPP2 and b) presence of one or more heterologous nucleotide sequence encoding a NAD+- dependent acetylating acetaldehyde dehydrogenase (E.C. 1.2.1.10.), wherein the yeast cell has an osmotolerance of 0.5 OsM or more.

Description

GPD" YEAST STRAINS WITH IMPROVED OSMOTOLERANCE
Field of the invention
The present invention relates to metabolic engineering in microorganisms such as yeast. In particular the invention relates to GPD" yeast strains. The invention further relates to the processes wherein the engineered strains to produce fermentation product such as ethanol.
Background of the invention
Bioethanol production with Saccharomyces cerevisiae is the single largest fermentation process in industrial biotechnology with an annual global product volume of ca. 8.6 x 1010 litres (Renewable Fuels Association, 2012). This puts S. cerevisiae at the centre of a global research effort to improve its productivity, robustness under process conditions, substrate range and product yield (van Maris et al., 2006). Anaerobic fermentation of sugars to ethanol and C02 is a redox-neutral process. However, in anaerobic cultures of S. cerevisiae, an 'excess' of NADH is generated from biosynthetic reactions such as oxidative decarboxylations in amino-acid and lipid synthesis (van Dijken and Scheffers, 1986; Bakker et al., 2001 ). In anaerobic yeast cultures, this 'excess' NADH is reoxidized through glycerol formation via NADH-dependent reduction of dihydroxyacetone phosphate to glycerol-3-phosphate, which is subsequently dephosphorylated to glycerol. Glycerol production has been estimated to account for a loss of 4 % of the consumed sugar in industrial ethanol production (Nissen et al., 2000). Under tightly controlled laboratory growth conditions, where biomass yields are typically higher than in industrial yeast fermentation processes, this percentage can be as high as 10 % (Verduyn et al., 1990b; Nissen et al., 2000; Guadalupe Medina et al., 2010). Elimination of glycerol formation via metabolic engineering strategies has therefore attracted significant interest (Nevoigt and Stahl, 1997; Nissen et al., 2000; Guadalupe Medina et al., 2010; Jain et al., 201 1 ). In S. cerevisiae, deletion of the GPD1 and GPD2 genes encoding NAD+- dependent glycerol-3-phosphate dehydrogenase (EC 1 .1 .1.8) eliminates glycerol formation (Bjorkqvist et al., 1997). However, such a double deletion also completely blocks growth under anaerobic conditions unless an external electron acceptor for NADH reoxidation, such as acetoin or acetaldehyde, is provided (Scheffers, 1966; Bjorkqvist et al., 1997; Ansell et al., 1997).
A (yeast) strain or (yeast) cell wherein NAD+-dependent glycerol-3-phosphate dehydrogenase expression is reduced or eliminated is herein designated as "Gpd" (yeast) strain" or "Gpd" (yeast) cell". There was a recent proposal of a metabolic engineering strategy for eliminating glycerol production in anaerobic S. cerevisiae cultures that is based on the use of acetic acid, a common inhibitor present in plant biomass hydrolysates, as electron acceptor (Guadalupe Medina et al., 2010). This strategy encompasses expression of an (acetylating) acetaldehyde dehydrogenase (EC 1 .2.1 .10) m pF gene (EMBL: CAA70751 ) from Escherichia coli in a gpdIA gpd2A (Gpd") S. cerevisiae strain. After activation of acetate by S. cerevisiae acetyl-Coenzyme A synthetase (van den Berg et al., 1996), the resulting acetyl-Coenzyme A can be reduced to ethanol by the combined activity of the NADH-dependent acetylating acetaldehyde dehydrogenase and yeast alcohol dehydrogenases. Anaerobic growth of the resulting engineered yeast strain on glucose was coupled to acetate reduction, glycerol production was eliminated and the ethanol yield increased by 13 % relative to that of a GPD1 GPD2 (Gpd+) reference strain (Guadalupe Medina et al., 2010).
Glycerol formation is not only crucial for redox balancing in anaerobic cultures of wild-type S. cerevisiae but, as its main compatible solute, is also required for osmotolerance. Osmotolerance is essential in industrial ethanol production due to the high sugar concentrations present at the start of fermentation processes (Blomberg and Adler, 1989; Albertyn et al., 1994; Nevoigt and Stahl, 1997). The response of S. cerevisiae to high osmolarity is regulated by the High-Osmolarity Glycerol (HOG) pathway and involves not only intracellular glycerol accumulation but also regulation of other stress-related genes (Hohmann, 2002). The osmosensitivity of Gpd" strains of S. cerevisiae (Ansell et al., 1997) can be partly alleviated by introduction of sorbitol-6-P-dehydrogenase and mannitol-1 -P-dehydrogenase encoding genes. In such engineered strains, mannitol or sorbitol act as alternative compatible solutes, although growth rates are lower than in wild- type strains (Shen et al., 1999). Summary of the invention
It is therefore an object of the present invention to provide for yeasts that are capable of producing ethanol from acetic acid or acetate while retaining their abilities of fermenting hexoses (glucose, fructose, galactose, etc) as well as pentoses like xylose, and having sufficient osmotolerance as well as processes wherein these strains are used for the production of ethanol and/or other fermentation products. Another object is to provide strains that have an improved production of fermentation product.
One or more of the objects are attained according to the invention that provides a yeast cell that is genetically modified comprising: a) a deletion or disruption of one or more nucleotide sequence selected from the group of GPD1, GPD2, GPP1 and GPP2 and b) presence of one or more heterologous nucleotide sequence encoding a NAD+-dependent acetylating acetaldehyde dehydrogenase (E.C. 1 .2.1.10.), wherein the yeast cell has an osmotolerance of 0.5 OsM or more.
In an embodiment, the yeast cell comprises one or more heterologous nucleic acid sequences encoding an NAD+-dependent acetylating acetaldehyde dehydrogenase represented by SEQ ID NO: 2 or a functional homologue of SEQ ID NO: 2 having sequence identity of at least 40% with SEQ ID NO 2, wherein the NAD+-dependent acetylating acetaldehyde dehydrogenase has a mutation at position corresponding to D38 of SEQ ID NO: 2.
One or more of the above objects are attained according to the invention..
It is clear from the examples that according to the invention improved osmotolerance and improved fermentation product production (ethanol) may be attained.
Brief description of the drawings
Fig. 1 : Figure 1 shows the osmotolerance of evolved strain IMZ333 (evolved Gpd" ), ancestral strain IMZ160 (unevolved Gpd") and the reference strain IME076 (Gpd+). Spot assay experiments were performed on synthetic medium agar plates with 0.1 -1 .0 M glucose under aerobic and anaerobic conditions. Pictures were taken after 3 days (panel A) and 7 days (panel B) of incubation at 30 °C.
Fig. 2: Figure 2 shows the results of anaerobic batch cultivation of the evolved osmotolerant strain S. cerevisiae IMZ333 (evolved Gpd") and the reference strain IME076 (Gpd+) on synthetic medium with 1 M glucose. Both strains were grown at pH 5.0 and at 30 °C. Panel A: IMZ333, 2 g I"1 acetic acid. Panel B: I ME076, 2 g I"1 acetic acid. Panel C: IMZ333, 3 g Γ1 acetic acid. Symbols:▲ , Dry weight; ·, glucose; O, ethanol (not corrected for evaporation); ■, acetate; □, glycerol. Each graph represents values for one of two independent replicates, which differ less than 5% in growth kinetics.
Fig. 3: Figure 3 shows the analysis of the contributions of genomic and/or plasmid based mutations to the evolved osmotolerant phenotype of Gpd" S. cerevisiae. Aerobic (black bars) and anaerobic (grey-bars) shake-flask cultures were both incubated at 30 °C and at 200 rpm with an initial glucose concentration of 1 M. The optical density (OD 660 nm) was measured after 48 h for strains IME076 (Gpd+ with empty-vector p426_GPD) and IMZ333 (evolved Gpd" with evolved pUDE043 population) or after 72 h for strains IMJ004 (evolved Gpd" pUDE043), IMJ005 (evolved Gpd" and pUDE043ev1 ), IMJ006 (evolved Gpd" and pUDE043ev2) and IMJ009 (evolved Gpd" with empty-vector pRS426).
Brief description of the sequence listing
SEQ ID NO: 1 Escherichia coli acetaldehyde dehydrogenase, mhpF (DNA)
SEQ ID NO: 2 Escherichia coli acetaldehyde dehydrogenase, mhpF (protein) SEQ ID NO: 3 AAACGGGCACAACCTCAATG
SEQ ID NO: 4 GTGACCATGTTGACGTTCAG
SEQ ID NO: 5 GGCGGTGATGGTTGGCATTG
SEQ ID NO: 6 GGGAGGGCGTGAATGTAAGC
Sequences 3-6 are used as primers in resequencing (see example).
Detailed description of the invention
Throughout the present specification and the accompanying claims, the words "comprise" and "include" and variations such as "comprises", "comprising", "includes" and "including" are to be interpreted inclusively. That is, these words are intended to convey the possible inclusion of other elements or integers not specifically recited, where the context allows. The articles "a" and "an" are used herein to refer to one or to more than one (i.e. to one or at least one) of the grammatical object of the article. By way of example, "an element" may mean one element or more than one element. The invention relates to a yeast cell that is genetically modified comprising: a) a deletion or disruption of one or more nucleotide sequence selected from the group of GPD1, GPD2, GPP1 and GPP2 and b) presence of one or more heterologous nucleotide sequence encoding a NAD+-dependent acetylating acetaldehyde dehydrogenase (E.C. 1 .2.1.10.), wherein the yeast cell has an osmotolerance of 0.5 OsM or more. In an embodiment, the yeast cell has an osmotolerance of 1 .0 OsM or more.
Osmotolerance of the yeast cell is herein expressed as Osmolarity" as measured with the spot assay method disclosed in the examples. Osmolarity is defined as the concentration of a solution expressed in terms of osmotically active particles, or osmoles (osmol/L or OsM). Osmotically active particles are any solutes that contribute to a concentration gradient. These can be either intact, uncharged molecules or charged ions.
To convert between molarity and osmolarity, the following equation is used:
Molarity (mol/L) X # of particles/molecule = osmolarity (osmol/L)
For substance that can dissociate, such as NaCI, osmolarity is calculated by multiplication of molarity with the dissociation constant:
Molarity (mol/L) X dissociation constant = osmolarity (osmol/L or OsM)
The yeast cell according to the invention has an osmotolerance of 0.5 OsM or more, in embodiments 0.7 OsM or more or 1 .0 OsM or more, measured under anaerobic conditions after 3 days growth at 0.5M glucose (Fig. 1 ).
The osmotolerance is determined herein, as in the examples by spot assay, by spotting 5 μΙ of serial dilution of 106, 105, 104 cells ml"1 of exponentially growing cultures onto 0.1 , 0.5, and/or 1 M glucose synthetic media agar plates (1 % w/v). The plates are incubated at 30 °C under anaerobic and aerobic conditions for 7 days and pictures were taken after 3 and 7 days. The osmotolerance values are determined under anaerobic conditions after 3 days growth at 0.5M glucose (Fig. 1 ).
The osmotolerance may be confirmed by specific growth of the yeast cell as in examples, under anaerobic conditions at high (1 M) glucose concentration at the presence of acetate in a concentration of 2 g/l. Under these conditions strain IMZ333 has a specific growth rate 0.12 h"1 (Fig. 2).
Herein, acetaldehyde dehydrogenase or acetaldehyde dehydrogenase
(acetylating) (E.C. 1 .2.1 .10) is a protein that catalyses the following reaction (1 ): Acetaldehyde + CoA + NAD(+) = acetyl-CoA + NADH
Figure imgf000007_0001
"acetaldehyde dehydrogenase polypeptide", is also designated herein as "polypeptide acetaldehyde dehydrogenase" or "polypeptide". "Acetaldehyde dehydrogenase polypeptide polynucleotide", is herein a polynucleotide that encodes the acetaldehyde dehydrogenase polypeptide.
In an embodiment, the acetaldehyde dehydrogenase has at least 50% sequence identity with SEQ ID NO: 2, and wherein the polypeptide has acetaldehyde dehydrogenase activity. In an embodiment, the mutations at the positions corresponding to D38 may be a substitution with C, P, G, A, V, L, I, M, F, W,Y, H, S, T, N, Q, D, E, K, R or a deletion. X may be any aminoacid, X (2) means two X.
In an embodiment, the NAD+-dependent acetylating acetaldehyde dehydrogenase has the substitution D38N or D38Q, in particular D38N.
Herein mutations are indicated by one letter aminoacids and positions of these amino acids. For example, A6 herein indicates an amino acid (one letter code) at a certain position in SEQ ID NO: 2, here A (Alanine) at position 6 of the protein. A6 (L/N/Q/GA /I Y/S/E/K) indicates herein mutation of amino acid at a certain position, here A (Alanine) at position 6 of the protein is exchanged for any of L (Leucine), N (Asparagine), Q (Glutamine), G (Glycine), V (Valine), I (Isoleucine), Y (Tyrosine), S (Serine), E (Glutamic acid) or K (Lysine).
In an embodiment, the yeast cell is a yeast cell wherein the genome of the yeast cell comprises a mutation in at least one gene selected from the group of GPD1, GPD2, GPP1 and GPP2, which mutation may be a knock-out mutation, which knock-out mutation may be a complete deletion of at least one of said genes in comparison to the yeast cell's corresponding wild-type yeast gene.
The invention further relates to a polynucleotide encoding such polypeptide, a nucleic acid construct comprising the polynucleotide encoding the polypeptide and to a vector for the functional expression of a heterologous polypeptide in a yeast cell, said expression vector comprising a heterologous nucleic acid sequence operably linked to a promoter functional in the yeast cell and said heterologous nucleic acid sequence encoding a polypeptide having enzymatic activity for converting acetyl-Coenzyme A into acetaldehyde in (the cytosol of) said yeast cell, wherein said polypeptide preferably comprises a sequence according to SEQ ID NO: 2, having a mutation at position corresponding to D38 of SEQ ID NO: 2 or a functional homologue of any of said sequences and to a host cell transformed with the nucleic acid construct or with the vector above.
In an embodiment, the yeast cell is free of genes encoding NADH-dependent glycerol 3-phosphate dehydrogenases.
In an embodiment, the yeast cell comprises one or more nucleic acid sequences encoding an acetyl-Coenzyme A synthetase activity (EC 6.2.1 .1 ) and one or more nucleic acid sequences encoding NAD+-dependent alcohol dehydrogenase activity (EC 1 .1.1 .1 ).
In an embodiment, the yeast cell is selected from Saccharomycetaceae, in particular from the group of Saccharomyces, such as Saccharomyces cerevisiae; Kluyveromyces, such as Kluyveromyces marxianus; Pichia, such as Pichia stipitis or Pichia angusta; Zygosaccharomyces, such as Zygosaccharomyces bailii; and Brettanomyces, such as Brettanomyces intermedius, Issachenkia, such as Issachenkia orientalis.
In an embodiment, the yeast cell is the Saccharomyces cerevisiae strain IMZ333 deposited on 7 May 2013 having deposit number CBS135134 at the Centraal Bureau voor Schimmelcultures, Uppsalalaan 8, 3584 CT UTRECHT, The Netherlands.
The invention further relates to a process for the production of an osmotolerant yeast cell comprising the following steps:
a) producing a first yeast strain starting from a host yeast strain by deleting or disrupting one or more NAD-dependent glycerol-3-phosphate encoding gene;
b) growing the first yeast strain under aerobic growth conditions in the presence of one or more solute;
wherein optionally step b) is repeated on an isolate of previous step b); c) isolating a second yeast strain from a culture of step b);
d) growing the second yeast strain under anaerobic growth conditions in the presence of acetic acid or acetate and one or more solute;
wherein optionally step d) is repeated on an isolate of previous step d); e) isolating an osmotolerant yeast cell from step d), wherein, one or more NAD+-dependent acetylating acetaldehyde dehydrogenase gene is introduced into the host yeast strain, or into any yeast strain isolated in any of steps a), b) and c), and the resulting strain is returned to that step.
In step a), the first yeast strain is produced starting from a host yeast strain by deleting or disrupting one or more NAD-dependent glycerol-3-phosphate encoding gene. In an embodiment of step a) the first yeast strain is produced starting from a host yeast strain by deleting or disrupting one or more NAD-dependent glycerol-3-phosphate encoding gene and by introducing one or more NAD+-dependent acetylating acetaldehyde dehydrogenase gene.
In step b) the first yeast strain is grown under aerobic growth conditions in the presence of one or more solute.
The solute may herein be chosen from the group consisting of salt, sugar, protein, RNA and sugar. Any salt that provides sufficient osmotic pressure for the yeast may be used as solute. Suitable examples of salts are sodium chloride and potassium chloride. Any sugar that provides sufficient osmotic pressure for the yeast may be used as solute. Suitable examples of sugars are glucose, xylose or arabinose, mannose, sorbitol. In an embodiment, the solute comprises one or more sugars that cannot be metabolized by the yeast cells, for example sorbitol.
In a preferred embodiment step b) is repeated on an isolate of previous step b). For example, in a batch reactor, once the first yeast strain is grown under aerobic growth conditions in the presence of one or more solute in the batch reactor, when sufficient growth has occurred (e.g. because all fermentable sugar is consumed) an isolate, for instance a single colony isolate may be taken from culture in the reactor and that isolate may be used to seed a new batch. In an embodiment, the concentration of solute may be higher in the new batch. This may be repeated until an isolate is obtained that has sufficient osmotolerance. This strain can be used in step c).
If the NAD+-dependent acetylating acetaldehyde dehydrogenase gene was not introduced into the yeast cell in a previous step, it may be introduced in step b).
In step c) a yeast strain, (the second yeast strain) is isolated from a culture of step b). If the NAD+-dependent acetylating acetaldehyde dehydrogenase gene was not introduced into the yeast cell in a previous step, it may be introduced in step c).
In step d) the second yeast strain is grown under anaerobic growth conditions in the presence of acetic acid or acetate and one or more solute.
Anaerobic growth conditions are herein anaerobic or oxygen limited. Anaerobic is here defined as a growth process run in the absence of oxygen or in which substantially no oxygen is consumed, preferably less than about 5, about 2.5 or about 1 mmol/L/h, and wherein organic molecules serve as both electron donor and electron acceptors.
An oxygen-limited growth process is a process in which the oxygen consumption is limited by the oxygen transfer from the gas to the liquid. The degree of oxygen limitation is determined by the amount and composition of the ingoing gasflow as well as the actual mixing/mass transfer properties of the fermentation equipment used. Preferably, in a process under oxygen-limited conditions, the rate of oxygen consumption is at least about 5.5, more preferably at least about 6, such as at least 7 mmol/L/h. A process of the invention comprises recovery of the fermentation product.
In step d) similar solutes and solute conditions, such as concentration may be used as in step b). Acetic acid or acetate (both herein considered equivalent and for both "acetate" may be used) is added in step d). Ratio of acetic acid/.acetate will depend on pH. The concentration of acetate in step d) may be chosen similar to the concentration the yeast strain meets in its end use (e.g. in fermentation of lignocellulosic hydrolysate.to fermentation product, such hydrolyate may contain 1 -10 g/l acetate, e.g. 2 g/l acetate.
The growing process in step b) and d) may also be called adaptive evolution herein. In an embodiment, the adaptive evolution may be conducted by growth of cultures in sequential batch reactors. In an embodiment, in the sequential batch reactors, concentration of solute may sequentially be increased. For example in a first series of batches the concentration may be 0.5 OsM solute (e.g. sorbitol), in a second series of batches the concentration may be 1 .0 OsM solute and in a third series of batches the concentration may be 2.0 OsM solute. Cells will be able to grow since they will gradually adapt to higher osmolarity. In step d), acetic acid (or acetate) is added, since this is necessary for growth under anaerobic conditions. In an embodiment, the yeast cells may be cultivated in repeated batches by repeated replacement of the culture with fresh medium with increased concentration of one or more solute chosen from the group consisting of salt, sugar, protein, RNA and sugar. Also herein the concentration of solute may be increased gradually.
The molarity of the solute may be 1 M or more. The molality may be 1 osM or more.
Molality is defined as the number of moles per liter of solution (mol/L or M). The weight of a mole is equal to the atomic mass or molecular weight of the substance, expressed in grams (gram molecular weight). Molecular weight is obtained by adding the atomic weights of each atom in the molecule. The term Molality herein is the number of moles of solute in 1 Kg of solvent (not total solution). Osmotolerance of the yeast cell is herein expressed as Osmolarity" as measured with the spot assay method disclosed in the examples. Osmolarity is defined as the concentration of a solution expressed in terms of osmotically active particles, or osmoles (osmol/L or OsM). Osmotically active particles are any solutes that contribute to a concentration gradient. These can be either intact, uncharged molecules or charged ions. To convert between molarity and osmolarity, the following equation is used:
Molarity (mol/L) X # of particles/molecule = osmolarity (osmol/L)
For substance that can dissociate, such as NaCI, osmolarity is calculated by multiplication of molarity with the dissociation constant:
Molarity (mol/L) X dissociation constant = osmolarity (osmol/L or OsM)
The yeast cell according to the invention has an osmotolerance of 0.5 OsM or more, in embodiments 0.7 OsM or more or 1 .0 OsM or more, measured under anaerobic conditions after 3 days growth at 0.5M glucose (Fig. 1 ).
The osmotolerance of a strain is determined herein, as in the examples by spot assay, by spotting 5 μΙ of serial dilution of 106, 105, 104 cells ml"1 of exponentially growing cultures onto 0.1 , 0.5, and/or 1 M glucose synthetic media agar plates (1 % w/v). The plates are incubated at 30 °C under anaerobic and aerobic conditions for 7 days and pictures were taken after 3 and 7 days. The osmotolerance values are determined under anaerobic conditions after 3 days growth at 0.5M glucose (Fig. 1 ).
The osmotolerance may be supported by specific growth of the yeast cell as in examples, under anaerobic conditions at high (1 M) glucose concentration at the presence of acetate in a concentration of 2 g/l. Under these conditions strain IMZ333 has a specific growth rate 0.12 h"1 (Fig. 2).
The invention further relates to the use of a yeast cell according to the invention for the preparation of fermentation product, preferably ethanol. The invention further raltes to a rocess for preparing fermentation product, comprising preparing fermentation product from acetate and from a fermentable carbohydrate - in particular a carbohydrate selected from the group of glucose, fructose, sucrose, maltose, xylose, arabinose, galactose and mannose - which preparation is carried out under anaerobic conditions using a yeast cell according to the invention. In an embodiment, the preparation is carried out in a fermentation medium comprising the acetate and the carbohydrate in a molar ratio is 0.7 or less, in particular at least 0.004 to 0.5, more in particular 0.05 to 0.3. In an embodiment of the preparation of fermentation product, at least part of the carbohydrate and at least part of the acetate has been obtained by hydrolysing a polysaccharide selected from the group of lignocelluloses, celluloses, hemicelluloses, and pectins. The lignocellulose is preferably lignocellulosic biomass that has been hydrolysed thereby obtaining the fermentable carbohydrate and acetate.
In an embodiment, the ligno-cellulosic or hemi-cellulosic material is contacted with an enzyme composition, wherein one or more sugar is produced, and wherein the produced sugar is fermented to give a fermentation product, wherein the fermentation is conducted with a yeast cell according to the invention.
The fermentation product of the invention may be any useful product. In one embodiment, it is a product selected from the group consisting of ethanol, n-butanol, isobutanol, lactic acid, 3-hydroxy-propionic acid, acrylic acid, acetic acid, succinic acid, adipic acid, fumaric acid, malic acid, itaconic acid, maleic acid, citric acid, adipic acid, an amino acid, such as lysine, methionine, tryptophan, threonine, and aspartic acid, 1 ,3- propane-diol, ethylene, glycerol, a β-lactam antibiotic and a cephalosporin, vitamins, pharmaceuticals, animal feed supplements, specialty chemicals, chemical feedstocks, plastics, solvents, fuels, including biofuels and biogas or organic polymers, and an industrial enzyme, such as a protease, a cellulase, an amylase, a glucanase, a lactase, a lipase, a lyase, an oxidoreductases, a transferase or a xylanase.
In an embodiment, the fermentation product may be one or more of ethanol, butanol, lactic acid, a plastic, an organic acid, a solvent, an animal feed supplement, a pharmaceutical, a vitamin, an amino acid, an enzyme or a chemical feedstock.
Advantageously, when in accordance with the invention ethanol is produced, it is produced in a molar ratio of glycerohethanol of less than 0.04:1 , in particular of less than 0.02:1 , preferably of less than 0.01 :1 . Glycerol production may be absent (undetectable), although at least in some embodiments (wherein NADH-dependent glycerol synthesis is reduced yet not completely prohibited) some glycerol may be produced as a side product, e.g. in a ratio glycerol to ethanol of 0.001 :1 or more.
The present invention allows complete elimination of glycerol production, or at least a significant reduction thereof, by providing a recombinant yeast cell, in particular S. cerevisiae, such that it can reoxidise NADH by the reduction of acetic acid to ethanol via NADH-dependent reactions.
This is not only advantageous in that glycerol production is avoided or at least reduced, but since the product formed in the re-oxidation of NADH is also the desired product, namely ethanol, a method of the invention may also offer an increased product yield (determined as the wt.% of converted feedstock, i.e. carbohydrate plus acetic acid, that is converted into ethanol). Since acetic acid is generally available at significant amounts in lignocellulosic hydrolysates, this makes the present invention particularly advantageous for the preparation of ethanol using lignocellulosic biomass as a source for the fermentable carbohydrate. Further, carbohydrate sources that may contain a considerable amount of acetate include sugar beet molasses (hydrolysates of) and starch containing (e.g. waste products from corn dry milling processes , from corn wet milling processes; from starch wastes processes , e.g. with stillage recycles). The invention contributes to a decrease of the levels of the inhibiting compound acetic acid and a larger fraction of the hydrolysate actually becomes a substrate for the production of the ethanol. Good results have been achieved with a yeast cell without noticeable enzymatic activity needed for the NADH-dependent glycerol synthesis, as illustrated in the example. However, the inventors contemplate that also a yeast cell according to the invention having NADH-dependent glycerol synthesis activity may advantageously be used for, e.g., ethanol production. It is contemplated that such cell can use acetate to re-oxidise at least part of the NADH. Thereby the acetate may compete with the NADH-dependent glycerol synthesis pathway and thus potentially reduce the glycerol synthesis. Moreover, acetate present in a feedstock used for the production of ethanol, such as a lignocellulosic hydrolysate, can be converted into ethanol, thereby increasing product yield, preferred cell according to the invention is free of enzymatic activity needed for the NADH-dependent glycerol synthesis or has a reduced enzymatic activity with respect to the NADH- dependent biochemical pathway for glycerol synthesis from a carbohydrate compared to its corresponding wild-type yeast cell. A reduced enzymatic activity can be achieved by modifying one or more genes encoding a NAD-dependent glycerol 3-phosphate dehydrogenase activity (GPD) or one or more genes encoding a glycerol phosphate phosphatase activity (GPP), such that the enzyme is expressed considerably less than in the wild-type or such that the gene encoded a polypeptide with reduced activity. Such modifications can be carried out using commonly known biotechnological techniques, and may in particular include one or more knock-out mutations or site-directed mutagenesis of promoter regions or coding regions of the structural genes encoding GPD and/or GPP. Alternatively, yeast strains that are defective in glycerol production may be obtained by random mutagenesis followed by selection of strains with reduced or absent activity of GPD and/or GPP. S. cerevisiae GPD1, GPD2, GPP1 and GPP2 genes are shown in WO201 1010923, and are disclosed in SEQ ID NO: 24-27. Preferably at least one gene encoding a GPD or at least one gene encoding a GPP is entirely deleted, or at least a part of the gene is deleted that encodes a part of the enzyme that is essential for its activity. In particular, good results have been achieved with a S. cerevisiae cell, wherein the open reading frames of the GPD1 gene and of the GPD2 gene have been inactivated. Inactivation of a structural gene (target gene) can be accomplished by a person skilled in the art by synthetically synthesizing or otherwise constructing a DNA fragment consisting of a selectable marker gene flanked by DNA sequences that are identical to sequences that flank the region of the host cell's genome that is to be deleted. In particular, good results have been obtained with the inactivation of the GPD1 and GPD2 genes in Saccharomyces cerevisiae by integration of the marker genes kanMX and hphMX4. Subsequently this DNA fragment is transformed into a host cell. Transformed cells that express the dominant marker gene are checked for correct replacement of the region that was designed to be deleted, for example by a diagnostic polymerase chain reaction or Southern hybridization. As indicated above, a cell according to the invention comprises a heterologous nucleic acid sequence encoding an NADC- dependent, acetylating acetaldehyde dehydrogenase (EC 1 .2.1.10). This enzyme catalyses the conversion of acetyl-Coenzyme A to acetaldehyde. This conversion can be represented by the equilibrium reaction formula: acetyl-Coenzyme A + NADH + H+ <-> acetaldehyde + NAD+ + Coenzyme A.
Thus, this enzyme allows the re-oxidation of NADH when acetyl-Coenzyme A is generated from acetate present in the growth medium, and thereby glycerol synthesis is no longer needed for redox cofactor balancing. The nucleic acid sequence encoding the NADC-dependent acetylating acetaldehyde dehydrogenase may in principle originate from any organism comprising a nucleic acid sequence encoding said dehydrogenase.
Known NAD+-dependent acetylating acetaldehyde dehydrogenases that can catalyse the NADH-dependent reduction of acetyl-Coenzyme A to acetaldehyde may in general be divided in three types of NADC-dependent acetylating acetaldehyde dehydrogenase functional homologues:
1 ) Bifunctional proteins that catalyse the reversible conversion of acetyl-Coenzyme A to acetaldehyde, and the subsequent reversible conversion of acetaldehyde to ethanol. An example of this type of proteins is the AdhE protein in E.coli (Gen Bank No: NP-415757). AdhE appears to be the evolutionary product of gene fusion. The NH2- terminal region of the AdhE protein is highly homologous to aldehyde:NADC oxidored uctases, whereas the COOH-terminal region is homologous to a family of Fe2+- dependent ethanohNADC oxidoreductases (Membrillo-Hernandez et al., (2000) J. Biol. Chem. 275: 33869-33875). The E. co// AdhE is subject to metal- catalyzed oxidation and therefore oxygen-sensitive (Tamarit et al. (1998) J. Biol. Chem. 273:3027-32).
2) Proteins that catalyse the reversible conversion of acetyl-Coenzyme A to acetaldehyde in strictly or facultative anaerobic micro-organisms but do not possess alcohol dehydrogenase activity. An example of this type of proteins has been reported in Clostridium kluyveri (Smith et al. (1980) Arch. Biochem. Biophys. 203: 663-675). An acetylating acetaldehyde dehydrogenase has been annotated in the genome of Clostridium kluyveri DSM 555 (GenBank No: EDK331 16). A homologous protein AcdH is identified in the genome of Lactobacillus plantarum (GenBank No: NP-784141 ). Another example of this type of proteins is the said gene product in Clostridium beijerinckii NRRL B593 (Toth et al. (1999) Appl. Environ. Microbiol. 65: 4973-4980, GenBank No: AAD31841 ).
3) Proteins that are part of a bifunctional aldolase-dehydrogenase complex involved in 4- hydroxy-2-ketovalerate catabolism. Such bifunctional enzymes catalyze the final two steps of the meta-cleavage pathway for catechol, an intermediate in many bacterial species in the degradation of phenols, toluates, naphthalene, biphenyls and other aromatic compounds (Powlowski and Shingler (1994) Biodegradation 5, 219-236). 4-Hydroxy-2- ketovaleraties first converted by 4-hydroxy- 2-ketovalerate aldolase to pyruvate and acetaldehyde, subsequently acetaldehyde is converted by acetylating acetaldehyde dehydrogenase to acetyl-CoA. An example of this type of acetylating acetaldehyde dehydrogenase is the DmpF protein in Pseudomonas sp CF600 (GenBank No: CAA43226) (Shingler et al. (1992) J. Bacteriol. 174:71 1 -24). The £. coli MphF protein (Ferrandez et al. (1997) J. Bacteriol. 179: 2573- 2581 , GenBank No: NP-414885) is homologous to the DmpF protein in Pseudomonas sp. CF600.
A suitable nucleic acid sequence may in particular be found in an organism selected from the group of Escherichia, in particular E. coli; Mycobacterium, in particular Mycobacterium marinum, Mycobacterium ulcerans, Mycobacterium tuberculosis; Carboxydothermus, in particular Carboxydothermus hydrogenoformans; Entamoeba, in particular Entamoeba histolytica; Shigella, in particular Shigella sonnei; Burkholderia, in particular Burkholderia pseudomallei, Klebsiella, in particular Klebsiella pneumoniae; Azotobacter, in particular Azotobacter uinelandii; Azoarcus sp; Cupriauidus, in particular Cupriauidus taiwanensis; Pseudomonas, in particular Pseudomonas sp. CF600; Pelomaculum, in particular Pelotomaculum thermopropionicum. Preferably, the nucleic acid sequence encoding the NADCdependent acetylating acetaldehyde dehydrogenase originates from Escherichia, mote preferably from E. coii.
Particularly suitable is an mhpF gene from E. coii, or a functional homologue thereof. This gene is described in Ferrandez et al. (1997) J. Bacteriol. 179:2573-2581. Good results have been obtained with S. cereuisiae, wherein an mhpF gene from E. coii has been incorporated.
In a further advantageous embodiment the nucleic acid sequence encoding an (acetylating) acetaldehyde dehydrogenase is from, in particular Pseudomonas.
dmpF from Pseudomonas sp. CF600.
In principle, the nucleic acid sequence encoding the NAD+-dependent, acetylating acetaldehyde dehydrogenase may be a wild type nucleic acid sequence. A preferred nucleic acid sequence encodes the NAD+-dependent, acetylating acetaldehyde dehydrogenase represented by SEQ ID NO: 2, SEQ ID NO: 29 in WO201 1010923, or a functional homologue of SEQ ID NO: 2 or SEQ ID NO: 29. In particular the nucleic acid sequence comprises a sequence according to SEQ ID NO: 1. SEQ ID NO: 28 in WO201 1010923 or a functional homologue of SEQ ID NO: 1 or SEQ ID NO: 28 in WO201 1010923.
Further, an acetylating acetaldehyde dehydrogenase (or nucleic acid sequence encoding such activity) may in for instance be selected from the group of Escherichia coii adhE, Entamoeba histolytica adh2, Staphylococcus aureus adhE, Piromyces sp.E2 adhE, Clostridium kluyveri EDK33116, Lactobacillus plantarum acdH, and Pseudomonas putida YP 001268189. For sequences of these enzymes, nucleic acid sequences encoding these enzymes and methodology to incorporate the nucleic acid sequence into a host cell, reference is made to WO 20091013159, in particular Example 3, Table 1 (page 26) and the Sequence ID numbers mentioned therein, of which publication Table 1 and the sequences represented by the Sequence ID numbers mentioned in said Table are incorporated herein by reference. Usually, a cell according to the invention also comprises an acetyl-Coenzyme A synthetase, which enzyme catalyses the formation of acetyl- coenzyme A from acetate. This enzyme may be present in the wild-type cell, as is for instance the case with S. cerevisiae which contains two acetyl-Coenzyme A synthetase isoenzymes encoded by the ACSI [SEQ ID NO: 171 and ACS2 [SEQ ID NO: 181 genes (van den Berg et a1 (1996) J. Biol. Chem. 271 :28953-28959), or a host cell may be provided with one or more heterologous gene(s) encoding this activity, e.g. the ACSI andlor ACS2 gene of S. cerevisiae or a functional homologue thereof may be incorporated into a cell lacking acetyl-Coenzyme A synthetase isoenzyme activity. Further, in particular in view of an efficient ethanol production, but also for an efficient NADH oxidation, it is preferred that the yeast cell comprises an NAD+ dependent alcohol dehydrogenase (EC 1 .1 .1.1 ). This enzyme catalyses the conversion of acetaldehyde into ethanol. The yeast cell may naturally comprise a gene encoding such a dehydrogenase, as is de case with S. cerevisiae (ADH1 -5) [SEQ ID NO: 19-23], see 'Lutstorf and Megnet. 1968 Arch. Biochem. Biophys. 126:933-944', or 'Ciriacy, 1975, Mutat. Res. 29:315-326'), or a host cell may be provided with one or more heterologous gene(s) encoding this activity, e.g. any or each of the ADH1 -5 genes of S. cerevisiae or functional homologues thereof may be incorporated into a cell lacking NAD+ dependent alcohol dehydrogenase activity.
An acetaldehyde dehydrogenase polypeptide of the invention may have one or more alternative and/or additional activities other than that of acetaldehyde dehydrogenase activity.
As set out above, an acetaldehyde dehydrogenase polypeptide of the invention will typically have acetylating acetaldehyde dehydrogenase activity. However, a acetaldehyde dehydrogenase polypeptide of the invention may have one or more of the activities set out above in addition to or alternative to that activity.
In a further preferred embodiment, the host cell of the invention has at least one of: a) the ability of isomerising xylose to xylulose; and, b) the ability to convert L-arabinose into D-xylulose 5-phosphate. For a) the yeast cell preferably has a functional exogenous xylose isomerase gene, which gene confers to the yeast cell the ability to isomerise xylose into xylulose. For b) the yeast cell preferably has functional exogenous genes coding for a L-arabinose isomerase, a L-ribulokinase and a L-ribulose-5-phosphate 4-epimerase, which genes together confers to the yeast cell the ability to isomerise convert L-arabinose into D-xylulose 5-phosphate.
Fungal host cells having the ability of isomerising xylose to xylulose as e.g. described in WO 03/0624430 and in WO 06/009434. The ability of isomerising xylose to xylulose is preferably conferred to the yeast cell by transformation with a nucleic acid construct comprising a nucleotide sequence encoding a xylose isomerase. Preferably the yeast cell thus acquires the ability to directly isomerise xylose into xylulose. More preferably the yeast cell thus acquires the ability to grow aerobically and/or anaerobically on xylose as sole energy and/or carbon source though direct isomerisation of xylose into xylulose (and further metabolism of xylulose). It is herein understood that the direct isomerisation of xylose into xylulose occurs in a single reaction catalysed by a xylose isomerase, as opposed to the two step conversion of xylose into xylulose via a xylitol intermediate as catalysed by xylose reductase and xylitol dehydrogenase, respectively.
Several xylose isomerases (and their amino acid and coding nucleotide sequences) that may be successfully used to confer to the yeast cell of the invention the ability to directly isomerise xylose into xylulose have been described in the art. These include the xylose isomerases of Piromyces sp. and of other anaerobic fungi that belongs to the families Neocallimastix, Caecomyces, Piromyces or Ruminomyces (WO 03/0624430), Cyllamyces aberensis (US 20060234364), Orpinomyces (Madhavan et al., 2008, DOI 10.1007/s00253-008-1794-6), the xylose isomerase of the bacterial genus Bacteroides, including e.g. B.thetaiotaomicron (WO 06/009434), B. fragilis, and B. uniformis (WO 09/109633), the xylose isomerase of the anaerobic bacterium Clostridium phytofermentans (Brat et al., 2009, Appl. Environ. Microbiol. 75:2304-231 1 ), and the xylose isomerases of Clostridium difficile, Ciona intestinales and Fusobacterium mortiferum (WO 10/074577).
Fungal host cells having the ability to convert L-arabinose into D-xylulose 5- phosphate as e.g. described in Wisselink et al. (2007, Appl. Environ. Microbiol. doi:10.1 128/AEM.00177-07) and in EP 1 499 708. The ability of to converting L-arabinose into D-xylulose 5-phosphate is preferably conferred to the yeast cell by transformation with a nucleic acid construct(s) comprising nucleotide sequences encoding a) an arabinose isomerase; b) a ribulokinase, preferably a L-ribulokinase a xylose isomerase; and c) a ribulose-5-P-4-epimerase, preferably a L-ribulose-5-P-4-epimerase. Preferably, in the yeast cells of the invention, the ability to convert L-arabinose into D-xylulose 5-phosphate is the ability to convert L-arabinose into D-xylulose 5-phosphate through the subsequent reactions of 1 ) isomerisation of arabinose into ribulose; 2) phosphorylation of ribulose to ribulose 5-phosphate; and, 3) epimerisation of ribulose 5-phosphate into D-xylulose 5- phosphate. Suitable nucleotide sequences encoding arabinose isomerases, a ribulokinases and ribulose-5-P-4-epimerases may be obtained from Bacillus subtilis, Escherichia coli (see e.g. EP 1 499 708), Lactobacilli, e.g. Escherichia coli (see e.g. Wisselink et al. supra; WO2008/041840), or species of Clavibacter, Arthrobacter and Gramella, of which preferably Clavibacter michiganensis, Arthrobacter aurescens and Gramella forsetii (see WO2009/01 1591 ).
The transformed host cell of the invention further preferably comprises xylulose kinase activity so that xylulose isomerised from xylose may be metabolised to pyruvate. Preferably, the yeast cell contains endogenous xylulose kinase activity. More preferably, a cell of the invention comprises a genetic modification that increases the specific xylulose kinase activity. Preferably the genetic modification causes overexpression of a xylulose kinase, e.g. by overexpression of a nucleotide sequence encoding a xylulose kinase. The gene encoding the xylulose kinase may be endogenous to the yeast cell or may be a xylulose kinase that is heterologous to the yeast cell. A nucleotide sequence that may be used for overexpression of xylulose kinase in the yeast cells of the invention is e.g. the xylulose kinase gene from S. cerevisiae (XKS1) as described by Deng and Ho (1990, Appl. Biochem. Biotechnol. 24-25: 193-199). Another preferred xylulose kinase is a xylose kinase that is related to the xylulose kinase from Piromyces {xylB; see WO 03/0624430). This Piromyces xylulose kinase is actually more related to prokaryotic kinase than to all of the known eukaryotic kinases such as the yeast kinase. The eukaryotic xylulose kinases have been indicated as non-specific sugar kinases, which have a broad substrate range that includes xylulose. In contrast, the prokaryotic xylulose kinases, to which the Piromyces kinase is most closely related, have been indicated to be more specific kinases for xylulose, i.e. having a narrower substrate range. In the yeast cells of the invention, a xylulose kinase to be overexpressed is overexpressed by at least a factor 1 .1 , 1 .2, 1 .5, 2, 5, 10 or 20 as compared to a strain which is genetically identical except for the genetic modification causing the overexpression. It is to be understood that these levels of overexpression may apply to the steady state level of the enzyme's activity, the steady state level of the enzyme's protein as well as to the steady state level of the transcript coding for the enzyme.
A cell of the invention further preferably comprises a genetic modification that increases the flux of the pentose phosphate pathway as described in WO 06/009434. In an embodiment, the genetic modification comprises overexpression of at least one enzyme of the (non-oxidative part) pentose phosphate pathway. Preferably the enzyme is selected from the group consisting of the enzymes encoding for ribulose-5-phosphate isomerase, ribulose-5-phosphate 3-epimerase, transketolase and transaldolase.
A further preferred cell of the invention comprises a genetic modification that reduces unspecific aldose reductase activity in the yeast cell. Preferably, unspecific aldose reductase activity is reduced in the host cell by one or more genetic modifications that reduce the expression of or inactivates a gene encoding an unspecific aldose reductase. Preferably, the genetic modifications reduce or inactivate the expression of each endogenous copy of a gene encoding an unspecific aldose reductase that is capable of reducing an aldopentose, including, xylose, xylulose and arabinose, in the yeast cell's genome. A given cell may comprise multiple copies of genes encoding unspecific aldose reductases as a result of di-, poly- or aneuploidy, and/or a cell may contain several different (iso)enzymes with aldose reductase activity that differ in amino acid sequence and that are each encoded by a different gene. Also in such instances preferably the expression of each gene that encodes an unspecific aldose reductase is reduced or inactivated. Preferably, the gene is inactivated by deletion of at least part of the gene or by disruption of the gene, whereby in this context the term gene also includes any non- coding sequence up- or down-stream of the coding sequence, the (partial) deletion or inactivation of which results in a reduction of expression of unspecific aldose reductase activity in the host cell. A nucleotide sequence encoding an aldose reductase whose activity is to be reduced in the yeast cell of the invention and amino acid sequences of such aldose reductases are described in WO 06/009434 and include e.g. the (unspecific) aldose reductase genes of S. cerevisiae GRE3 gene (Traff et al., 2001 , Appl. Environm. Microbiol. 67: 5668-5674) and orthologues thereof in other species.
In an embodiment, the yeast cell according to the invention may comprise further genetic modifications that result in one or more of the characteristics selected from the group consisting of (a) increased transport of xylose and/or arabinose into the yeast cell; (b) decreased sensitivity to catabolite repression; (c) increased tolerance to ethanol, osmolarity or organic acids; and, (d) reduced production of by-products. By-products are understood to mean carbon-containing molecules other than the desired fermentation product and include e.g. xylitol, arabinitol, glycerol and/or acetic acid. Any genetic modification described herein may be introduced by classical mutagenesis and screening and/or selection for the desired mutant, or simply by screening and/or selection for the spontaneous mutants with the desired characteristics. Alternatively, the genetic modifications may consist of overexpression of endogenous genes and/or the inactivation of endogenous genes. Genes the overexpression of which is desired for increased transport of arabinose and/or xylose into the yeast cell are preferably chosen form genes encoding a hexose or pentose transporter. In S. cerevisiae and other yeasts these genes include HXT1, HXT2, HXT3, HXT4, HXT5, HXT7 and GAL2, of which HXT7, HXT5 and GAL2 are most preferred (see Sedlack and Ho, Yeast 2004; 21 : 671-684). Another preferred transporter for expression in yeast is the glucose transporter encoded by the P. stipitis SUT1 gene (Katahira et al., 2008, Enzyme Microb. Technol. 43: 1 15-1 19). Similarly orthologues of these transporter genes in other species may be overexpressed. Other genes that may be overexpressed in the yeast cells of the invention include genes coding for glycolytic enzymes and/or ethanologenic enzymes such as alcohol dehydrogenases. Preferred endogenous genes for inactivation include hexose kinase genes e.g. the S. cerevisiae HXK2 gene (see Diderich et al., 2001 , Appl. Environ. Microbiol. 67: 1587- 1593); the S. cerevisiae MIG1 or MIG2 genes; genes coding for enzymes involved in glycerol metabolism such as the S. cerevisiae glycerol-phosphate dehydrogenase 1 and/or 2 genes; or (hybridising) orthologues of these genes in other species. Other preferred further modifications of host cells for xylose fermentation are described in van Maris et al. (2006, Antonie van Leeuwenhoek 90:391-418), WO2006/009434, WO2005/023998, WO2005/1 1 1214, and WO2005/091733. Any of the genetic modifications of the yeast cells of the invention as described herein are, in as far as possible, preferably introduced or modified by self-cloning genetic modification.
A preferred host cell according to the invention has the ability to grow on at least one of xylose and arabinose as carbon/energy source, preferably as sole carbon/energy source, and preferably under anaerobic conditions, i.e. conditions as defined herein below for anaerobic fermentation process. Preferably, when grown on xylose as carbon/energy source the host cell produces essentially no xylitol, e.g. the xylitol produced is below the detection limit or e.g. less than 5, 2, 1 , 0.5, or 0.3% of the carbon consumed on a molar basis. Preferably, when grown on arabinose as carbon/energy source, the yeast cell produces essentially no arabinitol, e.g. the arabinitol produced is below the detection limit or e.g. less than 5, 2, 1 , 0.5, or 0.3 % of the carbon consumed on a molar basis.
A preferred host cell of the invention has the ability to grow on at least one of a hexose, a pentose, glycerol, acetic acid and combinations thereof at a rate of at least 0.01 , 0.02, 0.05, 0.1 , 0.2, 0,25 or 0,3 h"1 under aerobic conditions, or, more preferably, at a rate of at least 0.005, 0.01 , 0.02, 0.05, 0.08, 0.1 , 0.12, 0.15 or 0.2 h"1 under anaerobic conditions. Therefore, preferably the host cell has the ability to grow on at least one of xylose and arabinose as sole carbon/energy source at a rate of at least 0.01 , 0.02, 0.05, 0.1 , 0.2, 0,25 or 0,3 h"1 under aerobic conditions, or, more preferably, at a rate of at least 0.005, 0.01 , 0.02, 0.05, 0.08, 0.1 , 0.12, 0.15 or 0.2 h"1 under anaerobic conditions. More preferably, the host cell has the ability to grow on a mixture of a hexose (e.g. glucose) and at least one of xylose and arabinose (in a 1 :1 weight ratio) as sole carbon/energy source at a rate of at least 0.01 , 0.02, 0.05, 0.1 , 0.2, 0,25 or 0,3 h"1 under aerobic conditions, or, more preferably, at a rate of at least 0.005, 0.01 , 0.02, 0.05, 0.08, 0.1 , 0.12, 0.15 or 0.2 h"1 under anaerobic conditions. Most preferably, the host cell has the ability to grow on a mixture of a hexose (e.g. glucose), at least one of xylose and arabinose and glycerol (in a 1 :1 :1 weight ratio) as sole carbon/energy source at a rate of at least 0.01 , 0.02, 0.05, 0.1 , 0.2, 0,25 or 0,3 h"1 under aerobic conditions, or, more preferably, at a rate of at least 0.005, 0.01 , 0.02, 0.05, 0.08, 0.1 , 0.12, 0.15 or 0.2 h"1 under anaerobic conditions. Over the years suggestions have been made for the introduction of various organisms for the production of bio-ethanol from crop sugars. In practice, however, all major bio-ethanol production processes have continued to use the yeasts of the genus Saccharomyces as ethanol producer. This is due to the many attractive features of Saccharomyces species for industrial processes, i. e. , a high acid-, ethanol-and osmo- tolerance, capability of anaerobic growth, and of course its high alcoholic fermentative capacity. Preferred yeast species as host cells include S. cerevisiae, S. bulderi, S. barnetti, S. exiguus, S. uvarum, S. diastaticus, K. lactis, K. marxianus or K fragilis.
A yeast cell of the invention may be able to convert plant biomass, celluloses, hemicelluloses, pectins, rhamnose, galactose, frucose, maltose, maltodextrines, ribose, ribulose, or starch, starch derivatives, sucrose, lactose and glycerol, for example into fermentable sugars. Accordingly, a cell of the invention may express one or more enzymes such as a cellulase (an endocellulase or an exocellulase), a hemicellulase (an endo- or exo-xylanase or arabinase) necessary for the conversion of cellulose into glucose monomers and hemicellulose into xylose and arabinose monomers, a pectinase able to convert pectins into glucuronic acid and galacturonic acid or an amylase to convert starch into glucose monomers.
The yeast cell further preferably comprises those enzymatic activities required for conversion of pyruvate to a desired fermentation product, such as ethanol, butanol, lactic acid, 3 -hydroxy- propionic acid, acrylic acid, acetic acid, succinic acid, citric acid, fumaric acid, malic acid, itaconic acid, an amino acid, 1 ,3- propane-diol, ethylene, glycerol, a β- lactam antibiotic or a cephalosporin.
A preferred cell of the invention is a cell that is naturally capable of alcoholic fermentation, preferably, anaerobic alcoholic fermentation. A cell of the invention preferably has a high tolerance to ethanol, a high tolerance to low pH (i.e. capable of growth at a pH lower than about 5, about 4, about 3, or about 2.5) and towards organic acids like lactic acid, acetic acid or formic acid and/or sugar degradation products such as furfural and hydroxy- methylfurfural and/or a high tolerance to elevated temperatures.
Any of the above characteristics or activities of a cell of the invention may be naturally present in the yeast cell or may be introduced or modified by genetic modification.
A cell of the invention may be a cell suitable for the production of ethanol. A cell of the invention may, however, be suitable for the production of fermentation products other than ethanol. Such non-ethanolic fermentation products include in principle any bulk or fine chemical that is producible by a eukaryotic microorganism such as a yeast or a filamentous fungus.
The fermentation process is preferably run at a temperature that is optimal for the yeast cell. Thus, for most yeasts or fungal host cells, the fermentation process is performed at a temperature which is less than about 42°C, preferably less than about 38°C. For yeast or filamentous fungal host cells, the fermentation process is preferably performed at a temperature which is lower than about 35, about 33, about 30 or about 28°C and at a temperature which is higher than about 20, about 22, or about 25°C.
The ethanol yield on xylose and/or glucose in the process preferably is at least about 50, about 60, about 70, about 80, about 90, about 95 or about 98%. The ethanol yield is herein defined as a percentage of the theoretical maximum yield.
The invention also relates to a process for producing a fermentation product.,
The fermentation processes may be carried out in batch, fed-batch or continuous mode. A separate hydrolysis and fermentation (SHF) process or a simultaneous saccharification and fermentation (SSF) process may also be applied. A combination of these fermentation process modes may also be possible for optimal productivity.
The fermentation process according to the present invention may be run under aerobic and anaerobic conditions. Preferably, the process is carried out under micro- aerophilic or oxygen limited conditions.
An anaerobic fermentation process is herein defined as a fermentation process run in the absence of oxygen or in which substantially no oxygen is consumed, preferably less than about 5, about 2.5 or about 1 mmol/L/h, and wherein organic molecules serve as both electron donor and electron acceptors.
An oxygen-limited fermentation process is a process in which the oxygen consumption is limited by the oxygen transfer from the gas to the liquid. The degree of oxygen limitation is determined by the amount and composition of the ingoing gasflow as well as the actual mixing/mass transfer properties of the fermentation equipment used. Preferably, in a process under oxygen-limited conditions, the rate of oxygen consumption is at least about 5.5, more preferably at least about 6, such as at least 7 mmol/L/h. A process of the invention comprises recovery of the fermentation product.
For the recovery of the fermentation product existing technologies are used. For different fermentation products different recovery processes are appropriate. Existing methods of recovering ethanol from aqueous mixtures commonly use fractionation and adsorption techniques. For example, a beer still can be used to process a fermented product, which contains ethanol in an aqueous mixture, to produce an enriched ethanol- containing mixture that is then subjected to fractionation (e.g., fractional distillation or other like techniques). Next, the fractions containing the highest concentrations of ethanol can be passed through an adsorber to remove most, if not all, of the remaining water from the ethanol.
All patent and literature references cited in the present specification are hereby incorporated by reference in their entirety.
The following examples are offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any way.
EXAMPLES
General molecular biology techniques
Unless indicated otherwise, the methods used are standard biochemical techniques. Examples of suitable general methodology textbooks include Sambrook et al., Molecular Cloning, a Laboratory Manual (1989) and Ausubel et al., Current Protocols in Molecular Biology (1995), John Wiley & Sons, Inc.
Strain construction and maintenance
All Saccharomyces cerevisiae strains used herein (Table 2) originate from the CEN.PK family (van Dijken et al., 2000; Entian and Kotter, 2007; Nijkamp et al., 2012). Stock cultures and precultures were grown as described previously (Guadalupe Medina et al., 2010). S. cerevisiae IMK006, obtained by removing the KanMX marker from the gpdIA gpd2A strain RWB0094 (Guadalupe Medina et al., 2010) by expression of Cre recombinase (Guldener et al., 1996), was transformed with the Z.EL/2-bearing plasmid pRS405, linearized with BstEII (NEB, Massachusetts, USA), yielding strain IMX031. Transformation of strain IMX031 with the L/R/\3-bearing mfrpF-expression plasmid pUDE43 (Guadalupe Medina et al., 2010) yielded the prototrophic, gpcT mhpF-expressing strain IMZ160. Plasmid(s) were isolated from S. cerevisiae IMZ333 with the Sigma GenElute plasmid miniprep kit (Sigma-Aldrich Chemie Gmbh, Munich, Germany) according to manufacturer's instructions. Plasmids were transformed into £. co// One Shot TOP10 Z-competent cells (Invitrogen, Paisley, UK) and transformants were selected on LB medium plates containing ampicillin (100 mg Γ1). Restriction analysis of isolated plasmids was done with Xmnl (Fermentas Gmbh, Germany). Plasmid sequencing was performed by BaseClear (Leiden, The Netherlands). L/R/\3-bearing plasmids were cured from strain IMZ333 by growth in complex medium with 20 g Γ1 glucose and subsequent selection on complex medium with 5-fluoro-orotic acid (5-FOA). A single colony was isolated on synthetic medium containing 20 g Γ1 glucose, 5-FOA (1 g Γ1) and uracil and named IMS343. Strain IMJ004 was constructed by transforming strain IMS343 with the original pUDE43 plasmid. Strains IMZ380 and IMZ381 , and IMJ005 and IMJ006 were constructed by transforming pUDE043ev1 and pUDE043ev2 into the unevolved parent strain IMX031 and the evolved plasmid-cured strain IMS343, respectively. Strain IMJ009 was constructed by transforming plasmid p426_GPD (URA3) into IMS343. Strains bearing plasmids with auxotrophic markers were plated on synthetic media (Verduyn et al., 1990b; Pronk, 2002) agar plates (1 % w/v) using 2 % w/v glucose as carbon source. Confirmation of correct genetic modification and transformations were performed as described earlier (Guadalupe Medina et al., 2010).
Shake flask cultivation
Shake flask cultivation was performed as described previously (Guadalupe Medina et al., 2010) using synthetic media (Verduyn et al., 1990b). For serial shake-flask cultivation, synthetic media with urea as the nitrogen source were used (Verduyn et al., 1990b). Glucose and sorbitol were autoclaved separately at 1 10 °C and afterwards added to sterile synthetic medium according to their desired concentrations (2 g Γ1 for glucose, and 1 M, 1 .5 M, and 2 M sorbitol). Three parallel evolution experiments were performed by serial transfer in aerobic shake flasks. 1 ml from a shake flask pre-culture of IMZ160 was used to inoculate a first shake flask containing 1 M sorbitol. Serial transfer was done with 1 ml inocula from shake flasks that had reached stationary phase. During the evolution experiment, increasing concentrations of sorbitol were used in 28 serial shake flasks: 4 at 1 M sorbitol, 8 at 1 .5 M sorbitol, and 16 at 2 M sorbitol. At the end of the evolution experiment, a sample of the evolved population was stored at -80 °C.
Anaerobic shake-flask cultures for inoculum or characterization were incubated in a BactronX anaerobic chamber (Shell Lab, Oregon, USA) at 30 °C and 200 rpm (Heidolph Unimax 2010 shaker).
Sequential batch reactors (SBR) and batch characterizations
Anaerobic bioreactor batch cultures, off-gas and metabolite analysis, enzymatic glycerol determination, optical density readings, determination of dry weight and enzymatic activity measurements for NAD+-dependent acetaldehyde dehydrogenase (acetylating) and glycerol 3-phosphate dehydrogenase were performed as described previously (Guadalupe Medina et al., 2010). All fermentations were carried out at least in duplicate. To correct for ethanol evaporation during cultivation in nitrogen sparged bioreactors, evaporation kinetics were analyzed as described previously (Guadalupe Medina et al., 2010).
Sequencing batch reactors were operated as described previously (Wisselink et al., 2009). The medium vessels were prepared by autoclaving 18 I of demineralized water containing sugar (1 .1 1 M), and subsequently adding 2 I of 10-fold concentrated synthetic media containing acetic acid (20 g Γ1), antifoam, ergosterol (0.1 g Γ1) and Tween 80 (4.2 g Γ1). The pH of the 10-fold concentrated synthetic medium containing acetic acid was adjusted to pH 4.8 with KOH before autoclaving. During sequential batch cultivation in bioreactors, carbon dioxide concentrations in the exhaust gas were used to determine the moment to start a new batch. A control routine was programmed in MFCS/win 3.0 (Sartorius AG, Gottingen, Germany) to initiate the switch to a new batch cycle. Fermenters were automatically emptied, leaving ca. 1 .5 ml of remaining culture volume, and refilled when the C02 % in the off gas reached 1 .2 %. When growth accelerated after the first three cycles, this threshold was gradually increased to 3.2 % C02.
Single colony isolates were obtained by streaking a sample taken from the sequential batch reactors on synthetic media agar plates (1 % w/v) containing 1 M glucose as carbon source, 2 g Γ1 acetic acid and anaerobic growth factors. The plates were placed under anaerobic environment in a BactronX anaerobic chamber (Shell Lab, Oregon, USA) and kept at 30 °C. After two transfers of single isolates to fresh agar plates, one colony was inoculated in 1 M glucose synthetic media for stock and named IMZ333. Before characterization in bioreactors, the evolved strains IMZ333 and IMJ006 were precultured anaerobically in synthetic media shake flasks with 1 M glucose as carbon source.
Spot assays experiments
Growth under high osmotic stress was assessed by spotting 5 μΙ of serial dilution of 106, 105, 104 cells ml"1 of exponentially growing cultures onto 0.1 , 0.5, and/or 1 M glucose synthetic media agar plates (1 % w/v). The plates were incubated at 30 °C under anaerobic and aerobic conditions for 7 days and pictures were taken after 3 and 7 days.
Example 1
Evolutionary engineering for improved osmotolerance
The ability of S. cerevisiae IMZ160 (gpdIA gpd2A mhpF) to grow at industrially relevant osmotic pressures was assessed with spot assays on synthetic medium plates containing 0.1 , 0.5 and 1 .0 M glucose. In line with previous research on Gpd" strains (Ansell et al., 1997), growth of strain IMZ160 was severely inhibited at 0.5 M glucose, both under aerobic and anaerobic conditions, and completely abolished at 1 .0 M glucose. Growth of the Gpd+ reference strain S. cerevisiae IME076 was not inhibited at these glucose concentrations (Fig. 1 ).
Evolutionary engineering for improved osmotolerance was initiated in shake-flask cultures with 20 g Γ1 glucose as the carbon source, supplemented with sorbitol to increase osmolarity. At an initial concentration of 1 .0 M sorbitol, the Gpd" strain IMZ160 showed a specific growth rate of 0.06 ± 0.00 h"1, as compared to 0.37 ± 0.00 h"1 for the Gpd+ reference strain IME076. After 4 serial transfers at 1 .0 M sorbitol, 8 transfers at 1 .5 M sorbitol and 16 transfers at 2.0 M sorbitol, the cultures showed a maximum specific growth rate of 0.18 ± 0.01 h"1 at 1 .0 M sorbitol and 0.15 ± 0.01 h"1 at 2.0 M sorbitol. To achieve anaerobic growth at 1 .0 M glucose, a shake-flask culture adapted to 2.0 M sorbitol was used as inoculum for an anaerobic bioreactor batch culture at low osmotic pressure. After 10 days, an anaerobic specific growth rate of 0.12 h"1 ± 0.00 was observed. Subsequently, anaerobic sequential batch cultivation was performed on synthetic media supplemented with 2 g Γ1 acetic acid and with 1 .0 M glucose as source of carbon and to increase osmolarity. Starting with an initial anaerobic specific growth rate of 0.05 h"1, the sequential batch culture showed a continuously increasing specific growth rate until, after 187 sequential batch cultures, a specific growth rate of 0.13 h"1 was reached. Glycerol, which was not detected during the initial cycles, was detected in culture supernatants later in the evolution experiments, albeit at much lower levels than in cultures of the Gpd+ reference strain grown under identical conditions (data not shown).
After 187 sequential batch cultures, individual single colony isolates were obtained, whose growth rates were analyzed in anaerobic batch cultures on synthetic glucose supplemented with 1.0 M glucose and 2 g Γ1 acetate. A single-colony isolate that exhibited the highest maximum specific growth rate of 0.12 ± 0.00 h"1 and the lowest final extracellular glycerol concentration of 0.64 ± 0.33 g Γ1 was named IMZ333 (evolved gpdIA gpd2A mhpF). Spot assay experiments under aerobic and anaerobic conditions at 0.1 , 0.5 and 1 .0 M glucose confirmed that, in contrast to the parental strain S. cerevisiae IMZ160, the evolved strain IMZ333 was able to grow at a concentration of 1 M glucose, albeit slower than the Gpd+ reference strain IME076 (Fig. 1 ).
IMZ333 was deposited on 7 May 2013 having deposit number CBS135134 at the Centraal Bureau voor Schimmelcultures, Uppsalalaan 8, 3584 CT UTRECHT, The Netherlands. The evolved osmotolerant strain IMZ333 was not only able to grow at 1 M glucose, but also converted this sugar to ethanol at increased yields relative to a GPD1 GPD2 reference strain (1 1 and 15 % increases in cultures grown at 2 and 3 g Γ1 acetic acid, respectively). Part of the increased ethanol yield arises from the elimination of glycerol formation (80 mM in the reference strain), which releases glucose that can be converted to additional ethanol. A further increase of the ethanol yield can be attributed to the slower growth and longer duration of the fermentation, which increases the fraction of sugar that is converted to ethanol by increasing the yeast cellular maintenance energy requirement (Verduyn et al., 1990a; Boender et al., 2009). Finally, additional ethanol is produced during the reduction of acetic acid, leading to maximal increases of 33 and 50 mM for the fermentations containing 2 and 3 g Γ1 respectively. The complete consumption of acetate in the cultures grown at 2 g Γ1 acetate (Fig. 2) illustrates that expression the acetylating acetaldehyde dehydrogenase strategy not only increases ethanol yields, but also enables the detoxification of significant amounts of inhibiting acetic acid. This detoxifying effect may be particularly relevant when high initial acetate concentrations are prevented by gradual feeding, for example by simultaneous saccharification and fermentation or by fed-batch feeding of hydrolysates to yeast fermentation processes (Taherzadeh et al., 2001 ; Rudolf et al., 2005).
Example 2
Growth and product formation in anaerobic batch cultures at high glucose concentrations.
To quantitatively characterize S. cerevisiae IMZ333 (evolved gpdIA gpd2A mhpF), this strain was grown in anaerobic bioreactors on synthetic medium supplemented with 2 g Γ1 acetic acid. At a glucose concentration of 20 g Γ1, the specific growth rate of strain IMZ333 was 0.20 h"1, which is significantly higher than that of the parental strain IMZ160 (0.14 h"1), but still lower than the Gpd+ reference strain IME076 (0.32 h"1). Under these conditions, no glycerol formation was observed for either IMZ333 or IMZ160, whereas the Gpd+ reference strain produced up to 1.75 ± 0.20 g Γ1 glycerol.
At an initial glucose concentration of 1 .0 M glucose, the evolved strain IMZ333 grew with a specific growth rate of 0.12 h"1 (Fig. 2A). Under identical conditions, its parental strain IMZ160 did not grow during a 10 day incubation, while the Gpd+ reference strain grew at 0.24 h"1 (Fig. 2B), which is in accordance with the better growth observed in the spot plate experiments (Fig. 1 ).
Growth of the evolved Gpd" strain IMZ333 was clearly coupled to the use of acetic acid as electron acceptor to reoxidize the excess NADH generated during growth (Fig. 2A). During the growth phase, no glycerol was formed by the Gpd" strain. Upon depletion of acetic acid, growth stopped and glucose consumption slowed down. Increasing the acetic acid concentration resulted in a continuation of glucose consumption and in drastically shortened fermentation times (Fig. 2C). When all glucose was consumed, low amounts of glycerol, up to 0.64 ± 0.33 g Γ1 at 182 h, appeared in the supernatant of cultures of the Gpd" strain IMZ333. However, the glycerol concentration in these cultures remained at least 10-fold lower than those observed in cultures of the Gpd+ reference strain (7.4 ± 0.37 g I"1 at 19.5 h) (Fig. 2A and 2B). The concentration of glycerol measured at the end of the batch cultures supplemented with 3 g I"1 acetate (0.53 ± 0.02 g I"1 at 93.6 h) was slightly lower than the concentration measured when 2 g I"1 acetate were used (Fig. 2). Enzyme activity assays in cell extracts of strain IMZ333 confirmed that glycerol-3- phosphate dehydrogenase activity remained below the detection level of 0.002 μηηοΙ min"1 (mg protein)"1. The activity of acetylating acetaldehyde dehydrogenase in IMZ333 was 0.01 1 ± 0.005 μηηοΙ mg protein"1 min"1, which is not significantly different from the value previously observed for the non-evolved strain IMZ132 (0.020 ± 0.004 μηηοΙ mg protein"1 min"1 (Guadalupe Medina et al., 2010)).
The ultimate goal of eliminating glycerol formation in anaerobic yeast cultures is to increase the ethanol yield on sugar. In the nitrogen-sparged anaerobic bioreactors, a significant amount of ethanol is lost through evaporation. Since ethanol loss via evaporation is time dependent, it will be higher for cultures with a lower specific growth rate (Guadalupe Medina et al., 2010). After correction for ethanol evaporation, the apparent ethanol yield on glucose of strain IMZ333 (1 .77 ± 0.09 mol rmol"1) was 1 1 % higher than that of the Gpd+ reference strain IME076 (1 .59 ± 0.02 mol mol"1) in cultures grown on 1 M glucose and 2 g I"1 acetic acid. At 3 g I"1 acetic acid, the apparent ethanol yield of IMZ333 further increased to 1 .84 ± 0.01 mol mol"1, which represents 92 % of the theoretical ethanol yield on glucose.
Even though both genes encoding glycerol-3-phosphate dehydrogenase were deleted and the enzymatic activity of glycerol-3-phosphate dehydrogenase was confirmed to be below the detection limit, low concentrations of glycerol were observed upon cessation of growth of the evolved strain IMZ333. Glycerolipids are essential for the growth of S. cerevisiae and are formed by acylation of glycerol-3-phosphate (Racenis et al., 1992). However, glycerolipids can also be obtained by acylation of dihydroxyacetone (DHAP) by the same G3P/DHAP acyltransferase, producing acyl-DHAP, which is later reduced to acyl-G3P by 1 -acyldihydroxyacetone-phosphate reductase (EC 1.1 .1 .101 ), encoded by AYR1 (Athenstaedt and Daum, 2000). Through this route Gpd" S. cerevisiae strains are able to form glycerolipids and grow. The low concentration of glycerol that was observed in the evolved Gpd" strain at the end of the fermentation, might be formed by deacylation of the glycerolipids and subsequently released when growth stopped and/or cells lysed.
Example 3
Mating of IMZ333 with the ancestral gpdIA gpd2A strain and analysis of segregants
Backcrossing and sporulation
To further investigate the evolved osmotolerant genotype, the evolved strain IMZ333 was mated with its osmosensitive ancestral strain IMX031 , after mating-type switching of the latter. Interpretation of results from crossing and segregation requires that causal mutation(s) reside on the chromosomes rather than on plasmids and, secondly, that the evolved strain should contain the same plasmids as the ancestral strain to avoid random segregation of different plasmids in the spores. A subset of ten plasmids isolated from IMZ333 was characterized by restriction analysis with Xmnl. This indicated that there are at least two types of plasmids in this strain: one that had lost the Xmnl restriction site in the TDH3 promoter upstream of the mhpF gene and a second that resembles the restriction pattern of the original pUDE043 plasmid. These plasmids were named pUDE043ev1 and pUDE043ev2 respectively. Reinserting these two plasmids and the original pUDE043 plasmid into a plasmid-free ancestral strain IMX031 and in the plasmid- cured evolved strain IMS343 indicated that causal mutations for aerobic osmotolerance were chromosomal, since only the evolved strain, transformed with either of the three plasmids, was able to grow aerobically on 1 M glucose plates. Further analysis showed that only the evolved strain with the reintroduced pUDE043ev2 was able to grow anaerobically, albeit at a lower specific growth rate of (0.07 ± 0.01 h"1), than the original evolved IMZ333 strain. This observation might indicate that anaerobic growth of the evolved strain on 1 M glucose required chromosomal as well as (a) plasmid-borne mutation(s) (Fig. 3). Sequencing of the mhpF gene on this plasmid revealed a point mutation at base pair position 1 12 of the open reading frame, resulting in an aminoacid change (D38N).
To prevent interference of plasmids in the backcross analysis, the first cross was performed with ancestral (IMK527) and evolved strains (IMS343) and osmotolerance was tested under aerobic conditions only. The resulting diploid IMD01 1 was able to grow on a 1 M glucose plate, indicating that the causal mutation(s) conferring aerobic osmotolerance was (were) dominant. Sporulation of this diploid strain revealed a 2:2 segregation of growth on 1 M glucose plates in 19 out of 19 tetrads, indicating that aerobic osmotolerance in the evolved strain is caused by a single mutation (assuming that there are no multiple, physically linked mutations). A cross between the ancestral strain IMK527 with the plasmid containing evolved strain IMZ333 resulted in a diploid strain IMD012 able to grow anaerobically on 1 M glucose, indicating that also the mutation(s) causing anaerobic osmotolerance was/were dominant.
To enable crossing, the mating type of the MATa strain IMX031 was switched by transforming plasmid pHO (Herskowitz and Jensen, 1991 ; Sugawara and Haber, 2012) into this strain, and later diploidized and sporulated, yielding the MATa strain IMK527. Sporulation was performed as described by Bahalul et al. (2010). Strains were inoculated in complex medium with 10 g Γ1 acetate as carbon source. After incubation at 30°C for 24 h, cultures were washed and resuspended in sporulation medium (20 g Γ1 potassium acetate). After 48 h at 30 °C, spore formation was checked microscopically. Prior to dissection, a culture sample (1 mL) was incubated with 2 μΙ zymolyase (1000 U ml"1) in a 200 μΙ 0.5M sorbitol solution at 37 °C for 10 min. Tetrad dissection on complex media plates with 20 g Γ1 glucose was performed with a dissection microscope (Singer MSM System 300, Singer Instruments, Somerset, UK). Plates were incubated at 30 °C. IMK527 (MATa) was crossed with haploid strains IMS343 (MATa) and IMZ333 (MATa) by streaking cultures over each other on selective synthetic medium agar plates containing G418 (100 mg Γ1) on which only diploids could grow. For auxotrophic diploids uracil (20 g Γ1) was added to the medium. The resulting diploids were re-streaked and single colonies were isolated, yielding strain IMD01 1 (IMS343xlMK527) and IMD012 (IMZ333xlMK527).
Plates were incubated at 30 °C. IMK527 (MATa) was crossed with haploid strains IMS343 (MATa) and IMZ333 (MATa) by streaking cultures over each other on selective synthetic medium agar plates containing G418 (100 mg Γ1) on which only diploids could grow. For auxotrophic diploids uracil (20 g Γ1) was added to the medium. The resulting diploids were re-streaked and single colonies were isolated, yielding strain IMD01 1 (IMS343xlMK527) and IMD012 (IMZ333xlMK527).
Sporulation and tetrad dissection of IMD01 1 and IMD012 were performed as described above. Dissected spores were replica plated on 1 M glucose synthetic medium agar plates to score for osmotolerant segregants. Plasmid sequencing
Single read (Sanger) sequencing was performed on the purified evolved plasmids by baseclear (Baseclear, leiden, The Netherlands) on the ABI3730XL sequencer (Life Technologies Ltd. Paisley, United Kingdom) using the following primers sequences: SEQ ID NO: 3: AAACGGGCACAACCTCAATG, SEQ ID NO: 4: GTGACCATGTTGACGTTCAG, SEQ ID NO: 5: GGCGGTGATGGTTGGCATTG, SEQ ID NO: 6: GGGAGGGCGTGAATGTAAGC.
The present application provides valuable information for experimental design towards improved osmotolerance. Firstly, the results indicate that mutations which confer osmotolerance under aerobic conditions are not necessarily sufficient to enable growth at high glucose concentrations in anaerobic cultures. In view of the envisaged application of strains in anaerobic bioethanol processes, future evolution experiments should therefore preferably be performed under anaerobic conditions. Secondly, our results indicate that mutations on the mphF expression plasmid contributed to anaerobic osmotolerance. This result indicates that mutagenesis of mhpF and/or expression of other (variant) acetylating acetaldehyde dehydrogenase genes may contribute to osmotolerance in anaerobic cultures
Table 2. Saccharomyces cerevisiae strains used in the examples.
Figure imgf000034_0001
Literature
Albertyn, J., Hohmann, S., Thevelein, J. M., and Prior, B. A. (1994) GPD1, which encodes glycerol-3-phosphate dehydrogenase, is essential for growth under osmotic stress in Saccharomyces cerevisiae, and its expression is regulated by the high- osmolarity glycerol response pathway. Mol Cell Biol 14:4135-4144.
Ansell, R., Granath, K., Hohmann, S., Thevelein, J. M., and Adler, L. (1997) The two isoenzymes for yeast NAD+-dependent glycerol 3-phosphate dehydrogenase encoded by GPD1 and GPD2 have distinct roles in osmoadaptation and redox regulation. EMBO J 16:2179-2187.
Athenstaedt, K., and Daum, G. (2000) 1 -Acyldihydroxyacetone-phosphate reductase (Ayrl p) of the yeast Saccharomyces cerevisiae encoded by the open reading frame YIL124w is a major component of lipid particles. J Biol Chem 275:235-240. Bahalul, M., Kaneti, G., and Kashi, Y. (2010) Ether-zymolyase ascospore isolation procedure: an efficient protocol for ascospores isolation in Saccharomyces cerevisiae yeast. Yeast 27:999-1003.
Bai, F. W., Anderson, W. A., and Moo-Young, M. (2008) Ethanol fermentation technologies from sugar and starch feedstocks. Biotechnol Adv 26:89-105.
Bakker, B. M., Overkamp, K. M., van Maris, A. J. A., Kotter, P., Luttik, M. A. H., Van Dijken, J. P., and Pronk, J. T. (2001 ) Stoichiometry and compartmentation of NADH metabolism in Saccharomyces cerevisiae. FEMS Microbiol Rev 25: 15-37.
Bjorkqvist, S., Ansell, R., Adler, L, and Liden, G. (1997) Physiological response to anaerobicity of glycerol-3-phosphate dehydrogenase mutants of Saccharomyces cerevisiae. AppI Environ Microbiol 63:128-132.
Blomberg, A., and Adler, L. (1989) Roles of glycerol and glycerol-3-phosphate dehydrogenase (NAD+) in acquired osmotolerance of Saccharomyces cerevisiae. J Bacteriol 171 :1087-1092.
Boender, L. G. M., de Hulster, E. A. F., van Maris, A. J. A., Daran-Lapujade, P. A. S., and Pronk, J. T. (2009) Quantitative physiology of Saccharomyces cerevisiae at near- zero specific growth rates. AppI Environ Microbiol 7 '5:5607 -5614.
Entian, K.D., and P. Kotter. 2007. Yeast genetic strain and plasmid collections. In Methods in Microbiology: Yeast Gene Analysis Second Edition. Stansfield I., and Stark M.J.R. (eds). Amsterdam: Academic Press, pp. 629-666.
Guadalupe Medina, V., Almering, M. J. H., van Maris, A. J. A., and Pronk, J. T. (2010) Elimination of glycerol production in anaerobic cultures of a Saccharomyces cerevisiae strain engineered to use acetic acid as an electron acceptor. AppI Environ Microbiol 76:190-195. Gijldener, U., Heck, S., Fiedler, T., Beinhauer, J., and Hegemann, J. H. (1996) A new efficient gene disruption cassette for repeated use in budding yeast. Nucleic Acids Res 24:2519-2524.
Herskowitz, I., and R.E.Jensen. 1991 . Putting the HO gene to work: Practical uses for mating-type switching. In Methods in Enzymology: Guide to Yeast Genetics and Molecular Biology. Guthrie C, and Fink G.R. (eds). Amsterdam: Academic Press, pp. 132-146.
Hohmann, S. (2002) Osmotic stress signaling and osmoadaptation in yeasts. Microbiol Mol Biol R 66:300-372.
Jain, V., Divol, B., Prior, B., and Bauer, F. (201 1 ) Elimination of glycerol and replacement with alternative products in ethanol fermentation by Saccharomyces cerevisiae. J Ind Microbiol Biot 38:1427-1435.
Jones, A. M., Thomas, K. C, and Ingledew, W. M. (1994) Ethanolic fermentation of blackstrap molasses and sugar cane juice using very high gravity technology. J Agric Food Chem 42:1242-1246.
Laluce, C. (1991 ) Current aspects of fuel ethanol production in Brazil. Crit Rev Biotechnol 11 :149-161.
Nevoigt, E., and Stahl, U. (1997) Osmoregulation and glycerol metabolism in the yeast Saccharomyces cerevisiae. FEMS Microbiol Rev 21 :231 -241 .
Nijkamp, J., van den Broek, M., Datema, E., de Kok, S., Bosman, L, Luttik, M., Daran-Lapujade, P., Vongsangnak, W., Nielsen, J., Heijne, W., Klaassen, P., Paddon, C, Piatt, D., Kotter, P., van Ham, R., Reinders, M., Pronk, J., de Ridder, D., and Daran, J. M. (2012) De novo sequencing, assembly and analysis of the genome of the laboratory strain Saccharomyces cerevisiae CEN.PK1 13-7D, a model for modern industrial biotechnology. Microb Cell Fact 11 :36. Nissen, T. L, Kielland-Brandt, M. C, Nielsen, J., and Villadsen, J. (2000) Optimization of ethanol production in Saccharomyces cerevisiae by metabolic engineering of the ammonium assimilation. Metab Eng 2:69-77.
Pronk, J. T. (2002) Auxotrophic yeast strains in fundamental and applied research. Appl Environ Microbiol 68:2095-2100.
Racenis, P. V., Lai, J. L, Das, A. K., Mullick, P. C, Hajra, A. K., and Greenberg, M. L. (1992) The acyl dihydroxyacetone phosphate pathway enzymes for glycerolipid biosynthesis are present in the yeast Saccharomyces cerevisiae. J Bacteriol 174:5702- 5710.
Renewable Fuels Association. (2012). World Fuel Ethanol Production [WWW document]. URL http://ethanolrfa.org/pages/World-Fuel-Ethanol-Production
Rudolf, A., Alkasrawi, M., Zacchi, G., and Liden, G. (2005) A comparison between batch and fed-batch simultaneous saccharification and fermentation of steam pretreated spruce. Enzyme Microb Technol 37:195-204.
Scheffers, W. A. (1966) Stimulation of fermentation in yeasts by acetoin and oxygen. Nature 210:533-534.
Shen, B., Hohmann, S., Jensen, R. G., and Bohnert, H. (1999) Roles of sugar alcohols in osmotic stress adaptation. Replacement of glycerol by mannitol and sorbitol in yeast. Plant Physiol 121 :45-52.
Sugawara, N., and J.Haber. 2012. Monitoring DNA Recombination Initiated by HO Endonuclease. In DNA Repair Protocols. Bjergbaek, L., editor New York: Humana Press, pp. 349-370.
Swinnen, S., Thevelein, J. M., and Nevoigt, E. (2012) Genetic mapping of quantitative phenotypic traits in Saccharomyces cerevisiae. FEMS Yeast Res 12:215-227. Taherzadeh, M., Millati, R., and Niklasson, C. (2001 ) Continuous cultivation of dilute-acid hydrolysates to ethanol by immobilized Saccharomyces cerevisiae. Appl Biochem Biotechnol 95:45-57. van den Berg, M. A., de Jong-Gubbels, P., Kortland, C. J., Van Dijken, J. P., Pronk, J. T., and Steensma, H. Y. (1996) The two acetyl-coenzyme A synthetases of Saccharomyces cerevisiae differ with respect to kinetic properties and transcriptional regulation. J Biol Chem 271 :28953-28959. van Dijken, J. P., Bauer, J., Brambilla, L, Duboc, P., Francois, J. M., Gancedo, C, Giuseppin, M. L. F., Heijnen, J. J., Hoare, M., Lange, H. C, Madden, E. A., Niederberger, P., Nielsen, J., Parrou, J. L, Petit, T., Porro, D., Reuss, M., Van Riel, N., Rizzi, M., Steensma, H. Y., Verrips, C. T., Vindel0v, J., and Pronk, J. T. (2000) An interlaboratory comparison of physiological and genetic properties of four Saccharomyces cerevisiae strains. Enzyme Microb Technol 26:706-714. van Dijken, J. P., and Scheffers, W. A. (1986) Redox balances in the metabolism of sugars by yeasts. FEMS Microbiol Rev 32:199-224. van Maris, A., Abbott, D., Bellissimi, E., van den Brink, J., Kuyper, M., Luttik, M., Wisselink, H., Scheffers, W., van Dijken, J. P., and Pronk, J. (2006) Alcoholic fermentation of carbon sources in biomass hydrolysates by Saccharomyces cerevisiae: current status. Antonie van Leeuwenhoek 90:391 -418.
Verduyn, C, Postma, E., Scheffers, W. A., and van Dijken, J. P. (1990a) Energetics of Saccharomyces cerevisiae in anaerobic glucose-limited chemostat cultures. J Gen Microbiol 136:405-412.
Verduyn, C, Postma, E., Scheffers, W. A., and Vandijken, J. P. (1990b) Physiology of Saccharomyces cerevisiae in anaerobic glucose-limited chemostat cultures. J Gen Microbiol 136:395-403. Wisselink, H. W., Toirkens, M. J., Wu, Q., Pronk, J. T., and van Maris, A. J. A. (2009) Novel evolutionary engineering approach for accelerated utilization of glucose, xylose, and arabinose mixtures by engineered Saccharomyces cerevisiae strains. AppI Environ Microbiol 75:907-914.

Claims

1. Yeast cell that is genetically modified comprising: a) a deletion or disruption of one or more nucleotide sequence selected from the group of GPD1, GPD2, GPP1 and GPP2 and b) presence of one or more heterologous nucleotide sequence encoding a NAD+-dependent acetylating acetaldehyde dehydrogenase (E.G. 1.2.1.10.), wherein the yeast cell has an osmotolerance of 0.5 OsM or more.
2. Yeast cell according to claim , wherein the yeast cell has an osmotolerance of 1 OsM or more.
3. Yeast cell according to claim 1 or 2, wherein the yeast cell comprises one or more heterologous nucleic acid sequences encoding an NAD+-dependent acetylating acetaldehyde dehydrogenase represented by SEQ ID NO: 2 or a functional hoimologue of SEQ ID NO: 2 having sequence identity of at least 60% with SEQ ID NO 2, wherein the NAD+-dependent acetylating acetaldehyde dehydrogenase has a mutation at position corresponding to D38 of SEQ ID NO: 2.
4. Yeast cell according to any of claims 1-3, wherein the NAD+-dependent acetylating acetaldehyde dehydrogenase has the substitution D38N or D38Q.
5. Yeast cell according to claim 4, wherein the NAD+-dependent acetylating acetaldehyde dehydrogenase has the substitution D38N.
6. Yeast cell according any of claims 1-5, wherein the yeast cell is free of genes encoding NADH-dependent glycerol 3-phosphate dehydrogenase.
7. Yeast cell according to any of the preceding claims, comprising one or more nucleic acid sequences encoding an acetyl-Coenzyme A synthetase activity (EC 6.2.1.1) and one or more nucleic acid sequences encoding NAD+-dependent alcohol dehydrogenase activity (EC 1.1.1.1).
8. Yeast cell according to any of the preceding claims, selected from Saccharomycetaceae, in particular from the group of Saccharomyces, such as Saccharomyces cerevisiae; Kluyveromyces, such as Kluyveromyces marxianus; Pichia, such as Pichia stipitis or Pichia angusta; Zygosaccharomyces, such as Zygosaccharomyces bailii; and Brettanomyces, such as Brettanomyces intermedius, Issachenkia, such as Issachenkia orientalis.
9. Yeast cell according to any of the preceding claims, wherein the yeast cell is of Saccharomyces cerevisiae strain IMZ333 deposited on 7 May 2013 having deposit number CBS135134 at the Centraal Bureau voor Schimmelcultures, Uppsalalaan 8, 3584 CT UTRECHT, The Netherlands.
10. Polypeptide having a mutation at a position corresponding to D38 of SEQ ID NO: 2, wherein the polypeptide has at least 50% sequence identity with SEQ ID NO: 2, and wherein the polypeptide has acetaldehyde dehydrogenase activity.
11. Polypeptide according to claim 16, wherein the polypeptide has the substitution D38N or D38Q, preferably D38N.
12. Polynucleotide encoding a polypeptide according to claim 10 or 11.
13. Nucleic acid construct comprising the polynucleotide of claim 12.
14. Host cell transformed with the nucleic acid construct of claim 13.
15. Use of a yeast cell according to any of claims 1-9 or claim 14 for the preparation of ethanol.
16. Process for preparing fermentation product, comprising preparing fermentation product from acetate and from a fermentable carbohydrate - in particular a carbohydrate selected from the group of glucose, fructose, sucrose, maltose, xylose, arabinose, galactose and mannose which preparation is carried out under anaerobic conditions using a yeast cell, according to any of claims 1-9 or claim 14.
17. Process according to claim 16, wherein the preparation is carried out in a fermentation medium comprising the acetate and the carbohydrate in a molar ratio is 0.7 or less, in particular at least 0.004 to 0.5, more in particular 0.05 to 0.3.
18. Process according to claim 16 or 17, wherein at least part of the carbohydrate and at least part of the acetate has been obtained by hydrolysing a polysaccharide selected from the group of lignocelluloses, celluloses, hemicelluloses, and pectins.
19. Process according to claim 18, wherein the lignocelluloses is lignocellulosic biomass that has been hydrolysed thereby obtaining the fermentable carbohydrate and acetate.
20. Process according to claim 19, wherein lignocellulosic or hemi-cellulosic material is contacted with an enzyme composition, wherein one or more sugar is produced, and wherein the produced sugar is fermented to give a fermentation product, wherein the fermentation is conducted with a transformed host cell of any of claims 1-9 or claim 14.
21. Process according to claim 20, wherein the fermentation product is one or more of ethanol, butanol, lactic acid, a plastic, an organic acid, a solvent, an animal feed supplement, a pharmaceutical, a vitamin, an amino acid, an enzyme or a chemical feedstock.
22. Process for the production of an osmotolerant yeast cell comprising the following steps:
a) producing a first yeast strain starting from a host yeast strain by deleting or disrupting one or more NAD-dependent glycerol-3-phosphate encoding gene and introducing one or more NAD+-dependent acetylating acetaldehyde dehydrogenase gene;
b) growing the first yeast strain under aerobic growth conditions in the presence of one or more solute;
wherein optionally step b) is repeated on an isolate of previous step b);
c) isolating a second yeast strain from a culture of step b);
d) growing the second yeast strain under anaerobic growth conditions in the presence of acetic acid or acetate and one or more solute;
wherein optionally step d) is repeated on an isolate of previous step d);
e) isolating an osmotolerant yeast cell from step d), wherein, prior to step d) one or more NAD+-dependent acetylating acetaldehyde dehydrogenase gene is introduced into the host yeast strain, or in any yeast strain isolated from steps a) or b).
23. Process according to claim 22 wherein the growth in step b) and d) is conducted by growth of cultures in sequential batch reactors with sequentially increasing concentration of one or more solute chosen from the group consisting of salt, sugar, protein, RNA and sugar.
24. Process according to claim 22 or 23, wherein cells are cultivated in repeated batches by repeated replacement of the culture with fresh medium with increased concentration of one or more solute chosen from the group consisting of salt, sugar, protein, RNA and sugar.
25. Process according to claim 24, wherein the solute comprises one or more sugars that cannot be metabolized by the yeast cells.
26. Process according to claim 25 wherein the solute comprises sorbitol.
PCT/EP2014/059193 2013-05-08 2014-05-06 Gpd- yeast strains with improved osmotolerance Ceased WO2014180820A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP13167002 2013-05-08
EP13167002.8 2013-05-08

Publications (2)

Publication Number Publication Date
WO2014180820A2 true WO2014180820A2 (en) 2014-11-13
WO2014180820A3 WO2014180820A3 (en) 2015-01-08

Family

ID=48236784

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2014/059193 Ceased WO2014180820A2 (en) 2013-05-08 2014-05-06 Gpd- yeast strains with improved osmotolerance

Country Status (2)

Country Link
AR (1) AR096233A1 (en)
WO (1) WO2014180820A2 (en)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016097202A1 (en) * 2014-12-19 2016-06-23 Dsm Ip Assets B.V. Fermentation process with improved glycerol and acetic acid conversion
WO2018220116A1 (en) 2017-05-31 2018-12-06 Novozymes A/S Xylose fermenting yeast strains and processes thereof for ethanol production
WO2019148192A1 (en) 2018-01-29 2019-08-01 Novozymes A/S Microorganisms with improved nitrogen utilization for ethanol production
CN112166188A (en) * 2018-03-27 2021-01-01 嘉吉有限公司 Methods for producing ethanol using engineered yeast
WO2021021458A1 (en) 2019-07-26 2021-02-04 Novozymes A/S Microorganisms with improved nitrogen transport for ethanol production
US11060056B2 (en) 2015-11-25 2021-07-13 Rajendra Surana Method of producing high amount of ethanol at high temperature by modified yeast strain Saccharomyces cerevisiae
CN116064266A (en) * 2022-11-01 2023-05-05 四川大学 Recombinant saccharomyces cerevisiae with enhanced salt stress resistance, and construction method and application thereof
CN116555062A (en) * 2023-03-17 2023-08-08 江南大学 Method for improving production of L-lactic acid by saccharomyces cerevisiae based on ethanol metabolic flow regulation and control

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2277989A1 (en) * 2009-07-24 2011-01-26 Technische Universiteit Delft Fermentative glycerol-free ethanol production

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11667935B2 (en) 2014-12-19 2023-06-06 Dsm Ip Assets B.V. Fermentation process for improved glycerol and acetic acid conversion
CN107109441A (en) * 2014-12-19 2017-08-29 帝斯曼知识产权资产管理有限公司 The fermentation process that glycerine and acetic acid conversion are improved
US10883122B2 (en) 2014-12-19 2021-01-05 Dsm Ip Assets B.V. Fermentation process for improved glycerol and acetic acid conversion
WO2016097202A1 (en) * 2014-12-19 2016-06-23 Dsm Ip Assets B.V. Fermentation process with improved glycerol and acetic acid conversion
EP3831950A1 (en) * 2014-12-19 2021-06-09 DSM IP Assets B.V. Fermentation process with improved glycerol and acetic acid conversion
US11060056B2 (en) 2015-11-25 2021-07-13 Rajendra Surana Method of producing high amount of ethanol at high temperature by modified yeast strain Saccharomyces cerevisiae
WO2018220116A1 (en) 2017-05-31 2018-12-06 Novozymes A/S Xylose fermenting yeast strains and processes thereof for ethanol production
WO2019148192A1 (en) 2018-01-29 2019-08-01 Novozymes A/S Microorganisms with improved nitrogen utilization for ethanol production
CN112166188A (en) * 2018-03-27 2021-01-01 嘉吉有限公司 Methods for producing ethanol using engineered yeast
CN112166188B (en) * 2018-03-27 2024-07-02 嘉吉有限公司 Method for producing ethanol using engineered yeast
WO2021021458A1 (en) 2019-07-26 2021-02-04 Novozymes A/S Microorganisms with improved nitrogen transport for ethanol production
CN116064266A (en) * 2022-11-01 2023-05-05 四川大学 Recombinant saccharomyces cerevisiae with enhanced salt stress resistance, and construction method and application thereof
CN116555062A (en) * 2023-03-17 2023-08-08 江南大学 Method for improving production of L-lactic acid by saccharomyces cerevisiae based on ethanol metabolic flow regulation and control
CN116555062B (en) * 2023-03-17 2023-10-27 江南大学 Methods for improving L-lactic acid production by Saccharomyces cerevisiae based on regulation of ethanol metabolic flow

Also Published As

Publication number Publication date
WO2014180820A3 (en) 2015-01-08
AR096233A1 (en) 2015-12-16

Similar Documents

Publication Publication Date Title
US11753659B2 (en) Glycerol and acetic acid converting yeast cells with improved acetic acid conversion
Demeke et al. Development of a D-xylose fermenting and inhibitor tolerant industrial Saccharomyces cerevisiae strain with high performance in lignocellulose hydrolysates using metabolic and evolutionary engineering
EP2069476B1 (en) Metabolic engineering of arabinose- fermenting yeast cells
JP5796925B2 (en) Metabolic engineering of xylose-fermenting eukaryotic cells
EP2250262B1 (en) A pentose sugar fermenting cell
US20100304454A1 (en) Novel arabinose-fermenting eukaryotic cells
EP2663645B1 (en) Yeast strains engineered to produce ethanol from glycerol
WO2014180820A2 (en) Gpd- yeast strains with improved osmotolerance
WO2009109631A1 (en) A pentose sugar fermenting cell
CN102482688A (en) Fermentative production of ethanol from glucose, galactose and arabinose using a recombinant yeast strain
WO2009109634A1 (en) A pentose sugar fermenting cell
EP2739729B1 (en) A pentose sugar fermenting cell
WO2009109630A1 (en) A pentose sugar fermenting cell
US11692187B2 (en) Xylose isomerases that confer efficient xylose fermentation capability to yeast
WO2014033019A1 (en) Yeast strains engineered to produce ethanol from acetate
DK2069476T3 (en) Metabolic MODIFICATION of arabinose-fermenting YEAST CELLS
WO2014033018A1 (en) Yeast strains engineered to produce ethanol from acetate

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14727413

Country of ref document: EP

Kind code of ref document: A2

122 Ep: pct application non-entry in european phase

Ref document number: 14727413

Country of ref document: EP

Kind code of ref document: A2