WO2014178649A1 - 골 형성 과정에서 인간 작은 류신 지퍼 단백질의 용도 - Google Patents

골 형성 과정에서 인간 작은 류신 지퍼 단백질의 용도 Download PDF

Info

Publication number
WO2014178649A1
WO2014178649A1 PCT/KR2014/003857 KR2014003857W WO2014178649A1 WO 2014178649 A1 WO2014178649 A1 WO 2014178649A1 KR 2014003857 W KR2014003857 W KR 2014003857W WO 2014178649 A1 WO2014178649 A1 WO 2014178649A1
Authority
WO
WIPO (PCT)
Prior art keywords
slzip
pparγ2
cells
protein
transcriptional activity
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2014/003857
Other languages
English (en)
French (fr)
Inventor
고제상
김정한
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Korea University Research and Business Foundation
Original Assignee
Korea University Research and Business Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Korea University Research and Business Foundation filed Critical Korea University Research and Business Foundation
Priority to US14/888,340 priority Critical patent/US9962425B2/en
Publication of WO2014178649A1 publication Critical patent/WO2014178649A1/ko
Anticipated expiration legal-status Critical
Priority to US15/945,858 priority patent/US10456446B2/en
Ceased legal-status Critical Current

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/08Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • A61P19/10Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease for osteoporosis
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • G01N33/5023Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects on expression patterns
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/46Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
    • G01N2333/47Assays involving proteins of known structure or function as defined in the subgroups

Definitions

  • the present invention relates to the use of human small leucine zipper proteins in osteoblast differentiation of mesenchymal stem cells.
  • mesenchymal stem cells have been used in various clinical trials, but for medical treatment, problems such as control of differentiation of mesenchymal stem cells have to be solved.
  • Adipocytes and osteoblasts are differentiated from mesenchymal stem cells, and this differentiation is regulated from transcription factors.
  • mesenchymal stem cells the balance of differentiation of osteoblasts and adipocytes is very important for recovery, regeneration and homeostasis. The failure of this mesenchymal stem cell differentiation balance causes problems such as degenerative arthritis and osteoporosis.
  • PPAR ⁇ 2 is expressed upon differentiation from mesenchymal stem cells to adipocytes and is involved in the regulation of adipocyte-related gene expression. Runx2 is also expressed during osteoblast differentiation and is involved in osteoblast-related gene expression. Therefore, it is very important to understand the regulation mechanism of transcription factor in adipocyte and osteoblast differentiation.
  • PPAR ⁇ belongs to the transcription factor PPAR family and includes PPAR ⁇ , PPAR ⁇ , and PPAR ⁇ .
  • PPAR ⁇ is a major regulator of lipogenesis, lipid biosynthesis, inflammation, and glucose metabolism, and is produced in two variants, PPAR ⁇ 1 and PPAR ⁇ 2 through alternative splicing.
  • PPAR ⁇ 2 contains 30 additional amino acids at the N-terminus than PPAR ⁇ 1, and is mainly expressed in macrophages and adipocytes, and partially expressed in bone marrow stromal cells.
  • PPAR ⁇ 1 is expressed in various tissues such as muscle, adipose tissue, and bone.
  • PPAR ⁇ binds to the peroxisome proliferator-activated response element (PPRE) DNA sequence and forms a heterologous complex with RXR. These factors are found in the CD36 promoter involved in ap2 and cholesterol transport, which are involved in lipid storage. PPAR ⁇ and RXR heterocomplexes bind to inhibitory complements such as HDAC, NCoR, and SMRT in the absence of ligand, and helpers such as P160 / SRC, PBP, PGC-1, CBP, etc. Is replaced by. Many transcription factors and ligands are involved in the regulation and expression of PPAR ⁇ .
  • PPRE peroxisome proliferator-activated response element
  • C / EBP directly binds to the PPAR ⁇ promoter to promote transcription
  • TZD a synthetic reagent such as prostaglandin J2, rosiglitazone, and pioglitazone, which is a natural PPAR ⁇ ligand, also increases PPAR ⁇ transcriptional activity.
  • RB and cyclin D1 inhibit the transcriptional activity of PPAR ⁇ .
  • LZIP is a member of the bZIP family and belongs to the CREB / ATF gene family.
  • LZIP has a basic DNA-binding domain and a leucine zipper domain, and binds to a cAMP-responsive element (CRE) and an AP-1 element.
  • CRE cAMP-responsive element
  • Human LZIP has been shown to be an HCF-1 binding protein and promotes cell proliferation and cellular transformation.
  • N-terminal 92 amino acids are strong transcriptional domains and contain two LxxLL-transcription helper binding motifs.
  • LZIP consists of five members: CREB3 (LZIP, Luman), CREB3L1 (OASIS), CREB3L2 (BBF2H7), CREB3L3 (CREB-H), and CREB3L4 (AIbZIP).
  • LZIP CREB3
  • Luman Luman
  • CREB3L1 OASIS
  • BBF2H7 CREB3L2
  • CREB3L3 CREB3L3
  • AIbZIP CREB3L4
  • LZIP an isoform of LZIP
  • sLZIP inhibits the transcriptional activity of the glucocorticoid receptor by activating HDACs without being involved in LKN-1 dependent cell migration.
  • the present inventors completed the present invention by studying the regulation mechanism of sLZIP that regulates the transcriptional activities of PPAR ⁇ and Runx2 in relation to the differentiation of osteoblasts and adipocytes in mesenchymal stem cells.
  • An object of the present invention is to identify the role of human small leucine-zipper protein (hereinafter referred to as sLZIP) in the differentiation of mesenchymal stem cells into osteoblasts, and use them as differentiation regulators of stem cells. To provide.
  • sLZIP human small leucine-zipper protein
  • Another object of the present invention to provide a preventive or therapeutic use of the sLZIP bone disease.
  • Still another object of the present invention is to provide a use of the sLZIP for the screening of a medicament for preventing or treating a bone disease.
  • the present invention provides a composition for promoting differentiation of mesenchymal stem cells into osteoblasts, including human small leucine-zipper protein as a differentiation regulator.
  • the present invention also provides a composition for the prevention or treatment of bone diseases comprising human small leucine zipper protein.
  • the present invention also provides the use of a human small leucine zipper protein for the preparation of a composition for preventing or treating bone diseases.
  • the present invention also provides a method for treating bone disease in an animal comprising administering to a subject a composition for preventing or treating bone disease comprising a pharmaceutically effective amount of a human small leucine zipper protein.
  • the present invention also provides a method for screening a medicament for preventing or treating a bone disease, comprising contacting a gene of a human small leucine zipper protein with a candidate outside the body, and determining whether the candidate promotes or inhibits the expression of the gene. To provide.
  • the present invention also provides a method for screening a medicament for preventing or treating bone diseases, comprising contacting a human small leucine zipper protein with a candidate outside the body, and determining whether the candidate enhances or inhibits the function or activity of the protein. To provide.
  • human small leucine zipper protein inhibits the transcriptional activity of PPAR ⁇ by increasing the binding of inhibitory complement and increases the transcriptional activity of Runx2 to balance the differentiation of adipocytes and osteoblasts in mesenchymal stem cells.
  • sLZIP small leucine zipper protein
  • sLZIP can be used for the treatment of bone diseases, such as dysplasia, osteoporosis, osteomalacia, or as a marker for the development of therapeutic drugs.
  • Figure 1 shows the effect on the transcriptional activity of PPAR ⁇ of sLZIP according to the present invention
  • a to C is a ligand of PPAR ⁇ 2 rosiglitazone (RZD) (A), pioglitazone (PZD) (B) and troglitazone (TZD) (C )
  • RZD rosiglitazone
  • PZD pioglitazone
  • TZD troglitazone
  • D is the result of measuring the transcriptional activity of PPAR ⁇ 2 by si-sLZIP
  • E is the differentiation of mesenchymal stem cells overexpressing sLZIP The result of measuring the transcriptional activity of PPAR ⁇ 2.
  • Figure 2 is a result of investigating the binding capacity of PPAR ⁇ of sLZIP according to the present invention, A and B in 293T cells transfected with GST-sLZIP and Myc-PPAR ⁇ 2 (A) and GST-PPAR ⁇ 2 and Flag-sLZIP (B)
  • the result of investigating the binding capacity of sLZIP and PPAR ⁇ 2 is the result of immunoblotting to measure the binding of His-sLZIP and PPAR ⁇ 2 using anti-PPAR ⁇ 2 and anti-His antibody
  • D is GFP expressed in C3H10T1 / 2 cells Nuclear localization of -PPAR ⁇ 2 and Flag-sLZIP.
  • Figure 3 shows the gene map and binding site analysis of sLZIP and PPAR ⁇ 2 according to the present invention, A is sLZIP, B is PPAR ⁇ 2.
  • Figure 4 shows the results of the role of HDAC3 in the inhibition of the transcriptional activity of PPAR ⁇ 2 by sLZIP according to the present invention
  • A is the effect of the transcriptional activity of PPAR ⁇ 2 after treatment with HDSA inhibitor TSA
  • B is the HDAC si-RNA PPAR ⁇ 2 transcriptional activity was inhibited after expression
  • C was the effect of PPAR ⁇ 2 transcriptional activity on HDAC3 overexpression
  • D was measured in the nucleus position of HDAC3 and sLZIP
  • E was HDAC3 according to GST pull-down analysis. This shows the combination of and sLZIP.
  • FIG. 5 shows the result of inhibition of PPAR ⁇ 2 induction of PPAR ⁇ 2 by sLZIP according to the present invention
  • A shows the binding of PPAR ⁇ 2 ligand dependent sLZIP and PPAR ⁇ 2
  • B shows the binding effect of sLZIP and PPAR ⁇ 2 according to the treatment of PPAR ⁇ 2 ligand according to time zones.
  • C represents the binding effect of HDAC3 and sLZIP, which are inhibitors of PPAR ⁇ 2 under PPAR ⁇ 2 ligand
  • D represents the binding effect of sLZIP, PPAR ⁇ 2 and HDAC3 complexes
  • E the binding effect of sLZIP, PPAR ⁇ 2 and HDAC3 complexes according to NCoR1 treatment
  • F The sLZIP deletion mutant was used to show the relationship between the regulatory mechanism of sLZIP and ligand-dependent binding to PPAR ⁇ 2.
  • A is the effect of sLZIP when binding between PPAR ⁇ 2 and HDAC3
  • B is ubiquitination result of HDAC3 by sLZIP
  • C is sLZIP The effect on PPAR ⁇ 2 helper is shown.
  • Figure 7 shows the modulating effect of Runx2 transcriptional activity of sLZIP according to the present invention
  • A is the effect of regulating Runx2 transcriptional activity of sLZIP
  • B is the effect of regulating Runx2 transcriptional activity of PPAR ⁇ 2 and sLZIP
  • C is Runx2 transcriptional activity of HDAC3 Regulatory effect
  • D to regulate the differentiation of sLZIP in mesenchymal stem cells and progenitor cells
  • E to regulate the differentiation of sLZIP in MEF cells
  • F to alkian blue of wild type and sLZIP TG mouse embryos of E17.5 days of age (For cartilage staining) and alizarin red (for bone staining) staining results are shown.
  • FIG. 8 is a result of identifying the role of sLZIP according to the present invention in the process of cartilage development, A and B after the treatment of sLZIP by the amount of chondrocytes RT-PCR (A) and real-time PCR (B) analysis results, C shows the sLZIP effect on cartilage development in embryos, and D shows the osteoclast differentiation effect of sLZIP.
  • Figure 9 is a schematic diagram showing the differentiation control effect of sLZIP in accordance with the present invention of mesenchymal stem cells.
  • the present invention relates to a composition for promoting differentiation from mesenchymal stem cells to osteoblasts comprising human small leucine zipper protein as a differentiation regulator.
  • sLZIP increased the transcriptional activity of Runx2 and increased the binding of inhibitory complement, thereby inhibiting the transcriptional activity of PPAR ⁇ 2, thereby increasing osteoblast differentiation and sLZIP transgenic mice.
  • the present invention was completed by confirming that the bone formation of sLZIP transgenic mice was increased in the experiments used.
  • sLZIP is an isoform of LZIP, which consists of 354 amino acids without transmembrane domains, and activates HDACs without involving LKN-1 dependent cell migration, thereby activating the transcriptional activity of the Glucocorticoid receptor. It is a protein that inhibits.
  • sLZIP is a differentiation regulator of mesenchymal stem cells that controls the differentiation balance of adipocytes and osteoblasts.
  • sLZIP inhibits PPAR ⁇ 2 transcriptional activity in a concentration dependent manner. Inhibition of the transcriptional activity of PPAR ⁇ 2 occurred by sLZIP binding directly to PPAR ⁇ 2. The binding of sLZIP and PPAR ⁇ 2 occurs in the nucleus.
  • various sLZIP deletion mutants such as N-terminal deletion mutants (1-228), C-terminal deletion mutants (229-354) and CC-terminal deletions Mutants (297-354) were generated and analyzed for PPAR binding domains.
  • PPAR ⁇ 2 The transcriptional activity of PPAR ⁇ is regulated by helpers and inhibitors, and in the resting state PPAR ⁇ 2 is known to bind inhibitory complexes such as HDAC3, SMRT and NCoR, so the effect of sLZIP on the transcriptional activity of PPAR ⁇ 2 by HDACs was investigated.
  • sLZIP inhibited the transcriptional activity of PPAR ⁇ 2
  • sLZIP did not reduce the PPAR ⁇ 2 transcriptional activity in cells treated with HDACs inhibitors. Inhibition of this PPAR ⁇ 2 transcriptional activity was limited to HDAC3 in class 1 HDACs.
  • sLZIP binds to HDAC3, which indicates that sLZIP binds to HDAC3 and negatively regulates the transcriptional activity of PPAR ⁇ 2.
  • Inhibitor complement complexes are replaced by helper upon binding of nuclear receptors and ligands.
  • sLZIP binds to PPAR ⁇ 2 in the absence of ligand, but in a time-dependent manner in the presence of ligand. It was isolated from PPAR ⁇ 2.
  • LZIP contains an N-terminal active domain (1-220) and has been reported to be involved in the transcriptional activity of cAMP-responsive elements (CREs) -containing reporter genes, and sLZIP, an isoform of LZIP, binds to PPAR ⁇ 2.
  • CREs cAMP-responsive elements
  • sLZIP enhances binding between PPAR ⁇ 2 and HDAC3 in the presence of ligand, but PPAR ⁇ 2 binds to inhibitors such as HDAC3 in the absence of ligand, and the addition of PPAR ⁇ 2 ligand results in the separation of the PPAR ⁇ -inhibitory complement complex resulting in ubiquitin / proteosomes. Induce degradation by the pathway.
  • SLZIP also inhibited HDAC3 ubiquitination upon ligand treatment.
  • sLZIP inhibited the supplementation of the helper PGC-1 ⁇ for PPAR ⁇ 2.
  • sLZIP binds to PPAR ⁇ 2 to regulate the transcriptional activity of PPAR ⁇ 2 and enhances the formation of inhibitory complement complexes.
  • sLZIP inhibits the transcriptional activity of PPAR ⁇ 2, thus affecting Runx2 transcriptional activity, which is a major transcription factor in differentiation of osteoblasts or adipocytes of mesenchymal stem cells.
  • sLZIP increased the transcriptional activity of Runx2 by approximately 4 times. That is, PPAR ⁇ 2 inhibited the transcriptional activity of Runx2, but sLZIP restored the activity of Runx2.
  • HDAC3 also reduced Runx2 transcriptional activity, while sLZIP restored Runx2 transcriptional activity.
  • sLZIP increased osteoblast differentiation in human primary MSCs and C3H10T1 / 2 cells.
  • sLZIP promoted osteoblast differentiation and bone nodule formation in MEFs. It also promoted ossification in vivo.
  • sLZIP did not influence the expression of chondrocyte differentiation marker genes such as Sox9 and ColIIIA1.
  • osteoclast markers such as Oscar, Ctsk and TARP did not differ between wild-type and sLZIP TG mice.
  • sLZIP inhibited adipocyte formation and induced osteoblast formation in pluripotent mesenchymal progenitor cells, but did not affect chondrocyte and osteoclast formation in bone formation.
  • composition for promoting differentiation of the present invention may include sLZIP as natural or recombinant sLZIP, or sLZIP having a physiological activity substantially equivalent thereto.
  • Proteins having substantially equivalent physiological activity include native / recombinant sLZIP and its functional equivalents and functional derivatives.
  • the “functional equivalent” refers to an amino acid sequence variant in which some or all of the amino acids of the native protein are substituted, or a portion of the amino acid is deleted or added, and has substantially the same physiological activity as the native sLZIP.
  • sLZIP a protein that has been modified to increase or decrease the physicochemical properties of the sLZIP and has substantially the same physiological activity as the native sLZIP.
  • the sLZIP of the present invention is a protein of mammalian, preferably human origin, for example GenBank accession no. It refers to a protein having a sequence known as FJ263669 and the like. More specifically, it may be represented by the amino acid sequence described in SEQ ID NO: 1.
  • sLZIP used in the present invention is GenBank accession no. It may be prepared by genetic engineering methods known to those skilled in the art from FJ263669 and the like.
  • the native sLZIP is similar to that of the natural type in terms of protein activity and solubility in mammalian cells than in E. coli or insect cells when the protein is produced by genetic recombination methods.
  • the recombinant sLZIP can be separated using a conventional column chromatography method.
  • the degree of purification of the protein can be confirmed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).
  • Differentiation promoting composition of the present invention can be added as a differentiation regulating factor in mesenchymal stem cell culture in vitro ( in vitro ).
  • natural or recombinant sLZIP may be added to control the number of osteoblasts through quantitative changes thereof.
  • the composition for promoting differentiation of the present invention may further include a known differentiation inducing factor for inducing differentiation of mesenchymal stem cells in addition to the sLZIP.
  • a known differentiation inducing factor for inducing differentiation of mesenchymal stem cells in addition to the sLZIP.
  • ciliary neurotrophic factor CNTF
  • BMPs bone morphogenetic proteins
  • TGF ⁇ transforming growth factor
  • GGF2 neuregulin-1
  • GGF2 glial growth factor-2
  • the present invention also relates to a composition for the prevention or treatment of bone diseases comprising human small leucine zipper protein.
  • the present invention also provides the use of a human small leucine zipper protein for the preparation of a composition for preventing or treating bone diseases.
  • the sLZIP promotes the differentiation of mesenchymal stem cells into osteoblasts and plays an important role in the bone formation process, and thus can be used as an agent for preventing or treating bone diseases such as dysplasia, osteoporosis and osteomalacia.
  • SLZIP used in the composition for preventing or treating bone diseases of the present invention is a protein derived from a mammal, preferably a human, for example, GenBank accession no. It refers to a protein having a sequence known as FJ263669 and the like. More specifically, it may be represented by the amino acid sequence described in SEQ ID NO: 1.
  • the sLZIP may be included in the form of a natural or recombinant protein, or in the form of a transformed stem cell overexpressing sLZIP.
  • the transformed stem cells overexpressing the native or recombinant sLZIP may be prepared by introducing a vector expressing the native or recombinant sLZIP into the stem cells through known methods.
  • the invention also provides a method of treating bone disease in an animal comprising administering to the subject a composition for the prevention or treatment of a bone disease comprising a pharmaceutically effective amount of sLZIP.
  • the subject to which the pharmaceutical composition for preventing or treating the bone disease can be administered includes all animals.
  • it may be an animal except a human such as a dog, a cat, and a mouse.
  • composition of the present invention may further comprise a pharmaceutically acceptable carrier.
  • Such pharmaceutically acceptable carriers include carriers and vehicles commonly used in the pharmaceutical arts, and in particular, ion exchange resins, alumina, aluminum stearate, lecithin, serum proteins (eg, human serum albumin), buffer materials (eg, Various phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids), water, salts or electrolytes (e.g., protamine sulfate, disodium hydrogen phosphate, hydrogen carbonate, sodium chloride and zinc salts) Silica, magnesium trisilicate, polyvinylpyrrolidone, cellulosic substrates, polyethylene glycols, sodium carboxymethylcellulose, polyarylates, waxes, polyethylene glycols or wool, and the like.
  • the pharmaceutical composition of the present invention may further include a lubricant, a humectant, an emulsifier, a suspending agent, a preservative, and the like, in addition to the above components.
  • the composition according to the invention may be prepared in an aqueous solution for parenteral administration, preferably a buffered solution such as Hanks' solution, Ringer's solution or physically buffered saline. Can be used.
  • Aqueous injection suspensions can add a substrate that can increase the viscosity of the suspension, such as sodium carboxymethylcellulose, sorbitol or dextran.
  • compositions of the present invention can be administered systemically or topically and can be formulated in suitable formulations by known techniques for such administration.
  • oral administration it can be administered by mixing with an inert diluent or an edible carrier, sealed in hard or soft gelatin capsules, or pressed into tablets.
  • the active compounds can be mixed with excipients and used in the form of intake tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers and the like.
  • sLZIP is well soluble in saline or buffer, it is stored in a freeze-dried state, and then formulated in solution immediately before administration to saline or buffer in an effective amount of sLZIP in a form suitable for intravenous, subcutaneous, intramuscular, intraperitoneal, or transdermal administration. It can also be administered.
  • An effective amount of the active ingredient of the pharmaceutical composition of the present invention means an amount required to achieve the effect of preventing, inhibiting or alleviating the disease.
  • the type of disease, the severity of the disease, the type and amount of the active and other ingredients contained in the composition, the type of formulation and the age, weight, general health, sex and diet, sex and diet, time of administration, route of administration and composition of the patient can be adjusted according to various factors including the rate of secretion, the duration of treatment, and the drug used concurrently.
  • the sLZIP of the present invention may be administered at a dose of 0.1 ng / kg to 10 g / kg in adults when administered once or several times a day.
  • the present invention also provides a method for screening a medicament for preventing or treating a bone disease, comprising contacting a gene of a human small leucine zipper protein with a candidate outside the body, and determining whether the candidate promotes or inhibits the expression of the gene. It is about.
  • the present invention also provides a method for screening a medicament for preventing or treating bone diseases, comprising contacting a human small leucine zipper protein with a candidate outside the body, and determining whether the candidate enhances or inhibits the function or activity of the protein. To provide.
  • a candidate substance to be analyzed may be contacted with a bone disease cell including the gene or protein.
  • the candidate substance is assumed to have a potential as a medicament for promoting or inhibiting the function or activity of the sLZIP protein or a substance that promotes or inhibits the transcription and translation of the mRNA and the protein in the sLZIP gene sequence according to a conventional selection method, or Random nucleic acids, proteins, peptides, other extracts or natural products, compounds, and the like.
  • the expression level of the gene, the amount of the protein or the activity of the protein can be measured in the cells treated with the candidate, and as a result of the increase or decrease in the amount of expression of the gene, the amount of the protein or the activity of the protein
  • the candidate material may be determined as a material capable of preventing or treating bone diseases.
  • the method of measuring the expression amount of the gene, the amount of the protein or the activity of the protein in the above may be carried out through a variety of methods known in the art, for example, but not limited to reverse transcriptase polymerase chain reaction (reverse transcriptase-polymerase chain reaction, real time-polymerase chain reaction, western blot, northern blot, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion (radioimmunodiffusion) And immunoprecipitation assays.
  • reverse transcriptase polymerase chain reaction reverse transcriptase-polymerase chain reaction, real time-polymerase chain reaction, western blot, northern blot, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion (radioimmunodiffusion)
  • immunoprecipitation assays for example, but not limited to reverse transcriptase polymerase
  • Candidates exhibiting activity that enhances gene expression or enhances protein function obtained through the screening method of the present invention may be candidates for treating bone diseases.
  • Such candidate candidates for treating bone disease will act as leading compounds in the development of the treatment for bone diseases in the future, and their structure will allow the leading materials to promote or inhibit the function of the sLZIP gene or proteins expressed therefrom.
  • new bone disease therapies can be developed.
  • Dulbecco's modified Eagle's medium was purchased from GIBCO technologies, Inc (Gaithersburg) and fetal bovine serum was purchased from HyClone Laboratory (Logan, UT).
  • Anti-PPAR ⁇ 2, anti-HDAC1, 2, 3, 4, 6, 8 and 9, anti- ⁇ -actin and anti-GST antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, Calif.).
  • Anti-mouse and anti-rabbit peroxidase bound secondary antibodies were purchased from Pierce (Madison, WI).
  • ⁇ -glycerophosphate and ascorbic acid were purchased from Sigma (St. Louis, Mo.).
  • MSCs Human primary mesenchymal stem cells
  • C3H10T1 / 2, 293T and MEF cells were cultured in DMEM with 10% FBS inactivated by heat and penicillin (100 U / mL) / streptomycin (100 ⁇ g / mL). . All cell types were incubated at 37 ° C. in a wet incubator containing CO 2 %.
  • C3H10T1 / 2 cells were changed for 8 days with DMEM containing 50 ⁇ g / mL ascorbic acid, 10 mM ⁇ -glycerophosphate and 10% FBS. Differentiation medium was changed every two days.
  • C3H10T1 / 2 and 293T cells were plated in 12-well culture dishes at a density of 2 ⁇ 10 5 cells / well. After incubation for 24 hours, cells were transfected with 0.2 ⁇ g of reporter gene and 0.1-0.5 ⁇ g of experimental plasmid using Lipofectamine 2000 or Genefectine according to the manufacturer's instructions. After 24 hours, cells were cultured in serum-free DMEM with or without 10 nM rosiglitazone. siRNAs were made using the sLZIP and HDAC target sequences (Table 1). For RNA interference experiments, cells were transfected with mixed RNA and appropriate siRNAs using Lipofectamine 2000 according to the manufacturer's instructions. Human MSC and C3H10T / 1/2 cells were infected with adenoviral or empty vectors containing cDNA for human sLZIP. After 2 hours the infection medium was changed to fresh medium.
  • RNA samples were directly lysed in the culture dish by adding TRIzol reagent (Invitrogen, Carlsbad, Calif.) According to the manufacturer's instructions.
  • CDNA was synthesized from 2 ⁇ g of total RNA using Accupower RT PreMix (BioNeer, Daejeon, Korea). The reaction was carried out at 42 ° C. for 60 minutes and at 94 ° C. for 5 minutes.
  • PCR amplification was performed using the Hipi PCR Mix Kit (ELPIS) using the oligomers listed in Table 2.
  • GAPDH was amplified as an internal control.
  • PCR products were electrophoresed on 1-2% (w / v) agarose gel containing 0.5 ⁇ g / mL ethidium bromide and the size of the PCR product was measured in comparison to the 1 kb DNA ladder marker (Invitrogen). .
  • the intensity of each band amplified by RT-PCR was analyzed using a MultiImage TM Light Cabinet (version 5.5, Alpha Innotech Corp., San Leandro, Calif.).
  • Cells were obtained and washed twice with cold PBS.
  • Cell extracts were prepared using RIPA buffer (10 mM HEPES, 10 mM NaCl, 0.1 mM EDTA, 0.1 mM EGTA, 1% NP-40, 0.5 mM PMSF, 0.1 mM DTT, 0.1 mM Na 3 VO 4 , and protease inhibitors). .
  • the suspension was centrifuged at 16,000 x g for 20 minutes at 4 ° C. Supernatants were combined and mixed with sample buffer. Protein samples were separated on SDS-PAGE (8-15%) and transferred to nitrocellulose membranes. Membranes and appropriate antibodies were incubated at 4 ° C. for overnight.
  • Luciferase assays were performed using a luciferase assay system (Promega Corporation, Madison, Wis.). Luciferase activity was recorded on Luminometer 20/20 n (Turner BioSystems, Sunnyvale, CA) according to the manufacturer's instructions. Luciferase activity was normalized to ⁇ -galactosidase activity. For ⁇ -galactosidase analysis, CMV- ⁇ -galactosidase was transfected with the luciferase reporter gene. All data are presented as mean ⁇ standard deviation in at least 3 independent experiments.
  • 293T cells were obtained and washed with cold PBS. Cells were resuspended in IP Lysis buffer [25 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1% NP-40 and 5% glycerol, and protease inhibitors. The suspension was centrifuged at 16,000 x g for 20 minutes at 4 ° C. Supernatants were collected and incubated with 0.5 ⁇ g of the appropriate antibody and 25 ⁇ l of Protein A / G-Agarose or GST Sepharose 4B beads at 4 ° C. for 24 hours.
  • IP Lysis buffer 25 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1% NP-40 and 5% glycerol, and protease inhibitors. The suspension was centrifuged at 16,000 x g for 20 minutes at 4 ° C. Supernatants were collected and incubated
  • Protein complexes were washed five times by centrifuging for 1 min at 1,000 x g with cold IP Lysis buffer. The final pellet was resuspended in 50 ⁇ l SDS-sample buffer containing 5% ⁇ -mercaptoethanol and boiled at 100 ° C. for 10 minutes. Protein samples were separated on SDS-PAGE (8-10%) and transferred to nitrocellulose membranes. Proteins precipitated together were detected by Western blotting using specific antibodies.
  • C3H10T1 / 2 cells were transiently transfected together with Flag-sLZIP, GFP-PPAR ⁇ 2 or GFP-sLZIP, and HDAC3 was cultured on cover slips. After 24 hours, cells were fixed for 10 minutes with 4% paraformaldehyde and infiltrated with 0.2% Triton-X 100 for 5 minutes. Cells were incubated with 1% BSA for 1 hour and then incubated with anti-Flag and anti-HDAC3 antibodies for 4 days at 4 ° C. After washing with PBS, cells were incubated with Texas Red bound antibody for 2 hours. Cover slides were washed with PBS, mounted and tested using an LSM 510 META confocal microscope (Carl Zeiss, Jena, Germany).
  • sLZIP was cloned into the pET-28a (+) vector. His-sLZIP protein was expressed in Escherichia coli BL21 cells using the T7 isopropyl- ⁇ -D-thiogalactopyranoside (IPTG) -derived system. IPTG-induced cells were disrupted upon sonication and cell lysates were cleared by centrifugation. His-sLZIP protein was placed in a nickel-nitrilotriacetic acid bead column (Bio-Rad, Richmond, CA).
  • sLZIP transgenic mice To produce human sLZIP transgenic (TG) mice, the sLZIP gene was cloned into the pCMV-flag expression vector. sLZIP TG mice were produced by Macrogen, Inc. (Seoul, Korea). Transgenic founders were mated with wild type C57BL / 6 mice to produce the F1 heterozygote. F1-F4 generations were genetically screened for transgenes at 2 weeks of age. The following two primers were used to amplify genomic DNA to identify wild type and TG mice: 5'- GGA CGA TGA TGA CAA GGA CT-3 'and 5'- GTC AGA GGA GTA CAT GCT GCT-3'.
  • Nuclear receptor PPAR ⁇ is an important positive regulator of adipocyte differentiation in MSCs and a negative regulator in osteoblast development.
  • sLZIP is known to be involved in many types of nuclear receptor transcriptional activity such as GR, estrogen receptor (ER) and androgen receptor (AR).
  • ER estrogen receptor
  • AR androgen receptor
  • human sLZIP contains two essential and sufficient LxxLL motifs to bind nuclear receptors.
  • sLZIP sLZIP-induced transcriptional activity of PPAR ⁇ 2
  • 293T cells were treated with PPAR ⁇ 2 (0.5 ⁇ g), ⁇ -galactosidase (0.1 ⁇ g), FABP4-Luc reporter gene (0.2 ⁇ g) and sLZIP (0.1-) by content.
  • 0.5 ⁇ g) was temporarily transfected together.
  • cells were stimulated with or without 10 nM rosiglitazone (RZD) (FIG. 1A), pioglitazone (PZD) (FIG. 1B), and troglitazone (TZD) (FIG. 1C).
  • sLZIP inhibited the transcriptional activity of PPAR ⁇ 2 in a concentration dependent manner.
  • Transcriptional activity of PPAR ⁇ 2 was down-regulated by sLZIP depending on the presence or absence of various PPAR ⁇ 2 ligands as compared to the control.
  • siRNA si-sLZIP
  • si-sLZIP si-sLZIP
  • C3H10T1 / 2 cells stably expressing the FABP4 reporter gene were infected with sLZIP expressing adenovirus and then differentiated into adipocytes. As shown in FIG. 2, the transcriptional activity of PPAR ⁇ 2 was decreased by sLZIP in adipocytes.
  • PPAR ⁇ 2 was translated in vitro by the TNT translation system (Promega) and His-sLZIP protein was expressed in BL21 cells using the IPTG-inducing system. Purified His-sLZIP protein was subjected to His pull-down assay. Proteins bound to beads were analyzed by SDS-PAGE and immunoblotted using anti-PPAR ⁇ 2, anti-His antibodies (FIG. 2C). GFP-PPAR ⁇ 2 and Flag-sLZIP constructs were expressed in C3H10T1 / 2 cells and analyzed under fluorescence microscopy using mouse anti-Flag and Texas red coupled anti-mouse antibodies. Nuclei were stained with DAPI (FIG. 2D).
  • 293T cells were transfected with Flag-full length PPAR ⁇ 2, full length PPAR ⁇ 2, N-terminal deletion mutant PPAR ⁇ 2 (1-310), C-terminal deletion mutant PPAR ⁇ 2 (139-505) and GST-sLZIP. Cell lysates were obtained and GST pull-down assays were performed. Protein complexes were analyzed on SDS-PAGE and subjected to immunoblotting using anti-GST and anti-Flag antibodies (FIG. 3B).
  • the C and CC domains of wild-type sLZIP and sLZIP bind PPAR ⁇ 2, but the sLZIP N domain does not bind PPAR ⁇ 2. It can be seen that the CC-terminal domain of sLZIP containing a proline-rich region is important for binding to PPAR ⁇ 2.
  • PPAR ⁇ 2 Transcriptional activity of PPAR ⁇ is regulated by helpers and inhibitors.
  • PPAR ⁇ 2 in the resting state is thought to bind to inhibitory complement complexes such as HDAC3, SMRT and NCoR.
  • the inhibitor complement complex is replaced with helpers such as p300 / CBP, p160, and PGC-1, leading to the initiation of transcription of the target gene.
  • helpers such as p300 / CBP, p160, and PGC-1
  • 293T cells were transiently transfected with PPAR ⁇ 2 (0.5 ⁇ g), ⁇ -galactosidase (0.1 ⁇ g), FABP4-Luc reporter gene (0.2 ⁇ g) and sLZIP (0.1 ⁇ g). After transfection, cells were stimulated with or without 10 nM RZD and 10 nM TSA (FIG. 4A). Promoter activity was measured according to the luciferase assay. In 293T cells, the FABP4-Luc reporter gene, sLZIP, PPAR, ⁇ -galactosidase, and 100 nM si-RNAs for the control, and HDAC1, 2, 3 and 8 were expressed.
  • FIG. 4B After transfection, cells were stimulated with or without 10 nM RZD and promoter activity was measured (FIG. 4B). 293T cells were transiently transfected with FABP4-Luc reporter gene, PPAR ⁇ 2, ⁇ -galactosidase, HDAC3 (0.5 ⁇ g) and sLZIP (0.1 ⁇ g). After transfection, cells were stimulated with or without 10 nM RZD and luciferase assay was performed (FIG. 4C). Luciferase activity was normalized to ⁇ -galactosidase activity and expressed as relative intensity (fold change). All experiments were performed in three replicates, and the bar in the graph represents the mean ⁇ standard deviation.
  • GFP-sLZIP expression constructs were expressed in C3H10T1 / 2 cells and analyzed under fluorescence microscopy using rabbit anti-HDAC3 antibodies and Texas red-bound anti-rabbit antibodies. Nuclei were stained with DAPI (FIG. 4D). 293T cells were transfected together with GST-HDAC3 and Flag-sLZIP. Cell lysates were pulled down using glutathione 4B beads. Protein complexes were analyzed on SDS-PAGE and immunoblotted using anti-GST and anti-Flag antibodies (FIG. 4E). *, P ⁇ 0.05; **, P ⁇ 0.01
  • siRNAs for HDAC1, 2, and 8 are not involved in PARL2 regulation mediated by sLZIP.
  • knockdown of HDAC3 dramatically improved the sLZIP-mediated PPAR ⁇ 2 transcriptional activity.
  • sLZIP was located in the nucleus with HDAC3 (FIG. 4D).
  • Inhibitor complement complexes are replaced by helpers upon ligand binding to the nuclear receptor. Therefore, the binding between sLZIP and PPAR ⁇ 2 by ligand treatment was investigated.
  • 293T cells were transfected with GST-PPAR ⁇ 2 and Flag-sLZIP and treated with 10 nM RZD for 24 hours or not.
  • Cell lysates were obtained and subjected to GST pull-down assay (FIG. 5A) and immunoprecipitation (FIG. 5B) using glutathione 4B beads. Protein complexes were analyzed on SDS-PAGE and immunoblotted using anti-GST and anti-Flag antibodies.
  • GST-PPAR ⁇ 2 and Flag-sLZIP were expressed in 293T cells, and cells were treated with 10 nM RZD at each time interval. Cell lysates were analyzed for GST pull-down (FIG. 5C).
  • 293T cells were transfected with GST-HDAC3 and Flag-sLZIP and treated with 10 nM RZD for 24 hours or not.
  • Cell lysates were analyzed for GST pull-down (FIG. 5D).
  • Flag-sLZIP was expressed in 293T cells, and cells were treated with 10 nM RZD for 24 hours.
  • Cell lysates were subjected to immunoprecipitation assays using anti-NCoR1 antibodies. Protein complexes were analyzed by SDS-PAGE and immunoblotted using anti-NCoR1 and anti-Flag antibodies (FIG. 5E).
  • 293T cells were transiently transfected together with PPAR ⁇ 2 (0.5 ⁇ g), ⁇ -galactosidase (0.1 ⁇ g), FABP4-Luc reporter gene (0.2 ⁇ g) and various deletion mutants of sLZIP (0.1 ⁇ g). After transfection, cells were stimulated with or without 10 nM RZD (FIG. 5F). Luciferase activity was normalized to ⁇ -galactosidase activity and expressed as relative activity (fold change). All experiments were performed in three replicates and expressed as mean ⁇ standard deviation. *, P ⁇ 0.05; **, P ⁇ 0.01
  • PPAR ⁇ 2 was isolated from sLZIP upon ligand treatment, as shown in FIG. 5B.
  • sLZIP was isolated from PPAR ⁇ 2 when treated with RZD and still inhibited PPAR ⁇ 2 transcriptional activity (FIG. 5F).
  • PPAR ⁇ 2 transcriptional activity was inhibited by deletion mutants (1-220) of sLZIP that did not bind PPAR ⁇ 2 (FIG. 5F).
  • LZIP contains N-terminal active domains (1-220) and is reported to be involved in the transcriptional activity of cAMP-responsive elements (CREs) -containing reporter genes.
  • CREs cAMP-responsive elements
  • GST-HDAC3, GST-PPAR ⁇ 2, Myc-PPAR ⁇ 2, Flag-sLZIP and Ha-UB were expressed in 293T cells and 10 nM RZD were treated with cells for 24 hours.
  • Cell lysates were subjected to GST pull-down assay (FIG. 6B).
  • GST-PPAR ⁇ 2 and Flag-sLZIP were expressed in 293T cells and treated with 10 nM RZD for 24 hours.
  • Cell lysates were subjected to GST pull-down assay and protein complexes were analyzed by SDS-PAGE followed by immunoblotting using anti-PGC1 ⁇ , anti-GST and anti-Flag antibodies (FIG. 6C).
  • GST pull-down assay showed that sLZIP enhanced binding between PPAR ⁇ 2 and HDAC3 upon ligand treatment.
  • PPAR ⁇ 2 binds to inhibitors such as HDAC3 when the ligand is not treated, and separation of the PPAR ⁇ -inhibitory complement complex occurs by addition of the PPAR ⁇ 2 ligand, rosiglitazone, leading to degradation by the ubiquitin / proteosome pathway.
  • sLZIP inhibited HDAC3 ubiquitination upon ligand treatment (FIG. 6B).
  • PPAR ⁇ has been reported to play an important role in mesenchymal passage measurement. Differentiation of MSCs into osteoblasts or adipocytes is regulated transcriptionally by two major transcription factors, Runx2 and PPAR ⁇ 2. Activation of PPAR ⁇ 2 inhibits Runx2 mediated transcription, and TZD, such as rosiglitazone, simultaneously inhibits osteoblast differentiation.
  • Runx2 transcriptional activity was tested to characterize the potential role of sLZIP in Runx2 transcriptional activity by inhibiting PPAR ⁇ 2 transcriptional activity.
  • 293T cells were transfected together temporarily with Runx2 (0.5 ⁇ g), ⁇ -galactosidase (0.1 ⁇ g), 6 copies of Runx2 response element (0.2 ⁇ g) and sLZIP (0.1 ⁇ g-0.5 ⁇ g) by content. Speciation was made (FIG. 7A).
  • PPAR ⁇ 2 (0.5 ⁇ g), ⁇ -galactosidase, Runx2, 6 copies of Runx2 response elements and sLZIP (0.5 ⁇ g) were expressed in 293T cells (FIG. 7B).
  • 293T cells were transiently transfected together with HDAC3 (0.5 ⁇ g), Runx2, ⁇ -galactosidase, 6 copies of Runx2 response elements and sLZIP (0.25 and 0.5 ⁇ g) by content (FIG. 7C).
  • Promoter activity was measured according to the luciferase assay. Luciferase activity was normalized to ⁇ -galactosidase activity and expressed as relative activity (fold change). All experiments were performed in three replicates and expressed as mean ⁇ standard deviation.
  • osteoblast differentiation was tested in MEFs.
  • sLZIP promoted osteoblast differentiation and bone nodule formation (FIG. 7E).
  • ossification or bone formation
  • ATDC5 cells were transiently transfected with sLZIP (0.1 ⁇ g-0.5 ⁇ g) by content.
  • Total RNA was extracted from the cells and mRNA expression levels of chondrocyte markers were measured using RT-PCR analysis (FIG. 8A) and real time PCR (FIG. 8B).
  • GAPDH was used as an internal control. The experiment was performed in three replicates.
  • sLZIP did not affect the expression of chondrocyte differentiation marker genes such as Sox9 and ColIIIA1 in response to insulin.
  • Bone homeostasis in vertebrates is maintained by the balance between bone formation by osteoblasts and bone uptake by osteoblasts. Osteoblasts regulate osteoclast formation as well as bone formation.
  • osteoclast markers such as Oscar, Ctsk and TARP did not differ between wild-type and sLZIP TG mice (FIG. 8D).
  • the present invention can be used as a therapeutic agent for bone diseases such as dysplasia, osteoporosis, osteomalacia.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Urology & Nephrology (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Pathology (AREA)
  • Biotechnology (AREA)
  • Cell Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Epidemiology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Zoology (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Rheumatology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 골 형성 과정에서 인간 작은 류신 지퍼 단백질의 용도에 관한 것으로, 보다 상세하게는 sLZIP이 Runx2의 전사활성을 증가시키고 PPARγ2의 전사활성을 억제하여 조골세포 분화를 증가시킴으로써 sLZIP이 골 형성과정에 중요한 역할을 하며, 이로부터 골 질환 치료 및 치료제 신약 개발을 위한 표지자로 사용될 수 있다.

Description

골 형성 과정에서 인간 작은 류신 지퍼 단백질의 용도
본 발명은 중간엽 줄기세포의 조골세포 분화에서 인간 작은 류신 지퍼 단백질의 용도에 관한 것이다.
세포 치료는 환자의 부족한 의료 요구를 충족할 수 있는 유망한 접근 방식이다. 최근 중간엽 줄기세포가 다양한 임상 실험에 이용되고 있지만 의학적 치료를 위해서는 중간엽 줄기세포의 분화 조절과 같은 문제점을 해결해야 한다.
지방세포와 조골세포는 중간엽 줄기세포로부터 분화되며, 이러한 분화는 전사인자로부터 조절된다. 중간엽 줄기세포에서 조골세포와 지방세포의 분화 균형은 회복, 재생, 항상성 유지에 매우 중요하다. 이러한 중간엽 줄기세포 분화조절 균형의 실패는 퇴행성 관절염, 골다공증과 같은 문제를 일으킨다. PPARγ2는 중간엽 줄기세포에서 지방세포로 분화 시 발현되고 지방세포관련 유전자 발현조절에 관여한다. 또한 Runx2는 조골세포 분화 시 발현되며 조골세포 관련 유전자 발현에 관여한다. 따라서 지방세포와 조골세포 분화에서 전사인자의 조절 메커니즘 이해는 매우 중요하다.
PPARγ는 전사인자 PPAR 패밀리에 속하며, PPARα, PPARγ, PPARδ를 포함하고 있다. PPARγ는 지방생성, 지질 생합성, 염증, 포도당 대사에 주요 조절자이며, 얼터너티브 스플라이싱(alternative splicing)을 통해 PPARγ1, PPARγ2 두 가지 변이체로 생성된다. PPARγ2는 PPARγ1 보다 N-말단에 30개의 아미노산이 추가로 포함되어 있고, 주로 대식세포와 지방세포에 발현되며, 골수 기질세포에도 일부 발현된다. PPARγ1은 근육, 지방조직, 뼈 등 다양한 조직에서 발현된다. PPARγ는 peroxisome proliferator-activated response element(PPRE) DNA 서열에 결합하고 RXR과 이형 복합체를 형성한다. 이러한 요소는 지질 저장에 관련된 ap2와 콜레스테롤 수송에 관여하는 CD36 프로모터에 발견된다. PPARγ과 RXR 이형복합체는 리간드가 없을 시 HDAC과 NCoR, SMRT와 같은 억제보체와 결합하고 있으며, 리간드 결합 시 배좌 변화(conformational change)를 통해 P160/SRC, PBP, PGC-1, CBP 등과 같은 도움인자로 대체된다. 많은 전사인자와 리간드들이 PPARγ의 발현과 기능에 조절에 관여한다. C/EBP는 PPARγ 프로모터에 직접적으로 결합하여 전사를 촉진하고, 천연 PPARγ 리간드인 프로스타글란딘 J2(Prostaglandin J2)와 로시글리타존(rosiglitazone), 피오글리타존(pioglitazone)과 같은 합성시약인 TZD 역시 PPARγ 전사활성을 증가시킨다. 음성조절자로서 RB와 사이클린 D1은 PPARγ의 전사활성을 억제한다.
LZIP은 bZIP 패밀리의 구성원으로서 CREB/ATF 유전자 패밀리에 속한다. LZIP은 기본 DNA-결합 도메인(basic DNA-binding domain)과 류신지퍼 도메인을 가지고 있고, cAMP-responsive element(CRE)와 AP-1 element에 결합한다. 인간 LZIP은 HCF-1 결합 단백질로 밝혀졌으며, 세포 증식과 세포성 형질전환을 촉진한다. N-말단 92개의 아미노산은 강력한 전사활성 도메인이고 2개의 LxxLL-전사 도움인자 결합 모티프를 포함하고 있다. LZIP은 CREB3(LZIP, Luman), CREB3L1 (OASIS), CREB3L2(BBF2H7), CREB3L3(CREB-H), CREB3L4(AIbZIP) 5개의 구성원으로 되어있으며, 이들은 상동성을 가지고 있으나 전사인자의 기능은 다르다. 보고된 LZIP의 기능은 CCR1에 결합하여 Lkn-1 의존성 세포이동을 조절하고, CCR2 프로모터에 결합하며 CCR2의 발현을 조절하며, 단핵구의 이동을 증가시킨다.
최근 LZIP의 이소 폼인 small LZIP을 발견했으며, 막관통(transmembrane) 도메인부분이 없는 354 아미노산으로 구성된다. sLZIP은 LKN-1 의존성 세포 이동에 관여하지 않고 HDACs을 활성화함으로써, 글루코코티코이드 수용체(Glucocorticoid receptor)의 전사활성을 억제한다.
이에 본 발명자들은 PPARγ와 Runx2의 전사활성을 조절하는 sLZIP의 조절 메커니즘을 중간엽 줄기세포에서 조골세포와 지방세포의 분화의 관련하여 연구함으로써 본 발명을 완성하였다.
본 발명의 목적은 중간엽 줄기세포의 조골세포로의 분화에서 인간 작은 류신 지퍼 단백질(human small leucine-zipper protein, 약어로 'sLZIP'라 함)의 역할을 규명함으로써 줄기세포의 분화 조절자로서의 용도를 제공하는 것이다.
본 발명의 다른 목적은 상기 sLZIP의 골 질환 예방 또는 치료적 용도를 제공하는 것이다.
본 발명의 또 다른 목적은 상기 sLZIP의 골 질환의 예방 또는 치료적 의약의 스크리닝 용도를 제공하는 것이다.
상기 목적을 달성하기 위하여, 본 발명은 분화 조절제로, 인간 작은 류신 지퍼 단백질(human small leucine-zipper protein)을 포함하는 중간엽 줄기세포에서 조골세포로의 분화 촉진용 조성물을 제공한다.
본 발명은 또한 인간 작은 류신 지퍼 단백질을 포함하는 골 질환 예방 또는 치료용 조성물을 제공한다.
또한, 본 발명은 골 질환 예방 또는 치료용 조성물의 제조를 위한 인간 작은 류신 지퍼 단백질의 용도를 제공한다.
또한, 본 발명은 약제학적 유효량의 인간 작은 류신 지퍼 단백질을 포함하는 골 질환 예방 또는 치료용 조성물을 개체에 투여하는 단계를 포함하는 동물의 골 질환 치료 방법을 제공한다.
본 발명은 또한 인간 작은 류신 지퍼 단백질의 유전자를 후보물질과 인체 외에서 접촉시키고, 상기 후보물질이 상기 유전자의 발현을 촉진하는지 또는 억제하는지를 판단하는 것을 포함하는 골 질환의 예방 또는 치료용 의약의 스크리닝 방법을 제공한다.
본 발명은 또한 인간 작은 류신 지퍼 단백질을 후보물질과 인체 외에서 접촉시키고, 상기 후보물질이 상기 단백질의 기능 또는 활성을 증진하는지 또는 억제하는지를 판단하는 것을 포함하는 골 질환의 예방 또는 치료용 의약의 스크리닝 방법을 제공한다.
본 발명에 따르면, 인간 작은 류신 지퍼 단백질(sLZIP)은 억제보체의 결합을 증가시킴으로써 PPARγ의 전사활성을 억제하고, Runx2의 전사활성을 증가시켜 중간엽 줄기세포에서 지방세포와 조골세포의 분화 균형을 조절하는 조절자임을 제공한다.
따라서, sLZIP는 골이형성증, 골다공증, 골연화증 등의 골 질환 치료적 용도로 사용하거나, 치료제 신약 개발을 위한 표지자로 이용될 수 있다.
도 1은 본 발명에 따른 sLZIP의 PPARγ의 전사활성에 대한 효과를 나타낸 것으로, A내지 C는 PPARγ2의 리간드인 로시글리타존(RZD)(A), 피오글리타존(PZD)(B) 및 트로글리타존(TZD)(C) 처리 시 sLZIP에 의한 PPARγ2의 전사활성을 측정한 결과이고, (D)는 si-sLZIP에 의한 PPARγ2의 전사활성을 측정한 결과이며, (E)는 sLZIP를 과발현하는 중간엽 줄기세포의 분화 시 PPARγ2의 전사활성을 측정한 결과이다.
도 2는 본 발명에 따른 sLZIP의 PPARγ의 결합능을 조사한 결과로, A 및 B는 GST-sLZIP 및 Myc-PPARγ2(A)와 GST-PPARγ2 및 Flag-sLZIP(B)로 트랜스펙션 된 293T 세포에서 sLZIP과 PPARγ2의 결합능을 조사한 결과이고, C는 항-PPARγ2와 항-His 항체를 사용하여 His-sLZIP와 PPARγ2의 결합 여부를 측정한 면역 블랏팅 결과이며, D는 C3H10T1/2 세포에서 발현된 GFP-PPARγ2 및 Flag-sLZIP의 핵 내 위치 측정 결과이다.
도 3은 본 발명에 따른 sLZIP 및 PPARγ2의 유전자 지도와 결합 부위 분석 결과로 A는 sLZIP를, B는 PPARγ2를 나타낸 것이다.
도 4는 본 발명에 따른 sLZIP에 의한 PPARγ2의 전사활성 억제에서 HDAC3의 역할 규명결과를 나타낸 것으로, A는 HDAC의 저해제인 TSA를 처리한 후 PPARγ2의 전사활성 효과를, B는 HDAC si-RNA를 통해 발현을 억제한 후 PPARγ2의 전사활성 효과를, C는 HDAC3 과발현 시 PPARγ2의 전사활성 효과를, D는 HDAC3와 sLZIP의 핵 내 위치를 측정한 결과를, E는 GST 풀-다운 분석에 따른 HDAC3와 sLZIP의 결합을 보여주는 결과이다.
도 5는 본 발명에 따른 sLZIP에 의한 PPARγ2의 억제보체 유도 결과를 나타낸 것으로, A는 PPARγ2 리간드 의존적 sLZIP과 PPARγ2의 결합을 보여주며, B는 시간대별 PPARγ2 리간드 처리에 따른 sLZIP과 PPARγ2의 결합 효과를, C는 PPARγ2 리간드 하에서 PPARγ2의 억제자인 HDAC3와 sLZIP의 결합 효과를, D는 sLZIP와 PPARγ2 및 HDAC3 복합체의 결합 효과를, E는 NCoR1 처리에 따른 sLZIP와 PPARγ2 및 HDAC3 복합체의 결합 효과를, F는 sLZIP 결실 돌연변이체를 이용하여 PPARγ2와의 리간드 의존적 결합에 대한 sLZIP의 조절 메카니즘과 관련성 조사 결과를 나타낸 것이다.
도 6은 PPARγ2 및 HDAC3 간의 결합 시 본 발명에 따른 sLZIP의 효과를 조사한 결과로, A는 PPARγ2 및 HDAC3 간의 결합 시 sLZIP의 효과를, B는 sLZIP에 의한 HDAC3의 유비퀴틴화 결과를, C는 sLZIP의 PPARγ2 도움인자에 대한 효과를 나타낸 것이다.
도 7은 본 발명에 따른 sLZIP의 Runx2 전사활성의 조절 효과를 나타낸 것으로, A는 sLZIP의 Runx2 전사활성 조절 효과를, B는 PPARγ2 및 sLZIP의 Runx2 전사활성 조절 효과를, C는 HDAC3의 Runx2 전사활성 조절 효과를, D는 중간엽 줄기세포 및 전구세포에서 sLZIP의 분화 조절 효과를, E는 MEF 세포에서 sLZIP의 분화 조절 효과를, F는 E17.5일령의 야생형 및 sLZIP TG 마우스 배아의 알시안 블루(연골 염색용) 및 알리자린 레드(뼈 염색용) 염색 결과를 나타낸 것이다.
도 8은 연골 발달 과정에서 본 발명에 따른 sLZIP의 역할을 규명한 결과로, A 및 B는 연골세포에 sLZIP를 함량별로 처리한 후 RT-PCR(A) 및 실시간 PCR(B) 분석 결과를, C는 배아에서 연골 발달 시 sLZIP 효과를, D는 sLZIP의 파골세포 분화 조절 효과를 나타낸 것이다.
도 9는 중간엽 줄기세포의 본 발명에 따른 sLZIP의 분화 조절 효과를 도시하는 모식도이다.
이하, 본 발명의 구성을 구체적으로 설명한다.
본 발명은 분화 조절제로, 인간 작은 류신 지퍼 단백질을 포함하는 중간엽 줄기세포에서 조골세포로의 분화 촉진용 조성물에 관한 것이다.
본 발명자들은 중간엽 줄기세포에서 조골세포로 분화하는 과정에서 sLZIP이 Runx2의 전사활성을 증가시키고 억제보체의 결합을 증가시킴으로써 PPARγ2의 전사활성을 억제하여 조골세포 분화를 증가시키고, sLZIP 형질전환 마우스를 이용한 실험에서 sLZIP 형질전환 마우스의 골 형성이 증가한다는 사실을 확인함으로써 본 발명을 완성하였다.
일반적으로, sLZIP는 LZIP의 이소 폼으로 막관통(transmembrane) 도메인부분이 없는 354 아미노산으로 구성되며, LKN-1 의존성 세포 이동에 관여하지 않고 HDACs을 활성화함으로써, 글루코코티코이드 수용체(Glucocorticoid receptor)의 전사활성을 억제하는 단백질이다.
상기 결과로부터, 본 발명은 sLZIP가 지방세포와 조골세포의 분화 균형을 조절하는 중간엽 줄기세포의 분화 조절자임을 최초로 제시하는 것이다.
본 발명의 일 구체예에 따르면, sLZIP는 농도 의존적인 방식으로 PPARγ2 전사활성을 억제한다. PPARγ2의 전사활성의 억제는 sLZIP가 PPARγ2와 직접적으로 결합함으로써 일어났다. sLZIP와 PPARγ2의 결합은 핵 내에서 이루어진다. PPARγ2와 결합하는데 필요한 sLZIP의 도메인을 조사하기 위해, 다양한 sLZIP 결실 돌연변이체들, 예컨대, N-말단 결실 돌연변이체(1-228), C-말단 결실 돌연변이체(229-354) 및 CC-말단 결실 돌연변이체(297-354)을 만들어 PPAR 결합 도메인을 분석한 결과, 야생형 sLZIP 및 sLZIP의 C 및 CC 도메인은 PPARγ2와 결합하나, sLZIP N 도메인은 PPARγ2와 결합하지 않았다. 이는 프롤린이 풍부한 영역을 포함하는 sLZIP의 CC-말단 도메인이 PPARγ2와의 결합에 중요함을 알 수 있다. 또한, sLZIP과 결합하는데 필요한 PPARγ2의 도메인을 시험한 결과, PPARγ2의 리간드 결합 도메인(AF-2)이 sLZIP과 결합하는데 필수적이었다. 상기 결과는 PPARγ2가 sLZIP과 결합하나, sLZIP의 LxxLL 모티프는 결합능에 필수적인 것은 아님을 입증한 것이다.
PPARγ의 전사활성은 도움인자와 억제보체에 의해 조절되고, 휴지기 상태에서 PPARγ2는 억제보체 복합체, 예컨대, HDAC3, SMRT 및 NCoR과 결합하는 것으로 알려져 있으므로, HDACs에 의한 PPARγ2의 전사활성에 대한 sLZIP의 효과를 조사하였다. 그 결과, HDACs 억제제가 없는 상태에서, sLZIP는 PPARγ2의 전사활성을 억제하나, HDACs 억제제가 처리된 세포에서는 sLZIP가 PPARγ2의 전사활성을 감소하지 않았다. 이러한 PPARγ2의 전사활성의 억제는 클래스 1 HDACs 중 HDAC3에만 한정된 것이었다. 또한, sLZIP는 HDAC3와 결합하였는바 sLZIP가 HDAC3와 결합하여 PPARγ2의 전사활성을 부정적으로 조절함을 알 수 있었다. 억제보체 복합체는 핵 수용체와 리간드 결합 시 도움인자에 의해 대체되므로 PPARγ2 리간드 처리에 의한 sLZIP 및 PPARγ2 간의 결합을 조사한 결과, sLZIP는 리간드가 없을 때는 PPARγ2와 결합하나, 리간드가 있는 경우에는 시간 의존적 방식으로 PPARγ2로부터 분리되었다. 다음으로, PPARγ2의 억제보체 복합체와의 결합에 대한 sLZIP의 효과를 조사한 결과, sLZIP는 PPARγ2 리간드가 없는 경우 PPARγ2 억제보체 복합체에서 HDAC3와 결합하였다. 또한, LZIP는 N-말단 활성 도메인(1-220)을 포함하고, cAMP-반응 요소(CREs)-함유 리포터 유전자의 전사활성에 관여하는 것으로 보고되어 있고, 상기 LZIP의 이소 폼인 sLZIP는 PPARγ2와 결합하고, 아마도 FABP4 프로모터 영역에 결합하여 그것의 전사활성을 조절하는 것으로 보여 이러한 조절 메카니즘을 이해하기 위해 PPARγ2 및 HDAC3 간의 결합 시 sLZIP의 효과를 조사하였다. 그 결과, sLZIP는 리간드가 있는 경우 PPARγ2 및 HDAC3 간의 결합을 향상시키나, PPARγ2는 리간드가 없는 경우 HDAC3 같은 억제보체와 결합하고, PPARγ2 리간드 첨가로 PPARγ-억제보체 복합체의 분리가 일어나 유비퀴틴/프로테오좀 경로에 의한 분해를 유도한다. 또한, sLZIP는 리간드 처리 시 HDAC3 유비퀴틴화를 억제하였다. 더욱이, sLZIP는 PPARγ2에 대한 도움인자 PGC-1α의 보충을 억제하였다. 즉, sLZIP이 PPARγ2와 결합하여 PPARγ2의 전사활성을 조절하고, 억제보체 복합체 형성을 향상시킴을 알 수 있다.
상술한 바와 같이, sLZIP가 PPARγ2의 전사활성을 억제하므로 중간엽 줄기세포의 조골세포 또는 지방세포 중 어느 하나로의 분화에서 주요 전사 인자인 Runx2 전사활성에 영향을 주는지 확인하였다. 그 결과, sLZIP는 대략 4배 정도로 Runx2의 전사활성을 증가하였다. 즉, PPARγ2는 Runx2의 전사활성을 억제하나, sLZIP는 Runx2의 활성을 회복시켰다. 또한, HDAC3는 Runx2 전사활성을 감소시키나, sLZIP는 Runx2의 전사활성을 회복시켰다. 따라서, sLZIP는 사람의 원발성 MSCs 및 C3H10T1/2 세포에서 조골세포 분화를 증가시켰다. 또한, MEFs에서 sLZIP는 조골세포 분화 및 골결절 형성을 촉진하였다. 생체 내에서 골화 역시 촉진하였다.
상기 결과를 바탕으로 sLZIP가 매개하는 골 형성이 연골 발달과 연관되어 있는 지를 조사한 결과, sLZIP는 연골세포 분화 마커 유전자, 예컨대 Sox9 및 ColIIIA1의 발현에 영향을 주지 않았다.
또한, 척추동물에서 골 항상성은 조골세포에 의한 뼈 형성과 조골세포에 의한 골 흡수 간의 균형에 의해 유지된다. 조골세포는 골 형성뿐만 아니라 파골세포 형성을 조절한다. 따라서, sLZIP가 파골세포 분화를 조절하는지를 측정한 결과, 파골세포 마커, 예컨대, Oscar, Ctsk 및 TARP는 야생형 및 sLZIP TG 마우스 간에 차이가 없었다. 따라서, sLZIP는 다능성 중간엽 전구세포에서 지방세포 형성을 억제하고, 조골세포 형성을 유도하나, 골 형성에서 연골세포 형성 및 파골세포 형성에는 영향을 주지 않음을 알 수 있었다.
본 발명의 분화 촉진용 조성물은 sLZIP를 천연형 또는 재조합 sLZIP, 또는 이들과 실질적으로 동등한 생리 활성을 갖는 sLZIP를 포함할 수 있다. 상기 실질적으로 동등한 생리 활성을 갖는 단백질에는 천연형/재조합 sLZIP과 그 기능적 동등물(functional equivalent) 및 기능적 유도체(functional derivative)가 포함된다.
상기 "기능적 동등물"에는 천연형 단백질의 아미노산 중 일부 또는 전부가 치환되거나, 아미노산의 일부가 결실 또는 부가된 아미노산 서열 변형체로서 천연형 sLZIP과 실질적으로 동등한 생리활성을 갖는 것을 말한다.
"기능적 유도체"는 상기 sLZIP의 물리 화학적 성질을 증가 또는 감소시키기 위한 변형을 가한 단백질로서 천연형 sLZIP과 실질적으로 동등한 생리 활성을 갖는 것을 의미한다.
본 발명의 sLZIP는 포유동물, 바람직하게는 사람에서 기원하는 단백질이며, 예컨대, 사람 유래의 GenBank accession no. FJ263669 등으로 공지된 서열을 가진 단백질을 말한다. 보다 구체적으로, SEQ ID NO: 1에 기재된 아미노산 서열로 표시되는 것일 수 있다.
일 구체예에 따르면, 본 발명에 사용된 sLZIP는 GenBank accession no. FJ263669 등으로부터 당업자에 공지된 유전공학적 방법으로 제조할 수 있다.
천연형의 sLZIP는 유전자 재조합 방법에 의하여 단백질을 제조하는 경우 대장균이나 곤충 세포를 이용하는 것보다 포유동물 세포를 이용하는 경우가 단백질의 활성도나 용해성 측면에서 천연형의 것과 유사할 것으로 여겨진다.
상기 재조합 sLZIP는 통상의 컬럼 크로마토그래피 방법 등을 이용하여 분리할 수 있다. 또한 단백질의 정제 정도는 소듐 도데실 술페이트-폴리아크릴아마이드 젤 전기영동(SDS-PAGE) 등으로 확인할 수 있다.
본 발명의 분화 촉진용 조성물은 시험관내(in vitro)에서 중간엽 줄기세포 배양 시 분화 조절 인자로 첨가될 수 있다. 예컨대, 중간엽 줄기세포의 분화 유도 배양 시 천연형 또는 재조합 sLZIP를 부가하여 이들의 양적 변화를 통해 조골세포의 수를 조절할 수 있다.
본 발명의 분화 촉진용 조성물은 상기 sLZIP 외에 중간엽 줄기세포의 분화를 유도하는 공지의 분화 유도 인자를 더 포함할 수 있다. 예컨대, ciliary neurotrophic factor(CNTF), bone morphogenetic proteins(BMPs), transforming growth factor(TGFα) 또는 neuregulin-1 (Nrg1)/glial growth factor-2(GGF2) 등을 사용할 수 있다.
본 발명은 또한 인간 작은 류신 지퍼 단백질을 포함하는 골 질환 예방 또는 치료용 조성물에 관한 것이다.
또한, 본 발명은 골 질환 예방 또는 치료용 조성물의 제조를 위한 인간 작은 류신 지퍼 단백질의 용도를 제공한다.
상기 sLZIP는 중간엽 줄기세포에서 조골세포로의 분화를 촉진하여 골 형성 과정에서 중요한 역할을 하므로 골이형성증, 골다공증, 골연화증 등의 골 질환 예방 또는 치료제로 사용할 수 있다.
본 발명의 골 질환 예방 또는 치료용 조성물에 사용되는 sLZIP는 포유동물, 바람직하게는 사람에서 기원하는 단백질이며, 예컨대, 사람 유래의 GenBank accession no. FJ263669 등으로 공지된 서열을 가진 단백질을 말한다. 보다 구체적으로, SEQ ID NO: 1에 기재된 아미노산 서열로 표시되는 것일 수 있다.
상기 sLZIP는 천연형 또는 재조합 단백질 형태, 또는 sLZIP를 과발현하는 형질전환 줄기세포 형태로 포함될 수 있다.
상기 천연형 또는 재조합 sLZIP를 과발현하는 형질전환 줄기세포는 공지의 방법을 통해 천연형 또는 재조합 sLZIP를 발현하는 벡터를 줄기세포에 도입하여 제조된 것일 수 있다.
본 발명은 또한 약제학적 유효량의 sLZIP를 포함하는 골 질환의 예방 또는 치료용 조성물을 개체에 투여하는 단계를 포함하는 동물의 골 질환의 치료 방법을 제공한다.
상기 골 질환의 치료 방법에 사용되는 약제학적 조성물 및 투여 방법은 상기에서 설명하였으므로, 이 둘 사이에 공통된 내용은 본 명세서의 과도한 복잡성을 피하기 위하여, 그 기재를 생략한다.
한편, 상기 골 질환의 예방 또는 치료용 약제학적 조성물을 투여할 수 있는 개체는 모든 동물을 포함한다. 예를 들어, 개, 고양이, 생쥐와 같은 인간을 제외한 동물일 수 있다.
또한, 본 발명의 약제학적 조성물은 약제학적으로 허용 가능한 담체를 더 포함할 수 있다.
상기 약제학적으로 허용 가능한 담체는 의약 분야에서 통상 사용되는 담체 및 비히클을 포함하며, 구체적으로 이온 교환 수지, 알루미나, 알루미늄 스테아레이트, 레시틴, 혈청 단백질(예, 사람 혈청 알부민), 완충 물질(예, 각종 인산염, 글리신, 소르브산, 칼륨 소르베이트, 포화 식물성 지방산의 부분적인 글리세라이드 혼합물), 물, 염 또는 전해질(예, 프로타민 설페이트, 인산수소이나트륨, 인산수소캄륨, 염화나트륨 및 아연 염), 교질성 실리카, 마그네슘 트리실리케이트, 폴리비닐피롤리돈, 셀룰로즈계 기질, 폴리에틸렌 글리콜, 나트륨 카르복시메틸셀룰로즈, 폴리아릴레이트, 왁스, 폴리에틸렌 글리콜 또는 양모지 등을 포함하나 이에 제한되지 않는다.
또한, 본 발명의 약제학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 유화제, 현탁제, 또는 보존제 등을 추가로 포함할 수 있다.
한 양태로서, 본 발명에 따른 조성물은 비경구 투여를 위한 수용성 용액으로 제조할 수 있으며, 바람직하게는 한스 용액(Hank's solution), 링거 용액(Ringer's solution) 또는 물리적으로 완충된 염수와 같은 완충 용액을 사용할 수 있다. 수용성 주입(injection) 현탁액은 소듐 카르복시메틸셀룰로오스, 솔비톨 또는 덱스트란과 같이 현탁액의 점도를 증가시킬 수 있는 기질을 첨가할 수 있다.
본 발명의 약제학적 조성물은 전신계 또는 국소적으로 투여될 수 있으며, 이러한 투여를 위해 공지의 기술로 적합한 제형으로 제제화될 수 있다. 예를 들어, 경구 투여 시에는 불활성 희석제 또는 식용 담체와 혼합하거나, 경질 또는 연질 젤라틴 캡슐에 밀봉되거나 또는 정제로 압형하여 투여할 수 있다. 경구 투여용의 경우, 활성 화합물은 부형제와 혼합되어 섭취형 정제, 협측 정제, 트로키, 캡슐, 엘릭시르, 서스펜션, 시럽, 웨이퍼 등의 형태로 사용될 수 있다.
주사용, 비경구 투여용 등의 각종 제형은 당해 기술 분야 공지된 기법 또는 통용되는 기법에 따라 제조할 수 있다. sLZIP는 식염수 또는 완충액에 잘 용해되므로 냉동 건조 상태로 보관한 후, 유효량의 sLZIP을 정맥내 주입, 피하 주입, 근육 주입, 복강 주입, 경피 투여 등에 적합한 형태로 식염수 또는 완충액에 투여 직전에 용액으로 제제화하여 투여할 수도 있다.
본 발명의 약제학적 조성물의 유효성분의 유효량은 질환의 예방, 억제 또는 경감 효과를 이루는데 요구되는 양을 의미한다.
따라서, 질환의 종류, 질환의 중증도, 조성물에 함유된 유효 성분 및 다른 성분의 종류 및 함량, 제형의 종류 및 환자의 연령, 체중, 일반 건강 상태, 성별 및 식이, 투여 시간, 투여 경로 및 조성물의 분비율, 치료 기간, 동시 사용되는 약물을 비롯한 다양한 인자에 따라 조절될 수 있다. 이에 제한되는 것은 아니나, 예컨대, 본 발명의 sLZIP는 1일 1회 내지 수회 투여 시, 성인의 경우 0.1ng/kg 내지 10g/kg의 용량으로 투여할 수 있다.
본 발명은 또한 인간 작은 류신 지퍼 단백질의 유전자를 후보물질과 인체 외에서 접촉시키고, 상기 후보물질이 상기 유전자의 발현을 촉진하는지 또는 억제하는지를 판단하는 것을 포함하는 골 질환의 예방 또는 치료용 의약의 스크리닝 방법에 관한 것이다.
본 발명은 또한 인간 작은 류신 지퍼 단백질을 후보물질과 인체 외에서 접촉시키고, 상기 후보물질이 상기 단백질의 기능 또는 활성을 증진하는지 또는 억제하는지를 판단하는 것을 포함하는 골 질환의 예방 또는 치료용 의약의 스크리닝 방법을 제공한다.
본 발명의 스크리닝 방법에 따르면, 먼저 상기 유전자 또는 단백질을 포함하는 골 질환 세포에 분석하고자 하는 후보물질을 접촉시킬 수 있다.
상기 후보물질은 통상적인 선정방식에 따라 sLZIP 유전자 염기서열에서 mRNA, 단백질로의 전사, 번역을 촉진하거나 억제하는 물질 또는 sLZIP 단백질의 기능 또는 활성을 증진하거나 억제하는 의약으로서의 가능성을 지닌 것으로 추정되거나 또는 무작위적으로 선정된 개별적인 핵산, 단백질, 펩타이드, 기타 추출물 또는 천연물, 화합물 등이 될 수 있다.
이후, 후보물질이 처리된 세포에서 상기 유전자의 발현양, 단백질의 양 또는 단백질의 활성을 측정할 수 있으며, 측정 결과, 상기 유전자의 발현양, 단백질의 양 또는 단백질의 활성이 증가 또는 감소하는 것이 측정되면 상기 후보물질은 골 질환을 예방 또는 치료할 수 있는 물질로 판단할 수 있다.
상기에서 유전자의 발현양, 단백질의 양 또는 단백질의 활성을 측정하는 방법은 당업계에 공지된 다양한 방법을 통해 수행될 수 있는데, 예를 들면, 이에 제한되지는 않으나, 역전사 중합효소 연쇄반응(reverse transcriptase-polymerase chain reaction), 실시간 중합효소 연쇄반응(real time-polymerase chain reaction), 웨스턴 블럿, 노던 블럿, ELISA(enzyme linked immunosorbent assay), 방사선면역분석(RIA: radioimmunoassay), 방사 면역 확산법(radioimmunodiffusion) 및 면역침전분석법(immunoprecipitation assay) 등을 이용하여 수행할 수 있다.
본 발명의 스크리닝 방법을 통해 얻은, 유전자 발현을 증진시키거나 단백질의 기능을 증진시키는 활성을 나타내는 후보물질이 골 질환 치료제 후보물질이 될 수 있다.
이와 같은 골 질환 치료제 후보물질은 이후의 골 질환 치료제 개발과정에서 선도물질(leading compound)로서 작용하게 되며, 선도물질이 sLZIP 유전자 또는 그로부터 발현되는 단백질의 기능을 촉진 또는 억제효과를 나타낼 수 있도록 그 구조를 변형시키고 최적화함으로써, 새로운 골 질환 치료제를 개발할 수 있다.
이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.
<제조예>
Dulbecco's modified Eagle's medium(DMEM)는 GIBCO technologies, Inc(Gaithersburg)에서 구입하였고, 우태아혈청은 HyClone Laboratory(Logan, UT)에서 구입하였다. 항-PPARγ2, 항-HDAC1, 2, 3, 4, 6, 8 및 9, 항-β-액틴 및 항-GST 항체는 Santa Cruz Biotechnology(Santa Cruz, CA)에서 구입하였다. 항-마우스 및 항-토끼 페록시다아제 결합된 2차 항체는 Pierce(Madison, WI)에서 구입하였다. β-글리세로포스페이트 및 아스코르브산은 Sigma(St. Louis, MO)에서 구입하였다.
(세포배양 및 분화)
사람의 원발성 중간엽 줄기세포(MSCs), C3H10T1/2, 293T 및 MEF 세포는 열로 불활성화시킨 10% FBS와 페니실린(100U/mL)/스트렙토마이신(100㎍/mL)이 첨가된 DMEM에서 배양하였다. 모든 세포 타입들은 CO2%를 포함하는 습식 배양기에서 37℃ 온도 조건에서 배양하였다. 조골세포 분화를 유도하기 위해, C3H10T1/2 세포는 50㎍/mL 아스코르브산, 10mM β-글리세로포스페이트 및 10% FBS를 포함하는 DMEM으로 8일 동안 바꿔주었다. 분화 배지는 2일 마다 바꿔주었다.
(일시적 발현 및 바이러스 감염)
C3H10T1/2 및 293T 세포를 2×105 세포/웰의 밀도로 12-웰 배양 접시에 플레이팅하였다. 24시간 동안 인큐베이션한 후, 제조업체의 설명서에 따라 리포펙타민 2000 또는 진펙틴(Genefectine)을 이용하여 0.2㎍의 리포터 유전자와 0.1~0.5㎍의 실험용 플라스미드로 세포를 트렌스펙션 시켰다. 24시간 후, 10nM 로시글리타존(rosiglitazone)이 있거나 없이 무혈청 DMEM에서 세포를 배양하였다. sLZIP 및 HDAC 표적 서열을 이용하여 siRNAs를 만들었다(표 1). RNA 간섭 실험을 위해, 제조업체의 설명서에 따라 리포펙타민 2000을 이용하여 뒤섞인 대조군 RNA 및 적당한 siRNAs로 세포를 트랜스펙션 시켰다. 사람 MSC 및 C3H10T/1/2 세포는 사람 sLZIP에 대한 cDNA를 포함하는 아데노바이러스 벡터 또는 빈 벡터로 감염시켰다. 2시간 후 감염 배지를 신선 배지로 바꿔주었다.
표 1
siRNA 서열(+dTdT)
Forward Reverse
대조군 CCUACGCCACCAAUUUGGU(SEQ ID NO:3) ACGAAAUUGGUGGCGUAGG(SEQ ID NO:4)
sLZIP GGACCCAGAUGACUCCACAGCAUAU(SEQ ID NO:5) AUAUGCUGUGGAGUCAUCUGGGUCC(SEQ ID NO:6)
HDAC1 CGACUGUUUGAGAACCUUA(SEQ ID NO:7) UAAGGUUCUCAAACAGUCGCU(SEQ ID NO:8)
HDAC2 GGUCAAUAAGACCAGAUAA(SEQ ID NO:9) UUAUCUGGUCUUAUUGACCG(SEQ ID NO:10)
HDAC3 GCCGGUUAUCAACCAGGUA(SEQ ID NO:11) UACCUGGUUGAUAACCGGC(SEQ ID NO:12)
HDAC8 CAUUCAGGAUGGCAUACAA(SEQ ID NO:13) UUGUAUGCCAUCCUGAAUGGG(SEQ ID NO:14)
(반-정량적 RT-PCR 및 실시간 PCR)
제조업체의 설명서에 따라 TRIzol 시약(Invitrogen, Carlsbad, CA)을 부가하여 배양 접시에서 세포를 직접적으로 용해시켰다. Accupower RT PreMix(BioNeer, Daejeon, Korea)를 사용하여 2㎍의 총 RNA로부터 cDNA를 합성하였다. 반응은 42℃에서 60분 동안 그리고 94℃에서 5분간 시행하였다. PCR 증폭은 표 2에 나열된 올리고머를 이용하여 Hipi PCR Mix Kit(ELPIS)를 사용하여 수행하였다. 내부 대조군으로서 GAPDH를 증폭하였다. PCR 산물은 0.5㎍/mL 에티디움 브로마이드를 포함하는 1-2% (w/v) 아가로오스 젤에서 전기영동을 하고, 1 kb DNA 래더 마커(Invitrogen)와 비교하여 PCR 산물의 크기를 측정하였다. RT-PCR에 따라 증폭된 각 밴드의 강도는 MultiImageTM Light Cabinet(version 5.5, Alpha Innotech Corp., San Leandro, CA)를 사용하여 분석하였다.
실시간 PCR은 SYBR 그린 마스터 믹스(Roche, Mannheim, Germany)를 사용하여 LightCycler 480에서 수행하였다. β-액틴은 내부 대조군으로 사용하였다. β-액틴에 대한 표적 유전자 발현 수준 비율은 CT 방법을 사용하여 계산하였고, 상기 CT 값은 형광 신호가 표적의 고정된 한계 비율에 도달하는 PCR 사이클의 횟수로 정의한다. 각 실험은 실험마다 3회 기술적 반복으로 3반복 실험을 수행하였다.
표 2
반-정량적 RT-PCR용 프라이머 서열
Forward Reverse
sLZIP AGCAGCAGCATGTACTCCTCT(SEQ ID NO:15) CTAGCCTGAGTATCTGTCCT(SEQ ID NO:16)
GAPDH CCATCACCATCTTCCAGGAG(SEQ ID NO:17) CCAGGAAATCATGTGCAATC(SEQ ID NO:18)
FABP4 GTG GGA ACC TGG AAG CTT GTC(SEQ ID NO:19) CTT CAC CTT CCT GTC GTC TGC(SEQ ID NO:20)
mLZIP ATGGATCCTGGTGGTCAG(SEQ ID NO:21) CT AAC CTG AAT ACC TGC C(SEQ ID NO:22)
PPARγ2 AT GGG TGA AAC TCT GGG AGA(SEQ ID NO:23) CT AAT ACA AGT CCT TGT AGA(SEQ ID NO:24)
TG micegenotype GGACGATGATGACAAGGACT(SEQ ID NO:25) GTCAGAGGAGTACATGCTGCT(SEQ ID NO:26)
표 3
실시간 RT-PCR용 프라이머 서열
Forward Reverse
FABP4 CATCAGCGTAAATGGGGATT(SEQ ID NO:27) TCGACTTTCCATCCCACTTC(SEQ ID NO:28)
C/EBPα TGGACAAGAACAGCAACGAG(SEQ ID NO:29) TCACTGGTCAACTCCAGCAC(SEQ ID NO:30)
LPL GGGCTCTGCCTGAGTTGTAG(SEQ ID NO:31) CCATCCTCAGTCCCAGAAAA(SEQ ID NO:32)
Sox9 CTGAAGGGCTACGACTGGAC(SEQ ID NO:33) TACTGGTCTGCCAGCTTCCT(SEQ ID NO:34)
Col2A1 GCCAAGACCTGAAACTCTGC(SEQ ID NO:35) GCCATAGCTGAAGTGGAAGC(SEQ ID NO:36)
OSCAR CACACACACCTGGCACCTAC(SEQ ID NO:37) GAGACCATCAAAGGCAGAGC(SEQ ID NO:38)
CTSK CCAGTGGGAGCTATGGAAGA(SEQ ID NO:39) AAGTGGTTCATGGCCAGTTC(SEQ ID NO:40)
TARP TCCTGGCTCAAAAAGCAGTT(SEQ ID NO:41) ACATAGCCCACACCGTTCTC(SEQ ID NO:42)
TG mice sLZIP TCGATTCCAGGCTTATGGAG(SEQ ID NO:43) AGTCGCTCGGTACCTCAGAA(SEQ ID NO:44)
hGAPDH GACAAGCTTCCCGTTCTCAG(SEQ ID NO:45) GAGTCAACGGATTTGGTCGT(SEQ ID NO:46)
mGAPDH ACCCAGAAGACTGTGGATGG(SEQ ID NO:47) CACATTGGGGGTAGGAACAC(SEQ ID NO:48)
(웨스턴 블랏 분석)
세포를 수득하고, 차가운 PBS로 2회 세척하였다. RIPA 버퍼(10mM HEPES, 10mM NaCl, 0.1mM EDTA, 0.1mM EGTA, 1% NP-40, 0.5mM PMSF, 0.1mM DTT, 0.1mM Na3VO4, 및 프로테아제 억제제)을 사용하여 세포 추출물을 준비하였다. 현탁액은 4℃에서 16,000×g, 20분간 원심분리 하였다. 상등액을 모아 샘플 버퍼와 혼합하였다. 단백질 샘플은 SDS-PAGE(8-15%)에서 분리하고, 니트로셀룰로오스 멤브레인으로 옮겼다. 멤브레인과 적당한 항체를 4℃에서 오버나이트 동안 인큐베이션 하였다. 그 후 각 면역 블랏은 서양고추냉이의 페록시다아제 표지된 2차 항체에서 인큐베이션 하였다. 면역 표지된 단백질은 ECL 분석(Amersham)을 사용하여 관찰하였고, X-선 필름을 사용하여 ECL 반응을 현상하였다. 상기 블랏을 벗긴 후 항-β-액틴을 다시 반응시켜 내부 대조군으로 사용하였다.
(루시퍼라아제 리포터 유전자 활성 분석)
적절히 트랜스펙션 된 세포를 차가운 PBS로 2회 세척하고, 리포터 라이시스 버퍼(Promega)를 사용하여 배양 접시에서 용해시켰다. 루시퍼라아제 분석은 루시퍼라아제 분석 시스템(Promega Corporation, Madison, WI)을 사용하여 수행하였다. 루시퍼라아제 활성은 제조업체의 설명서에 따라 Luminometer 20/20n(Turner BioSystems, Sunnyvale, CA)에서 기록하였다. 루시퍼라아제 활성은 β-갈락토시다아제 활성으로 표준화하였다. β-갈락토시다아제 분석을 위해, CMV-β-갈락토시다아제를 루시퍼라아제 리포터 유전자와 함께 트랜스펙션 시켰다. 모든 데이터는 적어도 3회 독립 실험에서 평균±표준편차로 나타내었다.
(공-면역침전 분석)
293T 세포를 수득하고, 차가운 PBS로 세척하였다. IP 라이시스 버퍼[25mM Tris-HCl(pH 7.4), 150mM NaCl, 1mM EDTA, 1% NP-40 및 5% 글리세롤, 및 프로테아제 억제제]에서 세포를 재현탁하였다. 현탁액을 4℃에서 16,000×g으로 20분간 원심분리 하였다. 상등액을 수집하고, 0.5㎍의 적당한 항체 및 25㎕의 단백질 A/G-아가로오스 또는 GST Sepharose 4B 비드와 4℃에서 24시간 동안 인큐베이션 하였다. 단백질 복합체는 차가운 IP 라이시스 버퍼로 1,000×g로 1분간 원심분리 하여 5회 세척하였다. 최종 펠렛은 5% β-머캅토에탄올을 포함하는 50㎕의 SDS-샘플 버퍼로 재현탁하고, 100℃에서 10분간 끓였다. 단백질 샘플을 SDS-PAGE(8-10%)에서 분리하고, 니트로셀룰로오스 멤브레인으로 옮겼다. 함께 침전된 단백질은 특이 항체를 사용하여 웨스턴 블랏팅에 따라 검출하였다.
(형광 현미경 분석)
C3H10T1/2 세포는 Flag-sLZIP, GFP-PPARγ2 또는 GFP-sLZIP으로 일시적으로 함께 트랜스펙션 시키고, HDAC3는 커버 슬립에서 배양하였다. 24시간 후, 4% 파라포름알데히드로 10분간 세포를 고정하고, 0.2% Triton-X 100로 5분간 침투시켰다. 세포는 1% BSA와 1시간 동안 인큐베이션 하고 나서, 항-Flag 및 항-HDAC3 항체들과 4℃에서 오버나이트 동안 인큐베이션 하였다. PBS로 세척한 후, 세포를 텍사스 레드가 결합된 항체와 2시간 동안 인큐베이션 하였다. PBS로 커버 슬라이드를 세척하고, 장착하고, LSM 510 META 공초점 현미경(Carl Zeiss, Jena, Germany)를 사용하여 시험하였다.
(His-sLZIP 단백질의 정제)
sLZIP는 pET-28a(+) 벡터에 클로닝하였다. His-sLZIP 단백질은 T7 isopropyl-β-D-thiogalactopyranoside(IPTG)-유도 시스템을 사용하여 대장균(Escherichia coli BL21) 세포에서 발현하였다. IPTG-유도된 세포는 초음파 처리에 따라 파쇄하고, 세포 용해물은 원심분리 하여 맑게 하였다. His-sLZIP 단백질을 니켈-니트릴로트리아세트산 비드 컬럼(Bio-Rad, Richmond, CA)에 넣었다. 다량의 라이시스 버퍼와 10mM 이미다졸로 상기 컬럼을 세척하고 나서, Ni-NTA 용출 버퍼(Bio-Rad Laboratories, Hercules, CA)에서 용출하였다. His-sLZIP 단백질을 포함하는 분획을 10% 글리세롤에 대해 투석시키고, -80℃에서 저장하였다. 단백질 정제는 10% SDS-PAGE/쿠마시 블루 염색에 따라 평가하였고, 보통 >98%의 순도를 나타내었다.
(sLZIP 형질전환 마우스 생산)
사람의 sLZIP 형질전환(TG) 마우스를 생산하기 위해, sLZIP 유전자를 pCMV-flag 발현 벡터에 클로닝하였다. sLZIP TG 마우스는 Macrogen, Inc(Seoul, Korea)에서 생산하였다. 형질전환 창시자(Transgenic founders)를 야생형 C57BL/6 마우스와 교미시켜 F1 이형접합체(heterozygote)를 생산하였다. F1-F4 세대는 2주령째에 트랜스유전자에 대해 유전학적으로 스크리닝 하였다. 하기 2개의 프라이머는 야생형과 TG 마우스를 동정하기 위한 게놈 DNA를 증폭하는데 사용하였다: 5'- GGA CGA TGA TGA CAA GGA CT -3' 및 5'- GTC AGA GGA GTA CAT GCT GCT -3'.
(통계 분석)
데이터는 평균±표준편차로 나타내었다. 통계 평가는 one-way ANOVA를 사용하여 시행하였다. 데이터는 p<0.05일 때 통계적으로 유의한 것으로 간주하였다. 모든 통계 분석은 컴퓨터 프로그램 Prism(GraphPad Software, La Jolla, CA)에 따라 수행하였다.
<실시예 1> sLZIP의 PPARγ 전사활성에 대한 효과
핵 수용체 PPARγ는 MSCs에서 지방세포 분화의 중요한 양성 조절자로, 조골세포 발생에서는 음성 조절자로 작용한다. 선행 연구에서, sLZIP는 많은 종류의 핵 수용체 전사활성, 예컨대, GR, 에스트로겐 수용체(ER) 및 안드로겐 수용체(AR)에 관련되어 있는 것으로 알려져 있다. 또한, 사람의 sLZIP는 핵 수용체들과 결합하기 위한 필수적이고 충분한 2개의 LxxLL 모티프를 포함한다. 따라서, 본 발명자들은 sLZIP 및 PPARγ2 간의 관계에 초점을 맞추었다.
PPARγ2의 전사활성에 대한 sLZIP의 효과를 조사하기 위해, 293T 세포를 PPARγ2(0.5㎍), β-갈락토시다아제(0.1㎍), FABP4-Luc 리포터 유전자(0.2㎍) 및 함량 별 sLZIP(0.1-0.5㎍)으로 일시적으로 함께 트랜스펙션 시켰다. 트랜스펙션 후, 10nM의 로시글리타존(RZD)(도 1A), 피오글리타존(PZD)(도 1B), 및 트로글리타존(TZD)(도 1C)이 있거나 없는 상태에서 세포를 자극하였다. 트랜스펙션 24시간 후, 세포에 리간드 처리하거나 그렇지 않고, 루시퍼라아제 상대 활성을 분석하였다. 또한, 293T 세포를 함량별로 si-sLZIP(50 및 100nM)로 일시적으로 트랜스펙션 하고, 세포에 RZD(도 1D)를 처리하거나 그렇지 않았다. FABP4-Luc 안정한 C3H10T1/2 세포를 sLZIP 발현 아데노바이러스로 감염시킨 후 4일 동안 지방세포로 분화시켰다(도 1E). 루시퍼라아제 활성은 β-갈락토시다아제 활성에 대해 표준화하였고, 상대 활성(배수 변화)으로 표시하였다. 모든 실험은 3반복으로 수행하였고, 그래프 내 막대 표시는 평균±표준편차를 나타낸다. *, P<0.05; **, P<0.01
도 1A 내지 C에 나타난 바와 같이, sLZIP는 농도 의존적인 방식으로 PPARγ2의 전사활성을 억제하였다. PPARγ2의 전사활성은 대조군과 비교하여 다양한 PPARγ2 리간드 유무에 따라 sLZIP에 의해 하향-조절되었다.
PPARγ2의 전사활성에 대한 sLZIP의 효과를 확인하기 위해, sLZIP에 대한 siRNA(si-sLZIP)를 사용하여 sLZIP 발현을 넉다운 시킨 결과, si-sLZIP에 의한 sLZIP 발현 억제는 PPARγ2의 전사활성을 향상시켰다(도 1D).
또한, 세포 내 PPARγ2의 전사활성이 sLZIP에 의해 조절되는지를 조사하기 위해, FABP4 리포터 유전자를 안정하게 발현하는 C3H10T1/2 세포를 sLZIP 발현 아데노바이러스로 감염시키고 나서, 지방세포로 분화시킨 결과, 도 1E에 나타난 바와 같이, PPARγ2의 전사활성은 지방세포에서 sLZIP에 의해 감소하였다.
<실시예 2> sLZIP 및 PPARγ2의 결합능 조사
PPARγ2의 전사활성이 sLZIP와의 결합에 의해 조절되는지를 조사하기 위해, sLZIP와 PPARγ2의 결합을 시험하였다. 이를 위해, GST-sLZIP 및 Myc-PPARγ2를 293T 세포에 트랜스펙션 시켰다. 세포 용해물을 수득하고, 글루타티온 4B 비드를 사용하여 GST 풀-다운 분석을 수행하였다. 단백질 복합체는 SDS-PAGE로 분석하고 나서 특정 항체(도 2A)를 사용하여 면역 블랏팅을 수행하였다. 293T세포를 GST-PPARγ2 및 Flag-sLZIP로 트랜스펙션 시키고, GST-풀 다운 분석에 따라 확인하였다(도 2B). PPARγ2는 TNT 번역 시스템(Promega)에 의해 시험관 내에서 번역되었고, His-sLZIP 단백질은 IPTG-유도 시스템을 사용하여 BL21 세포에서 발현되었다. 정제된 His-sLZIP 단백질은 His 풀-다운 분석을 실시하였다. 비드에 결합된 단백질은 SDS-PAGE에서 분석하고 나서 항- PPARγ2, 항-His 항체를 사용하여 면역 블랏팅 하였다(도 2C). GFP-PPARγ2 및 Flag-sLZIP 구조물은 C3H10T1/2 세포에서 발현되었고, 마우스 항-Flag 및 텍사스 레드 결합된 항-마우스 항체를 사용하여 형광 현미경에서 분석하였다. 핵은 DAPI로 염색하였다(도 2D).
도 2A에 나타난 바와 같이, sLZIP는 PPARγ2와 결합하였다.
상기 결합을 확인하기 위하여 GST-PPARγ2와 Flag-sLZIP를 293T 세포에 트랜스펙션 시키고, GST 풀-다운 분석을 수행한 결과 PPARγ2는 sLZIP과 결합하였다(도 2B).
sLZIP가 직접적으로 PPARγ2와 결합하는지를 시험한 결과, 도 2C에 나타난 바와 같이, PPARγ2는 직접적으로 sLZIP에 결합하였다.
또한, sLZIP와 PPARγ2 간의 결합을 특성 규명하기 위해, sLZIP와 PPARγ2의 세포 내 위치를 시험하였다. sLZIP는 PPARγ2와 함께 핵에 위치하였다(도 2D).
상기 결과로부터 sLZIP가 PPARγ2와의 직접 결합을 통해 PPARγ2의 전사활성을 부정적으로 조절함을 알 수 있었다.
많은 핵 수용체들의 활성화는 도움인자들의 보충에 달려있다. 따라서, PPARγ2와 결합하는데 필요한 sLZIP의 도메인을 조사하였다. 이를 위해, GST-전장 sLZIP (1-354), N-말단 결실 돌연변이체 sLZIP(1-228), C-말단 결실 돌연변이체 sLZIP(229-354), CC-말단 결실 돌연변이체 sLZIP(297-354) 및 PPARγ2를 293T 세포에 트랜스펙션 시켰다. 세포 용해물을 수득하고, 글루타티온 4B 비드를 사용하여 GST 풀-다운 분석을 수행하였다. 단백질 복합체는 SDS-PAGE에서 분석하고 나서, 특정 항체를 사용하여 면역 블랏팅을 하였다(도 3A). 293T 세포를 Flag-전장 PPARγ2, 전장 PPARγ2, N-말단 결실 돌연변이체 PPARγ2(1-310), C-말단 결실 돌연변이체 PPARγ2(139-505) 및 GST-sLZIP으로 트랜스펙션 시켰다. 세포 용해물을 수득하고, GST 풀-다운 분석을 수행하였다. 단백질 복합체는 SDS-PAGE에서 분석하고 나서, 항-GST 및 항-Flag 항체를 사용하여 면역 블랏팅을 하였다(도 3B).
도 3A에 나타난 바와 같이, 야생형 sLZIP 및 sLZIP의 C 및 CC 도메인은 PPARγ2와 결합하나, sLZIP N 도메인은 PPARγ2와 결합하지 않았다. 이는 프롤린이 풍부한 영역을 포함하는 sLZIP의 CC-말단 도메인이 PPARγ2와의 결합에 중요함을 알 수 있다.
또한, sLZIP과 결합하는데 필요한 PPARγ2의 도메인을 시험한 결과, 도 3B에 나타난 바와 같이, PPARγ2의 리간드 결합 도메인(AF-2)이 sLZIP과 결합하는데 필수적이었다.
즉, PPARγ2가 sLZIP과 결합하나, sLZIP의 LxxLL 모티프는 결합능에 필수적인 것은 아님을 입증한 것이다.
<실시예 3> sLZIP에 의한 PPARγ2 전사활성 억제에서 HDAC3의 역할 규명
PPARγ의 전사활성은 도움인자와 억제보체에 의해 조절된다. 일반적으로, 휴지기 상태에서 PPARγ2는 억제보체 복합체, 예컨대, HDAC3, SMRT 및 NCoR과 결합하는 것으로 생각된다. 그러나, 리간드에 의한 활성화 시 억제보체 복합체는 도움인자, 예컨대, p300/CBP, p160, 및 PGC-1으로 대체되어, 표적 유전자의 전사 개시를 이끈다. 선행 연구에서 sLZIP는 HDACs를 모집 및 활성화하여 GR 전사활성을 감소시킴을 보여준바 있다. HDAC3는 또한 모든 클래스 1 HDACs 중에서 LZIP와 특이적으로 결합한다. 따라서, HDACs에 의한 PPARγ2 전사활성에 대한 sLZIP의 효과를 이해하기 위해, HDACs 억제제인 트리코스테인 A(trichostain A, TSA)를 사용하여 HDACs가 sLZIP에 의한 PPARγ2 전사활성 억제에 관여하는 지를 시험하였다.
이를 위해, 293T 세포를 PPARγ2(0.5㎍), β-갈락토시다아제(0.1㎍), FABP4-Luc 리포터 유전자(0.2㎍) 및 sLZIP(0.1㎍)으로 함께 일시적으로 트랜스펙션 시켰다. 트랜스펙션 후, 10nM의 RZD 및 10nM의 TSA 유무 하에서 세포를 자극하였다(도 4A). 프로모터 활성은 루시퍼라아제 분석에 따라 측정하였다. 293T 세포에서 FABP4-Luc 리포터 유전자, sLZIP, PPAR, β-갈락토시다아제, 및 대조군에 대한 100nM의 si-RNAs, 및 HDAC1, 2, 3 및 8를 발현시켰다. 트랜스펙션 후 10nM의 RZD 유무 하에서 세포를 자극하였고, 프로모터 활성을 측정하였다(도 4B). 293T 세포를 FABP4-Luc 리포터 유전자, PPARγ2, β-갈락토시다아제, HDAC3(0.5㎍) 및 sLZIP(0.1㎍)로 함께 순간적으로 트랜스펙션 시켰다. 트랜스펙션 후 10nM의 RZD 유무 하에서 세포를 자극하였고, 루시퍼라아제 분석을 수행하였다(도 4C). 루시퍼라아제 활성은 β-갈락토시다아제 활성에 대해 표준화 하였고, 상대 강도(배수 변화)로 표시하였다. 모든 실험은 3반복으로 수행하였고, 그래프 내 막대 표시는 평균±표준편차를 나타낸다. GFP-sLZIP 발현 구조물을 C3H10T1/2 세포에서 발현시키고, 토끼 항-HDAC3 항체 및 텍사스 레드-결합된 항-토끼 항체를 사용하여 형광 현미경에서 분석하였다. 핵은 DAPI로 염색하였다(도 4D). 293T 세포를 GST-HDAC3 및 Flag-sLZIP로 함께 트랜스펙션 시켰다. 세포 용해물을 글루타티온 4B 비드를 사용하여 풀-다운시켰다. 단백질 복합체는 SDS-PAGE에서 분석하고, 항-GST 및 항-Flag 항체를 사용하여 면역 블랏팅 하였다(도 4E). *, P<0.05; **, P<0.01
도 4A에 나타난 바와 같이, TSA가 없는 상태에서, sLZIP는 PPARγ2 전사활성을 억제하나, TSA가 처리된 세포에서 sLZIP는 PPARγ2 전사활성을 감소하지 않았다.
다음으로, sLZIP가 매개하는 PPARγ2 전사활성의 억제가 클래스 1 HDACs 중 HDAC3에만 한정된 것인지를 조사한 결과, 도 4B에 나타난 바와 같이, HDAC1, 2 및 8에 대한 siRNA는 sLZIP가 매개하는 PPARγ2 조절에 관여하지 않았다. 그러나, HDAC3의 넉다운 결과 sLZIP가 매개하는 PPARγ2 전사활성을 극적으로 향상시켰다.
이 결과를 확인하기 위해, sLZIP 및 HDAC3 발현 구조물로 세포를 트랜스펙션 시킨 결과 sLZIP가 매개하는 PPARγ2 전사활성의 억제는 sLZIP 및 HDAC3 둘 다를 트랜스펙션 하여 상당히 하향-조절되었다(도 4C).
다음으로, sLZIP 및 HDAC3의 세포 내 위치를 시험한 결과, sLZIP는 HDAC3과 함께 핵에 위치하였다(도 4D).
HDAC3는 LZIP과 특이적으로 결합한다고 보고되어 있기 때문에, sLZIP 및 HDAC3 간의 결합을 시험한 결과, sLZIP는 HDAC3와 결합하였다(도 4E).
즉, sLZIP가 HDAC3와 결합하여 PPARγ2 전사활성을 부정적으로 조절함을 알 수 있다.
<실시예 4> sLZIP의 PPARγ2와 억제보체의 복합체 형성에 대한 효과
억제보체 복합체는 핵 수용체와 리간드 결합 시 도움인자에 의해 대체된다. 따라서, 리간드 처리에 의한 sLZIP 및 PPARγ2 간의 결합을 조사하였다.
이를 위해, 293T 세포를 GST-PPARγ2 및 Flag-sLZIP로 트랜스펙션 시키고, 10nM RZD를 24시간 동안 처리하거나 그렇지 않았다. 세포 용해물을 수득하고, 글루타티온 4B 비드를 사용하여 GST 풀-다운 분석(도 5A)과 면역침전(도 5B)을 실시하였다. 단백질 복합체는 SDS-PAGE에서 분석하고, 항-GST 및 항-Flag 항체를 사용하여 면역 블랏팅하였다. GST- PPARγ2 및 Flag-sLZIP를 293T 세포에서 발현시키고, 시간대 별로 세포에 10nM RZD를 처리하였다. 세포 용해물은 GST 풀-다운 분석하였다(도 5C). 293T 세포를 GST-HDAC3 및 Flag-sLZIP으로 트랜스펙션 시키고, 10nM RZD로 24시간 동안 처리하거나 그렇지 않았다. 세포 용해물은 GST 풀-다운 분석하였다(도 5D). Flag-sLZIP를 293T 세포에 발현시키고, 세포에 10nM RZD를 24시간 처리하였다. 세포 용해물에 대해 항-NCoR1 항체를 사용하여 면역 침전 분석을 실시하였다. 단백질 복합체는 SDS-PAGE에서 분석한 후 항-NCoR1 및 항-Flag 항체를 사용하여 면역 블랏팅하였다(도 5E). 293T 세포는 PPARγ2(0.5㎍), β-갈락토시다아제(0.1㎍), FABP4-Luc 리포터 유전자(0.2㎍) 및 sLZIP의 다양한 결실 돌연변이체(0.1㎍)로 함께 일시적으로 트랜스펙션 시켰다. 트랜스펙션 후, 10nM의 RZD를 처리하거나 그렇지 않고 세포를 자극하였다(도 5F). 루시퍼라아제 활성은 β-갈락토시다아제 활성에 대해 표준화하였고, 상대 활성(배수 변화)으로 표현하였다. 모든 실험은 3반복으로 수행하였고, 평균±표준편차로 나타내었다. *, P<0.05; **, P<0.01
GST 풀-다운 실험 결과, sLZIP는 리간드로 자극하지 않는 경우 PPARγ2와 결합하였다(도 5A). 그러나, 리간드 처리 시 sLZIP는 PPARγ2로부터 분리되었다.
면역 침전 분석을 사용하여 Flag-sLZIP 및 GST-PPARγ2를 발현하는 세포에서 sLZIP 및 PPARγ2 간의 결합을 시험한 결과, 도 5B에 나타난 바와 같이, 리간드 처리 시 PPARγ2는 sLZIP에서 분리되었다.
리간드 의존적인 분리를 확인하기 위해, RZD에 대한 반응에서 sLZIP 및 PPARγ2 간의 결합의 시간 의존성을 시험한 결과, sLZIP는 시간 의존적인 방식으로 PPARγ2에서 분리되었다(도 5C).
다음으로, PPARγ2의 억제보체 복합체와의 결합에 대한 sLZIP의 효과를 시험한 결과, sLZIP는 RZD를 처리하지 않는 경우 PPARγ2 억제보체 복합체에서 HDAC3와 결합하였다(도 5D). 비록 RZD 처리로 PPARγ2가 sLZIP에서 분리하나 HDAC3는 sLZIP에 결합된 채로 남아있었다(도 5D). 그러나, NCoR1은 RZD 처리 시 sLZIP에서 약간 분리되었다(도 5E).
또한, PPARγ2와의 리간드-의존적 결합에서 sLZIP의 조절 메카니즘과 PPARγ2 전사활성 조절에서 그것의 관련성을 조사한 결과, sLZIP는 RZD를 처리한 경우 PPARγ2에서 분리되었고, 여전히 PPARγ2 전사활성을 억제하였다(도 5F). PPARγ2 전사활성은 PPARγ2와 결합하지 않는 sLZIP의 결실 돌연변이체(1-220)에 의해 억제되었다(도 5F).
LZIP는 N-말단 활성 도메인(1-220)을 포함하고, cAMP-반응 요소(CREs)-함유 리포터 유전자의 전사활성에 관여하는 것으로 보고되어 있다. 즉, sLZIP가 PPARγ2와 결합하고, 아마도 FABP4 프로모터 영역에 결합하여 그것의 전사활성을 조절하는 것으로 보인다.
따라서, FABP4 프로모터 영역에 결합함에 따른 PPARγ2 전사활성에서 sLZIP의 조절 메카니즘을 이해하기 위해 PPARγ2 및 HDAC3 간의 결합 시 sLZIP의 효과를 조사하였다. 이를 위해, 293T 세포를 GST-HDAC3, Myc-PPARγ2 및 Flag-sLZIP로 트랜스펙션 시키고, 10nM RZD를 24시간 동안 처리하거나 그렇지 않았다. 세포 용해물은 글루타티온 4B 비드를 사용하여 GST 풀-다운 분석을 실시하고, 단백질 복합체는 SDS-PAGE에서 분석한 후 항-GST, 항-Myc 및 항-Flag 항체를 사용하여 면역 블랏팅하였다(도 6A). GST-HDAC3, GST-PPARγ2, Myc-PPARγ2, Flag-sLZIP 및 Ha-UB를 293T 세포에서 발현시키고, 10nM RZD를 세포에 24시간 동안 처리하였다. 세포 용해물은 GST 풀-다운 분석을 실시하였다(도 6B). GST-PPARγ2 및 Flag-sLZIP를 293T 세포에서 발현시키고, 10nM RZD를 24시간 동안 처리하였다. 세포 용해물은 GST 풀-다운 분석을 실시하고, 단백질 복합체는 SDS-PAGE에서 분석한 후 항-PGC1α, 항-GST 및 항-Flag 항체를 사용하여 면역 블랏팅 하였다(도 6C).
도 6A에 나타난 바와 같이, GST 풀-다운 분석 결과 sLZIP는 리간드 처리 시 PPARγ2 및 HDAC3 간의 결합을 향상시켰다.
PPARγ2는 리간드를 처리하지 않는 경우 HDAC3 같은 억제보체와 결합하고, PPARγ2 리간드, 로시글리타존의 첨가로 PPARγ-억제보체 복합체의 분리가 일어나 유비퀴틴/프로테오좀 경로에 의한 분해를 유도한다. sLZIP가 HDAC3 유비퀴틴화에 관여하는 지를 측정한 결과, sLZIP는 리간드 처리 시 HDAC3 유비퀴틴화를 억제하였다(도 6B).
또한, sLZIP는 PPARγ2에 대해 도움인자 PGC-1α의 보충을 억제하였다(도 6C).
상기 결과로부터 sLZIP이 PPARγ2와 결합하여 PPARγ2 전사활성을 조절하고, 억제보체 복합체 형성을 향상시킴을 알 수 있다.
<실시예 5> sLZIP의 Runx2 전사활성에 대한 효과
PPARγ는 중간엽 계대 측정 시 중요한 역할을 담당하는 것으로 보고되어 있다. MSCs의 조골세포 또는 지방세포 중 어느 하나로의 분화는 2가지 주요 전사 인자인 Runx2 및 PPARγ2에 의해 전사적으로 조절된다. PPARγ2의 활성화는 Runx2가 매개하는 전사를 억제하고, 로시글리타존 같은 TZD는 동시에 조골세포 분화를 억제한다.
따라서, PPARγ2 전사활성을 억제하여 Runx2 전사활성에서 sLZIP의 잠재적 역할을 특성 규명하기 위해, Runx2 전사활성을 시험하였다. 이를 위해, 293T 세포를 Runx2(0.5㎍), β-갈락토시다아제(0.1㎍), 6 카피 수의 Runx2 반응 요소(0.2㎍) 및 함량별 sLZIP(0.1㎍-0.5㎍)로 일시적으로 함께 트랜스펙션 시켰다(도 7A). PPARγ2(0.5㎍), β-갈락토시다아제, Runx2, 6 카피 수의 Runx2 반응 요소 및 sLZIP(0.5㎍)를 293T 세포에서 발현시켰다(도 7B). 293T 세포는 HDAC3 (0.5㎍), Runx2, β-갈락토시다아제, 6 카피 수의 Runx2 반응 요소 및 함량별 sLZIP(0.25 및 0.5㎍)으로 일시적으로 함께 트랜스펙션 시켰다(도 7C). 프로모터 활성은 루시퍼라아제 분석에 따라 측정하였다. 루시퍼라아제 활성은 β-갈락토시다아제 활성에 대해 표준화하였고, 상대 활성(배수 변화)으로 표시하였다. 모든 실험은 3반복으로 수행하였고, 평균±표준편차로 나타내었다. 사람의 원발성 MSCs 및 C3H10T1/2 세포는 50㎍/mL의 아스코르브산, 10mM β-글리세로포스페이트 및 10% FBS를 포함하는 분화 배지로 8일 동안 바꿔주었다(도 7D). MEF 세포는 50㎍/mL의 아스코르브산, 10mM β-글리세로포스페이트 및 10% FBS를 포함하는 분화 배지로 8일 동안 바꿔주었다. 세포는 알리자린 레드 용액으로 염색하고, 광학 현미경으로 관찰하였다(도 7E). E17.5에서 야생형 및 sLZIP TG 마우스 배아의 알시안 블루(연골 염색용) 및 알리자린 레드(뼈 염색용) 염색(F). *, P<0.05; **, P<0.01
도 7A에 나타난 바와 같이, sLZIP는 대략 4배 정도로 Runx2의 전사활성을 증가하였다.
다음으로, PPARγ2 및 Runx2의 전사활성 조절에서 sLZIP의 역할을 시험한 결과, 도 7B에 나타난 바와 같이, PPARγ2는 Runx2의 전사활성을 억제하나, sLZIP는 Runx2의 활성을 회복시켰다.
HDAC3가 sLZIP에 의해 조절된 Runx2 전사활성에 영향을 주는지 시험한 결과, 비록 HDAC3가 Runx2 전사활성을 감소시키기는 하나, sLZIP는 Runx2의 전사활성을 회복시켰다(도 7C). 따라서, sLZIP는 사람의 원발성 MSCs 및 C3H10T1/2 세포에서 조골세포 분화를 증가시켰다(도 7D).
또한, MEFs에서 조골세포 분화를 시험한 결과, 알리자린 레드 염색 결과, sLZIP는 조골세포 분화 및 골결절 형성을 촉진하였다(도 7E).
시험관 내 결과를 확증하기 위해, 생체 내에서 골화에 대한 sLZIP의 효과를 시험한 결과, 도 7F에 나타난 바와 같이, E17.5에서 연골 특이 알시안 블루(Alcian Blue) 및 뼈 특이 알리자린 레드(Alizarin Red) 염색 결과, sLZIP TG 마우스 배아의 두개골 및 다리(limb)는 야생형 한배 새끼(littermate)와 비교하여 촉진된 골화를 나타냈다.
배아 동안 뼈가 처음 발달하기 시작할 때, 연골이 형성되어 소위 골화(또는 골 형성) 과정에 의해 뼈로 경화된다. sLZIP가 매개하는 골 형성이 연골 발달과 연관되어 있는 지를 조사하기 위해, 연골세포 분화 시 sLZIP의 효과를 시험하였다. 이를 위해, ATDC5 세포를 함량별 sLZIP(0.1㎍-0.5㎍)로 일시적으로 트랜스펙션 시켰다. 세포에서 총 RNA를 추출하고, RT-PCR 분석(도 8A) 및 실시간 PCR(도 8B)을 사용하여 연골세포 마커의 mRNA 발현 수준을 측정하였다. GAPDH는 내부 대조군으로 사용하였다. 실험은 3반복으로 수행하였다. 알시안 블루(연골 염색용) 염색은 E12.5에서 야생형 및 sLZIP TG 마우스 배아에서 수행하였다(도 8C). sLZIP TG 마우스 BMMs(bone marrow macrophages) 유래의 성숙 파골세포는 RANKL (100ng/mL) 및 M-CSF(30ng/mL)와 함께 a-MEM + 10% FBS에서 배양하였다. 상기 배지는 3일 마다 교체하였다. 성숙 파골세포에서 총 RNA를 추출하고, 실시간 PCR을 사용하여 파골세포 마커의 mRNA 발현 수준을 측정하였다(도 8D). GAPDH는 내부 대조군으로 사용하였다. 모든 실험은 3반복으로 수행하였고, 평균±표준편차로 나타내었다. *, P<0.05; **, P<0.01
도 8A 및 B에 나타난 바와 같이, 인슐린과의 반응에서 sLZIP는 연골세포 분화 마커 유전자, 예컨대 Sox9 및 ColIIIA1의 발현에 영향을 주지 않았다.
상기 결과를 확인하기 위해 배아에서 연골 발달 시 sLZIP의 효과를 측정한 결과, 도 8C에 나타난 바와 같이, E12.5에서 연골-특이 알시안 블루 염색 결과, sLZIP TG 마우스 배아의 가지 및 꼬리는 야생형과 비교하여 차이가 없었다.
척추동물에서 골 항상성은 조골세포에 의한 뼈 형성과 조골세포에 의한 골 흡수 간의 균형에 의해 유지된다. 조골세포는 골 형성뿐만 아니라 파골세포 형성을 조절한다. sLZIP가 파골세포 분화를 조절하는지를 측정하기 위해, sLZIP TG 마우스에서 분리한 골수 대식세포를 파골세포로 분화시켰다. 그 결과, 파골세포 마커, 예컨대, Oscar, Ctsk 및 TARP는 야생형 및 sLZIP TG 마우스 간에 차이가 없었다(도 8D).
상기 결과로부터 도 9와 같이, sLZIP는 다능성 중간엽 전구세포에서 조골세포 형성을 유도하나, 골 형성에서 연골세포 형성 및 파골세포 형성에는 영향을 주지 않음을 알 수 있었다.
본 발명은 골이형성증, 골다공증, 골연화증 등의 골 질환 치료제로 사용할 수 있다.

Claims (8)

  1. 분화 조절제로, 인간 작은 류신 지퍼 단백질(human small leucine-zipper protein)을 포함하는 중간엽 줄기세포에서 조골세포로의 분화 촉진용 조성물.
  2. 제1항에 있어서,
    인간 작은 류신 지퍼 단백질은 SEQ ID NO: 1에 기재된 아미노산 서열로 표시되는 중간엽 줄기세포에서 조골세포로의 분화 촉진용 조성물.
  3. 인간 작은 류신 지퍼 단백질(human small leucine-zipper protein)을 포함하는 골 질환 예방 또는 치료용 조성물.
  4. 제3항에 있어서,
    인간 작은 류신 지퍼 단백질은 SEQ ID NO: 1에 기재된 아미노산 서열로 표시되는 골 질환 예방 또는 치료용 조성물.
  5. 제3항에 있어서,
    인간 작은 류신 지퍼 단백질은 천연 또는 재조합 단백질 형태, 또는 인간 작은 류신 지퍼 단백질을 과발현하는 형질전환 줄기세포 형태로 포함되는 골 질환 예방 또는 치료용 조성물.
  6. 제3항에 있어서,
    골 질환은 골이형성증, 골다공증 또는 골연화증을 포함하는 골 질환 예방 또는 치료용 조성물.
  7. 인간 작은 류신 지퍼 단백질(human small leucine-zipper protein)의 유전자를 후보물질과 인체 외에서 접촉시키고,
    상기 후보물질이 상기 유전자의 발현을 촉진하는지 또는 억제하는지를 판단하는 것을 포함하는 골 질환의 예방 또는 치료용 의약의 스크리닝 방법.
  8. 인간 작은 류신 지퍼 단백질(human small leucine-zipper protein)을 후보물질과 인체 외에서 접촉시키고,
    상기 후보물질이 상기 단백질의 기능 또는 활성을 증진하는지 또는 억제하는지를 판단하는 것을 포함하는 골 질환의 예방 또는 치료용 의약의 스크리닝 방법.
PCT/KR2014/003857 2013-04-10 2014-04-30 골 형성 과정에서 인간 작은 류신 지퍼 단백질의 용도 Ceased WO2014178649A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US14/888,340 US9962425B2 (en) 2013-04-30 2014-04-30 Use of human small leucine zipper protein in osteogenesis procedure
US15/945,858 US10456446B2 (en) 2013-04-10 2018-04-05 Use of human small leucine zipper protein in osteogenesis procedure

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2013-0048131 2013-04-10
KR1020130048131A KR101535336B1 (ko) 2013-04-30 2013-04-30 골 형성 과정에서 인간 작은 류신 지퍼 단백질의 용도

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US14/888,340 A-371-Of-International US9962425B2 (en) 2013-04-30 2014-04-30 Use of human small leucine zipper protein in osteogenesis procedure
US15/945,858 Division US10456446B2 (en) 2013-04-10 2018-04-05 Use of human small leucine zipper protein in osteogenesis procedure

Publications (1)

Publication Number Publication Date
WO2014178649A1 true WO2014178649A1 (ko) 2014-11-06

Family

ID=51843699

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2014/003857 Ceased WO2014178649A1 (ko) 2013-04-10 2014-04-30 골 형성 과정에서 인간 작은 류신 지퍼 단백질의 용도

Country Status (3)

Country Link
US (2) US9962425B2 (ko)
KR (1) KR101535336B1 (ko)
WO (1) WO2014178649A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2026078185A1 (en) * 2024-10-10 2026-04-16 Institut National De La Sante Et De La Recherche Medicale Creb3 for the treatment or the prevention of amyotrophic lateral sclerosis

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2007200133B2 (en) * 2001-05-23 2009-08-13 Mcneil-Ppc, Inc. Adaptable absorbent articles

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20110044545A (ko) * 2009-10-23 2011-04-29 고려대학교 산학협력단 신규한 인간 류신 지퍼 단백질 아형 및 이의 용도

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040142325A1 (en) * 2001-09-14 2004-07-22 Liat Mintz Methods and systems for annotating biomolecular sequences
EP1774043A4 (en) * 2004-05-28 2009-09-02 Dana Farber Cancer Inst Inc COMPOSITIONS, KITS AND METHODS OF IDENTIFICATION, ASSESSMENT, PREVENTION AND THERAPY OF CANCER
EP2111225A4 (en) * 2006-12-19 2010-02-10 Univ California INHIBITION OF PPAR GAMMA EXPRESSION BY SPECIFIC OSTEOGENIC OXYSTEROLE
KR101535337B1 (ko) * 2013-04-30 2015-07-09 고려대학교 산학협력단 지방세포 분화 과정에서 인간 작은 류신 지퍼 단백질의 용도

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20110044545A (ko) * 2009-10-23 2011-04-29 고려대학교 산학협력단 신규한 인간 류신 지퍼 단백질 아형 및 이의 용도

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE WPI 3 November 2009 Derwent World Patents Index; *
KANG ET AL.: "A novel isoform of human LZIP negatively regulates the transactivation of the glucocorticoid receptor", MOLECULAR ENDOCRINOLOGY, vol. 23, no. 11, 2009, pages 1746 - 1757 *
RAUCH ET AL.: "Glucocorticoids suppress bone formation by attenuating osteoblast differentiation via the monomeric glucocorticoid receptor", CELL METABOLISM, vol. 11, no. 6, 2010, pages 517 - 531, XP055009764, DOI: doi:10.1016/j.cmet.2010.05.005 *
ZHANG ET AL.: "Regulation of mesenchymal stem cell osteogenic differentiation by glucocorticoid-induced leucine zipper (GILZ", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 283, no. 8, 2008, pages 4723 - 4729 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2026078185A1 (en) * 2024-10-10 2026-04-16 Institut National De La Sante Et De La Recherche Medicale Creb3 for the treatment or the prevention of amyotrophic lateral sclerosis

Also Published As

Publication number Publication date
US20160067308A1 (en) 2016-03-10
US9962425B2 (en) 2018-05-08
KR101535336B1 (ko) 2015-07-09
KR20140129616A (ko) 2014-11-07
US10456446B2 (en) 2019-10-29
US20180221443A1 (en) 2018-08-09

Similar Documents

Publication Publication Date Title
Batchvarova et al. Inhibition of adipogenesis by the stress‐induced protein CHOP (Gadd153).
Yamada et al. Basic helix-loop-helix transcription factors, BHLHB2 and BHLHB3; their gene expressions are regulated by multiple extracellular stimuli
Don et al. The expanding family of CREB/CREM transcription factors that are involved with spermatogenesis
Geng et al. UCHL1 protects against ischemic heart injury via activating HIF-1α signal pathway
WO2014178653A1 (ko) 지방세포 분화 과정에서 인간 작은 류신 지퍼 단백질의 용도
Chung et al. FoxO6 and PGC-1α form a regulatory loop in myogenic cells
Ciani et al. Induction of the PAC1-R (PACAP-type I receptor) gene by p53 and Zac
US20050282167A1 (en) Methods and compositions for regulating adipogenesis
WO2023140664A1 (ko) 리포칼린 2 또는 이의 수용체의 발현 억제제를 유효성분으로 함유하는 비알코올성지방간염에 의해 유도된 간섬유화 예방 또는 치료용 약학 조성물
WO2018080146A2 (ko) 단백질 탈 인산화 효소 1 억제 펩타이드를 포함하는 혈관 질환 치료용 조성물
WO2014178649A1 (ko) 골 형성 과정에서 인간 작은 류신 지퍼 단백질의 용도
WO2020091463A1 (ko) 분리된 미토콘드리아를 포함하는 건병증 예방 또는 치료용 약학 조성물
WO2023200258A1 (ko) 화학적으로 유도된 유도 만능 줄기세포 유래 중간엽 줄기세포로부터 분리된 세포외 소포체 및 이의 용도
WO2010021516A9 (ko) 뇌 손상 치료를 위한 리포칼린 2의 신규한 용도
WO2022045668A1 (ko) 우유 엑소좀을 포함하는 갈색지방화 유도용 조성물
WO2013176503A1 (ko) 타우 단백질 매개 신경 퇴행성 질환 치료제
KR102072075B1 (ko) TRIM25을 유효성분으로 함유하는 PPARγ 분해용 조성물
WO2020242279A2 (en) Composition and method for inhibiting tau protein accumulation, aggregation, and tangle formation
Shi et al. Energy balance, myostatin, and GILZ: factors regulating adipocyte differentiation in belly and bone
WO2016018090A1 (ko) 혈관신생촉진용 펩타이드 및 이의 용도
WO2017052340A1 (ko) 운동유사효과 유도용 약학 조성물
WO2015111971A1 (ko) Gpr119 리간드를 유효성분으로 포함하는 비알콜성 지방간 질환의 예방 또는 치료용 약학적 조성물
WO2018012769A1 (ko) 자가포식 향상물질 및 그 용도
WO2016159695A1 (ko) Ssu72를 유효성분으로 포함하는 자가면역질환의 예방 또는 치료용 조성물
WO2026049438A1 (ko) 근육 재생 및 근육 성장 촉진용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14792331

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 14888340

Country of ref document: US

122 Ep: pct application non-entry in european phase

Ref document number: 14792331

Country of ref document: EP

Kind code of ref document: A1