WO2014159239A2 - Antibodies against notch 3 - Google Patents

Antibodies against notch 3 Download PDF

Info

Publication number
WO2014159239A2
WO2014159239A2 PCT/US2014/022642 US2014022642W WO2014159239A2 WO 2014159239 A2 WO2014159239 A2 WO 2014159239A2 US 2014022642 W US2014022642 W US 2014022642W WO 2014159239 A2 WO2014159239 A2 WO 2014159239A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
notch
lnr
antibody
fragment
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2014/022642
Other languages
English (en)
French (fr)
Other versions
WO2014159239A3 (en
Inventor
Joelle DEPLAZES-LAUBER
Christy FRYER
Tiancen HU
David Jenkins
Konstantin PETROPOULOS
Philippe Thiel
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novartis AG
Original Assignee
Novartis AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novartis AG filed Critical Novartis AG
Priority to EP19170673.8A priority Critical patent/EP3611189A1/en
Priority to JP2016501025A priority patent/JP2016514130A/ja
Priority to CN201480027023.XA priority patent/CN105246916A/zh
Priority to EP14722403.4A priority patent/EP2970479B1/en
Publication of WO2014159239A2 publication Critical patent/WO2014159239A2/en
Publication of WO2014159239A3 publication Critical patent/WO2014159239A3/en
Priority to US14/853,003 priority patent/US10538587B2/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/3955Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/5758Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/21Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/30Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/32Immunoglobulins specific features characterized by aspects of specificity or valency specific for a neo-epitope on a complex, e.g. antibody-antigen or ligand-receptor
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/30Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/33Crossreactivity, e.g. for species or epitope, or lack of said crossreactivity
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/30Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/34Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/54F(ab')2
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/55Fab or Fab'
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565Complementarity determining region [CDR]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/90Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/50Determining the risk of developing a disease
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/70Mechanisms involved in disease identification
    • G01N2800/7023(Hyper)proliferation
    • G01N2800/7028Cancer

Definitions

  • This invention relates generally to antibodies or fragments thereof which interact with Notch 3.
  • it relates to antibodies or fragments thereof that recognize at least one conformational epitope of Notch 3 or a mutant Notch 3 comprising continuous and discontinuous amino acid residues from the LNR region and the HD of the NRR domain.
  • Notch signaling is an evolutionarily conserved pathway that regulates a diverse set of biological functions including stem cell maintenance, cell differentiation and proliferation in both embryonic development and adult tissues (Kopan et ah, (2009) Cell 137: 216-233, Guruharsha et ah, (2012) Nat Rev Genet. 13 : 654-66, and Andersson et ah, (2001)
  • Notch 1-4 The extracellular domain (ECD) consists of a series of EGF-like repeats followed by a negative regulatory region (NRR) which contains 3 LNR repeats and a heterodimerization domain.
  • ECD extracellular domain
  • NRR negative regulatory region
  • Canonical Notch signaling is activated when a Notch receptor on one cell interacts with a ligand on a neighboring cell.
  • DLL1, DLL4, and DLL3 three Delta-like ligands
  • Jaggedl Jagged2
  • Ligand binding results in cleavage of Notch by ADAM proteases at the S2 site within the NRR domain. This initial cleavage generates the substrate for subsequent cleavage of the Notch receptor at the S3 site by the ⁇ - secretase complex. Following ⁇ -secretase cleavage, the intracellular domain of Notch (ICD) translocates to the nucleus where it interacts with a CSL transcription factor (CBF-l/RBP-Jk in mammals) and the co-activator mastermind (MAMLl) to activate target gene transcription.
  • CSL transcription factor CBF-l/RBP-Jk in mammals
  • MAMLl co-activator mastermind
  • Notch receptors in cancer have focused primarily on alterations in Notch 1 signaling, but very little on other Notch receptors. Accordingly, a need exists to study and identify methods and compositions that alter other Notch receptor signaling, such as Notch 3 signaling.
  • the disclosure pertains to a number of distinct conformational epitopes in Notch 3 or mutant Notch 3.
  • the disclosure also pertains to antibodies or fragments thereof that recognize at least one conformational epitope of Notch 3 or a mutant Notch 3 comprising continuous and discontinuous amino acid residues from the LNR region and the HD of the NRR domain.
  • the disclosure pertains to an isolated polypeptide comprising a conformational epitope of a Notch 3 receptor, wherein the conformational epitope comprises continuous and discontinuous amino acid sequences within a Lin Notch Repeat (LNR) region, a heterodimerization (HD) domain, and a linker region of a NRR domain of Notch 3 receptor; wherein the LNR region is selected from the group consisting of LNR-A, LNR-B, LNR-C and the corresponding linkers between these LNRs; wherein the HD domain is selected from the group consisting of the N-terminal HD and the C-terminal HD, and wherein the linker region is selected from the group consisting of LNR-A/B linker, LNR-B/C linker, LNR-HD linker .
  • LNR Lin Notch Repeat
  • HD heterodimerization
  • the disclosure pertains an isolated polypeptide comprising a conformational epitope of a Notch 3 receptor, wherein the conformational epitope comprises continuous and discontinuous amino acid sequences within a Lin Notch Repeat (LNR) region, a
  • LNR Lin Notch Repeat
  • heterodimerization (HD) domain and a linker region of a NRR domain of Notch 3 receptor; wherein the LNR region is LNR-B, and the HD domain is the HD a3 helix, and wherein the linker region is selected from the group consisting of LNR-A/B linker, LNR-B/C linker, LNR-HD linker.
  • the disclosure pertains n isolated polypeptide comprising a conformational epitope of a Notch 3 receptor, wherein the conformational epitope comprises continuous and discontinuous amino acid sequences within a Lin Notch Repeat (LNR) region, a
  • LNR Lin Notch Repeat
  • heterodimerization (HD) domain and a linker region of a NRR domain of Notch 3 receptor; wherein the LNR region is LNR-C, and the HD domain is the HD a2 helix; and the linker region is selected from the group consisting of LNR-A/B linker, LNR-B/C linker, LNR-HD linker.
  • the disclosure pertains an isolated antibody or fragment thereof that recognizes a conformational epitope of a Notch 3 receptor, wherein the conformational epitope comprises continuous and discontinuous amino acid sequences within a Lin Notch Repeat (LNR) region, a heterodimerization (HD) domain, and a linker region of a NRR domain of Notch 3 receptor; wherein the LNR region is selected from the group consisting of LNR-A, LNR-B, LNR-C; wherein the HD domain is selected from the group consisting of the N-terminal HD and the C-terminal HD; and wherein the antibody or fragment thereof blocks ligand-dependent signal transduction.
  • LNR Lin Notch Repeat
  • HD heterodimerization
  • the antibody or fragment thereof stabilizes the Notch 3 receptor LNR region in the autoinhibited state.
  • the present disclosure provides a mutant Notch 3 receptor, where the LNR region or the HD domain has at least one amino acid residue mutation.
  • the Notch 3 mutant comprises a mutation selected from the group consisting of S1580L, and G1487D, or combinations thereof.
  • the disclosure pertains an isolated antibody or fragment thereof that specifically binds a conformational epitope of a Notch 3 receptor, wherein the conformational epitope comprises continuous and discontinuous amino acid sequences within a Lin Notch Repeat (LNR) region, a heterodimerization (HD) domain, and a linker region of a NRR domain of Notch 3 receptor; wherein the LNR region is LNR-B, and the HD domain is the HD a3 helix; and wherein the antibody or fragment thereof blocks ligand-dependent signal transduction.
  • LNR Lin Notch Repeat
  • HD heterodimerization
  • the conformational epitope further comprises amino acid residues in the LNR-A/B linker of the NRR region. In one embodiment, the conformational epitope further comprises amino acid residues in the LNR-B/C linker of the NRR region. In one embodiment, the conformational epitope further comprises amino acid residues in the LNR-HD linker of the NRR region. In one embodiment, the conformational epitope further comprises amino acid residues in a HD ⁇ 4- ⁇ 3 loop. In one embodiment, the conformational epitope further comprises amino acid residues in the LNR-A/B linker, the LNR-B/C linker, the LNR-HD linker, and the HD ⁇ 4- ⁇ 3 loop.
  • the antibody or fragment thereof stabilizes the Notch 3 receptor LNR region in the autoinhibited state.
  • the Notch 3 receptor is a mutant Notch 3 receptor, wherein the LNR region or the HD domain has at least one amino acid residue mutation.
  • the Notch 3 mutant comprises a mutation selected from the group consisting of S1580L D 1587N, R1589Q, , Y1624H, A1608T, L1518M, A1537T, N1597K, L1547V, R1526C (HD) and G1487D, A1476T (LNR- C), or combinations thereof.
  • the conformational epitope comprises amino acid residues: 1427-1429 (of the LNR-A/B linker), 1442, 1444-1445, 1447-1450, 1453, 1458 (of LNR-B), 1461-1462, 1464 (of the LNR-B/C linker), 1507-1508, 1510 (of the LNR-HD linker), 1592, 1594-1599, 1602 (of the HD ⁇ 4- ⁇ 3 loop), and 1606 (of the HD a3 helix), or a subset thereof.
  • the VH of the antibody or fragment thereof binds to at least one of the following Notch 3 residues: Cysl442, Prol444, Alal445, Serl447, Serl448, Prol449, Tyrl453, Cysl458, Glyl461, Glyl462, Glyl464, Leul592, Serl594, Prol595, Glul596, Asnl597, Aspl598, and His l599.
  • the Notch 3 receptor is a mutant Notch 3 receptor, wherein the LNR region or the HD domain has at least one amino acid residue mutation.
  • the VL of the antibody or fragment thereof binds to at least one of the following Notch 3 residues: Glnl427, Cysl428, Glul429, Prol444, Serl445, Serl447, Serl448, Prol449, Tyrl453, Leul507, Leul508, Argl510, Leul592,
  • the antibody is selected from the group consisting of a monoclonal antibody, a polyclonal antibody, a chimeric antibody, a humanized antibody, and a synthetic antibody.
  • the disclosure pertains an isolated antibody or fragment thereof that specifically binds a conformational epitope of a Notch 3 receptor, wherein the conformational epitope comprises continuous and discontinuous amino acid sequences within a Lin Notch Repeat (LNR) region, a heterodimerization (HD) domain, and a linker of a NRR domain of Notch 3 receptor; wherein the LNR region is LNR-C, and the HD domain is the HD a2 helix; and wherein the antibody or fragment thereof blocks ligand-dependent signal transduction.
  • the conformational epitope further comprises amino acid residues in the LNR-B of the NRR region.
  • the conformational epitope further comprises amino acid residues in the LNR-B/C linker of the NRR region. In one embodiment, the conformational epitope further comprises amino acid residues in a HD ⁇ 3- ⁇ 5 loop. In one embodiment, the conformational epitope further comprises amino acid residues in LNR-B, the LNR-B/C linker, and the HD ⁇ 3- ⁇ 5 loop. In one embodiment, the antibody or fragment thereof stabilizes the Notch 3 receptor LNR region in the autoinhibited state.
  • the mutant Notch 3 receptor comprises a mutation selected from the group consisting of S1580L, R1510H, D 1587N, R1589Q,Y1624H, L1518M, A1537T, N1597K, L1547V, R1526C (HD), and A1476T (LNR-C), or combinations thereof.
  • the conformational epitope comprises amino acid residues: 1440 (of LNR-B), 1463, 1465- 1468 (of the LNR-B/C linker) 1469-1472, 1474, 1486-1487, (of LNR-C), 1534 (of HD a2 helix), and 1618, 1619, and 1621 (of the ⁇ 3- ⁇ 5 loop), or a subset thereof.
  • the VH of the antibody or fragment thereof binds to at least one of the following Notch 3 residues: Argl463, Thrl466, Asnl468, Prol469, Vall470, Tyrl471, Tyrl474, Glnl486, and Glyl487.
  • the VL of the antibody or fragment thereof binds to at least one of the following Notch 3 residues: Serl440, Argl465, Thrl466, Asnl468, Prol469, Vall470, glul472, Argl434, Glul618, Argl619, and Aspl621.
  • the antibody is selected from the group consisting of a monoclonal antibody, a polyclonal antibody, a chimeric antibody, a humanized antibody, and a synthetic antibody.
  • the antibody or fragment thereof inhibits Notch 3 signaling as assessed by an assasy sleeted from the group consisting of a Notch 3 ligand-driven reporter gene assay, FACS assay, Notch 3 target gene mRNA quantitation, in vitro proliferation of TALL- 1 cells, and by detecting gamma secretase cleaved form of Notch 3 intracellular domain (ICD).
  • ICD gamma secretase cleaved form of Notch 3 intracellular domain
  • the disclosure pertains an isolated antibody or fragment thereof to a Notch 3 receptor, having a dissociation (K D ) of at least 1 x 10 7 M “1 , 10 8 M “1 , 10 9 M “1 , 10 10 M “1 , 10 11 M “ l , 10 12 M “1 , 10 13 M “1 , wherein the antibody or fragment thereof inhibits inhibits Notch 3 signaling as assessed by an assay selected from the group consisting of a Notch 3 ligand- driven reporter gene assay, FACS assay, Notch 3 target gene mRNA quantitation, in vitro proliferation of TALL- 1 cells, and by detecting gamma secretase cleaved form of Notch 3 intracellular domain (ICD).
  • K D dissociation
  • the antibody or fragment thereof binds to the same conformational epitope as an antibody described in Table 2. In one embodiment, the antibody or fragment thereof cross-competes with an antibody described in Table 2.
  • the disclosure pertains an isolated antibody or fragment thereof to Notch 3 receptor which antibody comprises a VH selected from the group consisting of SEQ ID NO: 9, SEQ ID NO: 29, SEQ ID NO: 49, SEQ ID NO: 69, SEQ ID NO: 89, SEQ ID NO: 109, SEQ ID NO: 129, SEQ ID NO: 149, SEQ ID NO: 169, SEQ ID NO: 189, SEQ ID NO: 209, and SEQ ID NO: 229 ; and a VL selected from the group consisting of SEQ ID NO: 19, SEQ ID NO: 39, SEQ ID NO: 59, SEQ ID NO: 79, SEQ ID NO: 99, SEQ ID NO: 1 19, SEQ ID NO: 139, SEQ ID NO: 159, SEQ ID NO: 179, SEQ ID NO: 199, SEQ ID NO: 219, and SEQ ID NO: 239or an amino acid sequence with 97-99% identity thereof.
  • VH selected from the group consisting of SEQ ID NO:
  • the disclosure pertains to a single chain antibody or fragment thereof comprising a variable heavy chain sequence and a variable light chain sequence selected from the group consisting of a variable heavy chain having SEQ ID NO: 9 and a variable light chain sequence having SEQ ID NO: 19 ; variable heavy chain sequence having SEQ ID NO: 29 and a variable light chain sequence having SEQ ID NO: 39; a variable heavy chain sequence having SEQ ID NO: 49 and a variable light chain sequence having SEQ ID NO: 59; a variable heavy chain sequence having SEQ ID NO: 69 and a variable light chain sequence having SEQ ID NO: 79; a variable heavy chain sequence having SEQ ID NO: 89 and a variable light chain sequence having SEQ ID NO: 99; a variable heavy chain sequence having SEQ ID NO: 109 and a variable light chain sequence having SEQ ID NO: 1 19; a variable heavy chain sequence having SEQ ID NO: 129 and a variable light chain sequence having SEQ ID NO: 139; a variable heavy chain sequence having SEQ ID NO: 149 and
  • the disclosure pertains an isolated antibody or fragment thereof comprising a variable heavy chain sequence and a variable light chain sequence selected from the group consisting of a variable heavy chain having SEQ ID NO: 9 and a variable light chain sequence having SEQ ID NO: 19 ; variable heavy chain sequence having SEQ ID NO: 29 and a variable light chain sequence having SEQ ID NO: 39; a variable heavy chain sequence having SEQ ID NO: 49 and a variable light chain sequence having SEQ ID NO: 59; a variable heavy chain sequence having SEQ ID NO: 69 and a variable light chain sequence having SEQ ID NO: 79; a variable heavy chain sequence having SEQ ID NO: 89 and a variable light chain sequence having SEQ ID NO: 99; a variable heavy chain sequence having SEQ ID NO: 109 and a variable light chain sequence having SEQ ID NO: 119; a variable heavy chain sequence having SEQ ID NO: 129 and a variable light chain sequence having SEQ ID NO: 139; a variable heavy chain sequence having SEQ ID NO: 149 and a variable variable heavy
  • the disclosure pertains an isolated antibody or fragment thereof to Notch 3 receptor comprising a heavy chain CDR3 selected from the group consisting of SEQ ID NO: 5, SEQ ID NO: 25, SEQ ID NO: 45, SEQ ID NO: 65, SEQ ID NO: 85, SEQ ID NO: 105, SEQ ID NO: 125, SEQ ID NO: 145, SEQ ID NO: 165, SEQ ID NO: 185, SEQ ID NO: 205, and SEQ ID NO: 225.
  • a heavy chain CDR3 selected from the group consisting of SEQ ID NO: 5, SEQ ID NO: 25, SEQ ID NO: 45, SEQ ID NO: 65, SEQ ID NO: 85, SEQ ID NO: 105, SEQ ID NO: 125, SEQ ID NO: 145, SEQ ID NO: 165, SEQ ID NO: 185, SEQ ID NO: 205, and SEQ ID NO: 225.
  • the disclosure pertains an isolated antibody or fragment thereof comprising heavy and light chain variable regions CDRl, CDR2 and CDR3 selected from the group consisting of a heavy chain variable region CDRl of SEQ ID NO: 3; CDR2 of SEQ ID NO: 4; CDR3 of SEQ ID NO: 5; a light chain variable region CDRl of SEQ ID NO: 13; CDR2 of SEQ ID NO: 14; and CDR3 of SEQ ID NO: 15; a heavy chain variable region CDRl of SEQ ID NO: 23; CDR2 of SEQ ID NO: 24; CDR3 of SEQ ID NO: 25; a light chain variable region CDRl of SEQ ID NO: 33; CDR2 of SEQ ID NO: 34; and CDR3 of SEQ ID NO: 35; a heavy chain variable region CDRl of SEQ ID NO: 43; CDR2 of SEQ ID NO: 44; CDR3 of SEQ ID NO: 45; a light chain variable region CDRl of SEQ ID NO: 53; C
  • the disclosure pertains to a pharmaceutical composition
  • a pharmaceutical composition comprising an antibody or fragment thereof and a pharmaceutically acceptable carrier.
  • the disclosure pertains an antibody or fragment thereof for use in the treatment of a cancer mediated by Notch 3 signal transduction pathway selected from the group consisting of breast cancer, colorectal cancer, lung cancer, multiple myeloma, ovarian cancer, liver cancer, gastric cancer, pancreatic cancer, prostate cancer, acute myeloid leukemia, t-cell acute lymphoblastic leukemia, mantle cell lymphoma, chronic lymphocytic leukemia, Ewings sarcoma, chronic myeloid leukemia, acute lymphoblastic leukemia, lymphoma, osteosarcoma, squamous cell carcinoma, peripheral nerve sheath tumors, schwannoma, head and neck cancer, bladder cancer, esophageal cancer, glioblastoma, clear cell sarcoma of soft tissue, malignant mesothelioma, neurofibromatosis, renal cancer, and melanoma.
  • Notch 3 signal transduction pathway selected from the group consisting of breast
  • the antibody or fragment thereof is used for the treatment of a cancer mediated by Notch 3 signal transduction pathway wherein the cancer is T-cell acute lymphoblastic leukemia (TALL).
  • TALL T-cell acute lymphoblastic leukemia
  • the disclosure pertains an antibody or fragment thereof for use as a medicament for treating a cancer mediated by Notch 3 signal transduction pathway selected from the group consisting of breast cancer, colorectal cancer, lung cancer, multiple myeloma, ovarian cancer, liver cancer, gastric cancer, pancreatic cancer, prostate cancer, acute myeloid leukemia, T-cell acute lymphoblastic leukemia, mantle cell lymphoma, chronic lymphocytic leukemia, Ewings sarcoma, chronic myeloid leukemia, acute lymphoblastic leukemia, lymphoma, osteosarcoma, squamous cell carcinoma, peripheral nerve sheath tumors , schwannoma, head and neck cancer, bladder cancer, esophageal cancer, glioblastoma, clear cell sarcoma of soft tissue, malignant mesothelioma, neurofibromatosis, renal cancer, and melanoma.
  • the antibody or fragment thereof is used as
  • Figure 1 Domain structure of Notch 3
  • Figure 2 Domain structure of Notch 3 NRR with amino acid positions of each region
  • FIG. 6A-F FACS data of Notch 3 antibodies in HCC1143 Notch amplified cells
  • Figure 7A-D Percentage inhibition and IC5 0 values of Notch3 antibodies in the presence of Notch ligands (Jagged 1 and Delta 1) in a Notch 3 reporter gene assay;
  • Figure 8 Notch 3 target gene mRNA quantitation
  • Figure 9A-B Notch 3 NRR (Top) and PEST (Bottom) mutations
  • Figure 10A-B Graphs showing the characterization of Notch 3 NRR mutations
  • Figure 1 1A-B: Graphs showing TALL-1 mRNA and inhibition of proliferation in the presence of Notch 3 antibodies;
  • Figure 12A-B Photographs of Western blots showing the presence of a neo-epitope ICD3 antibody in TALL-1 cells only;
  • Figure 13A-B Photographs of Western blots showing decreased Notch 3 signaling with Notch 3 antibody treatment in TALL-1 cells and MDA-MB468 cells;
  • Figure 14A-C Photographs of Western blots showing decreased Notch 3 signaling with Notch 3 antibody treatment in Ishikawaheraklio02_ER cells, TE-1 1 cells, and A549 cells;
  • Figure 15 Photographs of Western blots showing decreased Notch 3 signaling with Notch 3 antibody treatment in a Notch 3 amplified cell-line, HCC1 143;
  • Figure 16A-B Photographs of Western blots and IHC photographs of in vivo PD studies in TALL-1 xenograft;
  • Figure 17A-C Photographs of Western blots of in vivo PD studies in MDA-MB468 xenograft
  • Figure 18 Photographs of Western blots in an in vivo PD HLUX1823 model xenograft
  • FIG. 19A-B Photographs of mice showing TALL-1 in vivo efficacy
  • Figure 20 Shows epitope binning of the Notch 3 antibodies identifying 4 distinct epitopes in the NRR domain of Notch 3, designated as NRR-A, NRR-B, NRR-C and NRR-D;
  • Figure 21 Surface and ribbon representation of the Notch 3 NRR X-ray crystal structure; labeled are 1) N- and C-terminus of the proteins; 2) the three LNR repeats and the coordinated Ca 2+ ions; 3) L1419, the autoinhibitory plug; 4) SI and S2 sites; 5) secondary structures within HD domain; and 6) the two regions in Notch3 with significantly different conformation than Notch 1 and Notch2 (LNR-B/C linker plus first half of LNR-C, and ⁇ 4- ⁇ 3 loop in HD domain);
  • Figure 22 A sequence alignment of human Notch 1, 2, and 3. Shown in the dashed boxes show are regions of Notch 3 with significantly different structures than Notch 1 or Notch 2;
  • Figure 23 X-ray crystal structure of the Notch3/20350 Fab complex determined at 3.2A, with the overall structure of 20350 Fab binding to Notch3 NRR (left panel) and detailed interactions on Notch3 NRR with epitope residues labeled (right panel);
  • Figure 24 X-ray crystal structure of the Notch3/20358 Fab complex determined at 2. lA, with the overall structure of 20358 Fab binding to Notch3 NRR (left panel) and detailed interactions on Notch3 NRR with epitope residues labeled (right panel)
  • Figure 25 Comparison of 20350 and 20358 epitopes on Notch3 NRR. X-ray crystal structure of the Notch3/20350 Fab complex and Notch 3/20358 Fab complex superimposed on Notch 3 NRR showing that the two antibodies bind to disctinct epitopes on Notch 3 NR;
  • Figure 26 The amino acid residues in conformational epitopes of 20350, 20358, and A4;
  • Figure 27 HDx-MS epitope mapping of Notch 3 NRR + Ca 2+ showing average deuterium uptake of Notch 3 NRR in an unbound state
  • Figure 28 Differential plot of Notch 3 NRR + Ca 2+ showing absolute protection amounts with 20350, 20358 antibody binding to Notch 3 NRR;
  • Figure 29 Structures showing regions that are protected (black) upon 20350 and 20358 binding to Notch 3 NRR;
  • Figure 30 Comparison of buried X-ray amino acid residues to protected regions detected in HDx-MS;
  • Figure 31 Difference Plot for Notch 3 NRR without Ca 2+ for 20037 and 20358 and protected regions (black) mapped onto Notch 3 NRR structure;
  • Figure 32 Conformational epitopes of antibodies 20337, 20350, 20358 and A4 mapped onto Notch 3 NRR surface;
  • Figure 33 Surface on Notch3 NRR left uncovered by antibodies 20337, 20350, 20358 and A4;
  • Figure 34 Potential conformational epitopes on the surface of Notch3 NRR left uncovered by antibodies 20337, 20350, 20358 and A4. Detailed Description
  • signal transduction or “signaling activity” as used herein refers to a biochemical causal relationship generally initiated by a protein-protein interaction such as binding of a growth factor to a receptor, resulting in transmission of a signal from one portion of a cell to another portion of a cell.
  • ligand binding results in cleavage of Notch 3 by ADAM proteases at the S2 site within the NRR domain. This initial cleavage generates the substrate for subsequent cleavage of the Notch receptor at the S3 site by the ⁇ -secretase complex.
  • Notch 3 or “Notch 3 receptor” as used herein refers to mammalian human Notch 3 protein.
  • Notch 3 The domain structure of Notch 3 is depicted in Figure I, which shows the ligand binding domain (LBD), negative regulatory region (NRR) comprising the Lin Notch Repeats (LNR) and the N-, C-terminal heterodimerization domain (HD-N and HD-C, respectively), as well as the ankarin domain (ANK) and PEST domains.
  • LBD ligand binding domain
  • NRR negative regulatory region
  • HD-N and HD-C the N-, C-terminal heterodimerization domain
  • ANK ankarin domain
  • PEST domains PEST domains
  • Figure 2 shows the overall structure of Notch 3 NRR and the corresponding amino acid residues:
  • LNR-A has amino acid residues E1383-G1422;
  • LNR-A-B linker has amino acid residues Asp 1423 -Leu- 1431;
  • LNR-B has amino acid residues Glnl432-Alal460;
  • LNR-BC linker has amino acid residues Glyl461- Asnl468;
  • LNR-C has amino acid residues Prol469-Serl502;
  • LNR-HD linker has amino acid residues Glul503-Argl510;
  • HD-N has amino acid residues Glyl511-Argl571; and
  • HD-C has amino acid residuesl572-Serl640.
  • Cynomolgus monkey Notch 3 is represented below as SEQ ID NO: 2.
  • Notch ligand refers to polypeptides which bind and activate Notch 3 receptor.
  • Examples of Notch 3 ligands include, but are not limited to Delta-like ligands (e.g., DLL1, DLL3, and DLL4) and Jagged ligands (e.g., Jagged 1, and Jagged 2).
  • the term “stabilization” or “stabilized” used in the context of Notch 3 refers to an antibody or fragment thereof that directly maintains (locks, tethers, holds, preferentially binds, favors) the autoinhibited conformation or state of Notch 3 receptor. Assays described in the Examples can be used to measure signal transduction of the stabilized Notch 3 receptor, e.g. in vitro screening using an ICD3 antibody disclosed herein.
  • ligand-dependent signaling refers to the activation of Notch 3 via ligand (e.g., Delta or Jagged ligand). Ligand binding results in Notch 3 proteolytic cleavage events that lead to Notch 3 signal transduction.
  • the antibody or fragment thereof can inhibit Notch 3 signaling of a cell exposed to the antibody or fragment thereof relative to an untreated (control) cell, as measured using the assays described in the Examples.
  • the cell which expresses Notch 3 can be a naturally occurring cell line or can be recombinantly produced by introducing nucleic acids encoding Notch 3 protein into a host cell.
  • ligand-independent signaling refers to cellular Notch 3 activity (e.g Notch 3 cleaved at an S2 within the NRR domain and subsequently cleaved at S3 site in the absence of a requirement for ligand binding.
  • ligand-independent Notch 3 activation can be a result of Notch 3 overexpression/amplification or activating mutations in Notch 3.
  • the antibody or fragment thereof can inhibit Notch 3 signaling of a cell exposed to antibody or fragment thereof relative to an unmutated (control) cell, as measured using the assays described in the Examples.
  • the cell which overexpresses Notch 3 can be a naturally occurring cell line (e.g.HCCl 143, TALL-1) or can be recombinantly produced by introducing nucleic acids encoding Notch 3 protein into a host cell.
  • a cell may have both ligand-dependent and ligand-independent Notch 3 signaling.
  • blocks refers to stopping or preventing an interaction or a process, e.g., stopping ligand-dependent or ligand-independent signaling.
  • recognition refers to an antibody or fragment thereof that finds and interacts (e.g., binds) with its conformational epitope.
  • antibody refers to whole antibodies that interact with (e.g., by binding, steric hindrance, stabilizing spatial distribution) a Notch 3 epitope and inhibit signal transduction.
  • a naturally occurring "antibody” is a glycoprotein comprising at least two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds.
  • Each heavy chain is comprised of a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region.
  • the heavy chain constant region is comprised of three domains, CHI, CH2 and CH3.
  • Each light chain is comprised of a light chain variable region (abbreviated herein as VL) and a light chain constant region.
  • the light chain constant region is comprised of one domain, CL.
  • the VH and VL regions can be further subdivided into regions of
  • CDR complementarity determining regions
  • FR framework regions
  • Each VH and VL is composed of three CDRs and four FRs arranged from amino-terminus to carboxy -terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.
  • the variable regions of the heavy and light chains contain a binding domain that interacts with an antigen.
  • the constant regions of the antibodies may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system.
  • antibody includes for example, monoclonal antibodies, human antibodies, humanized antibodies, camelised antibodies, chimeric antibodies, single-chain Fvs (scFv), disulfide-linked Fvs (sdFv), Fab fragments, F (ab') fragments, and anti-idiotypic (anti-Id) antibodies (including, e.g., anti-Id antibodies to antibodies of the disclosure), and epitope-binding fragments of any of the above.
  • scFv single-chain Fvs
  • sdFv disulfide-linked Fvs
  • Fab fragments fragments
  • F (ab') fragments fragments
  • anti-idiotypic (anti-Id) antibodies including, e.g., anti-Id antibodies to antibodies of the disclosure, and epitope-binding fragments of any of the above.
  • the antibodies can be of any isotype (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgGl, IgG2, IgG3, IgG4, IgAl and IgA2) or subclass.
  • variable domains of both the light (VL) and heavy (VH) chain portions determine antigen recognition and specificity.
  • the constant domains of the light chain (CL) and the heavy chain (CHI, CH2 or CH3) confer important biological properties such as secretion, transplacental mobility, Fc receptor binding, complement binding, and the like.
  • the N-terminus is a variable region and at the C-terminus is a constant region; the CH3 and CL domains actually comprise the carboxy -terminus of the heavy and light chain, respectively.
  • antibody fragment refers to one or more portions of an antibody that retain the ability to specifically interact with (e.g., by binding, steric hindrance, stabilizing spatial distribution) a Notch 3 epitope and inhibit signal transduction.
  • binding fragments include, but are not limited to, a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CHI domains; a F(ab)2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; a Fd fragment consisting of the VH and CHI domains; a Fv fragment consisting of the VL and VH domains of a single arm of an antibody; a dAb fragment (Ward et al, (1989) Nature 341 :544-546), which consists of a VH domain; and an isolated complementarity determining region (CDR).
  • a Fab fragment a monovalent fragment consisting of the VL, VH, CL and CHI domains
  • F(ab)2 fragment a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region
  • a Fd fragment consisting of the VH and CHI domains
  • a Fv fragment consist
  • the two domains of the Fv fragment, VL and VH are coded for by separate genes, they can be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv (scFv); see e.g., Bird et al, (1988) Science 242:423-426; and Huston et al, (1988) Proc. Natl. Acad. Sci. 85:5879-5883).
  • single chain Fv single chain Fv
  • Such single chain antibodies are also intended to be encompassed within the term "antibody fragment”.
  • antibody fragments are obtained using conventional techniques known to those of skill in the art, and the fragments are screened for utility in the same manner as are intact antibodies.
  • Antibody fragments can also be incorporated into single domain antibodies, maxibodies, minibodies, intrabodies, diabodies, triabodies, tetrabodies, v-NAR and bis-scFv (see, e.g.,
  • Antibody fragments can be grafted into scaffolds based on polypeptides such as Fibronectin type III (Fn3) (see U.S. Pat. No. 6,703, 199, which describes fibronectin polypeptide monobodies).
  • Fn3 Fibronectin type III
  • Antibody fragments can be incorporated into single chain molecules comprising a pair of tandem Fv segments (VH-CH1-VH-CH1) which, together with complementary light chain polypeptides, form a pair of antigen binding regions (Zapata et al, (1995) Protein Eng.
  • monoclonal antibody or “monoclonal antibody composition” as used herein refers to polypeptides, including antibodies, antibody fragments, bispecific antibodies, etc. that have substantially identical to amino acid sequence or are derived from the same genetic source. This term also includes preparations of antibody molecules of single molecular composition.
  • a monoclonal antibody composition displays a single binding specificity and affinity for a particular epitope.
  • human antibody includes antibodies having variable regions in which both the framework and CDR regions are derived from sequences of human origin. Furthermore, if the antibody contains a constant region, the constant region also is derived from such human sequences, e.g., human germline sequences, or mutated versions of human germline sequences or antibody containing consensus framework sequences derived from human framework sequences analysis, for example, as described in Knappik et ah, (2000) J Mol Biol 296:57-86).
  • immunoglobulin variable domains e.g., CDRs
  • CDRs may be defined using well known numbering schemes, e.g., the Kabat numbering scheme, the Chothia numbering scheme, or a combination of Kabat and Chothia (see, e.g., Sequences of Proteins of Immunological Interest, U.S. Department of Health and Human Services (1991), eds. Kabat et ah; Lazikani et ah, (1997) J. Mol. Bio. 273 :927-948); Kabat et ah, (1991) Sequences of Proteins of Immunological Interest, 5th edit., NIH Publication no. 91-3242 U.S.
  • human antibodies disclosed herein may include amino acid residues not encoded by human sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo, or a conservative substitution to promote stability or manufacturing).
  • human monoclonal antibody refers to antibodies displaying a single binding specificity which have variable regions in which both the framework and CDR regions are derived from human sequences.
  • the human monoclonal antibodies are produced by a hybridoma which includes a B cell obtained from a transgenic nonhuman animal, e.g., a transgenic mouse, having a genome comprising a human heavy chain transgene and a light chain transgene fused to an immortalized cell.
  • recombinant human antibody includes all human antibodies that are prepared, expressed, created or isolated by recombinant means, such as antibodies isolated from an animal (e.g., a mouse) that is transgenic or transchromosomal for human
  • immunoglobulin genes or a hybridoma prepared therefrom antibodies isolated from a host cell transformed to express the human antibody, e.g., from a transfectoma, antibodies isolated from a recombinant, combinatorial human antibody library, and antibodies prepared, expressed, created or isolated by any other means that involve splicing of all or a portion of a human immunoglobulin gene, sequences to other DNA sequences.
  • Such recombinant human antibodies have variable regions in which the framework and CDR regions are derived from human germline immunoglobulin sequences.
  • such recombinant human antibodies can be subjected to in vitro mutagenesis (or, when an animal transgenic for human Ig sequences is used, in vivo somatic mutagenesis) and thus the amino acid sequences of the VH and VL regions of the recombinant antibodies are sequences that, while derived from and related to human germline VH and VL sequences, may not naturally exist within the human antibody germline repertoire in vivo.
  • Specific binding between two entities means a binding with an equilibrium constant (KA) (kon/koff) of at least 10 2 M _1 , at least 5xl0 2 M _1 , at least 10 3 M _1 , at least 5xl0 3 M _1 , at least 10 4 M " x at least 5xl0 4 M _1 , at least 10 5 M _1 , at least 5xl0 5 M _1 , at least 10 6 M _1 , at least 5xl0 6 M _1 , at least 10 7 M _1 , at least 5xl0 7 M _1 , at least 10 8 ⁇ _1 , at least 5 ⁇ 10 8 ⁇ _1 , at least 10 9 M _1 , at least 5xl0 9 M _1 , at least lO ⁇ M "1 , at least SxlO ⁇ M "1 , at least 10 ⁇ ⁇ ⁇ , at least 10 lO ⁇ M "1 , at least
  • an antibody e.g., a Notch 3 binding antibody
  • a binding reaction that is determinative of the presence of a cognate antigen (e.g., a human Notch 3) in a heterogeneous population of proteins and other biologies.
  • a Notch 3 binding antibody disclosed herein typically also has a dissociation rate constant (K D ) (koff/k on ) of less than 5x10 " 2 M, less than 10 "2 M, less than 5xl0 ⁇ 3 M, less than 10 "3 M, less than 5xlO ⁇ 4 M, less than 10 "4 M, less than 5xl0 ⁇ 5 M, less than 10 "5 M, less than 5xlO ⁇ 6 M, less than 10 "6 M, less than 5xlO ⁇ 7 M, less than 10 "7 M, less than 5xl0 ⁇ 8 M, less than 10 "8 M, less than 5xlO ⁇ 9 M, less than 10 "9 M, less than 5xl0 ⁇ 10 M, less than 10 "10 M, less than 5xlO ⁇ n M, less than 10 "n M, less than 5xlO ⁇ 12 M, less than 10 "12 M, less than 5xl0 "13 M, less than 10
  • the antibody or fragment thereof has dissociation constant (Ka) of less than 3000 pM, less than 2500 pM, less than 2000 pM, less than 1500 pM, less than 1000 pM, less than 750 pM, less than 500 pM, less than 250 pM, less than 200 pM, less than 150 pM, less than 100 pM, less than 75 pM, less than 10 pM, less than 1 pM as assessed using a method described herein or known to one of skill in the art (e.g., a BIAcore assay, ELISA, FACS, SET) (Biacore International AB, Uppsala, Sweden).
  • Ka dissociation constant
  • Kas SOC or "K a ", as used herein, refers to the association rate of a particular antibody-antigen interaction
  • Kdi s or "Ka,” as used herein, refers to the dissociation rate of a particular antibody- antigen interaction
  • KD refers to the dissociation constant, which is obtained from the ratio of Kd to K a (i.e. Ka/K a ) and is expressed as a molar concentration (M).
  • KD values for antibodies can be determined using methods well established in the art. A method for determining the K D of an antibody is by using surface plasmon resonance, or using a biosensor system such as a Biacore ® system.
  • antibody refers to the strength of interaction between antibody and antigen at single antigenic sites. Within each antigenic site, the variable region of the antibody “arm” interacts through weak non-covalent forces with antigen at numerous sites; the more interactions, the stronger the affinity.
  • vidity refers to an informative measure of the overall stability or strength of the antibody-antigen complex. It is controlled by three major factors: antibody epitope affinity; the valence of both the antigen and antibody; and the structural arrangement of the interacting parts. Ultimately these factors define the specificity of the antibody, that is, the likelihood that the particular antibody is binding to a precise antigen epitope.
  • valency refers to the number of potential target binding sites in a polypeptide. Each target binding site specifically binds one target molecule or specific site (i.e, epitope) on a target molecule. When a polypeptide comprises more than one target binding site, each target binding site may specifically bind the same or different molecules (e.g., may bind to different molecules, e.g., different antigens, or different epitopes on the same molecule).
  • an antibody that "inhibits" one or more of the Notch 3 functional properties e.g., biochemical, immunochemical, cellular, physiological or other biological activities, or the like
  • an antibody that inhibits Notch 3 activity effects such a statistically significant decrease by at least 10% of the measured parameter, by at least 50%, 80% or 90%, and in certain
  • an antibody disclosed herein may inhibit greater than 95%, 98% or 99% of Notch 3 functional activity.
  • isolated antibody refers to an antibody that is substantially free of other antibodies having different antigenic specificities (e.g., an isolated antibody that specifically binds Notch 3 is substantially free of antibodies that specifically bind antigens other than Notch 3).
  • An isolated antibody that specifically binds Notch 3 may, however, have cross- reactivity to other antigens.
  • an isolated antibody may be substantially free of other cellular material and/or chemicals.
  • epitope includes any protein determinant capable of specific binding to an immunoglobulin or otherwise interacting with a molecule.
  • Epitopic determinants generally consist of chemically active surface groupings of molecules such as amino acids or carbohydrate or sugar side chains and can have specific three-dimensional structural characteristics, as well as specific charge characteristics.
  • An epitope may be "linear” or “conformational.”
  • linear epitope refers to an epitope with all of the points of interaction between the protein and the interacting molecule (such as an antibody or fragment thereof) occur linearally along the primary amino acid sequence of the protein (continuous).
  • conformational epitope refers to an epitope in which discontinuous amino acid residues come together in a three dimensional shape. In a conformational epitope, the points of interaction occur across amino acid residues that are separated from one another by at least one amino acid residue (discontinous), i.e., the points of contact occur on distinct and separate regions of the NRR such as the LNR region, the HD, as well as a linker region.
  • the conformational epitope may also comprise continuous contacts on separate and distinct regions of NRR, for example continuous contacts with at least two amino acids in the LNR region, at least two amino acids in the HD region, and at least one amino acid residue in a linker region (e.g., LNR-A/B linker, LNR-B/C linker, LNR-HD linker).
  • a linker region e.g., LNR-A/B linker, LNR-B/C linker, LNR-HD linker.
  • the conformational epitope is that described in Examples herein.
  • the conformational epitope comprising discontinuous points of interaction between amino acid residues within the LNR region (LNR-A, LNR-B, LNR-C) and the HD (e.g., a3 helix).
  • the conformational epitope comprising discontinuous points of interaction between amino acid residues within the LNR region (LNR-A, LNR-B, LNR-C) and the HD and at least one linker between the LNR region (e.g., a3 helix) and the HD (e.g., LNR-HD linker).
  • the conformational epitope comprising discontinuous points of interaction between amino acid residues within the LNR region (LNR-A, LNR-B, LNR-C) and the HD (e.g., a3 helix), and at least one linker within the HD (e.g., ⁇ 4- ⁇ 3 loop).
  • the conformational epitope comprising discontinuous points of interaction between amino acid residues within the LNR region (LNR-A, LNR-B, LNR-C) and the HD (e.g., a2 helix), and at least one linker within the HD (e.g., ⁇ 3- ⁇ 5 loop).
  • the conformational epitope is defined by Notch 3 amino acid residues: 1427-1429 (of the LNR-A/B linker), 1442, 1444-1445, 1447-1450, 1453, 1458 (of LNR-B), 1461-1462, 1464 (of the LNR-B/C linker), 1507-1508, 1510 (of the LNR-HD linker), 1592, 1594-1599, 1602 (of the HD ⁇ 4- ⁇ 3 loop), and 1606 (of the HD a3 helix) or SEQ ID NO: l, or a subset thereof.
  • the conformational epitope is defined by Notch 3 amino acid residues: 1440 (of LNR-B), 1463, 1465-1468 (of the LNR-B/C linker) 1469-1472, 1474, 1486-1487(of LNR-C), 1534 (of HD a2 helix), and 1618, 1619, and 1621 (of the ⁇ 3- ⁇ 5 loop) of SEQ ID NO: 1, or a subset thereof.
  • the conformational epitope is defined by Notch 3 amino acid residues: 1489-1498 (LNR-C), 1500-1506 (LNR-HD linker), 1538-1568 (HD) and 1571-1591 (HD).
  • the space that is occupied by a residue or side chain that creates the shape of a molecule helps to determine what an epitope is.
  • antibodies specific for a particular target antigen will preferentially recognize an epitope on the target antigen in a complex mixture of proteins and/or macromolecules.
  • Regions of a given polypeptide that include an epitope can be identified using any number of epitope mapping techniques, well known in the art. See, e.g., Epitope Mapping Protocols in Methods in Molecular Biology, Vol. 66 (Glenn E.Morris, Ed., 1996) Humana Press, Totowa, New Jersey.
  • linear epitopes may be determined by e.g., concurrently synthesizing large numbers of peptides on solid supports, the peptides corresponding to portions of the protein molecule, and reacting the peptides with antibodies while the peptides are still attached to the supports. Such techniques are known in the art and described in, e.g., U.S. Patent No.
  • conformational epitopes are readily identified by determining spatial conformation of amino acids such as by, e.g., hydrogen/deuterium exchange, X-ray crystallography and two-dimensional nuclear magnetic resonance. See, e.g. Epitope Mapping Protocols, supra.
  • Antigenic regions of proteins can also be identified using standard antigenicity and hydropathy plots, such as those calculated using, e.g., the Omiga version 1.0 software program available from the Oxford Molecular Group. This computer program employs the Hopp/Woods method, Hopp et al, (1981) Proc. Natl. Acad.
  • paratope refers to the general structure of a binding region that determines binding to an epitope. This structure influences whether or not and in what manner the binding region might bind to an epitope.
  • the term “pratope” can refer to an antigenic site of an antibody or fragment thereof that is responsible for an antibody or fragment thereof binding to an antigenic determinant. Paratope also refers to the idiotope of the antibody, and the complementary determining region (CDR) region that binds to the epitope.
  • CDR complementary determining region
  • the conformational epitope is defined by Notch 3 amino acid residues: 1427-1429 (of the LNR-A/B linker), 1442, 1444-1445, 1447-1450, 1453, 1458 (of LNR-B), 1461-1462, 1464 (of the LNR-B/C linker), 1507-1508, 1510 (of the LNR-HD linker), 1592, 1594-1599, 1602 (of the HD ⁇ 4- ⁇ 3 loop), and 1606 (of the HD a3 helix) of SEQ ID NO: l, or a subset thereof.
  • the paratope is the region of the antibody that comprises the CDR sequences. In one embodiment, the paratope comprises the sequences listed in Table 2.
  • the paratope comprises at least one amino acid residue that binds with Notch 3 residues: Cysl442, Prol444, Alal445, Serl447, Serl448, Prol449, Tyrl453, Cysl458, Glyl461, Glyl462, Glyl464, Leul592, Serl594, Prol595, Glul596, Asnl597, Aspl598, and Hisl599.
  • the paratope comprises at least one amino acid residue that binds with Notch 3 residues: Glnl427, Cysl428, Glul429, Prol444, Serl445, Serl447, Serl448, Prol449, Tyrl453, Leul507, Leul508, Argl510, Leul592, Aspl598, Prol602, and Serl606.
  • the conformational epitope is defined by Notch 3 amino acid residues: 1440 (of LNR-B), 1463, 1465-1468 (of the LNR-B/C linker) 1469-1472, 1474, 1486-1487 (of LNR-C), 1534 (of HD a2 helix), and 1618, 1619, and 1621 (of the ⁇ 3- ⁇ 5 loop) of SEQ ID NO: l, or a subset thereof.
  • the paratope comprises at least one amino acid residue that binds with Notch 3 residues: Argl463, Thrl466, Asnl468, Prol469, Vall470, Tyrl471, Tyrl474, Glnl486, and Glyl487.
  • the paratope comprises at least one amino acid residue that binds with Notch 3 residues: Serl440, Argl465, Thrl466, Asnl468, Prol469, Vall470, Glul472, Argl434, Glul618, Argl619, and Aspl621.
  • the paratope of any antibody, or variant thereof can be determined in the manner set forth by the present application.
  • cross-compete and “cross-competing” are used interchangeably herein to mean the ability of an antibody or fragment thereof to interfere with the binding of other antibodies or fragments to Notch 3 in a standard competitive binding assay.
  • cross-competes refers to an antibody or fragment thereof that intefers with the binding of other antibodies or fragments thereof to at least one conformational epitope of Notch 3.
  • the ability or extent to which an antibody or other binding agent is able to interfere with the binding of another antibody or fragment thereof to Notch 3 , and therefore whether it can be said to cross-compete according to the invention, can be determined using standard competition binding assays.
  • One suitable assay involves the use of the Biacore technology (e.g. by using the BIAcore 3000 instrument (Biacore, Uppsala, Sweden)), which can measure the extent of interactions using surface plasmon resonance technology.
  • Another assay for measuring cross-competing uses an ELISA-based approach.
  • polypeptide and "protein” are used interchangeably herein to refer to a polymer of amino acid residues.
  • the terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymer. Unless otherwise indicated, a particular polypeptide sequence also implicitly encompasses conservatively modified variants thereof.
  • conservatively modified variants refers to those nucleic acids which encode identical or essentially identical amino acid sequences, or where the nucleic acid does not encode an amino acid sequence, to essentially identical sequences. Because of the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given protein. For instance, the codons GCA, GCC, GCG and GCU all encode the amino acid alanine. Thus, at every position where an alanine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded polypeptide.
  • nucleic acid variations are "silent variations," which are one species of conservatively modified variations. Every nucleic acid sequence herein which encodes a polypeptide also describes every possible silent variation of the nucleic acid.
  • each codon in a nucleic acid except AUG, which is ordinarily the only codon for methionine, and TGG, which is ordinarily the only codon for tryptophan
  • TGG which is ordinarily the only codon for tryptophan
  • conservatively modified variants include individual substitutions, deletions or additions to a polypeptide sequence which result in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. Such conservatively modified variants are in addition to and do not exclude polymorphic variants, interspecies homologs, and alleles disclosed herein.
  • the following eight groups contain amino acids that are conservative substitutions for one another: 1) Alanine (A), Glycine (G); 2) Aspartic acid (D), Glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine (K); 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W); 7) Serine (S), Threonine (T); and 8) Cysteine (C), Methionine (M) (see, e.g., Creighton, Proteins (1984)).
  • the term "conservative sequence modifications” are used to refer to amino acid modifications that do not significantly affect or alter the binding characteristics of the antibody containing the amino acid sequence.
  • the term "optimized” as used herein refers to a nucleotide sequence has been altered to encode an amino acid sequence using codons that are preferred in the production cell or organism, generally a eukaryotic cell, for example, a cell oiPichia, a cell of Trichoderma, a Chinese Hamster Ovary cell (CHO) or a human cell.
  • the optimized nucleotide sequence is engineered to retain completely or as much as possible the amino acid sequence originally encoded by the starting nucleotide sequence, which is also known as the "parental" sequence.
  • Standard assays to evaluate the binding ability of the antibodies toward Notch 3 of various species are known in the art, including for example, ELISAs, western blots and RIAs.
  • Suitable assays are described in detail in the Examples.
  • the binding kinetics (e.g., binding affinity) of the antibodies also can be assessed by standard assays known in the art, such as by Biacore analysis, or FACS relative affinity (Scatchard).
  • Assays to evaluate the effects of the antibodies on functional properties of Notch 3 are described in further detail in the Examples.
  • percent identical in the context of two or more nucleic acids or polypeptide sequences, refers to two or more sequences or subsequences that are the same.
  • Two sequences are “substantially identical” if two sequences have a specified percentage of amino acid residues or nucleotides that are the same (i.e., 60% identity, optionally 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity over a specified region, or, when not specified, over the entire sequence), when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection.
  • the identity exists over a region that is at least about 50 nucleotides (or 10 amino acids) in length, or more preferably over a region that is 100 to 500 or 1000 or more nucleotides (or 20, 50, 200 or more amino acids) in length.
  • sequence comparison typically one sequence acts as a reference sequence, to which test sequences are compared.
  • test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated.
  • the sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
  • a “comparison window”, as used herein, includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned.
  • Methods of alignment of sequences for comparison are well known in the art.
  • Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith and Waterman, (1970) Adv. Appl. Math. 2:482c, by the homology alignment algorithm of Needleman and Wunsch, (1970) J. Mol. Biol.
  • BLAST and BLAST 2.0 algorithms Two examples of algorithms that are suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al, (1977) Nuc. Acids Res. 25:3389-3402; and Altschul et al, (1990) J. Mol. Biol. 215:403-410, respectively.
  • Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al, supra).
  • initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them.
  • the word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always > 0) and N (penalty score for mismatching residues; always ⁇ 0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative- scoring residue alignments; or the end of either sequence is reached.
  • the BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment.
  • the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin and Altschul, (1993) Proc. Natl. Acad. Sci. USA 90:5873-5787).
  • One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.
  • P(N) the smallest sum probability
  • a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, more preferably less than about 0.01, and most preferably less than about 0.001.
  • the percent identity between two amino acid sequences can also be determined using the algorithm of E. Meyers and W. Miller, (1988) Comput. Appl. Biosci. 4: 11-17) which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4.
  • the percent identity between two amino acid sequences can be determined using the Needleman and Wunsch (1970) J. Mol. Biol.
  • nucleic acid sequences or polypeptides are substantially identical is that the polypeptide encoded by the first nucleic acid is immunologically cross reactive with the antibodies raised against the polypeptide encoded by the second nucleic acid, as described below.
  • a polypeptide is typically substantially identical to a second polypeptide, for example, where the two peptides differ only by conservative substitutions.
  • Another indication that two nucleic acid sequences are substantially identical is that the two molecules or their complements hybridize to each other under stringent conditions, as described below.
  • Yet another indication that two nucleic acid sequences are substantially identical is that the same primers can be used to amplify the sequence.
  • nucleic acid is used herein interchangeably with the term “polynucleotide” and refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form.
  • the term encompasses nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, which have similar binding properties as the reference nucleic acid, and which are metabolized in a manner similar to the reference nucleotides.
  • Examples of such analogs include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2-O-methyl ribonucleotides, peptide-nucleic acids (PNAs).
  • nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions) and complementary sequences, as well as the sequence explicitly indicated.
  • degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al, (1991) Nucleic Acid Res. 19:5081; Ohtsuka et al, (1985) J. Biol. Chem. 260:2605-2608; and Rossolini et al, (1994) Mol. Cell. Probes 8:91-98).
  • operably linked refers to a functional relationship between two or more polynucleotide (e.g., DNA) segments. Typically, it refers to the functional relationship of a transcriptional regulatory sequence to a transcribed sequence.
  • a promoter or enhancer sequence is operably linked to a coding sequence if it stimulates or modulates the transcription of the coding sequence in an appropriate host cell or other expression system.
  • promoter transcriptional regulatory sequences that are operably linked to a transcribed sequence are physically contiguous to the transcribed sequence, i.e., they are cis- acting.
  • some transcriptional regulatory sequences, such as enhancers need not be physically contiguous or located in close proximity to the coding sequences whose transcription they enhance.
  • subject includes human and non-human animals.
  • Non-human animals include all vertebrates, e.g., mammals and non-mammals, such as non-human primates, sheep, dog, cow, chickens, amphibians, and reptiles. Except when noted, the terms “patient” or “subject” are used herein interchangeably.
  • Notch signaling is an evolutionarily conserved pathway that regulates a diverse set of biological functions including stem cell maintenance, cell differentiation and proliferation in both embryonic development and adult tissues (Kopan et al, (2009) Cell 137: 216-233, Guruharsha et al, (2012) Nat Rev Genet. 13 : 654-66, and Andersson et al, (2001)
  • Notch 1-4 The extracellular domain (ECD) consists of a series of EGF-like repeats followed by a negative regulatory region (NRR) which contains 3 LNR repeats and a heterodimerization domain as shown in Figure 1.
  • ECD extracellular domain
  • NRR negative regulatory region
  • Figure 1 the role of Notch signaling in tumor initiation and progression is not well understood (Ranganathan et al, (2011) Nat Rev Cancer 11 :338-51).
  • MMTV mouse mammary tumor virus
  • Notch4 initially known as Int3
  • mammary tumorigenesis For example, activation of Notch4 (initially known as Int3) by MMTV, resulted in mammary tumorigenesis (Gallahan et al, (1987) J Virol 61 :218-220, Gallahan et al, (1997) Oncogene 14: 1883-1890).
  • ER estrogen receptor
  • Notch3 NRR has a similar overall folding as that of Notch 1 (Gordan et al, (2009) Blood 1 13 :4381-4390; Gordon et al, (2009) 4:e6613; Wu e? al, (2010) Nature 464: 1052-1057) and Notch2 (Gordon et al, (2007) Nat Struct Mol Biol 14:295-300). It is composed of three Linl2/Notch repeats (LNR), namely LNR-A, LNR-B and LNR-C; and a heterodimerization (HD) domain divided into N-terminal part (HD-N) and C-terminal part (HD-C) by furin cleavage at SI site (between R1571 and E1572) (see Figure 2).
  • LNR Linl2/Notch repeats
  • HD heterodimerization domain divided into N-terminal part (HD-N) and C-terminal part (HD-C) by furin cleavage at SI site (between R1571 and E1572)
  • NRR domains regulate the activation of Notch receptors, which involves three proteolysis steps.
  • Furin-like convertase cleaves at SI site within NRR during maturation of Notch precursor, to prime the activation.
  • ADAM proteases cleave at S2 site, also within NRR, to create the substrate for intramembrane proteolysis at S3 site by gamma secretase.
  • S3 cleavage the intracellular part of Notch then enters nucleus to activate transcription.
  • S2 cleavage is the key step of this activation series and is negatively regulated by NRR domains. The mechanism of this so called autoinhibition can be explained by NRR structures below.
  • Notch 3 NRR typically exists in an autoinhibited conformation in which the three LNRs, each coordinating a Ca 2+ ion, wrap around HD to protect S2 site from access by ADAM proteases.
  • the stability of the interactions between LNRs and HD, as well as those within these regions, is critical to maintain the autoinhibited conformation of NRR. Mutations in the Notch 3 NRR alter the autoinhibited conformation, thereby exposing the HD domain, such that the S2, andsubsequently the S3 site is available for cleavage by proteases, thereby activating downstream Notch 3 signal transduction.
  • the antibody or fragment thereof binds to the conformational epitope such that it restricts the mobility of the LNR regions (LNR-A, LNR-B, LNR-C as well as corresponding linkers between LNR domains) relative to HD, stabilizing Notch 3 NRR in an autoinhibited conformation.
  • the failure to form the active (uninhibited, open) conformation results in failure to activate signal transduction.
  • the antibody or fragment thereof binds to the conformational epitope such that it prevents the HD within the NRR from becoming exposed, thereby rendering it unavailable for cleavage at the S2, and/or
  • the disclosure pertains to mutations in the Notch 3 receptor.
  • Activating mutations in Notchl were identified in >50% of T-ALL patients in two general regions of the receptor (Weng et al, (2004) Science 306:269-71).
  • One class of mutations was found to be clustered in the hydrophobic core of the HD domain of the NRR.
  • Rare mutations have also been identified in the LNR domain (Gordon et al, (2009) Blood 1 13 :4381-4390).
  • the NRR mutations likely act by partially, or completely unfolding the HD domain, altering the pocket that protects the S2 site and disrupting interactions with the LNR.
  • Notch 3 has been shown in several studies, including the TCGA analysis of serous ovarian cancer to be amplified in 1 1-25% of patient samples (Nakayama et al, (2007) Int J Cancer 120:2613-17, Etemadmoghadam et al, (2009) Clin Can Res 15: 1417- 27, Bell et al, (201 1) Nature 474:609-615).
  • Notch 3 has been reported in Cerebral Autosomal Dominant Arteriopathy with Subcortical Infarcts and Leukoencephalopathy (CADASIL) syndrome, these mutations are generaly missense in nature and the link to alterations in Notch 3 function and disease pathology is not clear (see Ayata, (2010), Stroke 41 :S129-S134). Comprehensive analysis of gene mutations in various cancer types has been performed by TCGA and other organizations. The standard technique used is exon-capture. As part of these studies, Notch 3 mutations have been reported in around 1% of head and neck squamous carcinomas, ovarian cancers and lung adenocarcinoma.
  • CADASIL Cerebral Autosomal Dominant Arteriopathy with Subcortical Infarcts and Leukoencephalopathy
  • Notch 3 mutations 947 human cancer cell lines were characterized and mutation information was obtained for >1600 genes by massively parallel sequencing using a solution phase hybrid capture technology, as described in Example 5.
  • primary tumor samples were sequenced with RNAseq (Wang et al (2009) Nature Reviews Genetics 10:57- 63. Mutations were identified in both the NRR and PEST domain in multiple cell lines and tumor samples as shown in Table 1.
  • Notch 3 activating mutations which interfere with the function of Notch 3 are involved in the pathogenesis of cancer. As the presence of an altered Notch 3 having a loss of function, gain of function or altered function, directly increases the risk of cancer, detection of such mutations lends itself to diagnostic and prognostic methods. The identification of such activating mutations may then be treated by antibodies or fragments thereof that bind to the mutant Notch 3. Table 1 : Notch 3 activating mutations
  • TALL-1 cells which are a T-cell acute lymphoblastic cell line with a S1580L mutation
  • breast tumor (X-1004) with a G1487D mutation The Examples show that introduction of either a S1580L mutation or a G1487D mutation into a Notch 3 receptor resulted in an approximately 10 fold increase in the basal signaling from the receptor relative to a wild-type control. In this system the wild-type and mutant receptors were expressed at approximately equivalent levels as determined by FACS assay. This data shows that these mutations activate Notch3 signaling in cell lines and tumors expressing these and other similar mutations. This activation of Notch 3 signaling is inhibited by Notch 3 antibodies or fragments therof
  • Mutant Notch 3 can be identified by any of the techniques described herein.
  • the mutant Notch 3 can be sequenced to identify the specific mutation (activating mutations that increase Notch 3 signal transduction).
  • the mutations, especially those which lead to an altered function of the protein, are then used for the diagnostic and prognostic methods of the present invention.
  • mutants can be introduced into wild-type Notch 3 (SEQ ID NO: 1) to investigate the effect on antibody binding.
  • Mutagenesis using known techniques such as alanine-scanning can help define functionally relevant epitopes.
  • Mutagenesis utilizing an arginine/glutamic acid scanning protocol can also be employed (see, e.g., Nanevicz et ah, (1995), J. Biol. Chem. 270(37):21619-21625 and Zupnick ei a/., (2006), J. Biol. Chem.
  • arginine and glutamic acids are substituted (typically individually) for an amino acid in the wild-type polypeptide because these amino acids are charged and bulky and thus have the potential to disrupt binding between an antigen binding protein and an antigen in the region of the antigen where the mutation is introduced.
  • Arginines that exist in the wild-type antigen are replaced with glutamic acid.
  • a variety of such individual mutants can be obtained and the collected binding results analyzed to determine what residues affect binding.
  • a series of mutant Notch 3 can be created, with each mutant Notch 3 having a single mutation. Binding of each mutant Notch 3 with various Notch 3 antibodies or fragments thereof can be measured and compared to the ability of the selected antibody or fragments thereof to bind wild-type Notch 3 (SEQ ID NO: 1).
  • An alteration (for example a reduction or increase) in binding between an antibody or fragment thereof and a mutant or variant Notch 3 as used herein means that there is a change in binding affinity (e.g., as measured by known methods such as Biacore testing or the bead based assay described below in the examples), EC5 0 , and/or a change (for example a reduction) in the total binding capacity of the antigen binding protein (for example, as evidenced by a decrease in B max in a plot of antigen binding protein concentration versus antigen concentration).
  • a significant alteration in binding indicates that the mutated residue is involved in binding to the antibody or fragment thereof.
  • a significant reduction in binding means that the binding affinity, EC50, and/or capacity between an antibody or fragments thereof and a mutant Notch 3 antigen is reduced by greater than 10%, greater than 20%, greater than 40%, greater than 50%, greater than 55%, greater than 60%, greater than 65%, greater than 70%, greater than 75%, greater than 80%, greater than 85%, greater than 90% or greater than 95% relative to binding between the an antibody or fragment thereof and a wild type Notch 3 (e.g., SEQ ID NO: 1).
  • a wild type Notch 3 e.g., SEQ ID NO: 1
  • binding of an antibody or fragments thereof is significantly reduced or increased for a mutant Notch 3 having one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) mutations as compared to a wild-type Notch3 protein (e.g., SEQ ID NO: 1).
  • a mutant Notch 3 having one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) mutations as compared to a wild-type Notch3 protein (e.g., SEQ ID NO: 1).
  • variant forms are referenced with respect to the wild-type sequence shown in SEQ ID NO: 1, it will be appreciated that in an allelic or splice variants of Notch 3 the amino acids could differ. Antibodies or fragments thereof showing significantly altered binding (e.g., lower or higher binding) for such allelic forms of Notch 3 are also contemplated.
  • any one of the mutatnts described in Table 1 can be be combined with any other 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 of the other mutants in Table 1 to produce an "expression pattern" or "expression signature” that can be used to identify, diagnose, or monitor a subject.
  • the expression signature comprises one or more group 1 mutations, for example a combination of S1580L, R1510H, D1587N, R1580Q, and Y1624H.
  • the expression signature comprises one or more group 2 mutations, for example a combination of G1487D, A1476T, A1609T, L1518M, and A1537T.
  • the expression signature comprises one or more group 3 mutations, for example a combination ofN1597K, L1547V, and R1526C.
  • the expression signature comprises one or more group 1 mutations, for example a combination of S1580L, R1510H, D1587N, R1580Q, and Y1624H; and one or more group 2 mutations, for example a combination of G1487D, A1476T, A1609T, L1518M, and A1537T.
  • the expression signature comprises one or more group 1 mutations, for example a combination of S1580L, R1510H, D1587N, R1580Q, and Y1624H; and one or more group 3 mutations, for example a combination of N1597K, L1547V, and R1526C.
  • the expression signature comprises one or more group 2 mutations, for example a combination of G1487D, A1476T, A1609T, L1518M, and A1537T; and one or more group 3 mutations, for example a combination of N1597K, L1547V, and R1526C Notch 3 Structure and Conformational Epitopes
  • the disclosure pertains to the identification of a number of distinct
  • the disclosure also shows for the first time that there are multiple conformational epitopes within the NRR and that antibody fragment binds to a unique conformational epitope that are separated from each other, as shown in Figure 25.
  • the antibodies or fragments thereof bind to the autoinhibited state of Notch 3 and stabilizes Notch 3 in this autoinhibited state.
  • a first class of antibodies (e.g., 20350) binds to a first conformational epitope in the NRR domain;
  • a second class of antibodies (e.g., 20358) binds to a second conformational epitope in the NRR domain;
  • a third class of antibodies binds to a third conformational epitope in the NRR domain.
  • the first, second and third conformational epitopes of the NRR do not overlap; and the first, second and third class of antibodies bind to distinct regions of the NRR.
  • first and second conformational epitopes of the NRR do not overlap; and the first and second class of antibodies bind to distinct regions of the NRR. In one embodiment, the first and third conformational epitopes of the NRR do not overlap, and the first and third class of antibodies bind to distinct regions of the NRR. In one embodiment, the second and conformational epitopes of the NRR do not overlap, and the second and third class of antibodies bind to distinct regions of the NRR.
  • the first, second and third conformational epitopes of the NRR overlap with each other by at least one, two, three, four, five, six, seven, eight, nine, or ten amino acid residues; and the first, second, and third class of antibodies bind to at least one, two, three, four, five, six, seven, eight, nine, or ten overlapping amino acid residues.
  • the first and second conformational epitopes of the NRR overlap with each other by at least one, two, three, four, five, six, seven, eight, nine, or ten amino acid residues; and the first and second class of antibodies bind to at least one, two, three, four, five, six, seven, eight, nine, or ten overlapping amino acid residues.
  • the first and third conformational epitopes of the NRR overlap with each other by at least one, two, three, four, five, six, seven, eight, nine, or ten amino acid residues; and the first and third class of antibodies bind to at least one, two, three, four, five, six, seven, eight, nine, or ten overlapping amino acid residues.
  • the second and third conformational epitopes of the NRR overlap with each other by at least one, two, three, four, or five, six, seven, eight, nine, or ten amino acid residues; and the second and third class of antibodies bind to at least one, two, three, four, five, six, seven, eight, nine, or ten overlapping amino acid residues.
  • the crystals of Notch 3 can be prepared by expressing a nucleotide sequence encoding Notch 3 or a variant thereof in a suitable host cell, and then crystallizing the purified protein(s) in the presence of the relevant Notch 3 targeted Fab.
  • Notch 3 polypeptides may also be produced as fusion proteins, for example to aid in extraction and purification.
  • fusion protein partners include glutathione-S- transferase (GST), histidine (HIS), hexahistidine (6HIS), GAL4 (DNA binding and/or transcriptional activation domains) and beta-galactosidase. It may also be convenient to include a proteolytic cleavage site between the fusion protein partner and the protein sequence of interest to allow removal of fusion protein sequences. After expression, the proteins may be purified and/or concentrated, for example by immobilised metal affinity chromatography, ion-exchange chromatography, and/or gel filtration.
  • the protein(s) may be crystallised using techniques described herein. Commonly, in a crystallization process, a drop containing the protein solution is mixed with the crystallization buffer and allowed to equilibrate in a sealed container. Equilibration may be achieved by known techniques such as the "hanging drop” or the “sitting drop” method. In these methods, the drop is hung above or sitting beside a much larger reservoir of crystallization buffer and equilibration is reached through vapor diffusion. Alternatively, equilibration may occur by other methods, for example under oil, through a semi-permeable membrane, or by free- interface diffusion (See e.g., Chayen et ah, (2008) Nature Methods 5, 147 - 153).
  • the structure may be solved by known X-ray diffraction techniques.
  • Many techniques use chemically modified crystals, such as those modified by heavy atom derivatization to approximate phases.
  • a crystal is soaked in a solution containing heavy metal atom salts, or organometallic compounds, e.g., lead chloride, gold thiomalate, thimerosal or uranyl acetate, which can diffuse through the crystal and bind to the surface of the protein.
  • the location(s) of the bound heavy metal atom(s) can then be determined by X-ray diffraction analysis of the soaked crystal.
  • the patterns obtained on diffraction of a monochromatic beam of X-rays by the atoms (scattering centres) of the crystal can be solved by mathematical equations to give mathematical coordinates.
  • the diffraction data are used to calculate an electron density map of the repeating unit of the crystal.
  • Another method of obtaining phase information is using a technique known as molecular replacement. In this method, rotational and translational alogrithms are applied to a search model derived from a related structure, resulting in an approximate orientation for the protein of interest (See Rossmann, (1990) Acta Crystals A 46, 73-82).
  • the electron density maps are used to establish the positions of the individual atoms within the unit cell of the crystal (Blundel et al, (1976) Protein Crystallography, Academic Press).
  • the present disclosure describes for the first time, multiple three-dimensional structures of Notch 3 and a Fab of a Notch 3 antibody, and show there are multiple conformational epitopes within the NRR.
  • the extracellular NRR domain of Notch 3 is shown in Figure 2.
  • the approximate domain boundaries are as follows: LNR-A has amino acid residues E1383- G1422; LNR-A-B linker has amino acid residues Aspl423-Leul431; LNR-B has amino acid residues Glnl432-Alal460; LNR-B -C linker has amino acid residues Glyl461-Asnl468; LNR-C has amino acid residues Prol469-Serl502; LNR-HD liner has amino acid residues Glul503-Argl510; HD-N has amino acid residues Glyl51 1-Argl571; and HD-C has amino acid residuesl572-Serl640.
  • Human Notch 3 has Accession No. (NP_000
  • the three-dimensional structure of Notch 3 and the antibody or fragment thereof allows the identification of target binding sites for potential Notch 3 receptor modulators.
  • Preferred target binding sites are those involved in the activation of Notch 3.
  • the target binding site is located within the LNR and HD domains of Notch 3.
  • an antibody or fragment thereof which binds to either LNR or HD, and preferably to both LNR and HD domains can modulate Notch 3 activation by preventing the domains from dissociating from each other and exposing the HD domain such that the S2, and subsequently the S3 cleavage sites are exposed.
  • an antibody or fragment thereof that bind to amino acid residues within these domains causes Notch 3 to maintain an autoinhibited conformation that prevents activation and downstream signal transduction.
  • the conformational epitope is defined by Notch 3 amino acid residues: 1427-1429 (of the LNR-A/B linker), 1442, 1444-1445, 1447-1450, 1453, 1458 (of LNR-B), 1461-1462, 1464 (of the LNR-B/C linker), 1507-1508, 1510 (of the LNR-HD linker), 1592, 1594-1599, 1602 (of the HD ⁇ 4- ⁇ 3 loop), and 1606 (of the HD a3 helix) of SEQ ID NO: l, or a subset thereof.
  • the paratope is the region of the antibody that comprises the CDR sequences. In one embodiment, the paratope comprises the sequences listed in Table 1.
  • the paratope comprises at least one amino acid residue that binds with Notch 3 residues: Cysl442, Prol444, Alal445, Serl447, Serl448, Prol449, Tyrl453, Cysl458, Glyl461, Glyl462, Glyl464, Leul592, Serl594, Prol595, Glul596, Asnl597, Aspl598, and Hisl599.
  • the paratope comprises at least one amino acid residue that binds with Notch 3 residues: Glnl427, Cysl428, Glul429, Prol444, Serl445, Serl447, Serl448, Prol449, Tyrl453, Leul507, Leul508, Argl510, Leul592, Aspl598, Prol602, and Serl606.
  • the antibody or fragment thereof binds to human Notch 3 protein having a conformational epitope comprising amino acid residues: 1427-1429 (of the LNR- A/B linker), 1442, 1444-1445, 1447-1450, 1453, 1458 (of LNR-B), 1461-1462, 1464 (of the LNR-B/C linker), 1507-1508, 1510 (of the LNR-HD linker), 1592, 1594-1599, 1602 (of the HD ⁇ 4- ⁇ 3 loop), and 1606 (of the HD a3 helix) of SEQ ID NO: 1, or a subset thereof.
  • the antibody or fragment thereof binds to amino acids within or overlapping amino acid residues amino acid residues: 1427-1429 (of the LNR-A/B linker), 1442, 1444-1445, 1447-1450, 1453, 1458 (of LNR-B), 1461-1462, 1464 (of the LNR-B/C linker), 1507-1508, 1510 (of the LNR-HD linker), 1592, 1594-1599, 1602 (of the HD ⁇ 4- ⁇ 3 loop), and 1606 (of the HD a3 helix) of SEQ ID NO: l, or a subset thereof.
  • the antibody or fragment thereof binds to amino acids within (and/or amino acid sequences consisting of) amino acid residues: 1427-1429 (of the LNR-A/B linker), 1442, 1444-1445, 1447-1450, 1453, 1458 (of LNR-B), 1461-1462, 1464 (of the LNR-B/C linker), 1507-1508, 1510 (of the LNR-HD linker), 1592, 1594-1599, 1602 (of the HD ⁇ 4- ⁇ 3 loop), and 1606 (of the HD a3 helix) of SEQ ID NO: 1, or a subset thereof.
  • the conformational epitope is defined by Notch 3 amino acid residues: 1440 (of LNR-B), 1463, 1465-1468 (of the LNR-B/C linker) 1469-1472, 1474, 1486-1487 (of LNR-C), 1534 (of HD a2 helix), and 1618, 1619, and 1621 (of the ⁇ 3- ⁇ 5 loop) of SEQ ID NO: l, or a subset thereof.
  • the paratope comprises at least one amino acid residue that binds with Notch 3 residues: Argl463, Thrl466, Asnl468, Prol469, Vall470, Tyrl471, Tyrl474, Glnl486, and Glyl487.
  • the paratope comprises at least one amino acid residue that binds with Notch 3 residues: Serl440, Argl465, Thrl466, Asnl468, Prol469, Vall470, glul472, Argl434, Glul618, Argl619, and Aspl621.
  • the antibody or fragment thereof binds to human Notch 3 protein having a conformational epitope comprising amino acid residues: 1440 (of LNR-B), 1463, 1465-1468 (of the LNR-B/C linker) 1469-1472, 1474, 1486-1487 (of LNR-C), 1534 (of HD a2 helix), and 1618, 1619, and 1621 (of the ⁇ 3- ⁇ 5 loop) of SEQ ID NO: l, or a subset thereof.
  • the antibody or fragment thereof binds to amino acids within or overlapping amino acid residues amino acid residues: 1440 (of LNR-B), 1463, 1465-1468 (of the LNR-B/C linker) 1469-1472, 1474, 1486-1487 (of LNR-C), 1534 (of HD a2 helix), and 1618, 1619, and 1621 (of the ⁇ 3- ⁇ 5 loop) of SEQ ID NO: l, or a subset thereof.
  • the antibody or fragment thereof binds to amino acids within (and/or amino acid sequences consisting of) amino acid residues: 1440 (of LNR-B), 1463, 1465-1468 (of the LNR-B/C linker) 1469-1472, 1474, 1486-1487(of LNR-C), 1534 (of HD a2 helix), and 1618, 1619, and 1621 (of the ⁇ 3- ⁇ 5 loop) of SEQ ID NO: l, or a subset thereof.
  • the antibody or fragment thereof binds to the conformational epitope such that it restricts the mobility of the LNR regions (LNR-A, LNR-B, LNR-C), stabilizing it in an autoinhibited conformation.
  • the failure to form the active (uninhibited, open) conformation results in failure to activate signal transduction.
  • the antibody or fragment thereof binds to the conformational epitope such that it prevents the HD within the NRR from becoming exposed, thereby rendering it unavailable for cleavage at the S2, and/or S3 sites by proteases.
  • the failure to cleave the HD results in failure to activate signal transduction.
  • the depicted structures also allows one to identify specific core Notch 3 amino acid residues for the interaction interface of an antibody or fragment thereof (e.g., 20350 and 20358) with Notch 3. For 20350, these were defined as residues that are within 5A of the 20350 VH chain.
  • the core residues are as follows: Cysl442, Prol444, Alal445, Serl447, Serl448, Prol449, Tyrl453, Cysl458, Glyl461, Glyl462, Glyl464, Leul592, Serl594, Prol595, Glul596, Asnl597, Aspl598, and Hisl599.
  • the core residues are as follows: Glnl427, Cysl428, Glul429, Prol444, Serl445, Serl447, Serl448, Prol449, Tyrl453, Leul507, Leul508, Argl510, Leul592, Aspl598, Prol602, and Serl606.
  • residues were defined as residues that are within 5A of the 20358 VH chain.
  • the core residues are as follows: Argl463, Thrl466, Asnl468, Prol469, Vall470, Tyrl471, Tyrl474, Glnl486, and Glyl487.
  • the core residues are as follows:
  • Interaction interface amino acids were determined as all amino acid residues with at least one atom less than or equal to 5A from the Notch 3 partner protein. 5A was chosen as the cutoff distance to allow for atoms within a van der Waals radius plus a possible water-mediated hydrogen bond.
  • any antigen binding protein that binds to, covers, or prevents 20350 from interacting with any of the above residues can be employed to bind to or inhibit Notch 3.
  • the antibodies or fragments thereof bind to or interact with at least one of the following Notch 3 residues: Cysl442, Prol444, A 445, Serl447, Serl448, Prol449, Tyrl453, Cysl458, Glyl461, Glyl462, Glyl464, Leul592, Serl594, Prol595, Glul596, Asnl597, Aspl598, and Hisl599.
  • the antibodies and fragments thereof bind to or interact with at least one of the following Notch 3 residues: Glnl427, Cysl428, Glul429, Prol444, Serl445, Serl447, Serl448, Prol449, Tyrl453, Leul507, Leul508, Argl510, Leul592, Aspl598, Prol602, and Serl606.
  • the antibodies or fragments thereof bind to or interact with at least one of the following Notch 3 residues: Cysl442, Prol444, A 445, Serl447, Serl448, Prol449, Tyrl453, Cysl458, Glyl461, Glyl462, Glyl464, Leul592, Serl594, Prol595, Glul596, Asnl597, Aspl598, Hisl599, Glnl427, Cysl428, Glul429, Prol444, Serl445, Serl447, Serl448, Prol449, Tyrl453, Leul507, Leul508, Argl510, Leul592, Aspl598, Prol602, and Serl606.
  • the antibodies or fragments thereof bind to or interact with a combination of the following Notch 3 residues: Cysl442, Prol444, Alal445, Serl447, Serl448, Prol449, Tyrl453, Cysl458, Glyl461, Glyl462, Glyl464, Leul592, Serl594, Prol595, Glul596, Asnl597, Aspl598, Hisl599, Glnl427, Cysl428, Glul429, Prol444, Serl445, Serl447, Serl448, Prol449, Tyrl453, Leul507, Leul508, Argl510, Leul592, Aspl598, Prol602, and Serl606.
  • the antibodies or fragments thereof bind to or interact with all of the following Notch 3 residues: Cysl442, Prol444, A 445, Serl447, Serl448, Prol449, Tyrl453, Cysl458, Glyl461, Glyl462, Glyl464, Leul592, Serl594, Prol595, Glul596, Asnl597, Aspl598, Hisl599, Glnl427, Cysl428, Glul429, Prol444, Serl445, Serl447, Serl448, Prol449, Tyrl453, Leul507, Leul508, Argl510, Leul592, Aspl598, Prol602, and Serl606.
  • any antigen binding protein that binds to, covers, or prevents 20358 from interacting with any of the above residues can be employed to bind to or inhibit Notch 3.
  • the antibodies or fragments thereof bind to or interact with at least one of the following Notch 3 residues: Argl463, Thrl466, Asnl468, Prol469, Vall470, Tyrl471, Tyrl474, Glnl486, and Glyl487.
  • the antibodies or fragments thereof bind to or interact with at least one of the following Notch 3 residues: Serl440, Argl465, Thrl466, Asnl468, Prol469, Vall470, Glul472, Argl434, Glul618, Argl619, and Aspl621.
  • the antibodies or fragments thereof bind to or interact with at least one of the following Notch 3 residues: Argl463, Thrl466, Asnl468, Prol469, Vall470, Tyrl471, Tyrl474, Glnl486, Glyl487, Serl440, Argl465, Thrl466, Asnl468, Prol469, Vall470, glul472, Argl434, Glul618, Argl619, and Aspl621.
  • the antibodies or fragments thereof bind to or interact with a combination of the following Notch 3 residues: Argl463, Thrl466, Asnl468, Prol469, Vall470, Tyrl471, Tyrl474, Glnl486, Glyl487, Serl440, Argl465, Thrl466, Asnl468, Prol469, Vall470, Glul472, Argl434, Glul618, Argl619, and Asp 1621.
  • the antibodies or fragments thereof bind to or interact with all of the following Notch 3 residues: Argl463, Thrl466, Asnl468, Prol469, Vall470, Tyrl471, Tyrl474, Glnl486, Glyl487, Serl440, Argl465, Thrl466, Asnl468, Prol469, Vall470, Glul472, Argl434, Glul618, Argl619, and Aspl621.
  • the antibodies disclosed herein bind to the same conformational epitope as 20350. In one embodiment, the antibodies disclosed herein bind to the same
  • a Notch 3 conformational epitope can be utilized to isolate antibodies of fragments thereof that bind to Notch 3.
  • a Notch 3 conformational epitope can be utilized to generate antibodies or fragments thereof which bind to Notch 3.
  • a Notch 3 conformational epitope can be utilized as an immunogen to generate antibodies of fragments thereof that bind to the Notch 3 conformational epitope.
  • a Notch 3 conformational epitope can be administered to an animal, and antibodies that bind to Notch 3 can subsequently be obtained from the animal.
  • conformational epitopes identified for 20337, 20350, and 20358 further conformational epitopes on Notch 3 NRR can also be found using the methods disclosed herein and as disclosed in the Examples.
  • conformational epitopes that bridge LNR and HD; and conformational epitopes in which the S2 plug (L1419) is part of an epitope In addition to the conformational epitopes identified for 20337, 20350, and 20358, further conformational epitopes on Notch 3 NRR can also be found using the methods disclosed herein and as disclosed in the Examples.
  • conformational epitopes that bridge LNR and HD; and conformational epitopes in which the S2 plug (L1419) is part of an epitope are particularly.
  • NRR/20350 and Notch 3 NRR/20358 provides the framework to explore other Notch 3 antibodies in more detail.
  • the 3D structure of Notch 3 allows the epitopes for monoclonal antibodies to be mapped and their mode of action inferred, since some inhibit, some stimulate and others have no effect on cell growth.
  • the conformational epitope for Notch 3 comprises discontinuous amino acid residues from the LNR region and the HDs of the NRR. The availability of the 3D structures of Notch 3 will facilitate the determination of the precise mechanism of action of these inhibitory agents and the design of new approaches for interfering with Notch 3 function.
  • the structure of the CDRs contribute to a paratope, through which an antibody is able to bind to an epitope.
  • the shape of such a paratope may be determined in a number of ways. Traditional structural examination approaches can be used, such as NMR or x-ray crystallography. These approaches can examine the shape of the paratope alone, or while it is bound to the epitope.
  • the paratope is the region of the antibody that comprises the CDR sequences. In one embodiment, the paratope comprises the sequences listed in Table 1.
  • the paratope comprises at least one amino acid residue that binds with Notch 3 residues: Cysl442, Prol444, Alal445, Serl447, Serl448, Prol449, Tyrl453, Cysl458, Glyl461, Glyl462, Glyl464, Leul592, Serl594, Prol595, Glul596, Asnl597, Aspl598, and His 1599.
  • the paratope comprises at least one amino acid residue that binds with Notch 3 residues: Glnl427, Cysl428, Glul429, Prol444, Serl445, Serl447, Serl448, Prol449, Tyrl453, Leul507, Leul508, Argl510, Leul592, Aspl598, Prol602, and Serl606.
  • the paratope comprises at least one amino acid residue that binds with Notch 3 residues: Argl463, Thrl466, Asnl468, Prol469, Vall470, Tyrl471, Tyrl474,
  • the paratope comprises at least one amino acid residue that binds with Notch 3 residues: Serl440, Argl465, Thrl466, Asnl468, Prol469, Vall470, Glul472, Argl434, Glul618, Argl619, and Aspl621.
  • molecular models may be generated in silico.
  • a structure can be generated through homology modeling, aided with a commercial package, such as Insightll modeling package from Accelrys (San Diego, Calif). Briefly, one can use the sequence of the antibody to be examined to search against a database of proteins of known structures, such as the Protein Data Bank. After one identifies homologous proteins with known structures, these homologous proteins are used as modeling templates. Each of the possible templates can be aligned, thus producing structure based sequence alignments among the templates. The sequence of the antibody with the unknown structure can then be aligned with these templates to generate a molecular model for the antibody with the unknown structure.
  • the result is that one is able to estimate where and how the epitope interacts with the paratope.
  • only a fragment, or variant, of the epitope is used to assist in determining the relevant interactions.
  • the entire epitope is used in the modeling of the interaction between the paratope and the epitope.
  • one is able to predict which residues are the most important in the interaction between the epitope and the paratope.
  • one is able to readily select which residues to change in order to alter the binding characteristics of the antibody. For instance, it may be apparent from the docking models that the side chains of certain residues in the paratope may sterically hinder the binding of the epitope, thus altering these residues to residues with smaller side chains may be beneficial.
  • One can determine this in many ways. For example, one may simply look at the two models and estimate interactions based on functional groups and proximity. Alternatively, one may perform repeated pairings of epitope and paratope, as described above, in order to obtain more favorable energy interactions.
  • the models determined above can be tested through various techniques. For example, the interaction energy can determined with the programs discussed above in order to determine which of the variants to further examine. Also, coulumbic and van der Waals interactions are used to determine the interaction energies of the epitope and the variant paratopes. Also site directed mutagenesis is used to see if predicted changes in antibody structure actually result in the desired changes in binding characteristics. Alternatively, changes may be made to the epitope to verify that the models are correct or to determine general binding themes that may be occurring between the paratope and the epitope.
  • any modification may also have additional side effects on the activity of the antibody. For instance, while any alteration predicted to result in greater binding, may induce greater binding, it may also cause other structural changes which might reduce or alter the activity of the antibody. The determination of whether or not this is the case is routine in the art and can be achieved in many ways. For example, the activity can be tested through an ELISA test. Alternatively, the samples can be tested through the use of a surface plasmon resonance device.
  • the present disclosure provides antibodies that recognize at least one conformational epitope of Notch 3.
  • the disclosure is based on the finding that a class of antibodies against Notch 3 bind to the particular conformation epitope of Notch 3 is disclosed in Table 2.
  • SEQ ID NO: 22 DNA Light Chain AGGCACTAAGGTCGAGATTAAGCGTACGGTGGCCGCTCCCAGCGTGTTCATCTTCCCCCC
  • SEQ ID NO: 30 DNA VH ACTACGCTCAGAAATTTCAGGGTAGAGTGACTATCACCGCCGACGAGTCTACTAGCACCG
  • SEQ ID NO: 50 DNA VH TATTCACTACGCCGCTAGTGTGAAGGGCCGGTTCACTATCTCTAGGGACGACTCTAAGAA
  • SEQ ID NO: 62 DNA Light Chain GTTCGGCGGAGGCACTAAGCTGACCGTGCTGGGTCAACCTAAGGCTGCCCCCAGCGTGA
  • SEQ ID NO: 70 DNA VH CGCCGACTACGCTGCCCCTGTGAAGGGCCGGTTCACTATCTCTAGGGACGACTCTAAGA
  • SEQ ID NO: 102 I DNA Light Chain CCAGGGCACGAAAGTTGAAATTAAACGTACGGTGGCCGCTCCCAGCGTGTTCATCTTCCC
  • SEQ ID NO: 162 DNA Light Chain CCAGGGCACGAAAGTTGAAATTAAACGTACGGTGGCCGCTCCCAGCGTGTTCATCTTCCC
  • SEQ ID NO: 182 DNA Light Chain CAGGGCACGAAAGTTGAAATTAAACGTACGGTGGCCGCTCCCAGCGTGTTCATCTTCCCC
  • SEQ ID NO: 190 DNA VH ATCCATTATGCCGCCTCTGTGAAAGGCCGCTTTACCATTAGCCGCGATGATTCGAAAAAC
  • SEQ ID NO: 202 DNA Light Chain GCAAGCAGAAGACGAAGCGGATTATTACTGCTCTACTTGGACTGGTACTTCTGAATCTCA
  • SEQ ID NO: 210 DNA VH ACTGACTATGCCGCCCCAGTGAAAGGCCGCTTTACCATTAGCCGCGATGATTCGAAAAAC

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Hematology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biomedical Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Urology & Nephrology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Cell Biology (AREA)
  • Endocrinology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Biotechnology (AREA)
  • Pathology (AREA)
  • General Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Oncology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
PCT/US2014/022642 2013-03-14 2014-03-10 Antibodies against notch 3 Ceased WO2014159239A2 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
EP19170673.8A EP3611189A1 (en) 2013-03-14 2014-03-10 Antibodies against notch 3
JP2016501025A JP2016514130A (ja) 2013-03-14 2014-03-10 Notch3に対する抗体
CN201480027023.XA CN105246916A (zh) 2013-03-14 2014-03-10 针对notch 3的抗体
EP14722403.4A EP2970479B1 (en) 2013-03-14 2014-03-10 Antibodies against notch 3
US14/853,003 US10538587B2 (en) 2013-03-14 2015-09-14 Antibodies against notch 3

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201361781421P 2013-03-14 2013-03-14
US61/781,421 2013-03-14

Related Child Applications (2)

Application Number Title Priority Date Filing Date
EP19170673.8A Previously-Filed-Application EP3611189A1 (en) 2013-03-14 2014-03-10 Antibodies against notch 3
US14/853,003 Continuation-In-Part US10538587B2 (en) 2013-03-14 2015-09-14 Antibodies against notch 3

Publications (2)

Publication Number Publication Date
WO2014159239A2 true WO2014159239A2 (en) 2014-10-02
WO2014159239A3 WO2014159239A3 (en) 2015-02-19

Family

ID=50680110

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2014/022642 Ceased WO2014159239A2 (en) 2013-03-14 2014-03-10 Antibodies against notch 3

Country Status (5)

Country Link
US (1) US10538587B2 (https=)
EP (2) EP2970479B1 (https=)
JP (2) JP2016514130A (https=)
CN (1) CN105246916A (https=)
WO (1) WO2014159239A2 (https=)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017190025A1 (en) * 2016-04-29 2017-11-02 Aveo Pharmaceuticals, Inc. Anti-notch3 antibody
US20210139556A1 (en) * 2018-04-10 2021-05-13 Stichting Sanquin Bloedvoorziening Chimeric notch receptors
WO2024105410A3 (en) * 2022-11-16 2024-06-27 Carocell Bio Limited Peptides

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108753833B (zh) * 2018-05-28 2021-12-03 上海海洋大学 斑马鱼notch3基因突变体的制备方法
TW202237642A (zh) * 2021-01-08 2022-10-01 美商10X基因組學有限公司 對冠狀病毒具有特異性的抗原結合多肽及其用途
CN117487018B (zh) * 2023-09-27 2024-05-17 武汉爱博泰克生物科技有限公司 抗人附睾分泌蛋白4的兔单克隆抗体及其应用

Citations (153)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3817837A (en) 1971-05-14 1974-06-18 Syva Corp Enzyme amplification assay
US3850752A (en) 1970-11-10 1974-11-26 Akzona Inc Process for the demonstration and determination of low molecular compounds and of proteins capable of binding these compounds specifically
US3939350A (en) 1974-04-29 1976-02-17 Board Of Trustees Of The Leland Stanford Junior University Fluorescent immunoassay employing total reflection for activation
US3996345A (en) 1974-08-12 1976-12-07 Syva Company Fluorescence quenching with immunological pairs in immunoassays
US4275149A (en) 1978-11-24 1981-06-23 Syva Company Macromolecular environment control in specific receptor assays
US4277437A (en) 1978-04-05 1981-07-07 Syva Company Kit for carrying out chemically induced fluorescence immunoassay
US4366241A (en) 1980-08-07 1982-12-28 Syva Company Concentrating zone method in heterogeneous immunoassays
US4458066A (en) 1980-02-29 1984-07-03 University Patents, Inc. Process for preparing polynucleotides
US4522811A (en) 1982-07-08 1985-06-11 Syntex (U.S.A.) Inc. Serial injection of muramyldipeptides and liposomes enhances the anti-infective activity of muramyldipeptides
US4526938A (en) 1982-04-22 1985-07-02 Imperial Chemical Industries Plc Continuous release formulations
EP0154316A2 (en) 1984-03-06 1985-09-11 Takeda Chemical Industries, Ltd. Chemically modified lymphokine and production thereof
US4683203A (en) 1984-04-14 1987-07-28 Redco N.V. Immobilized enzymes, processes for preparing same, and use thereof
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4708871A (en) 1983-03-08 1987-11-24 Commonwealth Serum Laboratories Commission Antigenically active amino acid sequences
EP0307434A1 (en) 1987-03-18 1989-03-22 Medical Res Council CHANGED ANTIBODIES.
US4816567A (en) 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
US4881175A (en) 1986-09-02 1989-11-14 Genex Corporation Computer based system and method for determining and displaying possible chemical structures for converting double- or multiple-chain polypeptides to single-chain polypeptides
US4880078A (en) 1987-06-29 1989-11-14 Honda Giken Kogyo Kabushiki Kaisha Exhaust muffler
EP0367166A1 (en) 1988-10-31 1990-05-09 Takeda Chemical Industries, Ltd. Modified interleukin-2 and production thereof
EP0368684A1 (en) 1988-11-11 1990-05-16 Medical Research Council Cloning immunoglobulin variable domain sequences.
EP0399666A1 (en) 1989-04-29 1990-11-28 Delta Biotechnology Limited Fusion proteins containing N-terminal fragments of human serum albumin
EP0401384A1 (en) 1988-12-22 1990-12-12 Kirin-Amgen, Inc. Chemically modified granulocyte colony stimulating factor
EP0413622A1 (en) 1989-08-03 1991-02-20 Rhone-Poulenc Sante Albumin derivatives with therapeutic functions
WO1991005548A1 (en) 1989-10-10 1991-05-02 Pitman-Moore, Inc. Sustained release composition for macromolecular proteins
US5013653A (en) 1987-03-20 1991-05-07 Creative Biomolecules, Inc. Product and process for introduction of a hinge region into a fusion protein to facilitate cleavage
WO1991006570A1 (en) 1989-10-25 1991-05-16 The University Of Melbourne HYBRID Fc RECEPTOR MOLECULES
US5091513A (en) 1987-05-21 1992-02-25 Creative Biomolecules, Inc. Biosynthetic antibody binding sites
WO1992003918A1 (en) 1990-08-29 1992-03-19 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
US5112946A (en) 1989-07-06 1992-05-12 Repligen Corporation Modified pf4 compositions and methods of use
US5128326A (en) 1984-12-06 1992-07-07 Biomatrix, Inc. Drug delivery systems based on hyaluronans derivatives thereof and their salts and methods of producing same
US5132405A (en) 1987-05-21 1992-07-21 Creative Biomolecules, Inc. Biosynthetic antibody binding sites
WO1992019244A2 (en) 1991-05-01 1992-11-12 Henry M. Jackson Foundation For The Advancement Of Military Medicine A method for treating infectious respiratory diseases
WO1993012227A1 (en) 1991-12-17 1993-06-24 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
US5223409A (en) 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
US5225539A (en) 1986-03-27 1993-07-06 Medical Research Council Recombinant altered antibodies and methods of making altered antibodies
WO1993015199A1 (fr) 1992-01-31 1993-08-05 Rhone-Poulenc Rorer S.A. Nouveaux polypeptides biologiquement actifs, leur preparation et composition pharmaceutique les contenant
WO1993015200A1 (fr) 1992-01-31 1993-08-05 Rhone-Poulenc Rorer S.A. Polypeptides antithrombotiques, antagonistes de la liaison du vwf aux plaquettes et/ou au sous-endothelium
US5258498A (en) 1987-05-21 1993-11-02 Creative Biomolecules, Inc. Polypeptide linkers for production of biosynthetic proteins
US5260203A (en) 1986-09-02 1993-11-09 Enzon, Inc. Single polypeptide chain binding molecules
WO1994004678A1 (en) 1992-08-21 1994-03-03 Casterman Cecile Immunoglobulins devoid of light chains
US5336603A (en) 1987-10-02 1994-08-09 Genentech, Inc. CD4 adheson variants
US5349053A (en) 1990-06-01 1994-09-20 Protein Design Labs, Inc. Chimeric ligand/immunoglobulin molecules and their uses
EP0616640A1 (en) 1991-12-02 1994-09-28 Medical Research Council Production of anti-self antibodies from antibody segment repertoires and displayed on phage
US5359046A (en) 1990-12-14 1994-10-25 Cell Genesys, Inc. Chimeric chains for receptor-associated signal transduction pathways
WO1994025585A1 (en) 1993-04-26 1994-11-10 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
US5374548A (en) 1986-05-02 1994-12-20 Genentech, Inc. Methods and compositions for the attachment of proteins to liposomes using a glycophospholipid anchor
WO1994029351A2 (en) 1993-06-16 1994-12-22 Celltech Limited Antibodies
US5399331A (en) 1985-06-26 1995-03-21 The Liposome Company, Inc. Method for protein-liposome coupling
US5405783A (en) 1989-06-07 1995-04-11 Affymax Technologies N.V. Large scale photolithographic solid phase synthesis of an array of polymers
US5412087A (en) 1992-04-24 1995-05-02 Affymax Technologies N.V. Spatially-addressable immobilization of oligonucleotides and other biological polymers on surfaces
US5416016A (en) 1989-04-03 1995-05-16 Purdue Research Foundation Method for enhancing transmembrane transport of exogenous molecules
US5427908A (en) 1990-05-01 1995-06-27 Affymax Technologies N.V. Recombinant library screening methods
US5447851A (en) 1992-04-02 1995-09-05 Board Of Regents, The University Of Texas System DNA encoding a chimeric polypeptide comprising the extracellular domain of TNF receptor fused to IgG, vectors, and host cells
US5476786A (en) 1987-05-21 1995-12-19 Creative Biomolecules, Inc. Biosynthetic antibody binding sites
US5476996A (en) 1988-06-14 1995-12-19 Lidak Pharmaceuticals Human immune system in non-human animal
WO1996004388A1 (en) 1994-07-29 1996-02-15 Smithkline Beecham Plc Novel compounds
US5530101A (en) 1988-12-28 1996-06-25 Protein Design Labs, Inc. Humanized immunoglobulins
WO1996020698A2 (en) 1995-01-05 1996-07-11 The Board Of Regents Acting For And On Behalf Of The University Of Michigan Surface-modified nanoparticles and method of making and using same
US5545807A (en) 1988-10-12 1996-08-13 The Babraham Institute Production of antibodies from transgenic animals
US5545806A (en) 1990-08-29 1996-08-13 Genpharm International, Inc. Ransgenic non-human animals for producing heterologous antibodies
US5605793A (en) 1994-02-17 1997-02-25 Affymax Technologies N.V. Methods for in vitro recombination
WO1997010365A1 (en) 1995-09-15 1997-03-20 Affymax Technologies N.V. Expression monitoring by hybridization to high density oligonucleotide arrays
WO1997013852A1 (en) 1995-10-10 1997-04-17 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
US5622929A (en) 1992-01-23 1997-04-22 Bristol-Myers Squibb Company Thioether conjugates
US5625126A (en) 1990-08-29 1997-04-29 Genpharm International, Inc. Transgenic non-human animals for producing heterologous antibodies
US5633425A (en) 1990-08-29 1997-05-27 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
US5641870A (en) 1995-04-20 1997-06-24 Genentech, Inc. Low pH hydrophobic interaction chromatography for antibody purification
US5661016A (en) 1990-08-29 1997-08-26 Genpharm International Inc. Transgenic non-human animals capable of producing heterologous antibodies of various isotypes
WO1997032572A2 (en) 1996-03-04 1997-09-12 The Penn State Research Foundation Materials and methods for enhancing cellular internalization
WO1997034631A1 (en) 1996-03-18 1997-09-25 Board Of Regents, The University Of Texas System Immunoglobin-like domains with increased half lives
US5677425A (en) 1987-09-04 1997-10-14 Celltech Therapeutics Limited Recombinant antibody
US5679377A (en) 1989-11-06 1997-10-21 Alkermes Controlled Therapeutics, Inc. Protein microspheres and methods of using them
WO1997044013A1 (en) 1996-05-24 1997-11-27 Massachusetts Institute Of Technology Aerodynamically light particles for pulmonary drug delivery
US5714350A (en) 1992-03-09 1998-02-03 Protein Design Labs, Inc. Increasing antibody affinity by altering glycosylation in the immunoglobulin variable region
WO1998023289A1 (en) 1996-11-27 1998-06-04 The General Hospital Corporation MODULATION OF IgG BINDING TO FcRn
WO1998024884A1 (en) 1996-12-02 1998-06-11 Genpharm International Transgenic non-human animals capable of producing heterologous antibodies
WO1998031346A1 (en) 1997-01-16 1998-07-23 Massachusetts Institute Of Technology Preparation of particles for inhalation
US5789650A (en) 1990-08-29 1998-08-04 Genpharm International, Inc. Transgenic non-human animals for producing heterologous antibodies
US5814318A (en) 1990-08-29 1998-09-29 Genpharm International Inc. Transgenic non-human animals for producing heterologous antibodies
US5831012A (en) 1994-01-14 1998-11-03 Pharmacia & Upjohn Aktiebolag Bacterial receptor structures
US5834252A (en) 1995-04-18 1998-11-10 Glaxo Group Limited End-complementary polymerase reaction
US5837458A (en) 1994-02-17 1998-11-17 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
US5855913A (en) 1997-01-16 1999-01-05 Massachusetts Instite Of Technology Particles incorporating surfactants for pulmonary drug delivery
US5869046A (en) 1995-04-14 1999-02-09 Genentech, Inc. Altered polypeptides with increased half-life
US5874299A (en) 1990-08-29 1999-02-23 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
US5877397A (en) 1990-08-29 1999-03-02 Genpharm International Inc. Transgenic non-human animals capable of producing heterologous antibodies of various isotypes
US5885793A (en) 1991-12-02 1999-03-23 Medical Research Council Production of anti-self antibodies from antibody segment repertoires and displayed on phage
WO1999015154A1 (en) 1997-09-24 1999-04-01 Alkermes Controlled Therapeutics, Inc. Methods for fabricating polymer-based controlled release preparations
WO1999016873A1 (de) 1997-09-26 1999-04-08 Arne Skerra Anticaline
WO1999020253A1 (en) 1997-10-23 1999-04-29 Bioglan Therapeutics Ab Encapsulation method
US5912015A (en) 1992-03-12 1999-06-15 Alkermes Controlled Therapeutics, Inc. Modulated release from biocompatible polymers
US5916597A (en) 1995-08-31 1999-06-29 Alkermes Controlled Therapeutics, Inc. Composition and method using solid-phase particles for sustained in vivo release of a biologically active agent
US5934272A (en) 1993-01-29 1999-08-10 Aradigm Corporation Device and method of creating aerosolized mist of respiratory drug
US5939598A (en) 1990-01-12 1999-08-17 Abgenix, Inc. Method of making transgenic mice lacking endogenous heavy chains
WO1999045962A1 (en) 1998-03-13 1999-09-16 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
US5958708A (en) 1992-09-25 1999-09-28 Novartis Corporation Reshaped monoclonal antibodies against an immunoglobulin isotype
US5969108A (en) 1990-07-10 1999-10-19 Medical Research Council Methods for producing members of specific binding pairs
WO1999054342A1 (en) 1998-04-20 1999-10-28 Pablo Umana Glycosylation engineering of antibodies for improving antibody-dependent cellular cytotoxicity
US5985309A (en) 1996-05-24 1999-11-16 Massachusetts Institute Of Technology Preparation of particles for inhalation
WO1999066903A2 (en) 1998-06-24 1999-12-29 Advanced Inhalation Research, Inc. Large porous particles emitted from an inhaler
US6019968A (en) 1995-04-14 2000-02-01 Inhale Therapeutic Systems, Inc. Dispersible antibody compositions and methods for their preparation and use
US6075181A (en) 1990-01-12 2000-06-13 Abgenix, Inc. Human antibodies derived from immunized xenomice
WO2000042072A2 (en) 1999-01-15 2000-07-20 Genentech, Inc. Polypeptide variants with altered effector function
US6121022A (en) 1995-04-14 2000-09-19 Genentech, Inc. Altered polypeptides with increased half-life
US6150584A (en) 1990-01-12 2000-11-21 Abgenix, Inc. Human antibodies derived from immunized xenomice
US6162963A (en) 1990-01-12 2000-12-19 Abgenix, Inc. Generation of Xenogenetic antibodies
US6165745A (en) 1992-04-24 2000-12-26 Board Of Regents, The University Of Texas System Recombinant production of immunoglobulin-like domains in prokaryotic cells
US6172197B1 (en) 1991-07-10 2001-01-09 Medical Research Council Methods for producing members of specific binding pairs
WO2001004144A2 (de) 1999-07-13 2001-01-18 Scil Proteins Gmbh Design von beta-faltblatt-proteinen mit spezifischen bindungseigenschaften
WO2001005950A2 (en) 1999-07-20 2001-01-25 Morphosys Ag Methods for displaying (poly)peptides/proteins on bacteriophage particles via disulfide bonds
US6194551B1 (en) 1998-04-02 2001-02-27 Genentech, Inc. Polypeptide variants
WO2001014424A2 (en) 1999-08-24 2001-03-01 Medarex, Inc. Human ctla-4 antibodies and their uses
US6277375B1 (en) 1997-03-03 2001-08-21 Board Of Regents, The University Of Texas System Immunoglobulin-like domains with increased half-lives
US6291158B1 (en) 1989-05-16 2001-09-18 Scripps Research Institute Method for tapping the immunological repertoire
WO2001077137A1 (en) 2000-04-12 2001-10-18 Human Genome Sciences, Inc. Albumin fusion proteins
US6316024B1 (en) 1996-10-11 2001-11-13 Sequus Pharmaceuticals, Inc. Therapeutic liposome composition and method of preparation
EP1176195A1 (en) 1999-04-09 2002-01-30 Kyowa Hakko Kogyo Co., Ltd. Method for controlling the activity of immunologically functional molecule
US6350466B1 (en) 1994-08-05 2002-02-26 Targesome, Inc. Targeted polymerized liposome diagnostic and treatment agents
WO2002043478A2 (en) 2000-11-30 2002-06-06 Medarex, Inc. Transgenic transchromosomal rodents for making human antibodies
WO2002092780A2 (en) 2001-05-17 2002-11-21 Diversa Corporation Novel antigen binding molecules for therapeutic, diagnostic, prophylactic, enzymatic, industrial, and agricultural applications, and methods for generating and screening thereof
WO2003002609A2 (en) 2001-06-28 2003-01-09 Domantis Limited Dual-specific ligand and its use
WO2003004873A1 (de) 2001-07-04 2003-01-16 Putzmeister Aktiengesellschaft Vorrichtung zum fördern von fliess- oder schüttfähigem fördergut
WO2003006007A1 (en) 2001-07-11 2003-01-23 Research & Innovation Soc.Coop. A R.L. Use of compounds as functional antagonists to the central cannabinoid receptors
WO2003035835A2 (en) 2001-10-25 2003-05-01 Genentech, Inc. Glycoprotein compositions
US20030153043A1 (en) 1997-05-21 2003-08-14 Biovation Limited Method for the production of non-immunogenic proteins
US20030157579A1 (en) 2002-02-14 2003-08-21 Kalobios, Inc. Molecular sensors activated by disinhibition
WO2003074679A2 (en) 2002-03-01 2003-09-12 Xencor Antibody optimization
US20030198971A1 (en) 2002-04-18 2003-10-23 Kalobios, Inc. Reactivation-based molecular interaction sensors
WO2004003019A2 (en) 2002-06-28 2004-01-08 Domantis Limited Immunoglobin single variant antigen-binding domains and dual-specific constructs
US6696245B2 (en) 1997-10-20 2004-02-24 Domantis Limited Methods for selecting functional polypeptides
US6703199B1 (en) 1997-06-12 2004-03-09 Research Corporation Technologies, Inc. Artificial antibody polypeptides
WO2004058821A2 (en) 2002-12-27 2004-07-15 Domantis Limited Dual specific single domain antibodies specific for a ligand and for the receptor of the ligand
US6765087B1 (en) 1992-08-21 2004-07-20 Vrije Universiteit Brussel Immunoglobulins devoid of light chains
US20040161738A1 (en) 2000-05-26 2004-08-19 Arumugam Muruganandam Single-domain brain-targeting antibody fragments derived from llama antibodies
US20040175756A1 (en) 2001-04-26 2004-09-09 Avidia Research Institute Methods for using combinatorial libraries of monomer domains
WO2004081026A2 (en) 2003-06-30 2004-09-23 Domantis Limited Polypeptides
EP1012280B1 (en) 1997-06-11 2004-11-10 Borean Pharma A/S Trimerising module
US6818418B1 (en) 1998-12-10 2004-11-16 Compound Therapeutics, Inc. Protein scaffolds for antibody mimics and other binding proteins
WO2004101790A1 (en) 2003-05-14 2004-11-25 Domantis Limited A process for recovering polypeptides that unfold reversibly from a polypeptide repertoire
WO2004106368A1 (de) 2003-05-28 2004-12-09 Scil Proteins Gmbh Generierung künstlicher bindungsproteine auf der grundlage von ubiquitin-proteinen
US6838254B1 (en) 1993-04-29 2005-01-04 Conopco, Inc. Production of antibodies or (functionalized) fragments thereof derived from heavy chain immunoglobulins of camelidae
US20050008625A1 (en) 2003-02-13 2005-01-13 Kalobios, Inc. Antibody affinity engineering by serial epitope-guided complementarity replacement
US20050048512A1 (en) 2001-04-26 2005-03-03 Avidia Research Institute Combinatorial libraries of monomer domains
US20050053973A1 (en) 2001-04-26 2005-03-10 Avidia Research Institute Novel proteins with targeted binding
US20050255552A1 (en) 2004-01-20 2005-11-17 Kalobios, Inc. Antibody specificity transfer using minimal essential binding determinants
US20060008844A1 (en) 2004-06-17 2006-01-12 Avidia Research Institute c-Met kinase binding proteins
US20060115470A1 (en) 2002-11-08 2006-06-01 Ablynx N. V. Camelidae antibodies against imminoglobulin e and use thereof for the treatment of allergic disorders
WO2006079372A1 (en) 2005-01-31 2006-08-03 Ablynx N.V. Method for generating variable domain sequences of heavy chain antibodies
WO2007059782A1 (en) 2005-11-28 2007-05-31 Genmab A/S Recombinant monovalent antibodies and methods for production thereof
US20080118520A1 (en) 2006-10-19 2008-05-22 Kang Li Anti-notch3 agonist antibodies and their use in the treatment of notch3-related diseases
US7399851B2 (en) 2002-07-25 2008-07-15 Dana Farber Cancer Institute, Inc. Composition and method for imaging cells
US20090304721A1 (en) 2005-09-07 2009-12-10 Medlmmune, Inc Toxin conjugated eph receptor antibodies
US7935791B2 (en) 2006-12-18 2011-05-03 Genentech, Inc. Antagonist anti-Notch3 antibodies and their use in the prevention and treatment of Notch3-related diseases

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7684505B2 (en) 2004-04-26 2010-03-23 Qualcomm Incorporated Method and apparatus for encoding interleaving and mapping data to facilitate GBPS data rates in wireless systems
EP2081962B1 (en) * 2006-10-19 2018-10-03 Genentech, Inc. Novel anti-notch3 antibodies and their use in the detection and diagnosis of disease
CN101605815B (zh) * 2006-12-18 2013-11-13 健泰科生物技术公司 拮抗性抗刻缺蛋白3抗体及其在预防和治疗刻缺蛋白3相关疾病中的用途
EP2125887A4 (en) * 2007-01-24 2010-11-10 Oncomed Pharm Inc COMPOSITIONS AND METHODS OF TREATMENT AND DIAGNOSIS OF CANCER
CN104402998A (zh) * 2008-07-08 2015-03-11 昂考梅德药品有限公司 分离的抗体
CA2775880A1 (en) * 2009-09-30 2011-04-07 Genentech, Inc. Anti-notch3 antagonist antibodies to treat gamma secretase inhibitor responsive and anti-notch1 antagonist antibody unresponsive t-cell leukemias
HK1214282A1 (zh) * 2012-11-07 2016-07-22 辉瑞公司 抗-notch3抗体及抗体-药物缀合物
WO2014100435A1 (en) * 2012-12-19 2014-06-26 Aveo Pharmaceuticals, Inc. Anti-notch3 antibodies

Patent Citations (187)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3850752A (en) 1970-11-10 1974-11-26 Akzona Inc Process for the demonstration and determination of low molecular compounds and of proteins capable of binding these compounds specifically
US3817837A (en) 1971-05-14 1974-06-18 Syva Corp Enzyme amplification assay
US3939350A (en) 1974-04-29 1976-02-17 Board Of Trustees Of The Leland Stanford Junior University Fluorescent immunoassay employing total reflection for activation
US3996345A (en) 1974-08-12 1976-12-07 Syva Company Fluorescence quenching with immunological pairs in immunoassays
US4277437A (en) 1978-04-05 1981-07-07 Syva Company Kit for carrying out chemically induced fluorescence immunoassay
US4275149A (en) 1978-11-24 1981-06-23 Syva Company Macromolecular environment control in specific receptor assays
US4458066A (en) 1980-02-29 1984-07-03 University Patents, Inc. Process for preparing polynucleotides
US4366241B1 (https=) 1980-08-07 1988-10-18
US4366241A (en) 1980-08-07 1982-12-28 Syva Company Concentrating zone method in heterogeneous immunoassays
US4526938A (en) 1982-04-22 1985-07-02 Imperial Chemical Industries Plc Continuous release formulations
US4522811A (en) 1982-07-08 1985-06-11 Syntex (U.S.A.) Inc. Serial injection of muramyldipeptides and liposomes enhances the anti-infective activity of muramyldipeptides
US4708871A (en) 1983-03-08 1987-11-24 Commonwealth Serum Laboratories Commission Antigenically active amino acid sequences
US4816567A (en) 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
EP0154316A2 (en) 1984-03-06 1985-09-11 Takeda Chemical Industries, Ltd. Chemically modified lymphokine and production thereof
US4683203A (en) 1984-04-14 1987-07-28 Redco N.V. Immobilized enzymes, processes for preparing same, and use thereof
US5128326A (en) 1984-12-06 1992-07-07 Biomatrix, Inc. Drug delivery systems based on hyaluronans derivatives thereof and their salts and methods of producing same
US5399331A (en) 1985-06-26 1995-03-21 The Liposome Company, Inc. Method for protein-liposome coupling
US4683195B1 (https=) 1986-01-30 1990-11-27 Cetus Corp
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US5225539A (en) 1986-03-27 1993-07-06 Medical Research Council Recombinant altered antibodies and methods of making altered antibodies
US5374548A (en) 1986-05-02 1994-12-20 Genentech, Inc. Methods and compositions for the attachment of proteins to liposomes using a glycophospholipid anchor
US4881175A (en) 1986-09-02 1989-11-14 Genex Corporation Computer based system and method for determining and displaying possible chemical structures for converting double- or multiple-chain polypeptides to single-chain polypeptides
US5455030A (en) 1986-09-02 1995-10-03 Enzon Labs, Inc. Immunotheraphy using single chain polypeptide binding molecules
US5260203A (en) 1986-09-02 1993-11-09 Enzon, Inc. Single polypeptide chain binding molecules
US5648260A (en) 1987-03-18 1997-07-15 Scotgen Biopharmaceuticals Incorporated DNA encoding antibodies with altered effector functions
US5624821A (en) 1987-03-18 1997-04-29 Scotgen Biopharmaceuticals Incorporated Antibodies with altered effector functions
EP0307434A1 (en) 1987-03-18 1989-03-22 Medical Res Council CHANGED ANTIBODIES.
US5013653A (en) 1987-03-20 1991-05-07 Creative Biomolecules, Inc. Product and process for introduction of a hinge region into a fusion protein to facilitate cleavage
US5482858A (en) 1987-05-21 1996-01-09 Creative Biomolecules, Inc. Polypeptide linkers for production of biosynthetic proteins
US5476786A (en) 1987-05-21 1995-12-19 Creative Biomolecules, Inc. Biosynthetic antibody binding sites
US5258498A (en) 1987-05-21 1993-11-02 Creative Biomolecules, Inc. Polypeptide linkers for production of biosynthetic proteins
US5091513A (en) 1987-05-21 1992-02-25 Creative Biomolecules, Inc. Biosynthetic antibody binding sites
US5132405A (en) 1987-05-21 1992-07-21 Creative Biomolecules, Inc. Biosynthetic antibody binding sites
US4880078A (en) 1987-06-29 1989-11-14 Honda Giken Kogyo Kabushiki Kaisha Exhaust muffler
US5677425A (en) 1987-09-04 1997-10-14 Celltech Therapeutics Limited Recombinant antibody
US5336603A (en) 1987-10-02 1994-08-09 Genentech, Inc. CD4 adheson variants
US5698767A (en) 1988-06-14 1997-12-16 Lidak Pharmaceuticals Human immune system in non-human animal
US5476996A (en) 1988-06-14 1995-12-19 Lidak Pharmaceuticals Human immune system in non-human animal
US5223409A (en) 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
US5403484A (en) 1988-09-02 1995-04-04 Protein Engineering Corporation Viruses expressing chimeric binding proteins
US5571698A (en) 1988-09-02 1996-11-05 Protein Engineering Corporation Directed evolution of novel binding proteins
US5545807A (en) 1988-10-12 1996-08-13 The Babraham Institute Production of antibodies from transgenic animals
EP0367166A1 (en) 1988-10-31 1990-05-09 Takeda Chemical Industries, Ltd. Modified interleukin-2 and production thereof
EP0368684A1 (en) 1988-11-11 1990-05-16 Medical Research Council Cloning immunoglobulin variable domain sequences.
EP0401384A1 (en) 1988-12-22 1990-12-12 Kirin-Amgen, Inc. Chemically modified granulocyte colony stimulating factor
US5693762A (en) 1988-12-28 1997-12-02 Protein Design Labs, Inc. Humanized immunoglobulins
US5585089A (en) 1988-12-28 1996-12-17 Protein Design Labs, Inc. Humanized immunoglobulins
US5530101A (en) 1988-12-28 1996-06-25 Protein Design Labs, Inc. Humanized immunoglobulins
US6180370B1 (en) 1988-12-28 2001-01-30 Protein Design Labs, Inc. Humanized immunoglobulins and methods of making the same
US5416016A (en) 1989-04-03 1995-05-16 Purdue Research Foundation Method for enhancing transmembrane transport of exogenous molecules
EP0399666A1 (en) 1989-04-29 1990-11-28 Delta Biotechnology Limited Fusion proteins containing N-terminal fragments of human serum albumin
US6291158B1 (en) 1989-05-16 2001-09-18 Scripps Research Institute Method for tapping the immunological repertoire
US5405783A (en) 1989-06-07 1995-04-11 Affymax Technologies N.V. Large scale photolithographic solid phase synthesis of an array of polymers
US5445934A (en) 1989-06-07 1995-08-29 Affymax Technologies N.V. Array of oligonucleotides on a solid substrate
US5112946A (en) 1989-07-06 1992-05-12 Repligen Corporation Modified pf4 compositions and methods of use
EP0413622A1 (en) 1989-08-03 1991-02-20 Rhone-Poulenc Sante Albumin derivatives with therapeutic functions
WO1991005548A1 (en) 1989-10-10 1991-05-02 Pitman-Moore, Inc. Sustained release composition for macromolecular proteins
WO1991006570A1 (en) 1989-10-25 1991-05-16 The University Of Melbourne HYBRID Fc RECEPTOR MOLECULES
US5679377A (en) 1989-11-06 1997-10-21 Alkermes Controlled Therapeutics, Inc. Protein microspheres and methods of using them
US6114598A (en) 1990-01-12 2000-09-05 Abgenix, Inc. Generation of xenogeneic antibodies
US6162963A (en) 1990-01-12 2000-12-19 Abgenix, Inc. Generation of Xenogenetic antibodies
US6150584A (en) 1990-01-12 2000-11-21 Abgenix, Inc. Human antibodies derived from immunized xenomice
US6075181A (en) 1990-01-12 2000-06-13 Abgenix, Inc. Human antibodies derived from immunized xenomice
US5939598A (en) 1990-01-12 1999-08-17 Abgenix, Inc. Method of making transgenic mice lacking endogenous heavy chains
US5580717A (en) 1990-05-01 1996-12-03 Affymax Technologies N.V. Recombinant library screening methods
US5427908A (en) 1990-05-01 1995-06-27 Affymax Technologies N.V. Recombinant library screening methods
US5349053A (en) 1990-06-01 1994-09-20 Protein Design Labs, Inc. Chimeric ligand/immunoglobulin molecules and their uses
US5969108A (en) 1990-07-10 1999-10-19 Medical Research Council Methods for producing members of specific binding pairs
US5874299A (en) 1990-08-29 1999-02-23 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
US5877397A (en) 1990-08-29 1999-03-02 Genpharm International Inc. Transgenic non-human animals capable of producing heterologous antibodies of various isotypes
US5569825A (en) 1990-08-29 1996-10-29 Genpharm International Transgenic non-human animals capable of producing heterologous antibodies of various isotypes
US5545806A (en) 1990-08-29 1996-08-13 Genpharm International, Inc. Ransgenic non-human animals for producing heterologous antibodies
US5814318A (en) 1990-08-29 1998-09-29 Genpharm International Inc. Transgenic non-human animals for producing heterologous antibodies
US5770429A (en) 1990-08-29 1998-06-23 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
WO1992003918A1 (en) 1990-08-29 1992-03-19 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
US5625126A (en) 1990-08-29 1997-04-29 Genpharm International, Inc. Transgenic non-human animals for producing heterologous antibodies
US5633425A (en) 1990-08-29 1997-05-27 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
US5789650A (en) 1990-08-29 1998-08-04 Genpharm International, Inc. Transgenic non-human animals for producing heterologous antibodies
US5661016A (en) 1990-08-29 1997-08-26 Genpharm International Inc. Transgenic non-human animals capable of producing heterologous antibodies of various isotypes
US5359046A (en) 1990-12-14 1994-10-25 Cell Genesys, Inc. Chimeric chains for receptor-associated signal transduction pathways
WO1992019244A2 (en) 1991-05-01 1992-11-12 Henry M. Jackson Foundation For The Advancement Of Military Medicine A method for treating infectious respiratory diseases
US5290540A (en) 1991-05-01 1994-03-01 Henry M. Jackson Foundation For The Advancement Of Military Medicine Method for treating infectious respiratory diseases
US6172197B1 (en) 1991-07-10 2001-01-09 Medical Research Council Methods for producing members of specific binding pairs
US5885793A (en) 1991-12-02 1999-03-23 Medical Research Council Production of anti-self antibodies from antibody segment repertoires and displayed on phage
US6521404B1 (en) 1991-12-02 2003-02-18 Medical Research Council Production of anti-self antibodies from antibody segment repertoires and displayed on phage
US6555313B1 (en) 1991-12-02 2003-04-29 Medical Research Council Production of anti-self antibodies from antibody segment repertoires and displayed on phage
EP0616640A1 (en) 1991-12-02 1994-09-28 Medical Research Council Production of anti-self antibodies from antibody segment repertoires and displayed on phage
US6544731B1 (en) 1991-12-02 2003-04-08 Medical Research Council Production of anti-self antibodies from antibody segment repertories and displayed on phage
US6582915B1 (en) 1991-12-02 2003-06-24 Medical Research Council Production of anti-self bodies from antibody segment repertories and displayed on phage
US6593081B1 (en) 1991-12-02 2003-07-15 Medical Research Council Production of anti-self antibodies from antibody segment repertoires and displayed on phage
WO1993012227A1 (en) 1991-12-17 1993-06-24 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
US5622929A (en) 1992-01-23 1997-04-22 Bristol-Myers Squibb Company Thioether conjugates
WO1993015200A1 (fr) 1992-01-31 1993-08-05 Rhone-Poulenc Rorer S.A. Polypeptides antithrombotiques, antagonistes de la liaison du vwf aux plaquettes et/ou au sous-endothelium
WO1993015199A1 (fr) 1992-01-31 1993-08-05 Rhone-Poulenc Rorer S.A. Nouveaux polypeptides biologiquement actifs, leur preparation et composition pharmaceutique les contenant
US5714350A (en) 1992-03-09 1998-02-03 Protein Design Labs, Inc. Increasing antibody affinity by altering glycosylation in the immunoglobulin variable region
US6350861B1 (en) 1992-03-09 2002-02-26 Protein Design Labs, Inc. Antibodies with increased binding affinity
US5912015A (en) 1992-03-12 1999-06-15 Alkermes Controlled Therapeutics, Inc. Modulated release from biocompatible polymers
US5447851A (en) 1992-04-02 1995-09-05 Board Of Regents, The University Of Texas System DNA encoding a chimeric polypeptide comprising the extracellular domain of TNF receptor fused to IgG, vectors, and host cells
US5447851B1 (en) 1992-04-02 1999-07-06 Univ Texas System Board Of Dna encoding a chimeric polypeptide comprising the extracellular domain of tnf receptor fused to igg vectors and host cells
US5412087A (en) 1992-04-24 1995-05-02 Affymax Technologies N.V. Spatially-addressable immobilization of oligonucleotides and other biological polymers on surfaces
US6165745A (en) 1992-04-24 2000-12-26 Board Of Regents, The University Of Texas System Recombinant production of immunoglobulin-like domains in prokaryotic cells
US6765087B1 (en) 1992-08-21 2004-07-20 Vrije Universiteit Brussel Immunoglobulins devoid of light chains
WO1994004678A1 (en) 1992-08-21 1994-03-03 Casterman Cecile Immunoglobulins devoid of light chains
US5759808A (en) 1992-08-21 1998-06-02 Vrije Universiteit Brussel Immunoglobulins devoid of light chains
US5958708A (en) 1992-09-25 1999-09-28 Novartis Corporation Reshaped monoclonal antibodies against an immunoglobulin isotype
US5934272A (en) 1993-01-29 1999-08-10 Aradigm Corporation Device and method of creating aerosolized mist of respiratory drug
WO1994025585A1 (en) 1993-04-26 1994-11-10 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
US6838254B1 (en) 1993-04-29 2005-01-04 Conopco, Inc. Production of antibodies or (functionalized) fragments thereof derived from heavy chain immunoglobulins of camelidae
WO1994029351A2 (en) 1993-06-16 1994-12-22 Celltech Limited Antibodies
US5831012A (en) 1994-01-14 1998-11-03 Pharmacia & Upjohn Aktiebolag Bacterial receptor structures
US5811238A (en) 1994-02-17 1998-09-22 Affymax Technologies N.V. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US5830721A (en) 1994-02-17 1998-11-03 Affymax Technologies N.V. DNA mutagenesis by random fragmentation and reassembly
US5605793A (en) 1994-02-17 1997-02-25 Affymax Technologies N.V. Methods for in vitro recombination
US5837458A (en) 1994-02-17 1998-11-17 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
WO1996004388A1 (en) 1994-07-29 1996-02-15 Smithkline Beecham Plc Novel compounds
US6350466B1 (en) 1994-08-05 2002-02-26 Targesome, Inc. Targeted polymerized liposome diagnostic and treatment agents
WO1996020698A2 (en) 1995-01-05 1996-07-11 The Board Of Regents Acting For And On Behalf Of The University Of Michigan Surface-modified nanoparticles and method of making and using same
US6121022A (en) 1995-04-14 2000-09-19 Genentech, Inc. Altered polypeptides with increased half-life
US5869046A (en) 1995-04-14 1999-02-09 Genentech, Inc. Altered polypeptides with increased half-life
US6019968A (en) 1995-04-14 2000-02-01 Inhale Therapeutic Systems, Inc. Dispersible antibody compositions and methods for their preparation and use
US5834252A (en) 1995-04-18 1998-11-10 Glaxo Group Limited End-complementary polymerase reaction
US5641870A (en) 1995-04-20 1997-06-24 Genentech, Inc. Low pH hydrophobic interaction chromatography for antibody purification
US5916597A (en) 1995-08-31 1999-06-29 Alkermes Controlled Therapeutics, Inc. Composition and method using solid-phase particles for sustained in vivo release of a biologically active agent
WO1997010365A1 (en) 1995-09-15 1997-03-20 Affymax Technologies N.V. Expression monitoring by hybridization to high density oligonucleotide arrays
WO1997013852A1 (en) 1995-10-10 1997-04-17 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
US5985320A (en) 1996-03-04 1999-11-16 The Penn State Research Foundation Materials and methods for enhancing cellular internalization
WO1997032572A2 (en) 1996-03-04 1997-09-12 The Penn State Research Foundation Materials and methods for enhancing cellular internalization
WO1997034631A1 (en) 1996-03-18 1997-09-25 Board Of Regents, The University Of Texas System Immunoglobin-like domains with increased half lives
US5874064A (en) 1996-05-24 1999-02-23 Massachusetts Institute Of Technology Aerodynamically light particles for pulmonary drug delivery
WO1997044013A1 (en) 1996-05-24 1997-11-27 Massachusetts Institute Of Technology Aerodynamically light particles for pulmonary drug delivery
US5985309A (en) 1996-05-24 1999-11-16 Massachusetts Institute Of Technology Preparation of particles for inhalation
US6316024B1 (en) 1996-10-11 2001-11-13 Sequus Pharmaceuticals, Inc. Therapeutic liposome composition and method of preparation
WO1998023289A1 (en) 1996-11-27 1998-06-04 The General Hospital Corporation MODULATION OF IgG BINDING TO FcRn
WO1998024884A1 (en) 1996-12-02 1998-06-11 Genpharm International Transgenic non-human animals capable of producing heterologous antibodies
WO1998031346A1 (en) 1997-01-16 1998-07-23 Massachusetts Institute Of Technology Preparation of particles for inhalation
US5855913A (en) 1997-01-16 1999-01-05 Massachusetts Instite Of Technology Particles incorporating surfactants for pulmonary drug delivery
US6277375B1 (en) 1997-03-03 2001-08-21 Board Of Regents, The University Of Texas System Immunoglobulin-like domains with increased half-lives
US20030153043A1 (en) 1997-05-21 2003-08-14 Biovation Limited Method for the production of non-immunogenic proteins
EP1012280B1 (en) 1997-06-11 2004-11-10 Borean Pharma A/S Trimerising module
US6703199B1 (en) 1997-06-12 2004-03-09 Research Corporation Technologies, Inc. Artificial antibody polypeptides
US5989463A (en) 1997-09-24 1999-11-23 Alkermes Controlled Therapeutics, Inc. Methods for fabricating polymer-based controlled release devices
WO1999015154A1 (en) 1997-09-24 1999-04-01 Alkermes Controlled Therapeutics, Inc. Methods for fabricating polymer-based controlled release preparations
WO1999016873A1 (de) 1997-09-26 1999-04-08 Arne Skerra Anticaline
US6696245B2 (en) 1997-10-20 2004-02-24 Domantis Limited Methods for selecting functional polypeptides
WO1999020253A1 (en) 1997-10-23 1999-04-29 Bioglan Therapeutics Ab Encapsulation method
WO1999045962A1 (en) 1998-03-13 1999-09-16 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
US6194551B1 (en) 1998-04-02 2001-02-27 Genentech, Inc. Polypeptide variants
WO1999054342A1 (en) 1998-04-20 1999-10-28 Pablo Umana Glycosylation engineering of antibodies for improving antibody-dependent cellular cytotoxicity
WO1999066903A2 (en) 1998-06-24 1999-12-29 Advanced Inhalation Research, Inc. Large porous particles emitted from an inhaler
US6818418B1 (en) 1998-12-10 2004-11-16 Compound Therapeutics, Inc. Protein scaffolds for antibody mimics and other binding proteins
WO2000042072A2 (en) 1999-01-15 2000-07-20 Genentech, Inc. Polypeptide variants with altered effector function
EP1176195A1 (en) 1999-04-09 2002-01-30 Kyowa Hakko Kogyo Co., Ltd. Method for controlling the activity of immunologically functional molecule
WO2001004144A2 (de) 1999-07-13 2001-01-18 Scil Proteins Gmbh Design von beta-faltblatt-proteinen mit spezifischen bindungseigenschaften
WO2001005950A2 (en) 1999-07-20 2001-01-25 Morphosys Ag Methods for displaying (poly)peptides/proteins on bacteriophage particles via disulfide bonds
WO2001014424A2 (en) 1999-08-24 2001-03-01 Medarex, Inc. Human ctla-4 antibodies and their uses
WO2001077137A1 (en) 2000-04-12 2001-10-18 Human Genome Sciences, Inc. Albumin fusion proteins
US20040161738A1 (en) 2000-05-26 2004-08-19 Arumugam Muruganandam Single-domain brain-targeting antibody fragments derived from llama antibodies
WO2002043478A2 (en) 2000-11-30 2002-06-06 Medarex, Inc. Transgenic transchromosomal rodents for making human antibodies
US20050053973A1 (en) 2001-04-26 2005-03-10 Avidia Research Institute Novel proteins with targeted binding
US20040175756A1 (en) 2001-04-26 2004-09-09 Avidia Research Institute Methods for using combinatorial libraries of monomer domains
US20050048512A1 (en) 2001-04-26 2005-03-03 Avidia Research Institute Combinatorial libraries of monomer domains
WO2002092780A2 (en) 2001-05-17 2002-11-21 Diversa Corporation Novel antigen binding molecules for therapeutic, diagnostic, prophylactic, enzymatic, industrial, and agricultural applications, and methods for generating and screening thereof
WO2003002609A2 (en) 2001-06-28 2003-01-09 Domantis Limited Dual-specific ligand and its use
WO2003004873A1 (de) 2001-07-04 2003-01-16 Putzmeister Aktiengesellschaft Vorrichtung zum fördern von fliess- oder schüttfähigem fördergut
WO2003006007A1 (en) 2001-07-11 2003-01-23 Research & Innovation Soc.Coop. A R.L. Use of compounds as functional antagonists to the central cannabinoid receptors
WO2003035835A2 (en) 2001-10-25 2003-05-01 Genentech, Inc. Glycoprotein compositions
US20030157579A1 (en) 2002-02-14 2003-08-21 Kalobios, Inc. Molecular sensors activated by disinhibition
WO2003074679A2 (en) 2002-03-01 2003-09-12 Xencor Antibody optimization
US20030198971A1 (en) 2002-04-18 2003-10-23 Kalobios, Inc. Reactivation-based molecular interaction sensors
WO2004003019A2 (en) 2002-06-28 2004-01-08 Domantis Limited Immunoglobin single variant antigen-binding domains and dual-specific constructs
US7399851B2 (en) 2002-07-25 2008-07-15 Dana Farber Cancer Institute, Inc. Composition and method for imaging cells
US20060115470A1 (en) 2002-11-08 2006-06-01 Ablynx N. V. Camelidae antibodies against imminoglobulin e and use thereof for the treatment of allergic disorders
WO2004058821A2 (en) 2002-12-27 2004-07-15 Domantis Limited Dual specific single domain antibodies specific for a ligand and for the receptor of the ligand
US20050008625A1 (en) 2003-02-13 2005-01-13 Kalobios, Inc. Antibody affinity engineering by serial epitope-guided complementarity replacement
WO2004101790A1 (en) 2003-05-14 2004-11-25 Domantis Limited A process for recovering polypeptides that unfold reversibly from a polypeptide repertoire
WO2004106368A1 (de) 2003-05-28 2004-12-09 Scil Proteins Gmbh Generierung künstlicher bindungsproteine auf der grundlage von ubiquitin-proteinen
WO2004081026A2 (en) 2003-06-30 2004-09-23 Domantis Limited Polypeptides
US20070065440A1 (en) 2003-10-08 2007-03-22 Domantis Limited Antibody compositions and methods
WO2005035572A2 (en) 2003-10-08 2005-04-21 Domantis Limited Antibody compositions and methods
US20090148434A1 (en) 2003-10-08 2009-06-11 Domantis Limted Antibody Compositions and Methods
US20050255552A1 (en) 2004-01-20 2005-11-17 Kalobios, Inc. Antibody specificity transfer using minimal essential binding determinants
US20060008844A1 (en) 2004-06-17 2006-01-12 Avidia Research Institute c-Met kinase binding proteins
WO2006079372A1 (en) 2005-01-31 2006-08-03 Ablynx N.V. Method for generating variable domain sequences of heavy chain antibodies
US20090304721A1 (en) 2005-09-07 2009-12-10 Medlmmune, Inc Toxin conjugated eph receptor antibodies
WO2007059782A1 (en) 2005-11-28 2007-05-31 Genmab A/S Recombinant monovalent antibodies and methods for production thereof
US20080118520A1 (en) 2006-10-19 2008-05-22 Kang Li Anti-notch3 agonist antibodies and their use in the treatment of notch3-related diseases
US7935791B2 (en) 2006-12-18 2011-05-03 Genentech, Inc. Antagonist anti-Notch3 antibodies and their use in the prevention and treatment of Notch3-related diseases

Non-Patent Citations (226)

* Cited by examiner, † Cited by third party
Title
"Remington's Pharmaceutical Sciences and Introduction to Pharmaceutical Dosage Forms, 19th ed.,", 1995, MACK PUB. CO.
"Sequences of Proteins of Immunological Interest", 1991, U. S. DEPARTMENT OF HEALTH AND HUMAN SERVICES
ABRAHAM ET AL., J MOL RECOGNIT., vol. 9, 1996, pages 456 - 461
AL-LAZIKANI ET AL., J. MOL. BIOL., vol. 273, 1997, pages 927 - 948
ALLEN, NAT. REV. CANCER, vol. 2, 2002, pages 750 - 763
ALT ET AL., FEBS LETTERS, vol. 454, 1999, pages 90 - 94
ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 - 410
ALTSCHUL ET AL., J.MOL. BIOL., vol. 215, 1990, pages 403 - 10
ALTSCHUL ET AL., NUC. ACIDS RES., vol. 25, 1977, pages 3389 - 3402
ANDERSSON ET AL., DEVELOPMENT, vol. 138, 2001, pages 3593 - 3612
ARNON ET AL.: "Monoclonal Antibodies And Cancer Therapy", 1985, ALAN R. LISS, INC., article "Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy", pages: 243 - 56
ASHKENAZI ET AL., PROC. NATL. ACAD. SCI. USA, vol. 88, 1991, pages 10535 - 10539
AVIS, ET AL.: "Pharmaceutical Dosage Forms: Parenteral Medications", 1993, MARCEL DEKKER
AYATA, STROKE, vol. 41, 2010, pages S129 - S134
BACH: "Monoclonal Antibodies and Peptide Therapy in Autoimmune Diseases", 1993, MARCEL DEKKER
BAERT ET AL., NEW ENGL. J. MED., vol. 348, 2003, pages 601 - 608
BALDWIN ET AL.: "Monoclonal Antibodies For Cancer Detection And Therapy", 1985, ACADEMIC PRESS, article "Analysis, Results, And Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy", pages: 303 - 16
BARRETINA J. ET AL., NATURE, vol. 483, 2012, pages 603 - 7
BATZER ET AL., NUCLEIC ACID RES., vol. 19, 1991, pages 081
BEAUCAGE ET AL., TETRA. LETT., vol. 22, 1981, pages 1859
BELL ET AL., NATURE, vol. 474, 2011, pages 609 - 615
BENIAMINOVITZ ET AL., NEW ENGL. J. MED., vol. 342, 2000, pages 613 - 619
BIRD ET AL., SCIENCE, vol. 242, 1988, pages 423 - 426
BITTNER ET AL., METH. ENZYMOL., vol. 153, 1987, pages 516
BLOEMAN ET AL., FEBS LETT., vol. 357, 1995, pages 140
BLUNDEL ET AL.: "Protein Crystallography", 1976, ACADEMIC PRESS
BRENNAN ET AL., SCIENCE, vol. 229, 1985, pages 81 - 83
BRENT ET AL., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, 2003
BRISCOE ET AL., AM. J. PHYSIOL., vol. 1233, 1995, pages 134
BROOKS ET AL., J. COMP. CHEM., vol. 4, 1983, pages 187
BROWN ET AL., METH. ENZYMOL., vol. 68, 1979, pages 109
BUCHWALD ET AL., SURGERY, vol. 88, 1980, pages 507
CHABNER AND LONGO: "Cancer Chemotherapy and Biotherapy", 2001, LIPPINCOTT, WILLIAMS & WILKINS
CHAYEN ET AL., NATURE METHODS, vol. 5, 2008, pages 147 - 153
CHEN ET AL., EMBO J., vol. 12, 1993, pages 821 - 830
CHEN ET AL., INTERNATIONAL IMMUNOLOGY, vol. 5, 1993, pages 647 - 656
CHEUNG ET AL., VIROLOGY, vol. 176, 1990, pages 546 - 552
CHOI ET AL., NATURE GENETICS, vol. 4, 1993, pages 117 - 123
CHOTHIA ET AL., J. MOL. BIOL., vol. 196, 1987, pages 901 - 917
CHOTHIA ET AL., NATURE, vol. 342, 1989, pages 877 - 883
CLEEK ET AL., PRO. INT'L. SYMP. CONTROL. REL. BIOACT. MATER., vol. 24, 1997, pages 853 - 854
CORTEZ-RETAMOZO ET AL., INT J CANCER, vol. 89, 2002, pages 456 - 62
COX ET AL., J IMMUNOL., vol. 24, 1994, pages 827 - 836
CREIGHTON, PROTEINS, 1984
DENARDO ET AL., CLIN CANCER RES., vol. 4, no. 10, 1998, pages 2483 - 90
DENT: "Good Laboratory and Good Clinical Practice", 2001, URCH PUBL.
DIMASI ET AL., J MOL BIOL., vol. 393, 2009, pages 672 - 692
DUMOULIN ET AL., NATURE, vol. 424, 2003, pages 783 - 788
DURING ET AL., ANN. NEUROL., vol. 25, 1989, pages 51
E. MEYERS; W. MILLER, COMPUT. APPL. BIOSCI., vol. 4, 1988, pages 11 - 17
ECKERT ET AL., PCR METHODS AND APPLICATIONS, vol. 1, 1991, pages 17
EGLOFF; GRANDIS, CLIN CAN RES, vol. 18, 2012, pages 5188 - 519
ELLIOT; O'HARE, CELL, vol. 88, 1997, pages 223
EMSLEY; COWTAN, ACTA CRYST., vol. 60, 2004, pages 2126 - 2132
EPSTEIN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 82, 1985, pages 3688 - 3692
ETEMADMOGHADAM ET AL., CLIN CAN RES, vol. 15, 2009, pages 1417 - 27
FISHWILD ET AL., NATURE BIOTECHNOLOGY, vol. 14, 1996, pages 845 - 851
FRIQUET ET AL., J IMMUNOL METHODS, vol. 77, 1985, pages 305 - 319
GALLAHAN ET AL., J VIROL, vol. 61, 1987, pages 218 - 220
GALLAHAN ET AL., ONCOGENE, vol. 14, 1997, pages 1883 - 1890
GENNARO: "Remington: The Science and Practice of Pharmacy", 2000, LIPPINCOTT, WILLIAMS, AND WILKINS
GENTZ ET AL., PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 821 - 824
GEYSEN ET AL., MOL. IMMUNOL., vol. 23, 1986, pages 709 - 715
GEYSEN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 8, 1984, pages 3998 - 4002
GEYSEN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 82, 1985, pages 78 - 182
GHOSH ET AL., NEW ENGL. J. MED., vol. 348, 2003, pages 24 - 32
GLENN E.MORRIS,: "Epitope Mapping Protocols in Methods in Molecular Biology", vol. 66, 1996, HUMANA PRESS
GLENNIE ET AL., J. IMMUNOL., vol. 139, 1987, pages 2367 - 2375
GOODSON, MEDICAL APPLICATIONS OF CONTROLLED RELEASE, vol. 2, 1984, pages 115 - 138
GORDAN ET AL., BLOOD, vol. 113, 2009, pages 4381 - 4390
GORDON ET AL., BLOOD, vol. 113, 2009, pages 4381 - 4390
GORDON ET AL., NAT STRUCT MOL BIOL, vol. 14, 2007, pages 295 - 300
GURUHARSHA ET AL., NAT REV GENET., vol. 13, 2012, pages 654 - 66
H.A. ERLICH: "PCR Technology: Principles and Applications for DNA Amplification", 1992, FREEMAN PRESS
HAENEL ET AL., ANAL BIOCHEM, vol. 339, 2005, pages 182 - 184
HAENEL ET AL., ANAL BIOCHEM., vol. 339, 2005, pages 182 - 184
HANSSON ET AL., J. MOL. BIOL., vol. 287, 1999, pages 265 - 76
HARAYAMA, TRENDS BIOTECHNOL., vol. 16, no. 2, 1998, pages 76 - 82
HARDING; LONBERG, ANN. N. Y. ACAD. SCI., vol. 764, 1995, pages 536 - 546
HARDMAN ET AL.,: "Goodman and Gilman's The Pharmacological Basis of Therapeutics, 10.sup.th ed.,", 2001, MCGRAW-HILL
HARDMAN ET AL.: "Goodman and Gilman's The Pharmacological Basis of Therapeutics", 2001, MCGRAW-HILL
HARRINGTON ET AL., NAT GENET, vol. 15, 1997, pages 345
HAWKINS ET AL., J MOL BIOL, vol. 226, 1992, pages 889 - 896
HELLSTROM ET AL.: "Controlled Drug Delivery", 1987, MARCEL DEKKER, INC., article "Antibodies For Drug Delivery", pages: 623 - 53
HENIKOFF; HENIKOFF, PROC. NATL. ACAD. SCI. USA, vol. 89, 1989, pages 10915
HEROLD ET AL., NEW ENGL. J. MED., vol. 346, 2002, pages 1692 - 1698
HICKS C ET AL., NATURE CELL BIO, vol. 2, 2000, pages 515 - 520
HOLLIGER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 6444 - 6448
HOLLINGER; HUDSON, NATURE BIOTECHNOLOGY, vol. 23, 2005, pages 1126 - 1136
HOPP ET AL., PROC. NATL. ACAD. SCI USA, vol. 78, 1981, pages 3824 - 3828
HOWARD ET AL., J. NEUROSURG., vol. 7 1, 1989, pages 105
HUSTON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 5879 - 5883
HUSTON ET AL., PROC. NATL. ACAD. SCI., vol. 85, 1988, pages 5879 - 5883
HWANG ET AL., PROC. NATL. ACAD. SCI. USA, vol. 77, 1980, pages 4030 - 4034
INNIS ET AL.: "PCR Protocols: A Guide to Methods and Applications", 1990, ACADEMIC PRESS
J. J. KILLION; I. J. FIDLER, IMMUNOMETHODS, vol. 4, 1994, pages 273
JENNY BOSTROM ET AL., SCIENCE, vol. 323, 2009, pages 1610 - 1614
JONES ET AL., NATURE, vol. 321, 1986, pages 522 - 525
K. KEINANEN; M. L. LAUKKANEN, FEBS LETT., vol. 346, 1994, pages 123
KABAT ET AL.: "Sequences of Proteins of Immunological Interest, 5th edit.,", 1991, NIH PUBLICATION NO. 91-3242
KABAT ET AL.: "Sequences of Proteins of Immunological Interest, Fifth Edition,", 1991, NIH PUBLICATION NO. 91-3242
KARLIN; ALTSCHUL, PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 5873 - 5787
KARPOVSKY ET AL., J. EXP. MED., vol. 160, 1984, pages 1686
KIRKLAND ET AL., J. IMMUNOL., vol. 137, 1986, pages 3614 - 3619
KNAPPIK ET AL., J MOL BIOL, vol. 296, 2000, pages 57 - 86
KOHLER; MILSTEIN, NATURE, vol. 256, 1975, pages 495
KOPAN ET AL., CELL, vol. 137, 2009, pages 216 - 233
KRESINA: "Monoclonal Antibodies, Cytokines and Arthritis", 1991, MARCEL DEKKER
KUROIWA ET AL., NATURE BIOTECHNOLOGY, vol. 20, 2002, pages 889 - 894
KYTE ET AL., J.MOI. BIOL., vol. 157, 1982, pages 105 - 132
LAM ET AL., PROC. INT'L. SYMP. CONTROL REL. BIOACT. MATER., vol. 24, 1997, pages 759 - 760
LANGER AND WISE: "Medical Applications of Controlled Release", 1974, CRC PRES.
LANGER ET AL., J. BIOMED. MATER. RES., vol. 15, 1981, pages 167 - 277
LANGER, CHEM. TECH., vol. 12, 1982, pages 98 - 105
LANGER, SCIENCE, vol. 249, 1990, pages 1527 - 1533
LAUWEREYS ET AL., EMBO J, vol. 17, 1998, pages 3512 - 3520
LAZIKANI ET AL., J. MOL. BIO., vol. 273, 1997, pages 927 - 948
LEVY ET AL., SCIENCE, vol. 228, 1985, pages 190
LIEBERMAN, ET AL.: "Pharmaceutical Dosage Forms: Disperse Systems", 1990, MARCEL DEKKER
LIEBERMAN, ET AL.: "Pharmaceutical Dosage Forms: Tablets", 1990, MARCEL DEKKER
LINDSELL C ET AL., CELL, vol. 80, 1995, pages 909 - 917
LIPSKY ET AL., NEW ENGL. J. MED., vol. 343, 2000, pages 1594 - 1602
LIU ET AL., J. NEUROL. NEUROSURG. PSYCH., vol. 67, 1999, pages 451 - 456
LIU ET AL., PROC. NATL. ACAD. SCI. USA, vol. 82, 1985, pages 8648
LONBERG ET AL., NATURE, vol. 368, no. 6474, 1994, pages 856 - 859
LONBERG: "Handbook of Experimental Pharmacology", vol. 113, 1994, pages: 49 - 101
LONBERG; HUSZAR, INTERN. REV. IMMUNOL., vol. 13, 1995, pages 65 - 93
LORENZO; BLASCO, BIOTECHNIQUES, vol. 24, no. 2, 1998, pages 308 - 313
LOW ET AL., J MOL BIOL, vol. 260, 1996, pages 359 - 368
LU ET AL., JBC, vol. 279, 2004, pages 2856 - 2865
LU ET AL., JBC, vol. 280, 2005, pages 19665 - 19672
MACPHERSON ET AL.: "PCR: A Practical Approach", 1991, IRL PRESS AT OXFORD UNIVERSITY PRESS
MALECKI ET AL., MOL. CELL BIOL., vol. 26, 2006, pages 642 - 651
MARVIN ET AL., ACTA PHARMACOLOGICA SINICA, vol. 26, 2005, pages 649 - 658
MARVIN ET AL., CURR OPIN DRUG DISC DEVELOP, vol. 9, 2006, pages 184 - 193
MATTILA ET AL., NUCLEIC ACIDS RES., vol. 19, 1991, pages 967
MAYNARD ET AL.: "A Handbook of SOPs for Good Clinical Practice", 1996, INTERPHARM PRESS
MCCOY ET AL., J. APPL. CRYST., vol. 40, 2007, pages 658 - 674
MICHAELSON ET AL., MABS, vol. 1, 2009, pages 128 - 141
MILGROM ET AL., NEW ENGL. J. MED., vol. 341, 1999, pages 1966 - 1973
MOLDENHAUER ET AL., SCAND. J. IMMUNOL., vol. 32, 1990, pages 77 - 82
MOREL ET AL., MOLEC. IMMUNOL., vol. 25, 1988, pages 7 - 15
MORRISON ET AL., NATURE BIOTECH., vol. 15, 1997, pages 159 - 163
NAKAYAMA ET AL., INT J CANCER, vol. 120, 2007, pages 2613 - 17
NANEVICZ ET AL., J. BIOL. CHEM., vol. 270, no. 37, 1995, pages 21619 - 21625
NARANG ET AL., METH. ENZYMOL., vol. 68, 1979, pages 90
NEEDLEMAN; WUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443
NEEDLEMAN; WUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 444 - 453
NING ET AL., RADIOTHERAPY & ONCOLOGY, vol. 39, 1996, pages 179 - 189
OHTSUKA ET AL., J. BIOL. CHEM., vol. 260, 1985, pages 2605 - 2608
OWAIS ET AL., ANTIMICROB. AGENTS CHEMOTHER., vol. 39, 1995, pages 180
P. TIJSSEN,: "Laboratory Techniques in Biochemistry and Molecular Biology, Vol. 24: Hybridization with Nucleic Acid Probes", vol. 24, 1993, ELSEVIER
PASTAN; KREITMAN, CURR. OPIN. INVESTIG. DRUGS, vol. 3, 2002, pages 1089 - 1091
PATTEN ET AL., CURR. OPINION BIOTECHNOL., vol. 8, 1997, pages 724 - 33
PAULUS, BEHRING INS. MITT. NO. 78, 1985, pages 118 - 132
PAYNE, CANCER CELL, vol. 3, 2003, pages 207 - 212
PEARSON; LIPMAN, PROC. NAT'L. ACAD. SCI. USA, vol. 85, 1988, pages 2444
PETERSON ET AL., BIOCONJUG. CHEM, vol. 10, no. 4, 1999, pages 553 - 7
PIEHLER ET AL., J IMMUNOL METHODS, vol. 201, 1997, pages 189 - 206
PLESCHBERGER ET AL., BIOCONJUGATE CHEM, vol. 14, 2003, pages 440 - 448
POLJAK ET AL., STRUCTURE, vol. 2, 1994, pages 1121 - 1123
POOLE AND PETERSON: "Pharmacotherapeutics for Advanced Practice:A Practical Approach", 2001, LIPPINCOTT, WILLIAMS & WILKINS
PORTIELJI ET AL., CANCER IMMUNOL. IMMUNOTHER., vol. 52, 2003, pages 133 - 144
QUEEN ET AL., IMMUNOL. REV., vol. 89, 1986, pages 49 - 68
QUEEN ET AL., PROC. NATL. ACAD., U.S.A., vol. 86, 1989, pages 10029 - 10033
RANADE, J. CLIN. PHARMACOL., vol. 29, 1989, pages 685
RANGANATHAN ET AL., NAT REV CANCER, vol. 11, 2011, pages 338 - 51
RANGER; PEPPAS, J. MACROMOL. SCI. REV. MACROMOL. CHEM., vol. 23, 1983, pages 61
RAUCHENBERGER ET AL., J BIOL CHEM., vol. 278, 2003, pages 38194 - 38205
RIECHMANN ET AL., NATURE, vol. 332, pages 323 - 327
ROBINSON ET AL., NAT MED, vol. 17, 2011, pages 1646 - 51
ROSENFELD ET AL., CELL, vol. 68, 1992, pages 143
ROSSMANN, ACTA CRYSTALS A, vol. 46, 1990, pages 73 - 82
ROSSOLINI ET AL., MOL. CELL. PROBES, vol. 8, 1994, pages 91 - 98
SAIKI ET AL., SCIENCE, vol. 239, 1988, pages 487
SAITO ET AL., ADV. DRUG DELIV. REV., vol. 55, 2003, pages 199 - 215
SAUDEK ET AL., N. ENGL. J. MED., vol. 321, 1989, pages 574
SCHARF ET AL., RESULTS PROBL. CELL DIFFER., vol. 20, 1994, pages 125
SCHMITTGEN; LIVAK, NATURE PROTOCOLS, vol. 3, 2008, pages 1101 - 1108
SCHREIER ET AL., J. BIOL. CHEM., vol. 269, 1994, pages 9090
SEFTON, CRC CRIT. REF BIOMED. ENG., vol. 14, 1987, pages 20
SENTER; SPRINGER, ADV. DRUG DELIV. REV., vol. 53, 2001, pages 247 - 264
SHEN ET AL., J IMMUN METHODS, vol. 218, 2007, pages 65 - 74
SHIELDS ET AL., J. BIOL. CHEM., vol. 277, 2002, pages 26733 - 26740
SHIELDS ET AL., J. BIOL. CHEN., vol. 276, 2001, pages 6591 - 6604
SIDMAN ET AL., BIOPOLYMERS, vol. 22, 1983, pages 547 - 556
SLAMON ET AL., NEW ENGL. J. MED., vol. 344, 2001, pages 783 - 792
SMITH, ANNU. REV. MICROBIOL., vol. 49, pages 807
SMITH; WATERMAN, ADV. APPL. MATH., vol. 2, 1970, pages 482
SMOLEN AND BALL: "Controlled Drug Bioavailability, Drug Product Design and Performance", 1984, WILEY
SONG ET AL., PDA JOURNAL OF PHARMACEUTICAL SCIENCE & TECHNOLOGY, vol. 50, 1995, pages 372 - 397
STAHLI ET AL., METHODS IN ENZYMOLOGY, vol. 9, 1983, pages 242 - 253
STIJLEMANS ET AL., J BIOL CHEM, vol. 279, 2004, pages 1256 - 1261
TAYLOR ET AL., INTERNATIONAL IMMUNOLOGY, 1994, pages 579 - 591
TAYLOR ET AL., NUCLEIC ACIDS RESEARCH, vol. 20, 1992, pages 6287 - 6295
TEWHEY ET AL., NATURE BIOTECHNOLOGY, vol. 27, 2009, pages 1025 - 1031
THORPE ET AL., IMMUNOL. REV., vol. 62, 1982, pages 119 - 58
THORPE ET AL.: "Monoclonal Antibodies 84: Biological And Clinical Applications", vol. 84, 1985, article "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review", pages: 475 - 506
TOMIZUKA ET AL., PROC. NATL. ACAD. SCI. USA, vol. 97, 2000, pages 722 - 727
TOMLINSON ET AL., J. FOL. BIOL., vol. 227, 1992, pages 776 - 798
TOMOYUKI IGAWA ET AL., NATURE BIOTECHNOLOGY, vol. 28, 2010, pages 1203 - 1207
TRAIL ET AL., CANCER IMMUNOL. IMMUNOTHER., vol. 52, 2003, pages 328 - 337
TUAILLON ET AL., J. IMMUNOL., vol. 152, 1994, pages 2912 - 2920
TUAILLON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 94, 1993, pages 3720 - 3724
UMANA ET AL., NAT. BIOTECH., vol. 17, 1999, pages 176 - 180
UMEZAWA ET AL., BIOCHEM. BIOPHYS. RES. COMMUN., 1988, pages 1531038
VIL ET AL., PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 11337 - 11341
VIMEKAS ET AL., NUCLEIC ACIDS RES., vol. 22, 1994, pages 5600 - 5607
WANG ET AL., NATURE REVIEWS GENETICS, vol. 10, 2009, pages 57 - 63
WARD ET AL., NATURE, vol. 341, 1989, pages 544 - 546
WAWRZYNCZAK: "Antibody Therapy", 1996, BIOS SCIENTIFIC PUB. LTD
WEINER; KOTKOSKIE: "Excipient Toxicity and Safety", 2000, MARCEL DEKKER, INC.
WENG ET AL., GENES DEV., vol. 20, 2006, pages 2096 - 2109
WENG ET AL., SCIENCE, vol. 306, 2004, pages 69 - 1
WILSON ET AL., CELL, vol. 37, 1984, pages 767
WINN ET AL., ACTA. CRYST., vol. D67, 2011, pages 235 - 242
WINNACKER: "FROM GENES TO CLONES", 1987, VCH PUBLISHERS
WU ET AL., NAT BIOTECHNOL., vol. 11, 2007, pages 1290 - 1297
WU ET AL., NATURE, vol. 464, 2010, pages 1052 - 1057
YAMAGUCHI ET AL., CANCER RES., vol. 68, 2008, pages 1881 - 1888
YANG ET AL., NEW ENGL. J. MED., vol. 349, 2003, pages 427 - 434
ZAPATA ET AL., PROTEIN ENG., vol. 8, 1995, pages 1057 - 1062
ZHENG ET AL., J. IMMUNOL., vol. 154, 1995, pages 5590 - 5600
ZIMMERMAN ET AL., NUCL. MED. BIOL., vol. 26, no. 8, 1999, pages 943 - 50
ZUO ET AL., PROTEIN ENGINEERING, vol. 13, 2000, pages 361 - 367
ZUPNICK ET AL., J. BIOL. CHEM., vol. 281, no. 29, 2006, pages 20464 - 20473

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017190025A1 (en) * 2016-04-29 2017-11-02 Aveo Pharmaceuticals, Inc. Anti-notch3 antibody
US11142573B2 (en) 2016-04-29 2021-10-12 Aveo Pharmaceuticals, Inc. Anti-Notch3 antibody
US12338282B2 (en) 2016-04-29 2025-06-24 Aveo Pharmaceuticals, Inc. Anti-Notch3 antibody
US20210139556A1 (en) * 2018-04-10 2021-05-13 Stichting Sanquin Bloedvoorziening Chimeric notch receptors
WO2024105410A3 (en) * 2022-11-16 2024-06-27 Carocell Bio Limited Peptides

Also Published As

Publication number Publication date
JP2019011331A (ja) 2019-01-24
US10538587B2 (en) 2020-01-21
EP2970479B1 (en) 2019-04-24
JP2016514130A (ja) 2016-05-19
EP3611189A1 (en) 2020-02-19
US20180009889A1 (en) 2018-01-11
CN105246916A (zh) 2016-01-13
EP2970479A2 (en) 2016-01-20
WO2014159239A3 (en) 2015-02-19

Similar Documents

Publication Publication Date Title
AU2018201967B2 (en) Antibodies for epidermal growth factor receptor 3 (HER3)
DK2606070T3 (en) Antibodies for the epidermal growth factor receptor 3 (HER3)
US20130273029A1 (en) Antibodies for epidermal growth factor receptor 3 (her3) directed to domain ii of her3
US10538587B2 (en) Antibodies against notch 3
AU2012349739A1 (en) Antibodies for epidermal growth factor receptor 3 (HER3) directed to domain III and domain IV of HER3
HK1182118B (en) Antibodies for epidermal growth factor receptor 3 (her3)
HK1182118A (en) Antibodies for epidermal growth factor receptor 3 (her3)

Legal Events

Date Code Title Description
ENP Entry into the national phase

Ref document number: 2016501025

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2014722403

Country of ref document: EP

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14722403

Country of ref document: EP

Kind code of ref document: A2