WO2014155021A1 - Bee calcium channel and uses - Google Patents

Bee calcium channel and uses Download PDF

Info

Publication number
WO2014155021A1
WO2014155021A1 PCT/FR2014/050749 FR2014050749W WO2014155021A1 WO 2014155021 A1 WO2014155021 A1 WO 2014155021A1 FR 2014050749 W FR2014050749 W FR 2014050749W WO 2014155021 A1 WO2014155021 A1 WO 2014155021A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
nucleic acid
acid sequence
variant
identity
Prior art date
Application number
PCT/FR2014/050749
Other languages
French (fr)
Inventor
Pierre CHARNET
Thierry CENS
Matthieu Rousset
Claude Collet
Original Assignee
Centre National De La Recherche Scientifique (Cnrs)
Institut National De La Recherche Agronomique - Inra
Université De Montpellier 2
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Centre National De La Recherche Scientifique (Cnrs), Institut National De La Recherche Agronomique - Inra, Université De Montpellier 2 filed Critical Centre National De La Recherche Scientifique (Cnrs)
Publication of WO2014155021A1 publication Critical patent/WO2014155021A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants

Definitions

  • the present invention relates to an isolated bee calcium channel comprising a Ca v al subunit.
  • the present invention also relates to an isolated bee calcium channel comprising a Ca v al subunit, a Ca v a2 - ⁇ regulatory protein and / or a Ca v p regulatory protein.
  • the present invention also relates to nucleic acid sequences encoding these isolated bee subunits, to vectors comprising these coding sequences, to a method of making these calcium channels.
  • the present invention also relates to a method for determining the toxicity of a molecule and / or detecting a toxic molecule and / or analyzing the toxicity of a molecule using an isolated bee calcium channel.
  • the present invention finds particular applications in the agricultural field, ecological, chemical and beekeeping. In particular, it finds applications for the analysis / identification of the toxicity or the safety of molecules, for example chemical molecules, with respect to bees.
  • references in brackets ([]) refer to the list of references at the end of the text.
  • the analysis of their toxicity in mammals made it possible to demonstrate the existence of other targets on the neurons and in particular the voltage-dependent calcium channels (CCDV).
  • An object of the present invention is an isolated bee calcium channel comprising a sequence Caval subunit selected from the group consisting of SEQ ID NO: 1 to 3.
  • Another object of the present invention is an isolated calcium channel of a pollinating insect Cav1 comprising the sequence SEQ ID NO: 1 or a variant thereof consisting of an amino acid sequence of less than 2000 amino acids and having at least 99% identity with SEQ ID NO: 1.
  • Another subject of the present invention is a calcium channel isolated from a pollinating insect Cav2 comprising a subunit of sequence SEQ ID NO: 2 or a variant thereof consisting of an amino acid sequence of less than 1900 amino acids and having at least 99% identity with SEQ ID NO: 2.
  • Another object of the present invention is a pollinator insect isolated calcium channel comprising a Cav3 subunit of sequence SEQ ID NO: 3 or a variant thereof consisting of an amino acid sequence having at least 92% d identity with SEQ ID NO: 3.
  • Another object of the present invention is an isolated calcium channel further comprising at least one regulatory protein selected from a Ca v a2- ⁇ regulatory protein of sequence selected from the group consisting of SEQ ID NO 6 to 8 and / or a protein Ca v p regulator of sequence chosen from the group comprising the sequence SEQ ID No. 4, 5 and 107.
  • Another object of the present invention is a pollinated insect isolated calcium channel further comprising at least one Ca v a2- ⁇ 1 regulatory protein comprising the sequence SEQ ID NO: 6 or a variant thereof consisting of a sequence of amino acids having at least 99% identity with SEQ ID NO: 6 and / or a Ca v a2- ⁇ 2 regulatory protein comprising the sequence SEQ ID NO: 7 or a variant thereof consisting of an acid sequence amino acids having at least 99% identity with SEQ ID NO: 7 and / or a Ca v a2- ⁇ 3 regulatory protein comprising the sequence SEQ ID NO: 8 or a variant thereof consisting of an amino acid sequence having at least 99% identity with SEQ ID NO: 8.
  • the calcium channel comprises a Caval channel, a Ca v a2 - ⁇ regulatory protein and a Ca v p regulatory protein.
  • Another object of the present invention is a isolated pollinator insect calcium channel further comprising at least one CavPa regulatory protein comprising the sequence SEQ ID NO: 4 or a variant thereof consisting of an amino acid sequence having at least one at least 99% identity with SEQ ID NO: 4 and / or a Cavpb regulatory protein comprising SEQ ID NO: 5 or a variant thereof consisting of an amino acid sequence having at least 99% identity with SEQ ID NO: 5 and / or a protein regulator CavPc comprising SEQ ID NO: 107 or a variant thereof consisting of an amino acid sequence having at least 99% identity with SEQ ID NO: 107.
  • Another subject of the present invention is a nucleic acid encoding a Caval channel and / or a Ca v a2 - ⁇ regulatory protein and / or a Ca v p regulatory protein as defined by the calcium channel described above. .
  • Another object of the present invention is a nucleic acid encoding the Cav1 calcium channel comprising SEQ ID NO: 9 or a variant thereof consisting of a nucleic acid sequence of less than 6,000 base pairs (bp) and having at least 99% identity with SEQ ID NO: 9.
  • Another object of the present invention is a nucleic acid encoding the Cav2 calcium channel comprising SEQ ID NO: 10 or a variant thereof consisting of a sequence of nucleic acid of less than 5,500 bp, greater than 600 bp and having at least 99% identity with SEQ ID NO: 10.
  • Another object of the present invention is a nucleic acid encoding the Cav3 calcium channel comprising SEQ ID NO: 11 or a variant thereof consisting of a nucleic acid sequence of less than 7800 bp and having at least 91% d identity with SEQ ID NO: 11.
  • Another object of the present invention is a nucleic acid encoding the regulatory Cava2 ⁇ 1 subunit comprising SEQ ID NO: 15 or a variant thereof consisting of a nucleic acid sequence of less than 4000 bp and having at least 99 % identity with SEQ ID NO: 15.
  • Another object of the present invention is a nucleic acid encoding the Cava2 ⁇ 2 regulatory subunit comprising SEQ ID NO: 16 or a variant thereof consisting of a nucleic acid sequence of less than 4000 bp, greater than 500 bp and having at least 99% identity with SEQ ID NO: 16.
  • Another object of the present invention is a nucleic acid encoding the regulatory subunit Cava2O3 comprising SEQ ID NO: 17 or a variant thereof consisting of a nucleic acid sequence of less than 4000 bp and having at least 99% identity with SEQ ID NO: 17.
  • Another object of the present invention is a nucleic acid encoding the CavPa regulatory subunit comprising SEQ ID NO: 12 or a variant thereof consisting of a nucleic acid sequence of less than 2000 bp and having at least 99 % identity with SEQ ID NO: 12.
  • Another object of the present invention is a nucleic acid encoding the Cavpb regulatory subunit comprising comprising SEQ ID NO: 13 or a variant thereof consisting of a nucleic acid sequence of less than 1500 bp and having at least less than 99% identity with SEQ ID NO: 13.
  • Another object of the present invention is a nucleic acid encoding the CavPc regulatory subunit comprising in SEQ ID NO: 14 or a variant thereof consisting of a nucleic acid sequence of less than 2000 bp and having at least 99% identity with SEQ ID NO: 14.
  • Another object of the present invention is a vector comprising at least one nucleic acid as described above.
  • Another object of the present invention is a transformed cell comprising at least one nucleic acid sequence as described above or a vector as described above.
  • the transformed cell expresses a channel as described above or a vector as described above.
  • the present invention also relates to the use of a calcium channel as defined above for determining the molecular interaction between said channel and a molecule.
  • the present invention also relates to an in vitro method for determining the effect of a test compound on the activity of a calcium channel of a pollinating insect, comprising: a. bringing the transformed cells as described above into contact with a test compound, b. measuring the effect of said compound on the activity of the calcium channel, and comparing the effect of said compound with the effect of a control compound or a vehicle solution, thereby determining a calcium channel modulation activity.
  • the method according to the invention makes it possible to determine the toxicity of a test compound on a pollinating insect.
  • the present invention also relates to an in vitro method for screening compounds that modulate the calcium channel activity of a pollinating insect comprising: a. bringing the transformed cells as described above into contact with a test compound, b. measuring the effect of said test compound on calcium channel activity, and comparing the effect of said test compound with the effect of a control compound or a vehicle solution, thus classifying said compound as a blocker of calcium channel, calcium channel activator, trigger modifier.
  • the present invention also relates to a kit comprising at least one vector according to the invention or a transformed cell according to the invention and reagents.
  • Nucleotide sequence refers to encompass the nucleic acids having the sequences defined below, as well as variants thereof, including for example fragments, deletions, insertions and substitutions that retain the ability to code for the different subunits of the pollinating insect calcium channel.
  • “Functional channel”, “functional expression” refers to the synthesis and any necessary post-translational processing of a Cav or Cava calcium channel molecule and / or regulatory subunit molecules in a cell so that the channel and / or its regulatory subunits are properly inserted into the cell membrane, and is capable of driving the ions in response to an experimentally imposed change in the membrane potential of the cell or upon exposure to pharmacological agents appropriate.
  • Test compound refers to a phytosanitary product, a molecule, an organism or an extract thereof that is capable of binding and / or modulating the calcium channel activity of a pollinating insect.
  • Derivative or “analogue” of a compound means generally the modification or substitution of one or more chemical moieties on an original compound and may include functional derivatives, positional isomers, tautomers, zwitterions, enantiomers, diastereoisomers, racemates, isosteres or stereochemical mixtures thereof.
  • Plant protection product means chemical or biological compounds used as insecticides, herbicides, fungicides, fertilizers, antibiotics or products used in agriculture, in winemaking, food preservation, ship bottom, animals or for domestic purposes.
  • Sub-lethal dose refers to a concentration of a potentially life-threatening test compound that is not high enough to cause death, which means a concentration below the lethal dose (LD50), but still capable of triggering death by a mechanism that is not acute (immediate).
  • the test compound induces changes in biological mechanisms that include, but are not limited to, behavioral changes at the colony level, changes in behavior at the individual level, changes in memory, cellular mechanisms or molecular mechanisms.
  • Minimum modulation dose refers to the lowest concentration of a test compound required to modulate calcium channel activity.
  • Modulation, “modulate” or “modulator” of calcium channel activity refers to the three distinct states of the channel that can be modulated: closed, open and inactivated.
  • the transition from the closed state to the open state refers to the activation mechanism, the return from the open state to the closed state refers to the deactivation.
  • the transition from the open state to the inactivated state refers to inactivation.
  • the transition between the inactivated states and the open or closed states relates to the reactivation mechanism.
  • Calcium channel blockers refers to compounds including "calcium channel blockers”, “calcium channel activators”, “trigger modifiers”, “allosteric modulators” affecting the flow of calcium ion current in the channel by inducing one and / or conformation modification (s) on said calcium channels, assembly subunits or organization, modification of the addressing and / or trafficking of the calcium channel to the plasma membrane, modification of the durability of said calcium channel to the plasma membrane, any modification of the post-translational state such as the phosphorylation state of said calcium channel, or any modification of the activation, deactivation, inactivation or reactivation processes.
  • Calcium channel blockers refers to compounds that slow down and / or interrupt and / or stop the normal entry of calcium ions through the calcium channel.
  • Calcium channel activators refers to compounds that activate the opening of calcium channels or increase the opening time of these channels.
  • Trigger modifiers refer to compounds that modify the initiation of calcium channel opening.
  • Allosteric modulators refers to compounds that bind to allosteric sites on the channel resulting in indirect modulation (increase or decrease) in the conductance or activation kinetics of deactivation, inactivation or reactivation of said calcium channel.
  • An object of the present invention is the isolated nucleic acid sequence or a variant thereof comprising at least one subunit of the calcium channel (Ca 2+ ) of a pollinating insect.
  • Another object of the present invention is the isolated amino acid or protein sequence or a variant thereof comprising at least one subunit of the calcium channel (Ca 2+ ) of a pollinating insect.
  • Pollinating insects of the invention include species of the order Hymenoptera, family Apidae and subfamily Apinae especially non-invasive species that do not harm crops or parasitize pollinating insects or damage beehives .
  • the pollinating insects of the invention comprise a non-limiting list: bees, bees such as Apis mellifera, Apis cerana, Apis dorsata, Apis Florea, stingless bees such as Melipona beecheii or Melipona yucatanica, Melipona anthidioides of quadrifasciata, honey bees. orchid, drones like Bombus franklini, Bombus terricola, Bombus affinis and Bombus occidentalis.
  • the pollinating insect of the invention is a bee, and preferably Apis mellifera.
  • the present invention is specifically intended to meet this need by providing bee calcium channel subunits with a sequence selected from the group consisting of the sequence SEQ ID Nos. 1 to 3 of the attached listing and bee calcium channels.
  • isolated bees comprising a subunit Ca v al.
  • the inventors have identified, isolated and provide the subunits of a bee calcium channel, in particular Apis mellifera.
  • the Cavla subunit expresses the isolated calcium channel protein sequence as described in SEQ ID NO: 1 or a variant thereof consisting of an amino acid sequence of less than 2000 amino acids and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99 , 6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 1.
  • the Cav2b subunit expresses the isolated calcium channel protein sequence as described in SEQ ID NO: 2 or a variant thereof consisting of an amino acid sequence less than 1900 amino acids and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 2.
  • the Cav3a subunit expresses the isolated calcium channel protein sequence as described in SEQ ID NO: 3 or a variant thereof consisting of an amino acid sequence more than 2300 amino acids and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 3.
  • the present invention also relates to an isolated bee calcium channel comprising: a subunit Ca v al as defined above and further comprising at least one regulatory protein selected from a regulatory protein Ca v a2- ⁇ of a sequence selected from the group comprising the sequences SEQ ID NO 6 to 8 of the listing and at least one regulatory protein Ca v p selected from the group comprising the sequences SEQ ID Nos. 4, 5 and 107 of the appended listing.
  • the subunits of SEQ ID Nos. 6 to 8 have been designated as amCava2O1, amCava2O2 or amCava2O3, respectively, by the inventors.
  • the subunits of SEQ ID Nos. 4, 5 and 107 have been named amCavPa, amCavPb or amCavPc respectively by the inventors.
  • the Cava2 ⁇ 1 subunit expresses the sequence of the isolated regulatory protein described in SEQ ID NO: 6 or a variant thereof consisting of an amino acid sequence of at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 6.
  • the Cava2 ⁇ 2 subunit expresses the sequence of the isolated regulatory protein described in SEQ ID NO: 7 or a variant thereof consisting of an amino acid sequence of at least 90, 91, 92 , 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 % identity with SEQ ID NO: 7.
  • the Cava2 ⁇ 3 subunit expresses the sequence of the regulatory isolated protein described in SEQ ID NO: 8 or a variant thereof consisting of an amino acid sequence of at least 90, 91, 92 , 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 % identity with SEQ ID NO: 8.
  • the CavPa subunit expresses the sequence of the regulatory isolated protein described in SEQ ID NO: 4 or a variant thereof consisting of an amino acid sequence of at least 90, 91, 92 , 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 Identity% with SEQ ID NO: 4.
  • the Cavpb subunit expresses the sequence of the regulatory isolated protein described in SEQ ID NO: 5 or a variant thereof consisting of an amino acid sequence of at least 90, 91, 92 , 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 Identity% with SEQ ID NO: 5.
  • the CavPc subunit expresses the sequence of the regulatory isolated protein described in SEQ ID NO: 107 or a variant thereof consisting of an amino acid sequence of at least 90, 91, 92 , 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 % identity with SEQ ID NO: 107.
  • the isolated bee calcium channel is a protein complex comprising a Ca v al subunit, a Ca v a2 - ⁇ regulatory protein and a Ca v p regulatory protein.
  • the present invention also relates to nucleic acids encoding a subunit Ca v al according to the present invention, particularly for protein sequence SEQ ID No. 1 to 3 or a variant thereof of the appended listing. It may be for example a nucleotide sequence comprising or consisting of the sequence SEQ ID No. 9 to 11 respectively of the attached sequence listing.
  • the isolated nucleic acid sequence comprises Cava as described in SEQ ID NO: 9 or a variant thereof consisting of a nucleic acid sequence of less than 6,000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7 , 99.8, 99.9% identity with SEQ ID NO: 9.
  • the isolated nucleic acid sequence comprises Cav2b as described in SEQ ID NO: 10 or a variant thereof consisting of a nucleic acid sequence of less than 5,500 base pairs (bp) , more than 600 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99 , 6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 10.
  • the isolated nucleic acid sequence comprises Cav3a as described in SEQ ID NO: 11 or a variant thereof consisting of a nucleic acid sequence of less than 7800 base pairs (bp) and having at least 90, 91, 91.5; 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99, 9% identity with SEQ ID NO: 11.
  • the present invention also relates to a nucleotide sequence coding for the Ca v a2- ⁇ regulatory protein of sequence SEQ ID Nos. 6 to 8 of the attached sequence listing. It may be, for example, the sequence SEQ ID No. 15 to 17 respectively of the appended sequence listing.
  • the isolated nucleic acid sequence comprises Cava2 ⁇ 1 as described in SEQ ID NO: 15 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7 , 99.8, 99.9% identity with SEQ ID NO: 15.
  • the isolated nucleic acid sequence comprises Cava2O2 as described in SEQ ID NO: 16 or a variant thereof. consisting of a nucleic acid sequence of less than 4000 base pairs (bp), greater than 500 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99, 1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 16.
  • the isolated nucleic acid sequence comprises Cava2 ⁇ 3 as described in SEQ ID NO: 17 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5
  • the present invention also relates to a nucleotide sequence coding for the Ca v p regulatory protein of sequence SEQ ID No. 17. 4, 5 or 107 or a variant thereof of the appended sequence listing. It may be, for example, the sequence SEQ ID No. 12 to 14 or a variant thereof respectively of the appended sequence listing.
  • the isolated nucleic acid sequence comprises CavPa as described in SEQ ID NO: 12 or a variant thereof consisting of a nucleic acid sequence of less than 2000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7 , 99.8, 99.9% identity with SEQ ID NO: 12.
  • the isolated nucleic acid sequence comprises Cavpb as described in SEQ ID NO: 13 or a variant thereof consisting of a nucleic acid sequence of less than 1500 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99, 7, 99.8, 99.9% identity with SEQ ID NO: 13.
  • the isolated nucleic acid sequence comprises CavPc as described in SEQ ID NO: 14 or a variant thereof consisting of a nucleic acid sequence of less than 2000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99, 7, 99.8, 99.9% identity with SEQ ID NO: 14.
  • the present invention also relates to the nucleic acids encoding a protein complex comprising a Ca v al subunit, a Ca v a2 - ⁇ regulatory protein and a Ca v p regulatory protein according to the present invention, in particular for the SEQ sequence protein. ID No. 1 to 8 and 107. It may be for example a nucleotide sequence comprising or consisting of the sequence SEQ ID No. 9 to 17 or a variant thereof of the appended sequence listing.
  • the present invention also relates to a vector comprising a nucleotide sequence coding for one of the Caval subunits and / or a Cava2-6 regulatory protein and / or a bee CavP regulatory protein of the present invention, for example an acid. nucleic acid selected from the sequences SEQ ID Nos. 9 to 17 or a variant thereof.
  • the vector of the invention comprises the isolated Cavla nucleic acid sequence as described in SEQ ID NO: 9 or a variant thereof consisting of a nucleic acid sequence of less than 6000 pairs of bases (pb) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7 , 99.8, 99.9% identity with SEQ ID NO: 9.
  • the vector of the invention comprises the isolated nucleic acid sequence Cav2b as described in SEQ ID NO: 10 or a variant thereof consisting of a nucleic acid sequence of less than 5,500. base pairs (bp), more than 600 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 10.
  • the vector of the invention comprises the isolated nucleic acid sequence Cav3a as described in SEQ ID NO: 11 or a variant thereof consisting of a nucleic acid sequence of less than 7800 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5,
  • the vector of the invention comprises the isolated Cavla nucleic acid sequence as described in SEQ ID NO: 9 or a variant thereof consisting of a nucleic acid sequence of less than 6000 pairs of bases (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99 , 6
  • SEQ ID NO: 9 the isolated nucleic acid sequence Cava2 ⁇ 1 as described in SEQ ID NO: 15 or a variant thereof consisting of a sequence of nucleic acid of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99, 4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 15.
  • the vector of the invention comprises the isolated Cavla nucleic acid sequence as described in SEQ ID NO: 9 or a variant thereof consisting of a nucleic acid sequence of less than 6000 pairs of bases (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99 , 6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 9 and the isolated Cava2 ⁇ 2 nucleic acid sequence as described in SEQ ID NO: 16 or a variant thereof in a nucleic acid sequence of less than 4000 base pairs (bp), more than 500 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7 , 99.8, 99.9% identity with SEQ ID NO: 16.
  • the vector of the invention comprises the isolated Cavla nucleic acid sequence as described in SEQ ID NO: 9 or a variant thereof consisting of a nucleic acid sequence of less than 6000 pairs of bases (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99 , 6
  • SEQ ID NO: 9 identity with SEQ ID NO: 9 and the isolated nucleic acid sequence amCava2 ⁇ 3 as described in SEQ ID NO: 17 or a variant thereof consisting of a sequence of nucleic acid of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99, 4, 99.5, 99.6, 99.7,
  • the vector of the invention comprises the isolated Cavla nucleic acid sequence as described in SEQ ID NO: 9 or a variant thereof consisting of a nucleic acid sequence of less than 6000 pairs of bases (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99 , 6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 9 and the isolated nucleic acid sequence CavPa as described in SEQ ID NO: 12 or a variant thereof consisting of in a nucleic acid sequence of less than 2000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99 , 3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 12.
  • the vector of the invention comprises the isolated Cavla nucleic acid sequence as described in SEQ ID NO: 9 or a variant thereof consisting of a nucleic acid sequence of less than 6000 pairs of bases (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99 , 6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 9 and the isolated nucleic acid sequence Cavpb as described in SEQ ID NO: 13 or a variant thereof consisting of in a nucleic acid sequence of less than 1500 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99 , 3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 13.
  • the vector of the invention comprises the isolated Cavla nucleic acid sequence as described in SEQ ID NO: 9 or a variant thereof consisting of a nucleic acid sequence of less than 6000 pairs of bases (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99 , 6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 9 and the isolated nucleic acid sequence CavPc as described in SEQ ID NO: 14 or a variant thereof in a nucleic acid sequence of less than 2000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99 , 3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 14.
  • the vector of the invention comprises the isolated nucleic acid sequence Cav2b as described in SEQ ID NO: 10 or a variant thereof consisting of a nucleic acid sequence of less than 5500 bp its (bp), greater than 600 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99 , 5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 10 and the isolated nucleic acid sequence Cava2 ⁇ 1 as described in SEQ ID NO: 15 or a variant of the latter consisting of a nucleic acid sequence of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99, 99 , 2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 15.
  • the vector of the invention comprises the isolated nucleic acid sequence Cav2b as described in SEQ ID NO: 10 or a variant thereof consisting of a nucleic acid sequence of less than 5,500. base pairs (bp), more than 600 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4 , 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 10 and the isolated nucleic acid sequence Cava2O2 as described in SEQ ID NO: 16 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp), greater than 500 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 16.
  • the vector of the invention comprises the isolated nucleic acid sequence Cav2b as described in SEQ ID NO: 10 or a variant thereof consisting of a nucleic acid sequence of less than 5,500. base pairs (bp), greater than 600 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99, 5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 10 and the isolated nucleic acid sequence Cava2 ⁇ 3 as described in SEQ ID NO: 17 or a variant of that consisting of a nucleic acid sequence of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99, 99, 2, 99.3, 99.4,
  • the vector of the invention comprises the isolated nucleic acid sequence Cav2b as described in SEQ ID NO: 10 or a variant thereof consisting of a nucleic acid sequence of less than 5,500. base pairs (bp), more than 600 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4 , 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 10 and the isolated nucleic acid sequence CavPa as described in SEQ ID NO: 12 or a variant thereof consisting of a nucleic acid sequence of less than 2000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 12.
  • the vector of the invention comprises the isolated nucleic acid sequence Cav2b as described in SEQ ID NO: 10 or a variant thereof consisting of a nucleic acid sequence of less than 5,500. base pairs (bp), more than 600 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4 , 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 10 and the isolated nucleic acid sequence Cavpb as described in SEQ ID NO: 13 or a variant thereof consisting of a nucleic acid sequence of less than 1500 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1 , 99.2, 99.3, 99.4, 99.5,
  • the vector of the invention comprises the isolated nucleic acid sequence Cav2b as described in US Pat.
  • the vector of the invention comprises the isolated nucleic acid sequence Cav3a as described in SEQ ID NO: 11 or a variant thereof consisting of a nucleic acid sequence of less than 7800 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5,
  • the vector of the invention comprises the isolated nucleic acid sequence Cav3a as described in SEQ ID NO: 11 or a variant thereof consisting of a nucleic acid sequence of less than 7800 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 11 and the isolated nucleic acid sequence Cava2O2 as described in SEQ ID NO: 16 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp), greater than 500 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 16.
  • the vector of the invention comprises the isolated nucleic acid sequence Cav3a as described in SEQ ID NO: 11 or a variant thereof consisting of a nucleic acid sequence of less than 7800 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 11 and the isolated nucleic acid sequence Cava2 ⁇ 3 as described in SEQ ID NO: 17 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 17.
  • the vector of the invention comprises the isolated nucleic acid sequence Cav3a as described in SEQ ID NO: 11 or a variant thereof consisting of a nucleic acid sequence of less than 7800 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 11 and the isolated nucleic acid sequence CavPa as described in SEQ ID NO: 12 or a variant thereof consisting of a nucleic acid sequence of less than 2000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 12.
  • the vector of the invention comprises the isolated nucleic acid sequence Cav3a as described in SEQ ID NO: 11 or a variant thereof consisting of a nucleic acid sequence of less than 7800 par bases (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 11 and the isolated nucleic acid sequence Cavpb as described in SEQ ID NO: 13 or a variant thereof consisting of a nucleic acid sequence of less than 1500 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 13.
  • the vector of the invention comprises the isolated nucleic acid sequence Cav3a as described in SEQ ID NO: 11 or a variant thereof consisting of a nucleic acid sequence of less than 7800 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 11 and the isolated nucleic acid sequence CavPc as described in SEQ ID NO: 14 or a variant thereof consisting of a nucleic acid sequence of less than 2000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 14.
  • the vector of the invention comprises the isolated Cavla nucleic acid sequence as described in SEQ ID NO: 9 or a variant thereof consisting of a nucleic acid sequence of less than 6000 pairs of bases (pb) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7 , 99.8, 99.9% identity with SEQ ID NO: 9 and the isolated nucleic acid sequence Cava2 ⁇ 1 as described in SEQ ID NO: 15 or a variant thereof consisting of an acid sequence nucleic of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4 , 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 15 and the isolated nucleic acid sequence CavPa as described in SEQ
  • the vector of the invention comprises the isolated Cavla nucleic acid sequence as described in SEQ ID NO: 9 or a variant thereof consisting of a nucleic acid sequence of less than 6000 pairs of bases (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99 , 6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 9 and the isolated nucleic acid sequence Cava2 ⁇ 1 as described in SEQ ID NO: 15 or a variant thereof consisting of in a nucleic acid sequence of less than 4000 base pairs (bp) and having at least
  • SEQ ID NO: 15 and the isolated nucleic acid sequence Cavpb as described in SEQ ID NO: 13 or a variant thereof consisting of a nucleic acid sequence of less than 1500 base pairs (bp) and having at least 90,
  • the vector of the invention comprises the isolated Cavla nucleic acid sequence as described in SEQ ID NO: 9 or a variant thereof consisting of a nucleic acid sequence of less than 6000 pairs of bases (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99 , 6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 9 and the isolated nucleic acid sequence Cava2 ⁇ 1 as described in SEQ ID NO: 15 or a variant thereof consisting of in a nucleic acid sequence of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99, 8, 99.9% identity with SEQ ID NO: 15 and the isolated nucleic acid sequence CavPc as described in SEQ
  • the vector of the invention comprises the isolated Cavla nucleic acid sequence as described in SEQ ID NO: 9 or a variant thereof consisting of a nucleic acid sequence of less than 6000 pairs of bases (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99 , 6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 9 and the isolated Cava2 ⁇ 2 nucleic acid sequence as described in SEQ ID NO: 16 or a variant thereof consisting of in a nucleic acid sequence of less than 4000 base pairs (bp), greater than 500 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 16 and the isolated nucleic acid sequence CavP
  • the vector of the invention comprises the isolated nucleic acid sequence Cavla as described in SEQ ID NO: 9 or a variant thereof. consisting of a nucleic acid sequence of less than 6,000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2.
  • SEQ ID NO: 9 the isolated nucleic acid sequence Cava2O2 as described. in SEQ ID NO: 16 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp), greater than 500 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 16 and the isolated nucleic acid sequence Cavpb as described in SEQ ID NO: 13 or a variant thereof being in a nucleic acid sequence of less than 1500 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9%
  • the vector of the invention comprises the isolated Cavla nucleic acid sequence as described in SEQ ID NO: 9 or a variant thereof consisting of a nucleic acid sequence of less than 6000 pairs of bases (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99 , 6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 9 and the isolated Cava2 ⁇ 2 nucleic acid sequence as described in SEQ ID NO: 16 or a variant thereof consisting of in a nucleic acid sequence of less than 4000 base pairs (bp), greater than 500 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 16 and the isolated nucleic acid sequence CavP
  • the vector of the invention comprises the isolated Cavla nucleic acid sequence as described in SEQ ID NO: 9 or a variant thereof consisting of a nucleic acid sequence of less than 6000 pairs of bases (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99 , 6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 9 and the isolated nucleic acid sequence Cava2 ⁇ 3 as described in SEQ ID NO: 17 or a variant thereof consisting of in a nucleic acid sequence of less than 4000 base pairs (bp) and having at least
  • SEQ ID NO: 17 and the isolated nucleic acid sequence CavPa as described in SEQ ID NO: 12 or a variant thereof consisting of a nucleic acid sequence of less than 2000 base pairs (bp) and having at least 90,
  • the vector of the invention comprises the isolated Cavla nucleic acid sequence as described in SEQ ID NO: 9 or a variant thereof consisting of a nucleic acid sequence of less than 6,000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 9 and the isolated nucleic acid sequence Cava2 ⁇ 3 as described in SEQ ID NO: 17 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 17 and the isolated nucleic acid sequence Cavpb as described in SEQ ID NO:
  • the vector of the invention comprises the isolated Cavla nucleic acid sequence as described in SEQ ID NO: 9 or a variant thereof consisting of a nucleic acid sequence of less than 6000 pairs of bases (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99 , 6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 9 and the isolated nucleic acid sequence Cava2 ⁇ 3 as described in SEQ ID NO: 17 or a variant thereof consisting of in a nucleic acid sequence of less than 4000 base pairs (bp) and having at least
  • SEQ ID NO: 17 and the isolated nucleic acid sequence CavPc as described in SEQ ID NO: 14 or a variant thereof consisting of a nucleic acid sequence of less than 2000 base pairs (bp) and having at least 90,
  • the vector of the invention comprises the isolated nucleic acid sequence Cav2b as described in SEQ ID NO: 10 or a variant of that consisting of a nucleic acid sequence of less than 5,500 base pairs (bp), more than 600 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99 , 1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 10 and the acid sequence isolated nucleic Cava2 ⁇ 1 as described in SEQ ID NO: 15 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93,
  • the vector of the invention comprises the isolated nucleic acid sequence Cav2b as described in SEQ ID NO: 10 or a variant thereof consisting of a nucleic acid sequence of less than 5,500. base pairs (bp), more than 600 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4 , 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 10 and the isolated nucleic acid sequence Cava2 ⁇ 1 as described in SEQ ID NO: 15 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 15 and the isolated nucleic acid sequence Cav2b as
  • the vector of the invention comprises the isolated nucleic acid sequence Cav2b as described in SEQ ID NO: 10 or a variant thereof consisting of a nucleic acid sequence of less than 5,500. base pairs (bp), more than 600 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4 , 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 10 and the isolated nucleic acid sequence Cava2 ⁇ 1 as described in SEQ ID NO: 15 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 15 and the isolated nucleic acid sequence Cav2b as
  • the vector of the invention comprises the isolated nucleic acid sequence Cav2b as described in SEQ ID NO: 10 or a variant thereof consisting of a nucleic acid sequence of less than 5,500. base pairs (bp), more than 600 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2,
  • SEQ ID NO: 10 the isolated nucleic acid sequence Cava2O2 as described in SEQ ID NO: 16 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp), greater than 500 bp and having at least 90, 91, 92, 93, 94, 95, 96 , 97, 98, 99, 99.1,
  • the vector of the invention comprises the isolated nucleic acid sequence Cav2b as described in SEQ ID NO: 10 or a variant thereof consisting of a nucleic acid sequence of less than 5,500. base pairs (bp), more than 600 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2,
  • the vector of the invention comprises the isolated nucleic acid sequence Cav2b as described in SEQ ID NO: 10 or a variant thereof consisting of a nucleic acid sequence of less than 5,500.
  • the vector of the invention comprises the isolated nucleic acid sequence Cav2b as described in SEQ ID NO: 10 or a variant thereof consisting of a nucleic acid sequence of less than 5,500. base pairs (bp), more than 600 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2,
  • SEQ ID NO: 17 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 17 and the isolated nucleic acid sequence CavPa as described in SEQ ID NO: 12 or a variant of that consisting of a nucleic acid sequence of less than 2000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99, 99, 2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 12.
  • the vector of the invention comprises the isolated nucleic acid sequence Cav2b as described in SEQ ID NO: 10 or a variant thereof consisting of a nucleic acid sequence of less than 5,500. base pairs (bp), more than 600 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 10 and the isolated nucleic acid sequence Cava2 ⁇ 3 as described in SEQ ID NO: 17 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 17 and the isolated nucleic acid sequence Cavpb
  • the vector of the invention comprises the isolated nucleic acid sequence Cav2b as described in SEQ ID NO: 10 or a variant thereof consisting of a nucleic acid sequence of less than 5 500 base pairs (bp), more than 600 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99, 4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 10 and the isolated Cava2 ⁇ 3 nucleic acid sequence as described in SEQ ID NO: 17 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99, 1, 99.2, 99.3, 99.4,
  • SEQ ID NO: 17 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 17 and the isolated nucleic acid sequence CavPc as described in SEQ ID NO: 14 or a variant of that consisting of a nucleic acid sequence of less than 2000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99, 99, 2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 14.
  • the vector of the invention comprises the isolated nucleic acid sequence Cav3a as described in SEQ ID NO: 11 or a variant thereof consisting of a nucleic acid sequence of less than 7800 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5,
  • SEQ ID NO: 11 the isolated nucleic acid sequence Cava2 ⁇ 1 as described in SEQ ID NO: 15 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99, 3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 15 and the isolated nucleic acid sequence CavPa as described in SEQ ID NO: 12 or a variant thereof consisting of a sequence nucleic acid of less than 2000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 12.
  • the vector of the invention comprises the isolated nucleic acid sequence Cav3a as described in SEQ ID NO: 11 or a variant thereof consisting of a nucleic acid sequence of less than 7800 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 11 and the isolated nucleic acid sequence Cava2 ⁇ 1 as described in SEQ ID NO: 15 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 15 and the isolated nucleic acid sequence Cavpb as described in SEQ ID NO: 11 and
  • the vector of the invention comprises the isolated nucleic acid sequence Cav3a as described in SEQ ID NO: 11 or a variant thereof consisting of a nucleic acid sequence of less than 7800 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5,
  • SEQ ID NO: 15 and the isolated nucleic acid sequence CavPc as described in SEQ ID NO: 14 or a variant thereof consisting of a sequence of nucleic acid of less than 2000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 14.
  • the vector of the invention comprises the isolated nucleic acid sequence Cav3a as described in SEQ ID NO: 11 or a variant thereof consisting of a nucleic acid sequence of less than 7800 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5,
  • SEQ ID NO: 11 and the isolated nucleic acid sequence Cava2 ⁇ 2 as described in SEQ ID NO: 16 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp), greater than 500 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99, 99 , 2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 16 and the isolated nucleic acid sequence CavPa as as described in SEQ ID NO: 12 or a variant thereof consisting of a nucleic acid sequence of less than 2000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96 , 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 11 and the isolated nucleic acid sequence Cava2 ⁇ 2
  • the vector of the invention comprises the isolated nucleic acid sequence Cav3a as described in SEQ ID NO: 11 or a variant thereof consisting of a nucleic acid sequence of less than 7800 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 11 and the isolated nucleic acid sequence Cava2O2 as described in SEQ ID NO: 16 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp), greater than 500 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 16 and the isolated nucleic acid sequence Cavpb as
  • the vector of the invention comprises the isolated nucleic acid sequence Cav3a as described in SEQ ID NO: 11 or a variant of the latter consisting of a nucleic acid sequence of less than 7800 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99, 99 , 2, 99.3, 99.4, 99.5,
  • the vector of the invention comprises the isolated nucleic acid sequence Cav3a as described in SEQ ID NO: 11 or a variant thereof consisting of a nucleic acid sequence of less than 7800 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 11 and the isolated nucleic acid sequence Cava2 ⁇ 3 as described in SEQ ID NO: 17 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 17 and the isolated nucleic acid sequence CavPa as described in SEQ ID NO: 17 and
  • the vector of the invention comprises the isolated nucleic acid sequence Cav3a as described in SEQ ID NO: 11 or a variant thereof consisting of a nucleic acid sequence of less than 7800 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 11 and the isolated nucleic acid sequence Cava2 ⁇ 3 as described in SEQ ID NO: 17 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 17 and the isolated nucleic acid sequence Cavpb as described in SEQ ID NO: 11 and
  • the vector of the invention comprises the isolated nucleic acid sequence Cav3a as described in SEQ ID NO: 11 or a variant thereof consisting of a nucleic acid sequence of less than 7800 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5,
  • SEQ ID NO: 17 and the isolated nucleic acid sequence CavPc as described in SEQ ID NO: 14 or a variant thereof consisting of a sequence of nucleic acid of less than 2000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99, 4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 14.
  • the term "vector” is intended to mean expression and / or secretion vectors in a specific host cell. They may for example be vectors of plasmid or viral origin, comprising, in addition to the nucleic acid sequence, the means necessary for its expression. These means may for example include a promoter, translation initiation and termination signals, as well as appropriate transcriptional regulatory regions.
  • the expression vector can also comprise other elements such as an origin of replication, a multiple cloning site, an enhancer, a signal peptide that can be fused in phase with the polypeptide produced during cloning, and one or more selection markers.
  • the vector may be one of the vectors known to those skilled in the art for manufacturing proteins by genetic recombination.
  • plasmid vector for example a viral vector, for example an adenoviral vector, a retroviral vector or a bacteriophage. It is generally chosen in particular according to the chosen cellular host.
  • the vector may for example be chosen from the vectors listed in the catalog http://www.promega.com/vectors/mammalian_express_vectors.htm [7] or http /// wwwqiagen.com [8] or https: // www .lifetechnologies.com [18]). It may be for example the expression vector described in WO 83/004261 [10].
  • the nucleic acids of the present invention or the vectors of the present invention are useful in particular for the manufacture by genetic recombination or heterologous expression of the Cavc11 subunits and / or regulatory proteins of the present invention.
  • the present invention also relates to a host cell comprising a nucleic acid sequence according to the invention or a vector according to the invention as defined above.
  • the nucleic acids of the present invention or the vectors of the present invention are useful in particular for the manufacture by genetic recombination or heterologous expression of the calcium channels of the present invention.
  • the present invention also relates to a transformed cell comprising a nucleic acid sequence according to the invention or a vector according to the invention.
  • Transformed cell means a prokaryotic or eukaryotic cell.
  • Transformable cells are those commonly used for genetic recombinations or heterologous expressions. They include in particular cells of bacteria such as Escherichia coli or Bacillus sp., Yeast cells such as Saccharomyces cerevisiae, fungi cells such as Aspergillus niger, insect cells, such as SF9, and mammalian cells (especially human) such as cell lines CHO, HEK 293, PER-C6, amphibian cells, for example Xenopus oocytes, etc.
  • the transformed cell of the invention is a Xenopus oocyte.
  • the genetic recombination techniques or heterologous expressions that can be used in the present invention are those known to those skilled in the art. This may be for example the techniques described in Guide to Molecular Cloning Techniques (Guide to Molecular Cloning Techniques, Berger SL Editors and Kimmel AR, Methods in Enzymology, Vol 152 [11]) or Molecular Cloning, A Laboratory Manual (Molecular Cloning, A Laboratory Manual Editors Green MR and Sambrook J., Cold Spring Harbor Laboratory Press [12])
  • the cell transformed with an expression vector according to the invention or a nucleic acid sequence according to the invention then expresses the corresponding polypeptide in a stable manner, as described in the examples below.
  • Those skilled in the art can easily verify that the host cell expresses the polypeptide stably, by any technique known to those skilled in the art to identify the peptides of the present invention according to their molecular weight including, for example in using the Western blot technique.
  • the transformed cell may be any cell suitable for making by genetic recombination or heterologous expression of calcium channels of the present invention from the nucleic sequences or vectors of the invention. It can be for example E. Coli, e.g. E. coli BL21, E. coli Origami (DE3) from Pischia pastoris, Saccharomyces cerevisiae, insect cells, e.g. insect-baculovirus cell system (e.g., SF9 insect cells using a baculovirus expression system), mammals, for example hek293 cells, amphibians, for example Xenopus oocytes.
  • E. Coli e.g. E. coli BL21, E. coli Origami (DE3) from Pischia pastoris, Saccharomyces cerevisiae
  • insect cells e.g. insect-baculovirus cell system (e.g., SF9 insect cells using a baculovirus expression system)
  • mammals for example hek293
  • the culture means of these cells are those known to those skilled in the art, for example those described in the aforementioned documents.
  • the inventors are the first to have isolated and characterized a Ca v al subunit, a Ca v a2 - ⁇ regulatory protein and a Ca v p regulatory protein of the bee calcium channel.
  • this channel composed of a Ca v al subunit and / or the regulatory protein Ca v a2 - ⁇ and / or the regulatory protein Ca v p bee are sensitive to certain compounds which can modify the properties of the Ca v al subunit channel and / or the Ca v a2 - ⁇ regulatory protein and / or the Ca v p protein, for example by plugging the pore the channel, for example by modifying the kinetics of the calcium current or for example by changing its sensitivity to voltage, and can therefore be used in particular to analyze the toxicity of molecules.
  • the calcium channel of insects comprises a Cav1a or Cav2b or Cav3a gene which constitutes the subunit forming the pore of the channel through which the ions pass.
  • the alternative splicing of RNA and the assembly of this gene can generate many variants of calcium channels with different voltage-dependence, kinetics and / or pharmacological properties.
  • the activity of the calcium channel is modulated by regulatory subunits. These regulatory subunits can also generate variants with different properties.
  • the modified cells expressing the calcium channel of a pollinating insect carry mutations that confer reduced sensitivity to a test compound.
  • the present invention thus also relates to an in vitro method for determining the toxicity of a molecule and / or analyzing the toxicity of a molecule and / or detecting a toxic molecule, said method comprising a step of analysis electrophysiological or calcium imaging comprising contacting said molecule with a channel according to the invention or with a transformed cell according to the invention.
  • the present invention also relates to the determination of the interaction between the channel according to the invention and a molecule.
  • the term "molecule" means any molecule that it is desired to test in order to determine whether it interacts with the Ca v al subunit and / or the Ca v a2 - ⁇ regulatory protein and / or the regulatory protein.
  • Ca v bee p It may be for example chemical and / or biological molecules, for example molecules used as an insecticide, as weed killer, as antifungal, as fertilizer, phytosanitary, and more generally any molecule used in the fields of agricultural production, animal , viticultural, domestic, etc. These may be existing molecules or new molecules which, thanks to the present invention, may be tested before use in nature.
  • An object of the invention is an in vitro method for determining the effect of a test compound on the activity of a calcium channel of a pollinating insect, comprising: a. bringing the transformed cells described above into contact with a test compound
  • Another object of the invention is an in vitro method for determining the effect of a test compound on the activity of a calcium channel of a pollinating insect, comprising: a. contacting a transformed cell as described above with a vehicle solution,
  • Another object of the invention is an in vitro method for determining the effect of a test compound on the activity of a calcium channel of an insect pollinator, comprising: a. contacting a modified cell as described above with a vehicle solution,
  • the vehicle solution used herein refers to the same solution that comprises the test compound.
  • control compound refers to a compound whose effect on calcium channel activity is well known to those skilled in the art.
  • control compound is a compound known to be toxic to the calcium channel of the pollinating insect.
  • control compound is a compound known to be toxic to the calcium channel of other species such as invasive species.
  • invasive species include, but are not limited to: introduced species, imported bees, hymenopteran species of the order, family Vespidae and subfamily Vespinae including Asian predatory wasp (Vespa velutina) , spiders, parasites, endoparasites, ectoparasites of the arachnid class, the Varroidae family such as Varroa jacobsoni, Varroa destructor, Varroa underwoodi, Varroa rindereri.
  • introduced species imported bees, hymenopteran species of the order, family Vespidae and subfamily Vespinae including Asian predatory wasp (Vespa velutina) , spiders, parasites, endoparasites, ectoparasites of the arachnid class, the Varroidae family such as Varroa jacobsoni, Varroa destructor, Varroa underwoodi, Varroa rindereri.
  • Examples of compounds used as a control compound include but are not limited to: direct modulators for example pyrethrinoids (permethrin, tetramethrin, allethrin ...), dihydropyridines (nifedipine, nicardipine, BayK 8644 ..), benzothiazepines ( verapamil), phenylalkylamines (diltiazem, D600), animal toxins (GVIA conotoxins, AgalVA agonists, atracotoxins, Cu- atracotioxinHvla), or indirect modulators of Srckinase-dependent phosphorylation, PKA, PKC or Pi3kinase for example (genistein, staurosporine, H89, Wortmannin, LY294002). These modulations may be agonist or antagonistic.
  • direct modulators for example pyrethrinoids (permethrin, tetramethrin, allethrin ...),
  • control compound modulates the activity of the calcium channel.
  • lethal dose of a test compound is added to the culture medium.
  • the sub-lethal dose of a test compound is added to the culture medium.
  • the minimum modulation dose of a test compound is added to the culture medium.
  • the present invention thus provides an effective means for combating the disappearance of bees and / or determining the causes thereof.
  • the chemical molecules can be insecticides, for example permethrin, for example allethrin, fertilizers, pesticides.
  • test compounds include molecules which include, but are not limited to: chemical compounds, novel chemical entities, siRNA, shRNA, antisense oligonucleotide, ribozymes or aptamers, calcium channel agonist or antagonist, antibodies or fragments of it, diabodies modulating the activity of a calcium channel of a pollinating insect.
  • the test compounds comprise molecules of biological origin which may be in a non-limiting list: insect venom, for example spider, molluscan venom, for example snail or snails. venoms from vertebrates, for example snakes, neurotoxins such as tetrodotoxin, and batrachotoxin, plant toxins, scorpion toxins, or other natural products used in integrated pest management.
  • test compounds also include, but are not limited to compounds already known to be toxic to other species such as invasive species as described above.
  • electrophysiological analysis any electrophysiological technique known to those skilled in the art.
  • the electrophysiological analysis can be carried out in imposed voltage with single or double electrodes patch-Clamp, imposed current.
  • the calcium channels are normally closed. They are activated (ie open) by depolarizations of the membrane.
  • the calcium concentration gradient between the extracellular medium and the intracellular medium then promotes a massive calcium entry as long as the potential is lower than the equilibrium potential for the calcium ions (in general, this equilibrium potential is of the order of + 80mV under normal conditions).
  • the coexpression of the Cava2 ⁇ and Cav subunits enhances the expression level of the Cavccl (CaV1 or CaV2) subunit and causes an increase in the probability of opening, and a modification of the kinetics of activation and inactivation as well as a hyperpolarization of the voltage-dependence of the activation and inactivation of the channel. Some of these effects are observed in the absence of the ⁇ subunit, while in other cases the coexpression of the ⁇ subunit is necessary.
  • the ⁇ subunit would play an important role in stabilizing the final conformation of the Cavccl subunit (CaV1 or CaV2) by modifying its targeting and trafficking to the plasma membrane.
  • the ⁇ subunit plays a role in the regulation of activation kinetics and inactivation, as well as in the voltage dependence of activation and inactivation as described above, sensitizing the cala to weak depolarizations.
  • said test compound is already known to modulate the activity of the calcium channel of a pollinating insect.
  • said test compound is not yet known to modulate the activity of the calcium channel of a pollinating insect.
  • said test compound is a new chemical entity.
  • said test compound increases or decreases the functional expression of the calcium channel in the modified cell. In one embodiment of the invention, said test compound induces or reduces the expression of the calcium channel on the surface of the cell.
  • the test compound modulates at least one of the calcium channel subunits and / or at least one of the calcium channel regulatory subunits described above. According to the method of the invention, said test compound modulates the calcium ion current through at least one of the calcium channel subunits and / or at least one of the calcium channel regulatory subunits described above. above.
  • said test compound modulates the activity of the calcium channel of the invention. In one embodiment, said test compound modifies the activation kinetics of the calcium channel. In another embodiment, said test compound modulates (increases or decreases) the amplitude of the calcium current of the pollinating insect.
  • test compound modulates (increases or decreases) inactivation during depolarization. In another embodiment, said test compound modulates (increases or decreases) the kinetics of activation or activation of the voltage-dependent channel and / or the deactivation of the channel.
  • test compound modulates calcium channel activity during repetitive depolarizations.
  • test compound is dependent on the operating states of the calcium channel with a preferred affinity for closed and / or open and / or inactivated states.
  • test compound modulates (increases or decreases) the sorting, addressing or translocation of the calcium channel of the invention. In another embodiment, said test compound modulates (increases or decreases) the stability of the calcium channel of the invention.
  • said test compound modulates the subunit assembly of the calcium channel of the invention.
  • the method of the invention is a high throughput screen. In another embodiment, the method of the invention is an electrophytic method.
  • the method of the invention is a fluorimetry or luminometry method.
  • the methods of the invention can be adapted to a conventional laboratory or adapted to medium or high flow screens.
  • high throughput screening refers to a test design that allows for easy analysis of multiple samples at a time and robotic handling capability.
  • Another desired characteristic of high-throughput assays is a test design that is optimized to reduce the use of reagents, or to minimize the number of manipulations to achieve the desired analysis.
  • calcium imaging refers to any calcium imaging method known to those skilled in the art. This may be for example the process described in Calcium Measurement Methods, 2010 Ed Alexei, Verkhratsky; Petersen, Ole H. Series: Neuromethods, vol. 43 Humana Press [15].
  • the determination of the toxicity of a molecule can be performed by comparing the activity and / or properties of the channel according to the invention in the presence of said candidate molecule with respect to the activity and / or properties of the channel. according to the invention in the absence of said candidate molecule.
  • one of the aforementioned host cells transformed by means of a nucleotide sequence or a vector according to the invention, and expressing one or more of the proteins of the present invention can be used.
  • Cells which express one or more of the proteins of the present invention are preferably favored. It may be, for example, Xenopus cells or HEK293 cells as shown in the examples below.
  • An object of the invention is an in vitro method for determining the toxicity of a test compound on a pollinating insect comprising: a. bringing the transformed cells described above into contact with a test compound
  • a candidate molecule can be determined to be toxic when it inhibits, decreases, increases or impairs the channel current according to the invention.
  • a test compound is considered toxic once a modulating effect is measured on the calcium channel of a pollinating insect.
  • a test compound is considered toxic once it modifies the activation kinetics of the calcium channel.
  • a test compound is considered toxic once it modulates (increases or decreases) the amplitude of a calcium stream of a pollinating insect calcium channel.
  • a test compound is considered toxic once it modulates (increases or decreases) inactivation during one or more depolarizing pulses.
  • a test compound is considered toxic once it modifies the activation kinetics or voltage-dependent activation of the channel.
  • a test compound is considered toxic once it modulates (increases or decreases) the activity of the channel during repetitive depolarizations. In another embodiment, a test compound is considered toxic once it induces deleterious neuronal hyperexcitability.
  • a test compound is considered toxic once its affinity is modulated (increased or decreased) upon opening of the channel. In another embodiment, a test compound is considered toxic as soon as it modulates the closed state of the channel.
  • a test compound is considered toxic once said compound is dependent on the operating states of the calcium channel with a preferred affinity for closed and / or open and / or inactivated states. In another embodiment, a test compound is considered toxic once assembly, addressing or translocation of the calcium channel of the invention is modified.
  • a test compound is considered toxic once the stability of the calcium channel of the invention is changed. In another embodiment, a test compound is considered toxic once the degradation of the calcium channel of the invention is changed.
  • a test compound is considered toxic once the subunit assembly of the calcium channel of the invention is modified.
  • test compound is not toxic to a pollinating insect of the invention.
  • test compound is toxic to a pollinating insect of the invention.
  • the test compound is toxic to the invasive species as described above while said test compound is not toxic to the pollinating insects of the invention.
  • the analysis of the toxicity of a molecule can be carried out by comparing the activity and / or the properties of the channel according to the invention in the presence of said candidate molecule with respect to the activity and / or the properties of the channel according to the invention in the absence of said candidate molecule or in the presence of a reference molecule whose interaction with the protein or proteins of the channel is known. Calibration measurements can also be performed, with a reference molecule, at different concentrations, such as for example cadmium or nifedipine.
  • Another object of the invention is an in vitro method of screening for compounds that modulate the calcium channel activity of a pollinating insect that comprises: a. bringing the transformed cells described above into contact with a test compound
  • kits comprising the vector of the invention or the modified cell expressing the calcium channel of the invention and reagents for carrying out one of the methods of the invention described above.
  • the kit may include culture medium, recombinant nucleic acid sequences, reagents, control compounds, and the like.
  • the kit typically comprises a compartmentalized support adapted to keep in close confinement at least one container.
  • the support should also include reagents useful for performing these methods.
  • the carrier may also contain a detection means such as labeled enzyme substrates or the like. Instructions may be provided to detail the use of kit components, video presentations, or instructions in a format that can be opened on a computer (for example, a floppy disk or CD-ROM). These instructions could indicate, for example, how to use the cells to screen test compounds of interest (such as inotropic drugs).
  • FIG. 1 represents a diagram of the exons present in the gene coding for the amCavl subunit, the nucleic sequence of the amCav1 subunit cDNA (SEQ ID No. 9) and the corresponding peptide sequence (SEQ ID No. 1). ).
  • FIG. 2 represents a diagram of the exons present in the gene coding for the amCav2 subunit, the nucleic sequence of the amCav2 subunit cDNA (SEQ ID No. 10), and the corresponding peptide sequence (SEQ ID No. 2). ) and the peptide sequence of the alternative exons of the gene encoding the amCav2 subunit.
  • FIG. 3 represents a diagram of the exons present in the gene coding for the amCav3a subunit, the nucleic sequence of the cDNA of the amCav3 subunit (SEQ ID No. 11), corresponding peptide sequence (SEQ ID No. 3) and the peptide sequence of the alternative exons of the gene encoding the amCav3 subunit.
  • FIG. 4 represents a diagram of the exons of the gene encoding the CavP subunit, the nucleic sequence of the cDNA of the amCavPa subunit (SEQ ID No. 12) and the corresponding peptide sequence (SEQ ID No. 4).
  • FIG. 5 shows the nucleotide sequences of the cDNA of two other variants of the CavP subunit, amCavpb (SEQ ID 13) and amCavPc (SEQ ID No. 14) and their peptide sequence, amCavpb (SEQ ID No. 5) and amCavPc (SEQ ID NO: 107).
  • Figure 6 is a schematic of the exons of the gene encoding the amCava2 ⁇ 1 subunit, the nucleic sequence of the amCava2 ⁇ 1 subunit cDNA (SEQ ID NO: 15) and the corresponding peptide sequence (SEQ ID NO: 6).
  • FIG. 7 represents a diagram of the exons of the gene coding for the amCava2 ⁇ 2 subunit, the nucleic sequence of the cDNA of the amCava2 ⁇ 2 subunit (SEQ ID No. 16) and the corresponding peptide sequence (SEQ ID No. 7).
  • FIG. 8 represents a diagram of the exons of the gene coding for the amCava2 ⁇ 3 subunit, the nucleic sequence of the amCava2 ⁇ 3 subunit cDNA (SEQ ID No. 17) and the corresponding peptide sequence (SEQ ID No. 8).
  • FIG. 9 represents the traces of currents recorded in voltage-imposed Apis mellifera Caval calcium channels (AmCaVla at the top, or AmCav2b at the bottom) with the Ca v p (AmCavPa) and Cava2- ⁇ 1 (AmCaV ⁇ 2- ⁇ 1) proteins after injection into oocytes of RNA Xenopes synthesized in vitro.
  • A Currents recorded in voltage- imposed on these two types of oocytes (three days post-injection) during the application of a depolarization of -80 mV at +10 or +20 mV of 400 ms duration.
  • B Current-voltage curves recorded on these oocytes showing the voltage-dependence of the opening of these calcium channels of Apis mellifera. The ordinate represents the normalized calcium current at -1 with respect to its maximum amplitude at + 10mV, the abscissa represents the value of the depolarization in millivolt (mV), on the left with AmCaVla and on the right with AmCav2b, in the two cases in the presence of AmCavPa and AmCaV ⁇ 2- ⁇ 1.
  • FIG. 10A shows traces of calcium currents Ca v (AmCaV2b) with the proteins Ca v p (AmCavPa) and Cava2- ⁇ (AmCava2-ol) recorded in voltage-imposed 3 days after injection of RNA in a Xenopus oocyte .
  • the trace referenced cont represents the current recorded under control conditions, the trace noted perm was recorded in the stable state after perfusion of permethrin to 20 ⁇ in the incubation medium.
  • FIG. 10B shows a bar graph (histogram) showing the average percentage of the amplitude of the current (ordinate) in absence (cont) or in the presence (perm) of permethrin (20 ⁇ ), normalized with respect to the control at 100 %.
  • Figure 10C shows the variations of the current amplitude (normalized compared to the beginning of the fixed record at 1, ordered) as a function of time (in seconds) after perfusion of permethrin at 20 ⁇ into the extracellular medium (beginning of the infusion marked by an arrow).
  • FIG. 11A shows an RT-PCR gel for the analysis of the expression of the two bee CavP variants at different stages of development of a larva and a pupa, on days 6 to 16 after hatching.
  • Figure 11B shows a Western blot of cell extracts of Hek T293 cells transfected with the cDNA encoding the amCav ⁇ (Am-CavPa) or amCav b (Am-Cavpb) subunits (a, b, respectively), or adult brain (B) and thorax (T) using primary antibodies directed against either the amino-terminal portion (Nt-Ab) or the carboxy-terminal portion (Ct-Ab) of the subtype.
  • amCav unit a shows an RT-PCR gel for the analysis of the expression of the two bee CavP variants at different stages of development of a larva and a pupa, on days 6 to 16 after hatching.
  • Figure 11B shows a Western blot of cell extracts of Hek T2
  • Figure 11D shows an immunofluorescence photograph stating the expression of CavP protein in antennal lobe neurons in culture.
  • Figure 11 E shows an immunofluorescence photograph stating the expression of CavP protein in a primary culture of muscle cells. Staining of the nucleus (arrowheads) is only observed in muscle cells. In parts D and E the primary antibody Ct-Ab was used.
  • Figure 12A shows photographs of larvae 10 days (D10), 11 days (D11) and 16 days (D16) after hatching.
  • Figure 12B shows nucleic acid agarose gels showing the expression pattern determined by RT-PCR of two of the variants of the CavP subunit (amCav a (AmCavPa) and amCav b (AmCavPb)), subunits Ca v al (amCavla (LVLC) amCav2b (CAV2) and amCav3a (CAV3)), and subunit Caya- ⁇ (amCavCc2ôl (Ca v a2-ol), amCavCc2ô2 (Ca v a2-a2) and amCavCc2 ⁇ 3 (Ca v a2- ⁇ 3)) of the calcium channels of Apis mellifera during development from D6 to D16.
  • AmCavPa amCav b
  • AmCavPb AmCavP
  • Figure 13A shows traces of rabbit calcium channel currents (rabbit CaV2.2), with rabbit Cay 2-ol proteins and Bee AmCavPa, expressed in the Xenopus oocyte and recorded in voltage-imposed 3 days post-injection during depolarization from -80 mV to +10 mV of 400 ms duration.
  • the two superimposed traces show the traces recorded in absence (control) and presence (Allet) of allethrin (20 ⁇ ).
  • FIG. 13B is a bar graph showing the average effect on the amplitude of rabbit calcium channel currents (rabbitCaY2.2) in the presence of CaV2.2 + Caya2-rabbit alone (H 2 0) or with CavP bee protein (variants a (AmCavPa) or b (AmCavPb)).
  • FIG. 13C represents the effect on the amplitude of the current in ⁇ (ordered) as a function of the time (in seconds) of the perfusion of allethrin in the extracellular medium on a Xenopus oocyte expressing a rabbit calcium channel ( rabbitCaV2.2) with rabbit CaVa2- ⁇ protein and bee CaVPa protein.
  • This example shows the role of the AmCavb subunit on inhibition by allethrin.
  • Figure 14 shows the functional properties of Am-CaVPa and Am-CaVpb subunits.
  • Figure 14 Left: represents the traces of the currents recorded from three different oocytes expressing CaV2.3 and CaVa2- ⁇ free rabbit channel (H20) or with Ca v P protein (A variants) (AmCa v Pa) or b (AmCa v pb)) during a depolarization of 400 ms from -80 mV to +10 or +20 mV (traces are superimposed).
  • a bar graph represents the averages of current amplitude peaks measured during depolarizations similar to those on the left side.
  • Figure 14 B shows the kinetics of inactivation, quantified in R400 (residual relative current after a depolarization of 400 ms at +10 mV), for calcium channels CaV2.3 and CaVa2-o rabbit without (H20) or with bee CavP protein (variant a (AmCavPa) or b (AmCavPb)).
  • FIG. 14B is the time average for the current peak in milliseconds (ms) for CaV2.3 and CaVa2- ⁇ rabbit calcium channels without (H20) or with Ca v P protein (variant a). (AmCavPa) or b (AmCavPb)).
  • Figure 14C shows the current-voltage (left) and voltage-dependent inactivation curves (isochronous at 2.5 sec, right) for CaV2.3 and CaVa2-o rabbit channels without (H20) or with protein Ca v p bee (variant has (AMCA v pa)).
  • the amplitude of the current is normalized to 1 with respect to the largest amplitude of the curve (relative current, Rel Current, ordinate), and the voltage is expressed in millivolts (mV).
  • Figure 15 shows the difference in the inactivation kinetics of CaV2.3 and CaVa2- ⁇ free rabbit calcium channels (H20) or with the CavP protein (bee variant (AmCavPa), or rat variant ( ⁇ or ⁇ 2).
  • FIG. 15 to the right represents a bar graph of the average inactivation kinetics of the current expressed in R400 (residual current after 400 ms) of calcium channel CaV2.3 and rabbit CaVa2- ⁇ without (H20) or with Ca v protein. bee (CavPa), rat CavP2a, or rat Cavpib.
  • FIG. 15B shows photographs of HeK-293 cells transfected with bee CavP protein (Am-CavPa) labeled with a Ct-Ab antibody (against the carboxy terminal portion of Am-CavPa) and a coupled rabbit secondary antibody. at alexa 488 (left image), labeled with Hoecht's dye (middle) and the merged image (right).
  • FIG. 15C is a bar graph of the effect on inactivation, expressed in R400, of the rabbit CaV2.3 channel in the presence of rat CavPa (Am-CavPa) or rat CavP2a, of the presence (+ ) or the absence (-) of 2Br-palmitate (injected 30-60 min before the recording in the oocytes).
  • 15 D represents curves of inactivation time constants (xinac) expressed in seconds and percentage of slow inactivation (xslow) relative to total inactivation as a function of voltage for the rabbit CaV2.3 channel in the presence of Ca v p bee (Am-CavPa) or rat CavP2a.
  • Figure 15E shows the channel stream traces recorded in oocytes expressing the rabbit CaV2.3 channel in the presence of the rat CavP (Am-CavPa, left) or CavP2a (right) rat. The depolarization phases used to calculate the probabilities of opening are shown at the beginning and at the end of the curves.
  • each record represents the average of 100 single-channel recordings for the rabbit CaV2.3 channel in the presence of the rat CavP (Am-CavPa, left) or rat CavP2a (right).
  • Figure 15 F shows a bar graph of the probability of mean channel opening in the early (E) or late (L) phase of depolarization recorded in oocytes expressing the rabbit CaV2.3 channel in the presence of CavP d bee (Am-CavPa, grayed) or CavP2a (in white) rat.
  • Figure 15 F is a straight line bar chart showing the mean millisecond constants of fast and slow opening (fast and slow tau tau) recorded in oocytes expressing CaV2.3 channel in the presence of Ca v p bee (Am-CavPa, dimmed) or Rat CavP2a (in white) at two different potentials (-20 mV and 0 mV).
  • FIG. 15 F is a straight line bar chart showing the mean millisecond constants of fast and slow opening (fast and slow tau tau) recorded in oocytes expressing CaV2.3 channel in the presence of Ca v p bee (Am-CavPa, dimmed) or Rat CavP2a (in white) at two different potentials (-20 mV and 0 mV).
  • 16A represents rod diagrams of the mean inactivation expressed in R400 of rabbit CaV2.3 channels expressed with rat CavP (Am-CavPa or Am-Cavpb) or rat CavP2a under control conditions (C ) or in the presence of genistein (G), staurosporine (S), H89 (H), Wortmannin (W), or LY294002 (L).
  • Figure 16 B shows the current trace recorded during a voltage ramp of -80 to + 80mV for 150 ms on a bee antennal neuron
  • medium traces of superimposed currents recorded from three bee neurons in culture after incubation in a control solution (C), or with an inhibitor of S / T kinases H89 (H), or a PDkinase inhibitor Wortmannin (W) during a depolarization of -80 to + 10mV of 100 ms duration
  • right diagram quantum knockdown assay R90 (residual current after 90 ms depolarization at +10 mV) after 30-60 min incubation of cultured neurons in a control solution (C), or supplemented with an inhibitor of S / T kinases H89 (H, 50 ⁇ ), or a PDkinase inhibitor Wortmannin (W, 10 ⁇ ).
  • Figure 16C left represents a trace of current recorded during a voltage ramp of -80 to + 80mV for 150ms from muscle cells of freshly dissociated bee meta-phosphate legs
  • medium current traces recorded from muscle cells of metastoracic legs after incubation in a control solution (C), or supplemented with an inhibitor of S / T kinases H89 (H, 50 ⁇ ), or a PDkinase inhibitor Wortmannin (W) , 10 ⁇ ) during a depolarization of -80 to + 10mV with a duration of 400ms
  • right rod plot representing mean inactivation quantified at R400 after incubation of muscle cells in a control solution (C), or supplemented with an inhibitor of S / T kinases H89 (H), or a PDkinase inhibitor Wortmannin (W) ).
  • Figure 17 shows the functional expression of AmCaV1 (A), AmCaV2 (B) with AmCaVa2- ⁇ 1 and AmCaVPc and AmCaV3 (C) in the Xenopus oocyte in voltage imposed.
  • A B, C, traces of currents in response to a depolarization are shown.
  • D current-voltage curves are shown.
  • Figure 18 shows the steady-state inactivation of AmCaV1 and AmCaV2 channels with AmCaVa2- ⁇ 1 and AmCaVPc and AmCaV3.
  • A shows examples of current traces recorded during these double tap protocols.
  • B shows the steady - state inactivation curves for these three channels (note the hyperpolarized inactivation of CaV3).
  • Figure 19 shows the functional expression of CaV2.3 + ⁇ 2 ⁇ 1 + AmCaV ⁇ , AmCaV b or AmCaV c
  • A Traces of current in response to a depolarization of -100 to +10 or +20 mV, superimposed, showing the effect on the kinetics of inactivation, and quantification of the effects of the coexpression of the AmCaV subunit a, b or c on the amplitude of the current.
  • B Quantification of the effects of AmCaV subunits a, b or c on the kinetics of inactivation (R400) and activation kinetics (peak time: T-t-P).
  • C Absence of effect of the AmCaV subunit on the expression of the AmCaV3 channel.
  • FIG. 20 represents the functional expression of the different AmCaVcc2- ⁇ 1, 2 or 3 subunits co-expressed with AmCaV2a and AmCaV cA: examples of traces of currents recorded during depolarizations of -100 mV to +10 mV with AmCaVcc2-ôl , AmCaVcc2- ⁇ 2 or AmCaVcc2- ⁇ .
  • B current-voltage curves obtained from oocytes expressing AmCaV2 + AmCaV c + AmCaVcc2- ⁇ 1, AmCaVcc2-ô2 or AmCaVcc2- ⁇ 3.
  • Example 1 Identification and Production of an Isolated Bee Calcium Channel The following protocols have been applied for the identification and production of an isolated bee calcium channel.
  • RNAs were also extracted from whole heads. The heads of about 20 to 30 bees were ground in a 4ml RNAwiz holder (Life Technologies SAS, Saint Aubin, France). The lysate was transferred to a sterile 14 ml tube (BD, NJ, USA). The volume was adjusted to 4ml with RNAwiz, vortexed for 1 minute and incubated for 5 minutes at room temperature, ie 20 ° C. One milliliter of chloroform was added to the lysate.
  • RNA samples were washed with 5 ml of a 75% ethanol solution and centrifuged at 5000 g for 10 minutes at 4 ° C. After removal of the supernatant, the pellet was allowed to dry for 5 minutes at room temperature before being resuspended in 50 to ⁇ of water. Concentration total RNAs were measured spectrophotometrically on a Biophotometer (Eppendorf France SAS, Le Pecq, France). The integrity of the RNA was verified by migrating an aliquot on an agarose gel, namely approximately 500ng of RNA in solution. The RNA solutions were then stored at -80 ° C for later use. 2. Synthesis of the first strand of cDNA.
  • First strand cDNA synthesis was performed using SuperScript II Reverse Transcriptase (Life Technologies, Saint Aubin, France).
  • reaction buffer (5X First Strand Buffer) and 2 ⁇ L ⁇ 100mM solution of dithiothreitol (DTT) supplied by the manufacturer with the enzyme, and RiboLock RNase inhibitor ( ⁇ (Fermentas France, Saint Rémy Lès Chevreuse, France).
  • DTT dithiothreitol
  • RiboLock RNase inhibitor ⁇ (Fermentas France, Saint Rémy Lès Chevreuse, France).
  • This mixture was incubated for 2 minutes at 37 ° C. then ⁇ of Reverse Transcriptase was added. The reaction was incubated for 50 minutes at 42 ° C and stopped by incubating for 15 minutes at 70 ° C. The reaction was cooled for 2 minutes on ice, ⁇ of RNase H (Fermentas France, Saint Rémy Lès Chevreuse, France) was added, and the reaction was incubated for 20 minutes at 37 ° C.
  • the 5 'end of the cDNA was obtained by RACE-PCR using 10 ⁇ of total RNA and the First Choice RLM-RACE Kit (Life Technologies, Saint Aubin, France) following the manufacturer's recommendations.
  • the cDNA solutions were stored at -20 ° C for later use.
  • PCR Chain Polymerization Reaction
  • amplification of the cDNA by Chain Polymerization Reaction was carried out according to the following method: Herculase II Fusion polymerase (Agilent Technologies France SAS, Les Ulis, France) was used to amplify cDNA fragments in 50 ⁇ reactions comprising: ⁇ d enzyme, 10 ⁇ L ⁇ of reaction buffer (5X Herculase II Reaction Buffer) supplied by the manufacturer, ⁇ of a solution of dNTP nucleotides at 10mM, ⁇ of each primer at ⁇ , 0 to 8% dimethylsulfoxide (DMSO, supplied with the enzyme by the manufacturer), water, and the DNA template consisting of either ⁇ cDNA from the Reverse Transcription reaction described above or 100ng of plasmid vector.
  • reaction buffer 5X Herculase II Reaction Buffer
  • DMSO dimethylsulfoxide
  • PCR reactions were performed using a PTC-150 MiniCycler (MJ Research Inc., MA, USA) equipped with a heated lid. The result of the amplification was analyzed by migrating an aliquot, namely about 5 ⁇ l of the PCR reaction on an agarose gel.
  • the remaining volume of the amplification reactions ie 45 l, was deposited on an agarose gel, the bands were excised from the gel and purified with the NucleoSpin Extract II kit (Macherey-Nagel EURL, Hoerd, France).
  • the purified fragments were treated with ⁇ of T4 polynucleotide kinase (Life Technologies, Saint Aubin, France) in a reaction volume of 50 ⁇ in the presence of: 10 ⁇ l of reaction buffer (5 ⁇ Forward Buffer) supplied by the manufacturer and 5 ⁇ l of a solution of ATP at 10 mM.
  • the phosphorylated fragments were inserted into the pBluescript-II SK cloning vector (Agilent Technologies France SAS, Les Ulis, France) opened with the restriction enzyme EcoRV (New England Biolabs France, Evry, France) and dephosphorylated by the Alkaline Phosphatase. CIF (New England Biolabs France, Evry, France), using T4 DNA ligase (New England Biolabs France, Evry, France), following the manufacturer's recommendations.
  • the recombinant vectors were sequenced on both strands by Eurofins MWG Operon (Ebersberg, Germany). The sequences were analyzed using the Vector NTI 5.0 software suite (InforMax, MD, USA).
  • Enzymatic digestion was performed following the manufacturer's recommendations (New England Biolabs France, Evry, France). Fragments from enzymatic digestion were separated on an agarose gel and the bands of interest were excised and purified with the NucleoSpin Extract II kit (Macherey-Nagel EURL, Hoerd, France) following the manufacturer's recommendations. The purified fragments were inserted into the cloning vectors using T4 DNA ligase (New England Biolabs France, Evry, France), following the manufacturer's recommendations. Construction of the cloning vector pBS-PL4
  • Oligonucleotides PL006 and PL007 were taken up to 100 ⁇ L, aliquoted at 100 ⁇ L and stored at -20 ° C. for later use.
  • a reaction mixture comprising 25 ⁇ ⁇ Loong oligonucleotide, 5 ⁇ reaction buffer (5X Forward Buffer) provided by the manufacturer, 2,5 ⁇ an ATP solution to lOmM, ⁇ of T4 Polynucleotide kinase (Life Technologies, Saint Aubin, France) and water was made, incubated 30 minutes at 37 ° C and then 30 minutes at 65 ° C.
  • a mixture comprising 5 ⁇ l of each of the phosphorylated oligonucleotides (PL006 and PL007) and 10 ⁇ l of a 5 mM Tris solution was made, placed in the PTC-150 MiniCycler thermocycler (MJ Research Inc, MA, USA). The mixture was heated for 3 minutes at 90 ° C and then the temperature was lowered from 1 ° C per minute to 30 ° C, to obtain a double-stranded fragment ("PL4 linker”), which was stored at - 20 ° C for later use.
  • PTC-150 MiniCycler thermocycler MJ Research Inc, MA, USA
  • the pBluescript-II SK vector was opened by the restriction enzymes SacI and KpnI as described above and purified on agarose gel using the NucleoSpin Extract II kit (Macherey-Nagel EURL, Hoerd, France), following the manufacturer's recommendations.
  • the PL4 linker was inserted into the SacI-KpnI open pBluescript-II SK vector using T4 DNA ligase (New England Biolabs France, Evry, France), 3 ⁇ l of "PL4 linker," 100 ng of vector, of reaction buffer (10X T4 DNA ligase Reaction Buffer) provided by the manufacturer and water to obtain a reaction volume of 20 ⁇ . The reaction was incubated for 5 hours at room temperature (20 ° C). A recombinant vector called pBS-PL4 was sequenced to verify the insertion of the PL4 linker.
  • Oligonucleotides PL10 and PLU were taken up to 40 ⁇ L, aliquoted at 100 ⁇ L and stored at -20 ° C. for later use.
  • a reaction mixture comprising 25 ⁇ ⁇ Loong oligonucleotide, 5 ⁇ reaction buffer (5X Forward Buffer) provided by the manufacturer, 2,5 ⁇ an ATP solution to lOmM, ⁇ of T4 Polynucleotide kinase (Life Technologies, Saint Aubin, France) and water was made, incubated 30 minutes at 37 ° C and then 30 minutes at 65 ° C.
  • a mixture comprising 5 ⁇ l of each of the phosphorylated oligonucleotides (PL10 and PLU) and 10 ⁇ L.
  • a 5mM Tris solution was made, placed in the PTC-150 MiniCycler thermal cycler (MJ Research Inc, MA, USA). The mixture was heated for 3 minutes at 90 ° C and then the temperature was lowered from 1 ° C per minute to 30 ° C, to obtain a double-stranded fragment ("PL6 linker”), which was stored at - 20 ° C for later use.
  • the pBluescript-II SK vector was opened by the NotI and KpnI restriction enzymes as described above and purified on agarose gel using the NucleoSpin Extract II kit (Macherey-Nagel EURL, Hoerd, France), following the manufacturer's recommendations.
  • the PL6 linker was inserted into the vector pBluescript-II SK open NotI-KpnI using the T4 DNA ligase (New England Biolabs France, Evry, France), 3 ⁇ l of "linker PL6", 100 ng of vector, of reaction buffer (10X T4 DNA ligase Reaction Buffer) provided by the manufacturer and water to obtain a reaction volume of 20 ⁇ . The reaction was incubated for 5 hours at room temperature (20 ° C). A recombinant vector called pBS-PL6 was sequenced to verify the insertion of the PL6 linker. 5. Construction of the cloning vector pBS-PL7.
  • Oligonucleotides PL12 and PL13 were taken up to 90 ⁇ L, aliquoted at 100 ⁇ L and stored at -20 ° C. for later use.
  • a reaction mixture of 25 ⁇ comprising 100 ng of oligonucleotides, 5 ⁇ of reaction buffer (5 ⁇ Forward Buffer) supplied by the manufacturer, 2.5 ⁇ of a solution of ATP at 10 mM, ⁇ ⁇ of T4 polynucleotide kinase ( Life Technologies, Saint Aubin, France) and water was made, incubated 30 minutes at 37 ° C and then 30 minutes at 65 ° C.
  • a mixture comprising 5 ⁇ of each of the phosphorylated oligonucleotides (PL12 and PL13) and ⁇ of a 5mM Tris solution was made, placed in a PTC-150 MiniCycler thermocycler (MJ Research Inc, MA, USA). The mixture was heated for 3 minutes at 90 ° C and then the temperature was lowered from 1 ° C per minute to 30 ° C, to obtain a double-stranded fragment ("PL7 linker”), which was stored at -20 ° C for later use.
  • PL7 linker double-stranded fragment
  • the pBluescript-II SK vector was opened by the NotI and KpnI restriction enzymes as described above and purified on agarose gel using the NucleoSpin Extract II kit (Macherey-Nagel EURL, Hoerd, France), following the manufacturer's recommendations.
  • the PL7 linker has been inserted into the vector pBluescript II- SK Open Notl-Kpnl using T4 DNA ligase (New England Biolabs France, Evry, France), 3 ⁇ of "PL7 linker," 100ng of vector, of reaction buffer (10X T4 DNA ligase Reaction Buffer) supplied by the manufacturer and water to obtain a reaction volume of 20 ⁇ 1.
  • reaction buffer (10X T4 DNA ligase Reaction Buffer) supplied by the manufacturer and water to obtain a reaction volume of 20 ⁇ 1.
  • the reaction was incubated for 5 hours at room temperature (20 ° C).
  • a recombinant vector called pBS-PL7 was sequenced to verify the insertion of the PL7 link
  • the amplified fragment, designated Cav1 (50Bl1) was cloned into pBluescript-II SK according to the protocol described above.
  • a PCR using primers amcavl-016S and amcavl-024AS was carried out, according to the protocol described above (without DMSO and 35 cycles: 1min at 94 ° C, 1min at 60 ° C, 1min at 72 ° C), and made it possible to identify the nucleotides 367 to 1122 of the sequence SEQ ID No. 9.
  • amplified fragment, named Cav1 (35) was cloned into pBluescript-II SK according to the protocol described above.
  • a PCR using primers amcav 1-007S and amcav 1-010AS was carried out according to the protocol described above (with 4% DMSO and 35 cycles: 30s at 95 ° C., 30s at 54 ° C., 3 min at 72 ° C. ), and identified nucleotides 511 to 3526 of the sequence SEQ ID NO: 9.
  • the amplified fragment, designated Cav1 (12) was cloned into pBluescript-II SK according to the protocol described above.
  • PCR using primers amcavl-OUS and amcavl-009AS was carried out according to the protocol described above (with 4% DMSO and 35 cycles: 30s at 95 ° C, 1min at 54 ° C, 3min at 72 ° C), and made it possible to identify nucleotides 3085 to 5143 of the sequence SEQ ID No. 9.
  • the amplified fragment, designated Cavl (II) was cloned into pBluescript-II SK according to the protocol described above.
  • PCR using primers amcav 1-003S and amcav 1-004AS was performed according to the protocol described above.
  • the amplified fragment, named Cav1 (23) was cloned into pBluescript-II SK according to the protocol described above.
  • Cav1 (42A) and Cav1 (42B) fragments were obtained according to the protocol described above (without DMSO and 30 cycles: 30s at 92 ° C, 30s at 56 ° C, 1 min at 72 ° C), using matrix 100ng of plasmid respectively containing the fragment Cav1 (50Bl1) and Cav1 (12). Cav1 (42A) and Cav1 (42B) fragments were purified on agarose gel as described above.
  • the Cav1 fragment (42) was obtained by carrying out a PCR according to the protocol described above (without DMSO, and 25 cycles: 1 min at 94 ° C., 1 min at 56 ° C., 90 sec at 72 ° C.), 3 ⁇ l each.
  • Cav1 (42A) and Cav1 (42B) fragments and primers amcavl-029S and amcavl-019AS The Cav1 fragment (42) was cloned into pBluescript-II SK according to the protocol described above. PCR using primers amcavl-008S and amcavl-030AS (located in the 3 'non-coding end) was carried out according to the protocol described above (without DMSO and 30 cycles: 30s at 92 ° C., 30s at 56 ° C.).
  • the Cav1 fragment (43) resulting from the enzymatic digestion of the Cav1 fragment (43) inserted into the vector pBluescript-II SK was subcloned into the vector pBS-PL7 using the restriction enzymes Agel (position 5258 in SEQ ID No. 9) and KpnI according to the protocol described above.
  • a Cav1 fragment (5a) from the enzymatic digestion of the Cav1 (5) fragment inserted into the pBluescript-II SK vector was subcloned into the pBluescript-II KS vector (Agilent Technologies) using Xbal restriction enzymes (position 2750). in SEQ ID NO: 9) and XhoI (position 3758 in SEQ ID NO: 9) according to the protocol described above.
  • the Cav1 fragment (42) resulting from the enzymatic digestion of the Cav1 fragment (42) inserted into the pBluescript-II SK vector was subcloned into the vector pBS-PL7 using the NotI and BamHI restriction enzymes (position 911 in SEQ ID No. 9) according to the protocol described above.
  • a fragment resulting from the enzymatic digestion of the Cav1 (ll) fragment inserted into the pBluescript-II SK vector was subcloned into the pBluescript-II SK vector containing the Cav1 fragment (6) using the AatII restriction enzymes (position 4803 in FIG. SEQ ID No. 9) and NotI according to the protocol described above to generate the fragment Cav1 (1 lb + 6).
  • a fragment from the enzymatic digestion of the Cav1 (1 lb + 6) fragment inserted into the pBluescript-II SK vector was subcloned into the pBS-PL7 vector containing the Cav1 fragment (43) using the XhoI restriction enzymes (position 3758 in SEQ ID No. 9) and Agel (position 5258 in SEQ ID No. 9) according to the protocol described above to generate the Cav1 fragment (1 lb + 6 + 43).
  • a fragment from the enzymatic digestion of the Cav1 fragment (1 lb + 6 + 43) inserted into the pBS-PL7 vector was subcloned into the pBluescript-II KS vector containing the Cav (5a) fragment using the Xho restriction enzymes.
  • a fragment from the enzymatic digestion of the Cav1 fragment (5 + 11 + 6 + 43) inserted into the vector pBluescript-II KS was subcloned into the vector pBS-PL7 containing the Cav1 fragment (42 + 12) using the enzymes Xbal restriction (position 2750 in SEQ ID No. 9) and KpnI according to the protocol described above to generate the amCavla fragment.
  • the amplified fragment designated Cav2 (22Jj) was cloned into the vector pBluescript-II SK according to protocol described above.
  • RACE PCR using the primers 5 'Primer and OUTER amCav2-021AS era for the PCR according to the protocol described above (with 4% DMSO and 40 cycles: 30s at 94 ° C, 30s at 56 ° C, 2 minutes 72 ° C), and the primers amcav2-025S and amcav2-022AS for the second PCR, according to the protocol described above (without DMSO and 40 cycles: 30s at 94 ° C, 30s at 56 ° C, 2mn at 72 ° C) was carried out, and made it possible to identify nucleotides 1 to 342 of the sequence SEQ ID No.
  • the fragment obtained, called Cav2 (II) was cloned into the pBluescript-II SK vector according to the protocol described above.
  • PCR using the primers amcav2-024S and amcav2-023AS was carried out according to the protocol described above (without DMSO and 40 cycles: 1 min at 94 ° C., 1 min at 56 ° C., 1 min at 72 ° C.), and identified nucleotides 1475 to 2110 of the sequence SEQ ID NO: 10.
  • the amplified fragment, called Cav2 (28) was cloned into the vector pBluescript-II SK according to the protocol described above.
  • PCR using primers amcav2-003S and amcav2-006AS were carried out according to the protocol described above (with 4% DMSO and 35 cycles: 30s at 95 ° C., 30s at 56 ° C., 4 minutes at 72 ° C.), and allowed to identify nucleotides 1689 to 5460 of SEQ ID NO: 10, including exons 21a, 25 and 29 but not exons 18 and 26.
  • the amplified fragment, designated Cav2 (18) was cloned into the vector pBluescript- II SK according to the protocol described above.
  • overlap PCR An overlapping PCR reaction (“overlap PCR") was performed to obtain the Cav2 fragment (54) using amplified Cav2 (54A) and Cav2 (29B) PCR fragments using primers amcav2-031S (located in the 5 'non-coding end) and amcav2-028AS, and amcav2-007S and amcav2-016AS to introduce a 5' NotI restriction site of the Start codon of SEQ ID NO: 10.
  • the Cav2 (54A) and Cav2 (29B) fragments were obtained according to the protocol described above (with 4% DMSO and 25 cycles: 20s at 98 ° C., 20s at 56 ° C., 1 minute at 68 ° C.), using as matrix 100 ng of plasmid respectively containing the fragment Cav2 (36a) and Cav2 (1-1).
  • the Cav2 (54A) and Cav2 (29B) fragments were purified on an agarose gel as described above.
  • the Cav2 fragment (54) was obtained by carrying out a PCR according to the protocol described above (without DMSO and 25 cycles 20s at 68 ° C., 20s at 56 ° C., 1 min at 68 ° C.), 3 ⁇ l of each of purified Cav2 (54a) and Cav2 (29B) fragments and the primers amcav2-031S and amcav2-016AS.
  • primers amcav2-013S and amcav2-026AS (located in the 3 'non-coding end) was carried out according to the protocol described above (without DMSO and 25 cycles: 1 min at 94 ° C., 1 min at 56 ° C., 1 min. at 72 ° C), using as template 100ng of plasmid containing the Cav2 fragment (21), to introduce a KpnI restriction site 3 'of the stop codon of SEQ ID No. 10.
  • the sequence of the entire amCav2b subunit was obtained by joining the different PCR fragments using restriction sites present in the fragments. overlapping in the vector pBS-PL6.
  • a Cav2 fragment (18b) resulting from the enzymatic digestion of the Cav2 (18) fragment inserted into the pBluescript-II SK vector was subcloned into the vector pBS-PL6 using the BamHI restriction enzymes (position 4177 in SEQ ID No. 10) and XhoI (position 4446 in SEQ ID No. 10) using the protocol described above.
  • a fragment derived from the enzymatic digestion of the Cav2 (30) fragment inserted into the pBluescript-II SK vector was subcloned into the vector pBS-PL6 containing the Cav2 fragment (18b) using the XhoI restriction enzymes (position 4646 in SEQ ID No. 10) and KpnI according to the protocol described above to generate the Cav2 fragment (18b + 30).
  • a Cav2 fragment (28) resulting from the enzymatic digestion of the Cav2 fragment (28) inserted in the vector pBluescript-II SK was subcloned into the vector pBS-PL6 using the restriction enzymes Csp45I (position 1566 in SEQ ID No. 10) and SalI (position 2012 in SEQ ID No.
  • a fragment resulting from the enzymatic digestion of the Cav2 fragment (54) inserted into the pBluescript-II SK vector was subcloned into the pBS-PL6 vector containing the Cav2 fragment (1.1 + 28) using the NotI and MluI restriction enzymes ( position 442 in SEQ ID No. 10) according to the protocol described above to generate the Cav2 fragment (54 + 1, 1 + 28).
  • a Cav2 fragment (18a) from the enzymatic digestion of the Cav2 (18) fragment inserted into the pBluescript-II SK vector was subcloned into the vector pBS-PL6 containing the Cav2 fragment (54 + 1, 1 + 28) using the SalI restriction enzymes (position 2012 in SEQ ID No.
  • a fragment from the enzymatic digestion of the Cav2 fragment (54 + 1, 1 + 28 + 18a) inserted into the pBS-PL6 vector was subcloned into the vector pBS-PL6 containing the Cav2 fragment (18b + 30) using the restriction enzymes NotI and BamHI (position 4177 in SEQ ID No. 10) according to the protocol described above to generate the amCav2b fragment. 10. Amplification of the nucleotide sequence of variants of the amCav2 subunit.
  • PCR using primers amcav2-003S and amcav2-004AS was carried out according to the protocol described above (with 4% DMSO and 30 cycles: 30s at 95 ° C, 30s at 58 ° C, 2mn at 72 ° C), and identified a Cav2 (2) fragment located between nucleotides 1689 and 3778 of SEQ ID NO: 10, including exons 18 and 21a ( Figure 24/4).
  • the amplified fragment was cloned into the pBluescript-II SK vector according to the protocol described above.
  • PCR using the primers amcav2-012S and amcav2-006AS was carried out according to the protocol described above (with 4% DMSO and 35 cycles: 30s at 95 ° C., 1 min at 54 ° C., 3 minutes at 72 ° C.), and identified a fragment designated Cav2 (3.1) located between nucleotides 3593 and 5460 of SEQ ID NO: 10, including exons 21b, 25, 26 and 29.
  • the amplified fragment was cloned into the vector pBluescript-II SK according to the protocol described above.
  • PCR using the primers amcav2-012S and amcav2-006AS was carried out according to the protocol described above (with 4% DMSO and 35 cycles: 30s at 95 ° C., 1 min at 54 ° C., 3 minutes at 72 ° C.), and identified a fragment called Cav2 (3.2) located between nucleotides 3593 and 5460 of SEQ ID NO: 10, including exons 21a and 25, but not exons 26 and 29.
  • the amplified fragment was cloned into the pBluescript-II SK vector according to the protocol described above.
  • PCR using the primers amcav2-012S and amcav2-006AS was carried out according to the protocol described above (with 4% DMSO and 35 cycles: 30s at 95 ° C., 1 min at 54 ° C., 3 minutes at 72 ° C.), and identified a fragment called Cav2 (3.3) located between nucleotides 3593 and 5460 of SEQ ID NO: 10, including exons 21a and 26, but not exons 25 and 29.
  • Cav2 3.3
  • PCR using the primers amcav2-013S and amcav2-015AS (located in the 3 'non-coding end) was carried out according to the protocol described above (with 4% DMSO and 35 cycles: 30s at 95 ° C., 30s at 30 ° C.). 60 ° C, 2 min at 72 ° C), and identified a fragment, designated Cav2 (21) located between nucleotides 4371 and 5460 of SEQ ID NO: 10, including exons 26 and 29, but not Exon 25.
  • the amplified fragment was cloned into the vector pBluescript-II SK according to the protocol described above.
  • Amplification of the nucleotide sequence of the amCav3a subunit RACE PCR using the primers 5 'OUTER Primer and amcav3-018AS for the 1st PCR, according to the protocol described above (with 4% DMSO and 40 cycles: 1 min at 94 ° C., 1 min at 55 ° C., 1 min at 72 ° C.). ° C), and primers 5 'INNER Primer and amcav3-019AS for the second PCR according to the protocol described above (with 4% DMSO and 40 cycles: 1 min at 94 ° C, 1 min at 55 ° C, 1 min at 72 ° C).
  • the amplified fragment, called Cav3 (56) was cloned into the pBLuescript-II SK vector according to the protocol described above.
  • PCR using the primers amcav3-001S and amcav3-020AS was carried out according to the protocol described above (without DMSO and 35 cycles: 1 min at 94 ° C., 1 min at 60 ° C., 2 min at 72 ° C.), and identified a fragment located between nucleotides 606 and 3302 of SEQ ID NO: 11, including exon 17b.
  • the amplified fragment, called Cav3 (55) was cloned into the pBluescript-II SK vector according to the protocol described above.
  • PCR using primers amcav3-003S and amcav3-004AS was performed according to the protocol described above (without DMSO and 35 cycles: 1 min at 94 ° C, 1 min at 60 ° C, 2 min at 72 ° C), and identified a fragment located between nucleotides 3112 and 5698 of SEQ ID NO: 11, including exon 17b ( Figure 35/5).
  • the amplified fragment, named Cav3 (32) was cloned into the pBluescript-II SK vector according to the protocol described above.
  • PCR using the primers amcav3-005S and amcav3-006AS (located in the 3 'non-coding end) was carried out according to the protocol described above (without DMSO and 35 cycles: 1 min at 94 ° C., 1 min at 60 ° C.). C., 2 min at 72 ° C.), and made it possible to identify nucleotides 5591 to 7701 of the sequence SEQ ID No. 11.
  • the amplified fragment, called Cav3 (33) was cloned into the pBluescript-II SK vector according to the protocol described above. 12. Construction of the nucleotide sequence of the amCav3a subunit
  • the sequence of the entire amCav3a subunit was obtained by joining the different PCR fragments using restriction sites present in the overlapping fragments in the pBluescript-II SK vector (Agilent Technologies France SAS, Les Ulis, France). PCR using primers amcav3-011S and amcav3-004AS according to the protocol described above (without DMSO and 35 cycles: 1 min at 94 ° C, 1 min at 60 ° C, 2 min at 72 ° C) was performed. The amplified fragment, called Cav3 (57), was cloned into the vector pBluescript-II SK according to the protocol described above.
  • PCR using primers amcav3-013S and amcav3-022AS (located in the 3 'non-coding end) was carried out according to the protocol described above (without DMSO and 25 cycles: 1 min at 94 ° C., 1 min at 56 ° C.). 1mnn at 72 ° C) using as template 100ng of plasmid containing the Cav3 fragment (33) to introduce an AflII restriction site and a KpnI restriction site 3 'of the Stop codon of SEQ ID No. 11.
  • the amplified fragment, designated Cav3 (58) was cloned into the vector pBluescript-II-SK according to the protocol described above.
  • a Cav3 fragment (58a) resulting from the enzymatic digestion of the Cav3 fragment (58) inserted into the pBluescript-II SK vector was subcloned into the pBluescript-II SK vector using the SalI restriction enzymes (position 7348 in SEQ ID No. 11) and KpnI following the protocol described above.
  • a fragment from the enzymatic digestion of the Cav3 (33) fragment inserted into the pBluescript-II SK vector was subcloned into the vector pBluescript-II SK containing the Cav3 fragment (58a) using the restriction enzymes HindIII (position 5669 in SEQ ID No. 11) and SalI (position 7348 in SEQ ID No.
  • a fragment from the enzymatic digestion of the Cav3 fragment (59) inserted into the pBluescript-II SK vector was subcloned into the pBluescript-II SK vector containing the Cav3 fragment (60) using the NotI and EcoRI restriction enzymes (position 741 in SEQ ID No. 11) according to the protocol described above to generate the Cav3 fragment (59 + 60).
  • a fragment from the enzymatic digestion of the Cav3 fragment (56) inserted into the pBluescript-II SK vector was subcloned into the vector pBluescript-II SK containing the Cav3 fragment (55) using the Espl restriction enzymes (position 2789 in SEQ ID No.
  • a Cav3 fragment (57) resulting from the enzymatic digestion of the Cav3 fragment (57) inserted in the pBluescript-II SK vector was subcloned into the vector pBS-PL4 using the XbaI restriction enzymes (position 4267 in SEQ ID No. 11) and HindIII (position 5669 in SEQ ID No. 11) according to the protocol described above.
  • a fragment resulting from the enzymatic digestion of the Cav3 fragment (57) inserted into the vector pBS-PL4 was subcloned into the pBluescript-II SK vector containing the Cav3 fragment (59 + 60) using the restriction enzymes EcoRI and HindIII ( position 5669 in SEQ ID No.
  • PCR using the amb2-003S and amb2-004AS primers was carried out according to the protocol described above (with 4% DMSO and 30 cycles: 30s at 98 ° C., 30s at 50 ° C., 2 minutes at 72 ° C.), and identified nucleotides 1 to 1635 of SEQ ID NO: 12, including exons 1a, 4b and 9.
  • amCav a The fragment amplified in the previous point, called amCav a, was cloned into pBluescript-II SK according to the protocol described above.
  • PCR using primers amb2-006S (located in the 5 'non-coding end) and amb2-007AS (located in the 3' non-coding end) was carried out according to the protocol described above (with 4% DMSO and 35 cycles: 30 sec at 95 ° C, 30s at 60 ° C, 2 min at 72 ° C), and identified nucleotides 1 to 1413 of SEQ ID No. 13, including exons 1b and 4b but not exon 9.
  • amCav subunit b The fragment amplified in the previous point, called amCav b, was cloned into pBluescript-II SK according to the protocol described above.
  • PCR using primers amb2-008S (located in the 5 'non-coding end) and amb2-007AS (located in the 3' non-coding end) was carried out according to the protocol described above (with 4% DMSO and 35 cycles: 30 sec at 95 ° C, 30 sec at 60 ° C, 2 min at 72 ° C), and identified nucleotides 1 through 1632 of SEQ ID NO: 14, including exons la and 4a but not Exon 9.
  • amCav c The fragment amplified in the previous point, called amCav c, was cloned into the vector pBluescript-II SK according to the protocol described above.
  • a PCR using primers amcava2d-012S (located in the 5 'non-coding end) and amcava2d-013AS was carried out according to the protocol described above (without DMSO and 35 cycles: 1 min at 94 ° C., 1 min at 60 ° C. C, 2 min at 72 ° C) and identified nucleotides 1 to 1314 of SEQ ID NO: 15.
  • PCR using primers amcava2d-014S and amcava2d-015AS was carried out according to the protocol described above (without DMSO and 35 cycles: 1 min at 94 ° C., 1 min at 60 ° C., 2 min at 72 ° C.), and identified nucleotides 1264 to 2344 of SEQ ID NO: 15.
  • a PCR using the primers amcava2d-016S and amcava2d-017AS (located in the 3 'non-coding end) was carried out according to the protocol described above (without DMSO and 35 cycles: 1 min at 94 ° C., 1 min at 60 ° C. C, 2 min at 72 ° C), and identified nucleotides 2322 to 3615 of SEQ ID NO: 15. 20. Construction of the nucleotide sequence of the amCavCc2 ⁇ 1 subunit.
  • PCR using primers amcava2d-012S and amcava2d-017AS was performed according to the protocol described above (without DMSO and 30 cycles: 1 min at 94 ° C, 1 min at 60 ° C, 3 min at 72 ° C).
  • the amplified fragment, called amCavCc2 ⁇ 1 was cloned into the vector pBluescript-II SK according to the protocol described above.
  • PCR using primers amcava2d-018S (located in the 5 'non-coding end) and amcava2d-019AS (located in the 3' non-coding end) was carried out according to the protocol described above (without DMSO and 32 cycles). 1 min at 94 ° C, 1 min at 60 ° C, 3 min at 72 ° C), and identified nucleotides 1 to 3597 of SEQ ID NO: 16.
  • amCav The fragment amplified in the previous point, called amCav (x2O2), was cloned into the vector pBluescript-II SK according to the protocol described above.
  • Amplification of the nucleotide sequence of the amCav subunit (x2 ⁇ 3) A PCR using the primers amcava2d-010S (located in the 5 'non-coding end) and amcava2d-007AS was carried out according to the protocol described above ( with 4% DMSO and 35 cycles: 30s at 95 ° C, 30s at 60 ° C, 2mn at 72 ° C), and identified nucleotides 1-864 of SEQ ID NO: 17.
  • Cava2d The amplified fragment, called Cava2d (25), was cloned into the vector pBluescript-II SK according to the protocol described above.
  • a PCR using primers amcava2d-005S and amcava2d-011AS (located in the coding 3 'end) was carried out according to the protocol described above (with 4% DMSO and 35 cycles: 30s at 95 ° C., 30s at 60 ° C.). ° C, 2min to 72 ° C), and to identify nucleotides 2999 to 3582 of SEQ ID NO: 17.
  • the amplified fragment, called Cava2d (26) was cloned into the vector pBluescript-II SK according to the protocol described above.
  • the sequence of the entire amCava2d3 subunit was obtained by joining the different PCR fragments using restriction sites present in the overlapping fragments.
  • An overlapping PCR reaction (“overlap PCR") was performed to obtain the Cava2d fragment (27) using amplified Cava2d (27A) and Cava2d (27B) PCR fragments using primers amcava2d-006S and amcava2d-002AS, respectively. and amcava2d-003S and amcava2d-009AS.
  • the fragments Cava2d (27A) and Cava2d (27B) were obtained according to the protocol described above (with 4% DMSO and 25 cycles: 30s at 92 ° C., 30s at 55 ° C., 30s at 72 ° C.), using as matrix 100ng of plasmid respectively containing the fragment Cava2d (7) and Cava2d (8).
  • the Cava2d (27A) and Cava2d (27B) fragments were purified on agarose gel as described above.
  • the Cava2d fragment (27) was obtained by carrying out a PCR according to the protocol described above (with 4% DMSO and 25 cycles: 30s at 92 ° C., 30s at 55 ° C., 45s at 72 ° C.).
  • the Cava2d fragment (27) was cloned into the pBluescript-II SK vector according to the protocol described above.
  • a fragment from the enzymatic digestion of the Cava2d fragment (25) inserted into the pBluescript-II SK vector was subcloned into the pBluescript-II SK vector containing the Cava2d fragment (7) using HindIII and MluI restriction enzymes (position 798 in SEQ ID No. 17) to generate the Cava2d fragment (25 + 7) according to the protocol described above.
  • a fragment from the enzymatic digestion of the Cava2d fragment (26) inserted into the pBluescript-II SK vector was subcloned into the pBluescript-II SK vector containing the Cava2a fragment (8) using the restriction enzymes Agel (position 3287 in SEQ ID No. 17) and NotI according to the protocol described above, to generate the Cava2d fragment (8 + 26).
  • a fragment from the enzymatic digestion of the Cava2d fragment (27) inserted into the pBluescript-II SK vector was subcloned into the pBluescript-II SK vector containing the Cava2d fragment (8 + 26) using the HindIII and AatII restriction enzymes ( position 1834 in SEQ ID No.
  • Oligonucleotides / primers were supplied in freeze-dried form by Eurofins MWG Operon (Ebersberg, Germany). The primers were resuspended at ⁇ in water, aliquoted at ⁇ and stored at -20 ° C for later use.
  • the entire calcium channel sequences namely three Caval subunits (amCavla, amCav2b and amCav3a) and one CavP subunit (three variants identified and cloned amCav a, amCav b and amCav c) and three subunits Cava2- ⁇ (amCavCc2 ⁇ 1, amCav (x2ô2 and amCavCc2ô3) bee, were isolated for the first time and sequenced.
  • FIG. 12 The photographs of the agarose gels obtained are shown in FIG. 12.
  • the three Caval subunits of the calcium channel (amCavla (CaV1), amCav2b (CaV2) and amCav3a (CaV3)) and two of the variants of the CavP subunit (AmCaVpb and AmCaVPa) and the Cava2 ⁇ subunits (amCavCc2 ⁇ 1 (Cava2- ⁇ 1), amCav (x2ô2 (Cava2-ô2) and amCav (x2 ⁇ 3 (Cava2- ⁇ 3)) isolated, are expressed during the development of the bee.
  • EXAMPLE 2 Measurement of the Regulation of the Activity of the Calcium Channel After Expression in Cell Lines
  • the Cava calcium channel and the isolated CavP and Cava2- ⁇ proteins were expressed in Hek TSA201 cells, derived from HEKs, which are human embryonic kidney cells. They were stably transfected with the large SV40 virus T antigen. This large T antigen is produced by the cell. During the transient plasmid transfection containing the replication origin of the SV40 virus, the T antigen will come to interact with the replication site and will thus amplify the replication of the plasmid causing massive production of the protein of interest. The preparation of the culture dishes was carried out as follows. Petri dishes of 35mm in diameter used for culture were covered before transfection.
  • polyomithine P3655, Sigma
  • P3655 sterile water or PBS.
  • the solution is filtered on a filter with pores with a diameter of 0.22 ⁇ m, aliquoted with 1 ml / in 15 ml tubes before storage at -20.degree.
  • the polyornithine was used diluted 1:10 6 (either 15 ⁇ g / ml) in PBS three days before cultivation (J-3).
  • One ml of the solution was placed in each 35mm petri dish and allowed to dry at 37 ° C. On the day of culture (J), all the 35mm dishes are rinsed 3 times with PBS, before transplanting the cells.
  • the culture medium used in this example is a complete medium that was prepared fresh before each experiment as follows: Serum Decompletion: 1 ⁇ 2 hour at 56 ° C. DMEM HG (GIBCO ref 41965); 10% FCS (GIBCO ref 10106).
  • DMEM HG subculturing of the cells was carried out with the following solutions: 5 ml of medium (DMEM HG) were placed in a 15 ml centrifuge tube (tube 1), 2 ml of trypsin or ⁇ of trypsin (GIBCO ref 25090) and 1.9 ml of PBS (without Ca, without Mg), 15 ml of PBS, 10 ml of complete medium (for a single subculture, 900 ⁇ l of DMEM medium HG: allows the counting of a diluted 10 ⁇ solution) . All of these solutions were put at 37 ° C for a few minutes.
  • the culture medium was aspirated, 4 ml of PBS was added, then mixed to rinse the bottom of the box, and re-aspirated. 2 ml of diluted trypsin was added directly to the cells and without precaution.
  • the culture dishes were incubated under the hood for a few seconds. The boxes were then tapped with the hand to finish off the still attached cells. 2 ml of PBS were then added directly to the cells.
  • the 4 ml of cell suspension was then recovered and placed in the tube (1) containing 5 ml of basal medium. A second rinsing of the culture dishes is carried out with 3 ml of PBS in order to collect the residual cells. This suspension is added to the tube (1).
  • the tube was then centrifuged for 3 min at 1500 rpm at room temperature, i.e. 20 ° C. The supernatant was removed leaving 200 / 300 ⁇ l of residual medium above the cell pellet. The cells were then resuspended by shaking the bottom of the tube with the fingers. Finally 2 ml of fresh medium were added to finish the resuspension of the cells using a sterile Pasteur pipette lapped at 50%.
  • the DNA mixtures used were made from 1 ⁇ / ⁇ l DNA stock solutions containing the DNA coding for one of the different calcium channel subunits, inserted into a eukaryotic expression vector with or without an N label. or C-terminal obtained in Example 1 above.
  • the expression vectors encoding the CavP and Cava2- ⁇ proteins were mixed in a 1: 1: 1 ratio with the channel.
  • the vectors containing the pIRES sequences and two genes can also be prepared by molecular biology for this type of transfection.
  • either one of the subunits is labeled with a GFP fluorescent protein, or a vector encoding such a fluorescent protein is cotransfected with the channel subunits (in a 10: 1: 1 ratio : 1 for GFP: Cava: CavP and Cava2-ô).
  • the cells expressing the channel are then visualized thanks to a microscope equipped with fluorescence
  • the measurement of the activity of the calcium channels was carried out, in this example, with an electrophysiological method and / or by calcium imaging. at. Electrophysiological method.
  • This box was transferred to the stage of an inverted microscope (Leica DMIRB type or equivalent) equipped with an epifluorescence system, and a perfusion system of the petri dish.
  • the recording of the channel activity was then made in Whole cell recording using an Axopatch 200 patch-clamp amplifier or equivalent, connected to a computer by a Digidata 1200 type interface (Axon Ist, or equivalent).
  • the potential jumps applied to the cell as the currents were recorded using the software pClamp (ver 7, Axon Inst, or equivalent).
  • the recording pipettes have generally been drawn from capillary glass (Clark Electromedical Instrument GC150T10 or equivalent) by a horizontal programmable puller (type P-93 Sutter Inst or equivalent) to give pipettes which have a resistance.
  • the activity of the channel was recorded during potential jumps from a resting potential of -80 mV to a potential between -40 and +60 mV (generally at +10 mV, maximum of the current curve -voltage).
  • the substance effect on the calcium channel is then evaluated by recording changes in amplitude, kinetics, or voltage-dependent voltage activation during the infusion of the substance at different concentrations.
  • the measurement of the activity of the channel can also be recorded in unitary channel with other methods already described for example in "cell-attached", “inside-out”, “outside-out” patch clamp as described in "Electrophysiology Molecular "2001 Ed. M. Joffre, Science Teaching Collection, Herman [13] or” Technical Microelectrode, The Plymouth Workshop Handbook "1988, NB Ed. Standen, PTA Gray and MJ Whitaker, The Company of Biologists Limited or” Single Channel recording 1983 Ed. B. Sackmann and E Neher. Plenum Press, New York [14].
  • the transfected cells were subcultured at low density on coverlips coated as before and placed in several 35 mm petri dishes. On day D, these dishes were rinsed twice with PBS. They are then incubated in the presence of a fluorescent calcium indicator passing through the membranes, often in an AM version (that is to say, acetoxymethyl ester) radiometric or otherwise, such as for example fluo-3; fura-2, at a concentration of 5 ⁇ g Fura2-AM / ml PBS + 1mg / ml BSA fatty acid free) between 30min to 2h.
  • AM version that is to say, acetoxymethyl ester
  • the box is transferred to the stage of an inverted microscope (Leica DMIRB type or equivalent) equipped with an epifluorescence system, and a perfusion system of the petri dish.
  • the channel activity is then recorded using a CCD or other microscope-mounted camera or one or two photomultipliers.
  • Channel activity is given by measuring changes in intracellular calcium concentration (measured as a fluorescence change, or a fluorescence variation ratio) after depolarization of the cell obtained either by infusion of a KC1 concentration from 20 to 60mM outside, either by activation of light-sensitive depolarizing channel (channelrhodopsin-2) and activated by a blue flash (488 nm, genetic opto).
  • the positive control for the measurement of the calcium concentration is carried out by the infusion of 20 ⁇ ionomycin (calcium ionophore) successively with 10 mM EGTA or 20 mM Ca 2+ to obtain the ratio, minimum (Rmin) and maximum (Rmax).
  • S f and S b are the emission intensities at 380 nm for Free Calcium and Fura2-bound Calcium, respectively.
  • This set of operations is realized by various types of software, including Tillvision (dTill photonics GmbH), or equivalent, in imaging or directly with photomultipliers (we can also use Clampex ver 7)
  • the analysis of the effect of substance on this activity of the calcium channel is obtained by comparing the activity of the channel, measured under these conditions with or without the substance in the medium. A decrease or an alteration of the activity of the channel in the presence of the test substance showing that it affects the operation of the channel and is therefore potentially toxic.
  • Example 3 Method for Analyzing the Toxicity of a Molecule
  • the analysis of the toxicity of a molecule was carried out by studying the calcium currents as a function of said molecule.
  • RNAs Preparation of the RNAs
  • a reaction volume of 50 ⁇ l containing 10 ⁇ g of plasmid, 3 ⁇ l of the appropriate enzyme (New England Biolabs France, Evry, France), 5 ⁇ l of reaction buffer provided by the manufacturer and water was incubated for 3 hours at 37 ° C.
  • the linearization of the plasmid was verified by migrating an aliquot of the reaction, namely 3 ⁇ l, on an agarose gel
  • the linearized plasmid was purified with the kit NucleoSpin Extract II (Macherey-Nagel EURL, Hoerd, France) according to the manufacturer's recommendations except that the elution of the linearized plasmid was carried out in 30 ⁇ l of water.
  • CDNA was determined by spectrophotometry on a biophotometer (Eppendorf France SAS, Le Pecq, France). In vitro transcription was performed using the T3 or T7 mMessage mMachine kit (Life Technologies, Saint Aubin, France) following the manufacturer's recommendations.
  • RNA was purified using the RNeasy Mini Kit Kit (Qiagen SAS, Courtaboeuf, France) following the manufacturer's recommendations, except that elution of the purified RNA was performed in 30 ⁇ l of water. The RNA was determined by spectrophotometry, the concentration reduced to 1 / / 1 with water. The integrity of the RNA was verified by migrating an aliquot, namely 500ng of RNA, onto an agarose gel. The RNA was then stored at -20 ° C for later use.
  • CDNA vector, restriction enzyme and polymerase used for in vitro transcription.
  • a female Xenopus laevis obtained by the CRBM laboratory, UMR 5237 from the CNRS in adjoin, was immersed in a jar containing water added with an aqueous solution of MS222 (ethylaminobenzoate methanesulfonate, ref A5040, Sigma) at 0, 2% at 4 ° C for 15 to 20 minutes.
  • MS222 ethylaminobenzoate methanesulfonate
  • ref A5040 ethylaminobenzoate methanesulfonate
  • the ovarian sacs containing the oocytes were removed using round-shaped curved pliers, isolated and placed in a Petri dish filled with OR2. The muscle, then the epidermis were then sewn, and the Xenopus returned to his aquarium for awakening. The ovarian sacs were then dilacerated with two forceps in the Petri dish, then transferred to a 50ml Falcon tube and rinsed 3 times with 30 ml of OR2 each time.
  • the Falcon tube was filled with a solution containing 30 ml of OR2 and 30 mg of collagenase 1A (ref C9891 Sigma) in order to dissociate the oocytes from the follicular cells. This tube was then placed under orbital agitation (1 revolution / sec.) For 2 hours. After 2h (or as soon as the follicular cells were dissociated from the oocytes, visualizable by inspection under a 30x binocular loupe), the oocytes were rinsed 2 to 3 times with an OR2 solution (30ml each time), then twice with a ND96S solution. The isolated oocytes are then transferred into this solution in a Petri dish of 100 mm. From this box, lots of 30-40 oocytes are selected and then isolated in 30mm Petri dishes for injection. Table 3: composition of OR2 and ND96S solutions
  • Glass pipettes for injection of the nucleic acids were prepared from Clark Electromedical Instrument CG150T10 glass capillaries which were hot-drawn on a vertical (Sutter Inst. P-30) or horizontal (Sutter type) Inst P93) to give a final aperture of a few ⁇ .
  • the nucleic acid injection is under a binocular loupe (x30).
  • the pipette was mounted on a micromanipulator and connected to an injection system. It was filled with 1 to 2 ⁇ of nucleic acid mixture, and was then used to inject the nucleic acids into 20 to 30 oocytes. The same type of injection was performed for the different nucleic acid mixtures of nucleic sequences. When the nucleic acid mixture is DNA, the injection was carried out in the middle of the animal pole, when it is RNA, the injection was made in the equatorial zone.
  • the DNA or RNA mixtures used were as follows: for the channel, the cDNA coding for Cava and its variants, namely the sequences SEQ ID No. 1, or 2 and 6 and 4, were injected.
  • the cava coding for Cava (2 and 3) of SEQ ID NO 1 or 2 were injected with a cDNA encoding CaVP (SEQ ID No. 4 or 5), and a cDNA encoding CaVal-6 and its variants. (SEQ ID NO 6).
  • the cDNAs or cRNA were prepared at a concentration of g / ⁇ l.
  • the oocytes respectively comprising the cava / RNA coding for Cava (2 and 3) of sequences SEQ ID No. 1 or 2, CaVP (SEQ ID NO 4 or 5), and CaVal-6 (SEQ ID NO 6) were obtained.
  • the oocytes are returned to their labeled box and stored in ND96S for 2-5 days.
  • the oocyte stimulation and recording of currents was realized thanks to the pclamp software (Clampex ver 7, Axon Inst or higher) or equivalent, running on a computer connected to the amplifier thanks to a Digidata acquisition card 1200 (Axon Inst) or equivalent.
  • FIG. 9 represents the results obtained with the Cava (AmCaVal) and CaVa (AmCava2) calcium bee channels coexpressed with the CavP (AmCavPa) and Cava2-6 (AmCava2-ol) bee regulatory proteins in a functional manner in FIG. Xenopus oocytes.
  • Conventional current-voltage curves are obtained.
  • the AmCaV3a bee channels the CaVa2 ⁇ and CavP subunits not being necessary for its expression, their DNA / RNA was not injected.
  • the current traces obtained during depolarization from -100 mV to -30 mV are shown in Figure 17 C and the current-potential curve Figure 17 D. Note that the peak of the current-potential curve is at hyperpolarized potentials with respect to AmCaVl or CaV2.
  • This experiment clearly demonstrates the expression of the three types of bee calcium channels in Xenopus oocytes.
  • this example clearly demonstrates that the Cava bee calcium channel, and the isolated CavP and Cava2- ⁇ 1 proteins can be used to detect an interaction between the Cava bee calcium channel, and the CavP and Cava2-ole proteins. and a molecule.
  • FIG. 18 represents the results obtained with the Cava (AmCaVal) and CaVa (AmCava2) bee calcium channels coexpressed with the CavP (AmCavPc) and Cava2- ⁇ (AmCava2-ol) and AmCaVcc3 bee regulatory proteins. functional in Xenopus oocytes.
  • a first conditional depolarization (from -100 to 30mV, and 2.5s duration) precedes the test depolarization at + 10mV (CaV1 or CaV2) or -30mV (CaV3) which reveals the available channels.
  • I / I max R + (1 - R) / (1 + exp ((V - V in ) / k
  • I was the amplitude of the current measured during the test pulse at +10 mV or -30 mV (for CaV3) for a conditioning potential varying from -100 to 50 mV
  • Imax the amplitude of the maximum current
  • Vi n the half-inactivation potential
  • V the conditioning potential
  • k the slope
  • R the proportion of In the case of bee channels AmCaV3a, the CaVa2d and Cav subunits are not necessary for its expression, their DNA / RNA has not been injected. hyperpolarized potentials.
  • RT-PCR Reverse polymerase reverse transcriptase chain reaction analysis of CavP expression in different adult bee tissues was performed with primers amb2-003S (SEQ ID NO. 75) and amb2-004AS (SEQ. ID No. 76) which amplify a del635-bp fragment by the polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • amb-013AS CCTGCTGCCTCAGGGCCTCC (SEQ ID NO. amb-O14S (ATGATCGGATACAATCAACACAATTCCGG (SEQ ID NO: 100) and AMB-013AS which respectively amplify a fragment of 574 bp and a fragment of 391-pb.Am-PTF1 which corresponds to truncated Am-CavPa of its first 78 amino acids which has been obtained by PCR with amb-005S primers
  • AM-pb-mut corresponding to Am-Cavpb mutated on four residues in its N-terminus was obtained by overlapping PCR of two amplified fragments with T7 (sequence present in pBluescript) and amb-016AS
  • Rabbit polyclonal antibodies were generated against synthetic peptides corresponding to the N-terminus of AmCavPa (NH2-MSRQLRAERDHVSRC-CONH2 (SEQ ID NO. 105)) or at the C-terminal common end (NH2-CRQQQDPRALNAI-COOH (SEQ ID No. 106)): Nt-Ab and Ct-Ab, respectively.
  • Sera were collected, and antibodies were affinity purified against the peptide used for immunization. Their specificity was verified using a protein gel ("Western Blot") using cellular extracts of cells HEK 293 transfected with both splice variants or brain tissues of bees, and by immunofluorescence on transfected cells, or brain slices.
  • Electrophysiology Xenopus oocytes were prepared and injected in vitro with transcribed RNA (20-40 nor mixture of CaV2.3 (Genbank Accession # X67855) + ⁇ 2- ⁇ (M86621) + / - AmCaVP or CavP2a ( M80545) or Cavpib (X61394) at 1 ⁇ g / ⁇ l, 1: 1: 1 stoichiometry as already described in Restituito S, Cens T, Barrere C, Geib S, Galas S, De Waard M, Charnet P (2000) The P2a subunit is a molecular groom for the Ca 2+ channel inactivation spoils. J Neurosci 20: 9046-9052 [11].
  • BAPTA in mM: BAPTA free acid, 100, CsOH, 10, HEPES, pH 7.2 CsOH
  • BAPTA free acid 100, CsOH, 10, HEPES, pH 7.2 CsOH
  • isochronous inactivation curves 2.5 s of conditioning potential followed by a test depolarization of 400 ms at + 10 mV
  • I / I max R in + (1 - R in ) / (1 + exp ((V - V in ) / k in
  • I was the amplitude of the current measured during the test pulse at + 10 mV for a conditioning potential ranging from -80 to 50 mV
  • Imax the amplitude of the maximum current
  • Vi n the half-inactivation potential
  • V the conditioning potential
  • k in the slope the proportion of non-ion channels.
  • Inactivation kinetics were quantified as R400, the ratio of peak current amplitude to current amplitude recorded at the end of a depolarization of 400 ms.
  • I / I max G x (V-E rev ) / (1 + exp ((V-V act ) / k act )) in which I is the magnitude of the current measured during depolarization ranging from -80 to +50 mV; Imax the amplitude of the maximum current of the current-voltage curve; the normalized macroscopic G conductance, E rev the apparent inversion potential extrapolated, V act the half-activation potential, V the depolarization value and k act a slope factor.
  • the oocyte vitelline membrane was removed using forceps after immersion in a hypertonic solution (200 mM NaCl, 10 mM HEPES), and the oocyte was then placed in the filled recording chamber of a depolarizing solution (100 mM KCl, 5 mM HEPES, 10 mM EGTA, pH 7.2 adjusted with KOH, osmolarity at ⁇ 250 mosmol).
  • a depolarizing solution 100 mM KCl, 5 mM HEPES, 10 mM EGTA, pH 7.2 adjusted with KOH, osmolarity at ⁇ 250 mosmol.
  • Patch pipettes, once coated (coated) (Sylgard ®) and polished had a resistance of 8-12 ⁇ , when filled with a solution containing 100 mM BaCl 2 , 5 mM HEPES (pH 7.2 was adjusted with NaOH ⁇ 290 mOsm).
  • the attached cell currents were recorded with an Axo-patch 200B (Molecular Devices) amplifier, filtered at 2 kHz, and digitized at 10 kHz using a Digidata 1200 interface and stored on a computer using Clampex software. The junction potentials were 1-3 mV and were therefore neglected. Currents were analyzed with Clampfit software (Molecular Devices). Leakage currents were subtracted by means of the manual Clampfit control. The openings of the channels were detected by a threshold set at 50% of the current. Channel conductance and open time constants were calculated from nonlinear regressions performed on amplitude and open time histograms obtained at different potentials using Gaussian and multi-exponential models, respectively.
  • the Popen was calculated by dividing the total time that the channel goes to the open state over the total recording time. This Popen was also determined on the early (early Po, first 40 ms) or late (late Po, last 40 ms) phases of each depolarization during 100 successive depolarizations. The average of the Popen was calculated from these 100 consecutive curves.
  • biotinylated rabbit anti-antibodies (Vector Laboratories, USA) were applied at 1/500 in 10% PBS NGS.
  • the VectaStain ABC kit (Vector Laboratories, USA) was used according to the manufacturer's recommendations.
  • the sections were incubated with a solution of 3,3'-diaminobenzidine supplemented with 3% NiCl 2 .
  • the reaction was blocked with PBS-0.05% sodium azide, and the slices were dehydrated by successive incubation in ethanol solutions (50% to 100%). After rinsing with limonene, the slices were mounted using the Eukitt solution (Kindler GmbH and Co, Germany).
  • HEK293 cells were transfected with pCS4-AmCaVPa or AmCaVpb obtained as described above and cultured for 48 h.
  • Eight A. mellifera were anesthetized at 4 ° C for 30 min, and the antenna, brain, legs, chest, abdomen and were collected.
  • the cells were then centrifuged at 14,000 rpm at 4 ° C for 15 minutes, and the supernatant was subjected to a protein gel (Western Blot) by depositing 10 ⁇ g / well of protein on a 10% gel, subjected to a migration for two hours at 100V, then a transfer of 1 hour at 100V at 4 ° C.
  • the expression of AmCaV is revealed using the Nt-Ab or Ct-Ab antibodies diluted 1/1000.
  • the inhibitory chemical compounds were used as follows: Genistein (10 ⁇ ), staurosporine (2 ⁇ ), H89 (2-50 ⁇ M), Wortmannin (10 ⁇ ), and LY294002 (10 ⁇ ) were added in the incubation medium 1-2 h before the recordings. 2Br-palmitate was injected at 1 mM into oocytes 4 h before the recordings (calculated intra-oocyte concentration ⁇ 10 ⁇ M) and added to the external medium. Allethrin (20 ⁇ ) was either added to the incubation medium 2 h before the recordings, and / or perfused at this concentration during the recordings.
  • the Ct-Ab antibody revealed two ⁇ 70 and ⁇ 55 kDa species in respectively the cell lysates of HEK 293 cells transfected with Am-CavPa and Am-Cavpb ( Figure 11B).
  • Ct-Ab revealed two transcripts migrating at 70 and 55 kDa corresponding to variants a and b.
  • the 70 kDa band migrates as a doublet in bees. This doublet was also observed with the Nt-Ab antibody, as the smallest variant was not detected ( Figure 11B).
  • tyrosine kinases genestein, 10 ⁇
  • serine / threonine kinases staurosporine, 10 ⁇ or H89, 50 ⁇
  • PI3K phosphoinositide kinases
  • the channels containing the Bee CavP are clearly sensitive to the tyrosine and serine / threonine kinase inhibitors (genistein, staurosporin or H89, respectively: G, S, H, Figure 16 A), while they are insensitive to inhibitors of PDkinase (W and L).
  • tyrosine and serine / threonine kinase inhibitors genestein, staurosporin or H89, respectively: G, S, H, Figure 16 A
  • W and L PDkinase
  • Figure 19C shows that the coexpression of AmCaVPc with the AmCaV3 subunit neither modulates the amplitude nor the kinetics of the channel, suggesting that the functional association between CaV3 and Ca v p, if it exists, does not modify these settings.
  • FIG. 20 shows the effects of the co-expression of each of the CaVa2O1, CaVa2O2 or CaVa2O3 subunits with AmCaV2 and AmCaVPc on the amplitude and voltage dependence of the calcium currents.
  • A traces recorded on oocytes expressing each of these combinations in response to depolarizations of -100 mV to +10 mV and 400 ms duration.
  • B Current-voltage curves for each of these combinations in response to depolarizations of -100 to +50 mV in increments of 10 mV. Note the shift to hyperpolarized potentials of the combination with AmCaVa2O2.
  • C specific parameters of each of these curves: Vac, k, Erev, defined as above.
  • This experiment clearly demonstrates that the Cava bee calcium channel, and the isolated CavP and Cava2-ol proteins can be used to detect toxic molecules and / or determine the molecule toxicity and / or to analyze the toxicity of a molecule. molecule. Furthermore this example clearly demonstrates that the Cava bee calcium channel, and the isolated CavP and Cava2-ol proteins can be used to detect an interaction between the Cava bee calcium channel, and the CavP and Cava2- ⁇ l proteins and a molecule.
  • the P2a subunit is a molecular groom for the Ca2 + channel inactivation pattest. J Neurosci 20: 9046-9052

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to a calcium channel isolated from bees, comprising a Cavα channel having a sequence chosen from the group comprising the sequences SEQ ID Nos 1 to 3. The present invention also relates to a calcium channel isolated from bees, comprising a Cavα channel, a Cavα2‑δ regulatory protein having a sequence chosen from the group comprising the sequence SEQ ID Nos 6 to 8 and/or a Cavβ regulatory protein having a sequence chosen from the group comprising the sequences SEQ ID Nos 4, 5 and 107. The present invention also relates to nucleic acid sequences and to vectors comprising these coding sequences, and also to a method for producing these calcium channels and to the uses thereof. The present invention is in particular of use in the agricultural, ecological and chemistry fields and in the beekeeping field. In particular, it is of use for the analysis/identification of the toxicity or of the innocuousness of molecules, for example of chemical molecules, with respect to bees.

Description

CANAL CALCIQUE D'ABEILLE ET UTILISATIONS  BEE CALCIUM CHANNEL AND USES THEREOF
DOMAINE DE L'INVENTION La présente invention se rapporte à un canal calcique isolé d'abeille comprenant une sous-unité Caval. La présente invention se rapporte également à un canal calcique isolé d'abeille comprenant une sous-unité Caval, une protéine régulatrice Cava2-ô et/ou une protéine régulatrice Cavp. La présente invention se rapporte également à des séquences d'acides nucléiques codant pour ces sous-unités isolées d'abeille, à des vecteurs comprenant ces séquences codantes, à un procédé de fabrication de ces canaux calciques. FIELD OF THE INVENTION The present invention relates to an isolated bee calcium channel comprising a Ca v al subunit. The present invention also relates to an isolated bee calcium channel comprising a Ca v al subunit, a Ca v a2 -δ regulatory protein and / or a Ca v p regulatory protein. The present invention also relates to nucleic acid sequences encoding these isolated bee subunits, to vectors comprising these coding sequences, to a method of making these calcium channels.
La présente invention se rapporte également à un procédé de détermination de la toxicité d'une molécule et/ou de détection d'une molécule toxique et/ou d'analyse de la toxicité d'une molécule utilisant un canal calcique isolé d'abeille. La présente invention trouve notamment des applications dans le domaine agricole, écologique, chimique et dans le domaine apicole. En particulier, elle trouve des applications, pour Γ analyse/1' identification de la toxicité ou de l'innocuité de molécules, par exemple de molécules chimiques, vis-à-vis des abeilles. The present invention also relates to a method for determining the toxicity of a molecule and / or detecting a toxic molecule and / or analyzing the toxicity of a molecule using an isolated bee calcium channel. The present invention finds particular applications in the agricultural field, ecological, chemical and beekeeping. In particular, it finds applications for the analysis / identification of the toxicity or the safety of molecules, for example chemical molecules, with respect to bees.
Dans la description ci-dessous, les références entre crochets ([ ]) renvoient à la liste des références présentée à la fin du texte. In the description below, references in brackets ([]) refer to the list of references at the end of the text.
ÉTAT DE LA TECHNIQUE STATE OF THE ART
La régression et le déclin inhabituellement élevés des colonies d'abeilles enregistrés ces dernières années, menant souvent à un syndrome d'effondrement des ruches, par exemple jusqu'à 40% du cheptel en Espagne en 2007, sont extrêmement préoccupants. Ces effondrements ne semblent pas tous passer par une mortalité immédiate des abeilles mais pourraient aussi être la conséquence de modifications de comportements sociaux au sein de la ruche aboutissant à sa disparition. The unusually high regression and decline of bee colonies recorded in recent years, often leading to hive collapse syndrome, for example up to 40% of the herd in Spain in 2007, are extremely worrying. These collapses do not all seem to involve an immediate mortality of bees but could also be the consequence of changes in social behavior within the hive leading to its disappearance.
Les recherches menées sur les causes de ces effondrements, essentiellement réalisées sur Apis mellifera, mettent en cause plusieurs facteurs incluant l'intensification de l'agriculture, l'existence de parasites, de pathogènes ou de prédateurs. En France le débat sur ces effondrements s'est surtout focalisé sur l'utilisation des insecticides. En particulier, et même si une toxicité aiguë de ces produits (40 ng/abeille) semble écartée dans la plupart des cas, une toxicité chronique, voire synergique, s 'opérant pour des doses beaucoup plus faibles ayant peu d'effets létaux immédiats, mais des effets comportementaux non négligeables sur le long terme, pourrait être impliquée (Suchail et al., 2001 [1]). Research on the causes of these collapses, mainly on Apis mellifera, involves several factors including the intensification of agriculture, the existence of parasites, pathogens or predators. In France the debate on these collapses has mainly focused on the use of insecticides. In particular, and even if an acute toxicity of these products (40 ng / bee) seems to be discarded in most cases, a chronic or even synergistic toxicity operating for much smaller doses having little immediate lethal effects, however, significant behavioral effects in the long term could be implicated (Suchail et al., 2001 [1]).
Les pyréthrinoïdes aussi bien vendus comme médicament vétérinaire (contre les parasites des chats et chiens), comme produit ménager (bombe insecticide) que comme insecticide utilisé en agriculture, en horticulture ou en apiculture, ont pour cible principale, chez l'insecte, une protéine de la membrane des neurones responsable de leur excitabilité à savoir les canaux sodiques dépendant du voltage codés par le gène para. Leur action passe par une diminution de la désactivation de ces canaux aboutissant à une hyperexcitabilité nerveuse délétère (Kadala et al., 2010 [2] ; Ray and Fry, 2006 [3]). L'analyse de leur toxicité chez les mammifères a permis de démontrer l'existence d'autres cibles sur les neurones et notamment les canaux calciques dépendant du voltage (CCDV). Ces canaux jouent un rôle fondamental dans l'excitabilité cellulaire, la transmission synaptique, l'expression génique et dans de nombreuses autres fonctions, plus intégrées, dépendant du calcium, par exemple la mémoire, l'apprentissage etc. (Catterall, 2000 [4]). Ils constituent une cible reconnue de nombreux médicaments utilisés en médecine humaine, ou d'autres régulateurs utilisés en recherche fondamentale. Pyrethroids sold as a veterinary medicine (against parasites of cats and dogs), as a household product (insecticide bomb) and as an insecticide used in agriculture, horticulture or beekeeping, have the main target, in the insect, a protein of the neuron membrane responsible for their excitability namely the voltage-dependent sodium channels encoded by the para gene. Their action involves decreasing the deactivation of these channels, leading to deleterious nervous hyperexcitability (Kadala et al., 2010 [2], Ray and Fry, 2006 [3]). The analysis of their toxicity in mammals made it possible to demonstrate the existence of other targets on the neurons and in particular the voltage-dependent calcium channels (CCDV). These channels play a fundamental role in cell excitability, synaptic transmission, gene expression, and in many other more integrated, calcium-dependent functions, such as memory, learning, and so on. (Catterall, 2000 [4]). They are a recognized target of many drugs used in human medicine, or other regulators used in basic research.
Des rôles biologiques similaires du calcium ont été retrouvés chez l'abeille (Grunewald, 2003 [5]). Il a par exemple été montré, in vivo chez l'abeille, que des variations de calcium intracellulaires au niveau des cellules de Kenyon jouent un rôle important dans les mécanismes d'apprentissage et de mémoire olfactive, deux fonctions potentiellement importantes pour le butinage et le retour à la ruche, fonctions touchées par les insecticides. Malheureusement, malgré le séquençage du génome d'Apis mellifera réalisé en 2006 (Weinstock et al., 2006), et l'identification de certains gènes codant pour ces canaux, aucun de ces gènes n'a, à l'heure actuelle, été cloné et exprimé, aucun anticorps ni aucun siRNA validé n'est encore disponible pour des expériences in vitro, comme in vivo. Ce manque prive clairement la recherche et l'industrie d'outils extrêmement précieux pour la compréhension des mécanismes moléculaires régulant l'excitabilité cellulaire, le comportement de l'abeille (Weinstock et al., 2006 [6]), la toxicité de ces molécules, mais aussi pour des études toxicologiques comparées précises entre insectes nuisibles et utiles et/ou mammifères, ou la mise au point de tests simples de toxicité. Similar biological roles of calcium have been found in bees (Grunewald, 2003 [5]). For example, it has been shown, in vivo in the bee, that intracellular calcium changes in Kenyon cells play an important role in mechanisms of learning and olfactory memory, two potentially important functions for foraging and return to the hive, functions affected by insecticides. Unfortunately, despite the sequencing of the Apis mellifera genome performed in 2006 (Weinstock et al., 2006), and the identification of certain genes encoding these channels, none of these genes has, at present, been cloned and expressed, no validated antibody or siRNA is yet available for in vitro experiments, such as in vivo. This lack clearly deprives research and the industry of extremely valuable tools for understanding the molecular mechanisms regulating cellular excitability, bee behavior (Weinstock et al., 2006 [6]), the toxicity of these molecules. but also for accurate comparative toxicological studies between harmful and beneficial insects and / or mammals, or the development of simple toxicity tests.
Il existe donc un réel besoin d'identifier, d'isoler et de caractériser les canaux calciques d'abeille et les insectes pollinisateurs en général palliant ces défauts, inconvénients et obstacles de l'art antérieur, en particulier un canal susceptible d'être utilisé dans un procédé permettant d'identifier, quantifier et/ou tester la toxicité d'une molécule vis-à- vis des abeilles, permettant ainsi de réduire les coûts et d'améliorer, notamment la production apicole et/ou l'écologie. There is therefore a real need to identify, isolate and characterize bee calcium channels and pollinating insects in general overcoming these defects, disadvantages and obstacles of the prior art, in particular a channel that can be used in a method for identifying, quantifying and / or testing the toxicity of a molecule to bees, thereby reducing costs and improving, including beekeeping production and / or ecology.
RÉSUMÉ ABSTRACT
Un objet de la présente invention est un canal calcique isolé d'abeille comprenant une sous-unité Caval de séquence choisie dans le groupe comprenant les séquences SEQ ID n° 1 à 3. An object of the present invention is an isolated bee calcium channel comprising a sequence Caval subunit selected from the group consisting of SEQ ID NO: 1 to 3.
Un autre objet de la présente invention est un canal calcique isolé d'insecte pollinisateur Cavl comprenant la séquence SEQ ID NO : 1 ou un variant de celle-ci consistant en une séquence d'acides aminés de moins de 2000 acides aminés et ayant au moins 99% d'identité avec SEQ ID NO : 1. Another object of the present invention is an isolated calcium channel of a pollinating insect Cav1 comprising the sequence SEQ ID NO: 1 or a variant thereof consisting of an amino acid sequence of less than 2000 amino acids and having at least 99% identity with SEQ ID NO: 1.
Un autre objet de la présente invention est un canal calcique isolé d'insecte pollinisateur Cav2 comprenant une sous-unité de séquence SEQ ID NO: 2 ou un variant de celle-ci consistant en une séquence d'acides aminés de moins de 1900 acides aminés et ayant au moins 99% d'identité avec la SEQ ID NO: 2. Another subject of the present invention is a calcium channel isolated from a pollinating insect Cav2 comprising a subunit of sequence SEQ ID NO: 2 or a variant thereof consisting of an amino acid sequence of less than 1900 amino acids and having at least 99% identity with SEQ ID NO: 2.
Un autre objet de la présente invention est un canal calcique isolé d'insecte pollinisateur comprenant une sous-unité Cav3 de séquence SEQ ID NO: 3 ou un variant de celle-ci consistant en une séquence d'acides aminés ayant au moins 92% d'identité avec la SEQ ID NO: 3. Another object of the present invention is a pollinator insect isolated calcium channel comprising a Cav3 subunit of sequence SEQ ID NO: 3 or a variant thereof consisting of an amino acid sequence having at least 92% d identity with SEQ ID NO: 3.
Un autre objet de la présente invention est un canal calcique isolé comprenant en outre au moins une protéine régulatrice choisie parmi une protéine régulatrice Cava2-ô de séquence choisie dans le groupe comprenant la séquence SEQ ID NO 6 à 8 et/ou une protéine régulatrice Cavp de séquence choisie dans le groupe comprenant la séquence SEQ ID n° 4, 5 et 107. Another object of the present invention is an isolated calcium channel further comprising at least one regulatory protein selected from a Ca v a2-δ regulatory protein of sequence selected from the group consisting of SEQ ID NO 6 to 8 and / or a protein Ca v p regulator of sequence chosen from the group comprising the sequence SEQ ID No. 4, 5 and 107.
Un autre objet de la présente invention est un canal calcique isolé d'insecte pollinisateur comprenant en outre au moins une protéine régulatrice Cava2-ôl comprenant la séquence SEQ ID NO : 6 ou un variant de celle-ci consistant en une séquence d'acides aminés ayant au moins 99% d'identité avec la SEQ ID NO: 6 et/ou une protéine régulatrice Cava2-ô2 comprenant la séquence SEQ ID NO : 7 ou un variant de celle-ci consistant en une séquence d'acides aminés ayant au moins 99% d'identité avec la SEQ ID NO: 7 et/ou une protéine régulatrice Cava2-ô3 comprenant la séquence SEQ ID NO : 8 ou un variant de celle-ci consistant en une séquence d'acides aminés ayant au moins 99% d'identité avec la SEQ ID NO: 8. Another object of the present invention is a pollinated insect isolated calcium channel further comprising at least one Ca v a2-δ1 regulatory protein comprising the sequence SEQ ID NO: 6 or a variant thereof consisting of a sequence of amino acids having at least 99% identity with SEQ ID NO: 6 and / or a Ca v a2-δ2 regulatory protein comprising the sequence SEQ ID NO: 7 or a variant thereof consisting of an acid sequence amino acids having at least 99% identity with SEQ ID NO: 7 and / or a Ca v a2-δ3 regulatory protein comprising the sequence SEQ ID NO: 8 or a variant thereof consisting of an amino acid sequence having at least 99% identity with SEQ ID NO: 8.
Dans un mode de réalisation, le canal calcique comprend un canal Caval, une protéine régulatrice Cava2-ô et une protéine régulatrice Cavp. In one embodiment, the calcium channel comprises a Caval channel, a Ca v a2 -δ regulatory protein and a Ca v p regulatory protein.
Un autre objet de la présente invention est un canal calcique isolé d'insecte pollinisateur comprenant en outre au moins une protéine régulatrice CavPa comprenant la séquence SEQ ID NO : 4 ou un variant de celle-ci consistant en une séquence d'acides aminés ayant au moins 99% d'identité avec la SEQ ID NO: 4 et/ou une protéine régulatrice Cavpb comprenant SEQ ID NO : 5 ou un variant de celle-ci consistant en une séquence d'acides aminés ayant au moins 99% d'identité avec la SEQ ID NO: 5 et/ou une protéine régulatrice CavPc comprenant SEQ ID NO : 107 ou un variant de celle-ci consistant en une séquence d'acides aminés ayant au moins 99% d'identité avec la SEQ ID NO: 107. Another object of the present invention is a isolated pollinator insect calcium channel further comprising at least one CavPa regulatory protein comprising the sequence SEQ ID NO: 4 or a variant thereof consisting of an amino acid sequence having at least one at least 99% identity with SEQ ID NO: 4 and / or a Cavpb regulatory protein comprising SEQ ID NO: 5 or a variant thereof consisting of an amino acid sequence having at least 99% identity with SEQ ID NO: 5 and / or a protein regulator CavPc comprising SEQ ID NO: 107 or a variant thereof consisting of an amino acid sequence having at least 99% identity with SEQ ID NO: 107.
Un autre objet de la présente invention est un acide nucléique codant pour un canal Caval et/ou une protéine régulatrice Cava2-ô et/ou une protéine régulatrice Cavp telle(s) que définies par le canal calcique décrit ci-dessus. Another subject of the present invention is a nucleic acid encoding a Caval channel and / or a Ca v a2 -δ regulatory protein and / or a Ca v p regulatory protein as defined by the calcium channel described above. .
Un autre objet de la présente invention est un acide nucléique codant pour le canal calcique Cavl comprenant SEQ ID NO : 9 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 6000 paires de bases (pb) et ayant au moins 99% d'identité avec SEQ ID NO: 9. Un autre objet de la présente invention est un acide nucléique codant pour le canal calcique Cav2 comprenant SEQ ID NO: 10 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 5500 pb, plus de 600 pb et ayant au moins 99% d'identité avec SEQ ID NO: 10. Another object of the present invention is a nucleic acid encoding the Cav1 calcium channel comprising SEQ ID NO: 9 or a variant thereof consisting of a nucleic acid sequence of less than 6,000 base pairs (bp) and having at least 99% identity with SEQ ID NO: 9. Another object of the present invention is a nucleic acid encoding the Cav2 calcium channel comprising SEQ ID NO: 10 or a variant thereof consisting of a sequence of nucleic acid of less than 5,500 bp, greater than 600 bp and having at least 99% identity with SEQ ID NO: 10.
Un autre objet de la présente invention est un acide nucléique codant pour le canal calcique Cav3 comprenant SEQ ID NO: 11 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 7800 pb et ayant au moins 91% d'identité avec SEQ ID NO: 11. Another object of the present invention is a nucleic acid encoding the Cav3 calcium channel comprising SEQ ID NO: 11 or a variant thereof consisting of a nucleic acid sequence of less than 7800 bp and having at least 91% d identity with SEQ ID NO: 11.
Un autre objet de la présente invention est un acide nucléique codant pour la sous-unité régulatrice Cava2ôl comprenant SEQ ID NO: 15 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 pb et ayant au moins 99% d'identité avec SEQ ID NO: 15. Another object of the present invention is a nucleic acid encoding the regulatory Cava2δ1 subunit comprising SEQ ID NO: 15 or a variant thereof consisting of a nucleic acid sequence of less than 4000 bp and having at least 99 % identity with SEQ ID NO: 15.
Un autre objet de la présente invention est un acide nucléique codant pour la sous-unité régulatrice Cava2ô2 comprenant SEQ ID NO: 16 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 pb, plus de 500 pb et ayant au moins 99% d'identité avec SEQ ID NO: 16. Another object of the present invention is a nucleic acid encoding the Cava2δ2 regulatory subunit comprising SEQ ID NO: 16 or a variant thereof consisting of a nucleic acid sequence of less than 4000 bp, greater than 500 bp and having at least 99% identity with SEQ ID NO: 16.
Un autre objet de la présente invention est un acide nucléique codant pour la sous-unité régulatrice Cava2ô3 comprenant SEQ ID NO: 17 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 pb et ayant au moins 99% d'identité avec SEQ ID NO: 17. Another object of the present invention is a nucleic acid encoding the regulatory subunit Cava2O3 comprising SEQ ID NO: 17 or a variant thereof consisting of a nucleic acid sequence of less than 4000 bp and having at least 99% identity with SEQ ID NO: 17.
Un autre objet de la présente invention est un acide nucléique codant pour la sous-unité régulatrice CavPa comprenant SEQ ID NO: 12 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 2000 pb et ayant au moins 99% d'identité avec SEQ ID NO: 12. Another object of the present invention is a nucleic acid encoding the CavPa regulatory subunit comprising SEQ ID NO: 12 or a variant thereof consisting of a nucleic acid sequence of less than 2000 bp and having at least 99 % identity with SEQ ID NO: 12.
Un autre objet de la présente invention est un acide nucléique codant pour la sous-unité régulatrice Cavpb comprenant décrite dans SEQ ID NO: 13 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 1500 pb et ayant au moins 99% d'identité avec SEQ ID NO: 13. Another object of the present invention is a nucleic acid encoding the Cavpb regulatory subunit comprising comprising SEQ ID NO: 13 or a variant thereof consisting of a nucleic acid sequence of less than 1500 bp and having at least less than 99% identity with SEQ ID NO: 13.
Un autre objet de la présente invention est un acide nucléique codant pour la sous-unité régulatrice CavPc comprenant dans SEQ ID NO: 14 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 2000 pb et ayant au moins 99% d'identité avec SEQ ID NO: 14. Un autre objet de la présente invention est un vecteur comprenant au moins un acide nucléique tel que décrit ci-dessus. Another object of the present invention is a nucleic acid encoding the CavPc regulatory subunit comprising in SEQ ID NO: 14 or a variant thereof consisting of a nucleic acid sequence of less than 2000 bp and having at least 99% identity with SEQ ID NO: 14. Another object of the present invention is a vector comprising at least one nucleic acid as described above.
Un autre objet de la présente invention est une cellule transformée comprenant au moins une séquence d'acide nucléique telle que décrite ci-dessus ou un vecteur tel que décrit ci-dessus. Dans un mode de réalisation, la cellule transformée exprime un canal tel que décrit ci- dessus ou un vecteur tel que décrit ci-dessus. Another object of the present invention is a transformed cell comprising at least one nucleic acid sequence as described above or a vector as described above. In one embodiment, the transformed cell expresses a channel as described above or a vector as described above.
Un autre objet de la présente invention est un procédé de fabrication d'un canal calcique utilisant un acide nucléique tel que décrit ci-dessus ou un vecteur tel que décrit ci- dessus. Un autre objet de la présente invention est un procédé de détermination de la toxicité d'une molécule et/ou de détection d'une molécule toxique et/ou d'analyse de la toxicité d'une molécule comprenant : une étape d'analyse électrophysiologique et/ou d'imagerie calcique comprenant la mise en contact de ladite molécule avec un canal tel que décrit ci-dessus ou avec une cellule transformée telle que décrite ci-dessus. Another object of the present invention is a method of manufacturing a calcium channel using a nucleic acid as described above or a vector as described above. Another object of the present invention is a method for determining the toxicity of a molecule and / or detecting a toxic molecule and / or analyzing the toxicity of a molecule comprising: an electrophysiological analysis step and / or imaging calcium comprising contacting said molecule with a channel as described above or with a transformed cell as described above.
La présente invention concerne également l'utilisation d'un canal calcique tel que défini ci-dessus pour la détermination de l'interaction moléculaire entre ledit canal et une molécule. The present invention also relates to the use of a calcium channel as defined above for determining the molecular interaction between said channel and a molecule.
La présente invention concerne également un procédé in vitro pour déterminer l'effet d'un composé test sur l'activité d'un canal calcique d'un insecte pollinisateur, comprenant: a. la mise en contact des cellules transformées telles que décrites ci-dessus, avec un composé test, b. mesurer l'effet dudit composé sur l'activité du canal calcique, et comparer l'effet dudit composé à l'effet d'un composé contrôle ou une solution de véhicule, en déterminant ainsi une activité de modulation du canal calcique. The present invention also relates to an in vitro method for determining the effect of a test compound on the activity of a calcium channel of a pollinating insect, comprising: a. bringing the transformed cells as described above into contact with a test compound, b. measuring the effect of said compound on the activity of the calcium channel, and comparing the effect of said compound with the effect of a control compound or a vehicle solution, thereby determining a calcium channel modulation activity.
Dans un mode de réalisation, le procédé selon l'invention permet de déterminer la toxicité d'un composé test sur un insecte pollinisateur. In one embodiment, the method according to the invention makes it possible to determine the toxicity of a test compound on a pollinating insect.
La présente invention concerne également un procédé in vitro de criblage de composés qui modulent l'activité du canal calcique d'un insecte pollinisateur comprenant: a. la mise en contact des cellules transformées telles que décrites ci-dessus, avec un composé test, b. la mesure de l'effet dudit composé test sur l'activité du canal calcique, et comparer l'effet dudit composé test à l'effet d'un composé contrôle ou une solution de véhicule, en classant ainsi ledit composé en tant que bloqueur de canal calcique, activateur du canal calcique, modificateur de déclenchement. The present invention also relates to an in vitro method for screening compounds that modulate the calcium channel activity of a pollinating insect comprising: a. bringing the transformed cells as described above into contact with a test compound, b. measuring the effect of said test compound on calcium channel activity, and comparing the effect of said test compound with the effect of a control compound or a vehicle solution, thus classifying said compound as a blocker of calcium channel, calcium channel activator, trigger modifier.
La présente invention concerne également un kit comprenant au moins un vecteur selon l'invention ou une cellule transformée selon l'invention et des réactifs. DEFINITIONS The present invention also relates to a kit comprising at least one vector according to the invention or a transformed cell according to the invention and reagents. DEFINITIONS
Dans la présente invention, les termes ci-dessous sont définis de la manière suivante : - "Séquence nucléotidique" se réfère à englober les acides nucléiques ayant les séquences définies ci-dessous, ainsi que des variants de ceux-ci, y compris par exemple des fragments, des délétions, des insertions et des substitutions qui conservent la capacité de coder pour les différentes sous-unités du canal calcique d'insectes pollinisateurs. - "Canal fonctionnel", "l'expression fonctionnelle" se réfère à la synthèse et tout traitement post-traductionnelle nécessaire d'une molécule de canal calcique Cav ou Cava et/ou de molécules de sous-unités régulatrices dans une cellule de sorte que le canal et/ou ses sous-unités régulatrices sont correctement insérés dans la membrane cellulaire, et est capable de conduire les ions en réponse à un changement imposé expérimentalement dans le potentiel de membrane de la cellule ou lors de l'exposition à des agents pharmacologiques appropriés. In the present invention, the terms below are defined as follows: "Nucleotide sequence" refers to encompass the nucleic acids having the sequences defined below, as well as variants thereof, including for example fragments, deletions, insertions and substitutions that retain the ability to code for the different subunits of the pollinating insect calcium channel. - "Functional channel", "functional expression" refers to the synthesis and any necessary post-translational processing of a Cav or Cava calcium channel molecule and / or regulatory subunit molecules in a cell so that the channel and / or its regulatory subunits are properly inserted into the cell membrane, and is capable of driving the ions in response to an experimentally imposed change in the membrane potential of the cell or upon exposure to pharmacological agents appropriate.
"Composé test" se réfère à un produit phytosanitaire, une molécule, un organisme ou un extrait de celui-ci capable de se lier et/ou de moduler l'activité de canal calcique d'un insecte pollinisateur. - "Dérivé" ou "analogue" d'un composé désigne globalement la modification ou la substitution d'une ou plusieurs fractions chimiques sur un composé d'origine et peuvent inclure des dérivés fonctionnels, des isomères de position, des tautomères, des zwitterions, des énantiomères, diastéréoisomères, racémates, isostères ou mélanges stéréochimiques de celui-ci. - "Produit phytosanitaire" désigne des composés chimiques ou biologiques utilisés comme insecticides, herbicides, fongicides, des engrais, des antibiotiques ou des produits utilisés dans l'agriculture, dans la vinification, la conservation des aliments, le fond de bateau, des animaux ou à des fins domestiques. "Test compound" refers to a phytosanitary product, a molecule, an organism or an extract thereof that is capable of binding and / or modulating the calcium channel activity of a pollinating insect. - "Derivative" or "analogue" of a compound means generally the modification or substitution of one or more chemical moieties on an original compound and may include functional derivatives, positional isomers, tautomers, zwitterions, enantiomers, diastereoisomers, racemates, isosteres or stereochemical mixtures thereof. - "Plant protection product" means chemical or biological compounds used as insecticides, herbicides, fungicides, fertilizers, antibiotics or products used in agriculture, in winemaking, food preservation, ship bottom, animals or for domestic purposes.
"Dose sub-létale" se réfère à une concentration d'un composé test potentiellement mortelle qui n'est pas suffisamment élevée pour provoquer la mort ce qui signifie une concentration sous la dose létale (DL50), mais encore capable de déclencher la mort par un mécanisme qui n'est pas aiguë (immédiat). À dose sub-létale, le composé test induit des changements dans les mécanismes biologiques qui incluent, mais ne sont pas limités à, des changements de comportement au niveau de la colonie, des changements de comportement au niveau individuel, les changements de mémoire, de mécanismes cellulaires ou de mécanismes moléculaires. "Sub-lethal dose" refers to a concentration of a potentially life-threatening test compound that is not high enough to cause death, which means a concentration below the lethal dose (LD50), but still capable of triggering death by a mechanism that is not acute (immediate). At a sub-lethal dose, the test compound induces changes in biological mechanisms that include, but are not limited to, behavioral changes at the colony level, changes in behavior at the individual level, changes in memory, cellular mechanisms or molecular mechanisms.
"Dose minimale de modulation" se réfère à la concentration la plus faible d'un composé test requise pour moduler l'activité du canal calcique. "Minimum modulation dose" refers to the lowest concentration of a test compound required to modulate calcium channel activity.
"Modulation", "moduler" ou "modulateur" de l'activité du canal calcique se réfèrent aux trois états distincts du canal qui peuvent être modulés: fermé, ouvert et inactivé. La transition de l'état fermé à l'état ouvert se réfère au mécanisme d'activation, le retour de l'état ouvert à l'état fermé se réfère à la désactivation. La transition entre l'état ouvert et l'état inactivé se réfère à l'inactivation. Enfin, la transition entre les états inactivés et les états ouvert ou fermé se rapporte au mécanisme de réactivation. Il se réfère également à des composés y compris "les bloqueurs de canaux calciques", "activateurs de canaux calciques", "modificateurs du déclenchement", "modulateurs allostériques" affectant la circulation du courant d'ions calcium dans le canal en induisant une et/ou des modification(s) de conformation sur lesdits canaux calciques, les sous-unités d'assemblage ou l'une organisation, la modification de l'adressage et/ou le trafic du canal calcique à la membrane plasmique, la modification de la durée de vie dudit canal calcique à la membrane plasmique, toute modification de l'état post- traductionnelle comme l'état de phosphorylation dudit canal calcique, ou toute modification des processus d'activation, de déactivation, d' inactivation ou de réactivation. "Bloqueurs de canaux calciques" se réfèrent à des composés freinant et/ou interrompant et/ou stoppant l'entrée normale d'ions calcium au travers du canal calcique. "Modulation", "modulate" or "modulator" of calcium channel activity refers to the three distinct states of the channel that can be modulated: closed, open and inactivated. The transition from the closed state to the open state refers to the activation mechanism, the return from the open state to the closed state refers to the deactivation. The transition from the open state to the inactivated state refers to inactivation. Finally, the transition between the inactivated states and the open or closed states relates to the reactivation mechanism. It also refers to compounds including "calcium channel blockers", "calcium channel activators", "trigger modifiers", "allosteric modulators" affecting the flow of calcium ion current in the channel by inducing one and / or conformation modification (s) on said calcium channels, assembly subunits or organization, modification of the addressing and / or trafficking of the calcium channel to the plasma membrane, modification of the durability of said calcium channel to the plasma membrane, any modification of the post-translational state such as the phosphorylation state of said calcium channel, or any modification of the activation, deactivation, inactivation or reactivation processes. "Calcium channel blockers" refers to compounds that slow down and / or interrupt and / or stop the normal entry of calcium ions through the calcium channel.
"Activateurs de canaux calciques" se réfèrent à des composés qui activent l'ouverture des canaux calciques ou augmentent le temps d'ouverture de ces canaux. "Calcium channel activators" refers to compounds that activate the opening of calcium channels or increase the opening time of these channels.
"Modificateurs du déclenchement" se réfèrent à des composés modifiant le déclenchement de l'ouverture du canal calcique. "Trigger modifiers" refer to compounds that modify the initiation of calcium channel opening.
"Modulateurs allostériques" se réfèrent à des composés qui se lient à des sites allostériques sur le canal entraînant une modulation (augmentation ou diminution) indirecte dans la conductance ou les cinétiques d'activation de déactivation, d'inactivation ou de réactivation dudit canal calcique. "Allosteric modulators" refers to compounds that bind to allosteric sites on the channel resulting in indirect modulation (increase or decrease) in the conductance or activation kinetics of deactivation, inactivation or reactivation of said calcium channel.
DESCRIPTION DÉTAILLÉE DETAILED DESCRIPTION
Un objet de la présente invention est la séquence d'acide nucléique isolée ou un variant de celle-ci comprenant au moins une sous-unité du canal calcique (Ca2+) d'un insecte pollinisateur. An object of the present invention is the isolated nucleic acid sequence or a variant thereof comprising at least one subunit of the calcium channel (Ca 2+ ) of a pollinating insect.
Un autre objet de la présente invention est la séquence d'acides aminés ou protéique isolée ou un variant de celle-ci comprenant au moins une sous-unité du canal calcique (Ca2+) d'un insecte pollinisateur. Another object of the present invention is the isolated amino acid or protein sequence or a variant thereof comprising at least one subunit of the calcium channel (Ca 2+ ) of a pollinating insect.
Les insectes pollinisateurs de l'invention comprennent des espèces de l'ordre des hyménoptères, de la famille des Apidae et la sous-famille Apinae en particulier les espèces non-invasives qui ne nuisent pas à des cultures ou parasitent les insectes pollinisateurs ou endommagent ruches. Pollinating insects of the invention include species of the order Hymenoptera, family Apidae and subfamily Apinae especially non-invasive species that do not harm crops or parasitize pollinating insects or damage beehives .
Les insectes pollinisateurs de l'invention comprennent une liste non limitative: abeilles, abeilles tels que Apis mellifera, Apis cerana, Apis dorsata, Apis Florea, abeilles sans dard tels que Melipona beecheii ou Melipona yucatanica, Melipona anthidioides de quadrifasciata, des abeilles d'orchidée, bourdons comme Bombus franklini, Bombus terricola, Bombus affinis et Bombus occidentalis. De préférence, l'insecte pollinisateur de l'invention est une abeille, et de préférence Apis mellifera. The pollinating insects of the invention comprise a non-limiting list: bees, bees such as Apis mellifera, Apis cerana, Apis dorsata, Apis Florea, stingless bees such as Melipona beecheii or Melipona yucatanica, Melipona anthidioides of quadrifasciata, honey bees. orchid, drones like Bombus franklini, Bombus terricola, Bombus affinis and Bombus occidentalis. Preferably, the pollinating insect of the invention is a bee, and preferably Apis mellifera.
La présente invention a précisément pour but de répondre à ce besoin en fournissant des sous-unités de canaux calciques d'abeille de séquence choisie dans le groupe comprenant la séquence SEQ ID N° 1 à 3 du listage annexé et des canaux calciques d'abeille isolés d'abeille comprenant une sous-unité Caval. The present invention is specifically intended to meet this need by providing bee calcium channel subunits with a sequence selected from the group consisting of the sequence SEQ ID Nos. 1 to 3 of the attached listing and bee calcium channels. isolated bees comprising a subunit Ca v al.
Ces sous-unités de SEQ ID n°l à 3 ont été appelées respectivement amCavla, amCav2b ou amCav3a par les inventeurs. These subunits of SEQ ID Nos. 1 to 3 were respectively called amCavla, amCav2b or amCav3a by the inventors.
En particulier, les inventeurs ont identifié, isolé et fournissent les sous-unités d'un canal calcique d'abeille, en particulier d'Apis mellifera. In particular, the inventors have identified, isolated and provide the subunits of a bee calcium channel, in particular Apis mellifera.
Dans un mode de réalisation, la sous-unité Cavla (appelée également Cavl) exprime la séquence de la protéine isolée du canal calcique comme décrite dans SEQ ID NO: 1 ou un variant de celle-ci consistant en une séquence d'acides aminés de moins de 2000 acides aminés et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec la SEQ ID NO: 1. In one embodiment, the Cavla subunit (also referred to as Cav1) expresses the isolated calcium channel protein sequence as described in SEQ ID NO: 1 or a variant thereof consisting of an amino acid sequence of less than 2000 amino acids and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99 , 6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 1.
Dans un autre mode de réalisation, la sous-unité Cav2b (appelée également Cav2) exprime la séquence de la protéine isolée du canal calcique comme décrite dans SEQ ID NO: 2 ou un variant de celle-ci consistant en une séquence d'acides aminés de moins de 1900 acides aminés et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec la SEQ ID NO: 2. In another embodiment, the Cav2b subunit (also referred to as Cav2) expresses the isolated calcium channel protein sequence as described in SEQ ID NO: 2 or a variant thereof consisting of an amino acid sequence less than 1900 amino acids and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 2.
Dans un autre mode de réalisation, la sous-unité Cav3a (appelée également Cav3) exprime la séquence de la protéine isolée du canal calcique comme décrite dans SEQ ID NO: 3 ou un variant de celle-ci consistant en une séquence d'acides aminés de plus de 2300 acides aminés et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec la SEQ ID NO: 3. In another embodiment, the Cav3a subunit (also referred to as Cav3) expresses the isolated calcium channel protein sequence as described in SEQ ID NO: 3 or a variant thereof consisting of an amino acid sequence more than 2300 amino acids and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 3.
La présente invention a également pour objet un canal calcique isolé d'abeille comprenant : - une sous-unité Caval telle que définie ci-dessus et comprenant en outre au moins une protéine régulatrice choisie parmi une protéine régulatrice Cava2-ô de séquence choisie dans le groupe comprenant les séquences SEQ ID NO 6 à 8 du listage annexé, et - au moins une protéine régulatrice Cavp choisie dans le groupe comprenant les séquences SEQ ID N° 4, 5 et 107 du listage annexé. The present invention also relates to an isolated bee calcium channel comprising: a subunit Ca v al as defined above and further comprising at least one regulatory protein selected from a regulatory protein Ca v a2-δ of a sequence selected from the group comprising the sequences SEQ ID NO 6 to 8 of the listing and at least one regulatory protein Ca v p selected from the group comprising the sequences SEQ ID Nos. 4, 5 and 107 of the appended listing.
Les sous-unités de SEQ ID n°6 à 8 ont été appelées respectivement amCava2ôl, amCava2ô2 ou amCava2ô3 par les inventeurs. Les sous-unités de SEQ ID n°4, 5 et 107 ont été appelées respectivement amCavPa, amCavPb ou amCavPc par les inventeurs. Dans un mode de réalisation, la sous-unité Cava2ôl exprime la séquence de la protéine isolée régulatrice décrite dans SEQ ID NO : 6 ou un variant de celle-ci consistant en une séquence d'acides aminés ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec la SEQ ID NO: 6. The subunits of SEQ ID Nos. 6 to 8 have been designated as amCava2O1, amCava2O2 or amCava2O3, respectively, by the inventors. The subunits of SEQ ID Nos. 4, 5 and 107 have been named amCavPa, amCavPb or amCavPc respectively by the inventors. In one embodiment, the Cava2δ1 subunit expresses the sequence of the isolated regulatory protein described in SEQ ID NO: 6 or a variant thereof consisting of an amino acid sequence of at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 6.
Dans un autre mode de réalisation, la sous-unité Cava2ô2 exprime la séquence de la protéine isolée régulatrice décrite dans SEQ ID NO : 7 ou un variant de celle-ci consistant en une séquence d'acides aminés ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec la SEQ ID NO: 7. In another embodiment, the Cava2δ2 subunit expresses the sequence of the isolated regulatory protein described in SEQ ID NO: 7 or a variant thereof consisting of an amino acid sequence of at least 90, 91, 92 , 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 % identity with SEQ ID NO: 7.
Dans un autre mode de réalisation, la sous-unité Cava2ô3 exprime la séquence de la protéine isolée régulatrice décrite dans SEQ ID NO : 8 ou un variant de celle-ci consistant en une séquence d'acides aminés ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec la SEQ ID NO: 8. In another embodiment, the Cava2δ3 subunit expresses the sequence of the regulatory isolated protein described in SEQ ID NO: 8 or a variant thereof consisting of an amino acid sequence of at least 90, 91, 92 , 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 % identity with SEQ ID NO: 8.
Dans un autre mode de réalisation, la sous-unité CavPa exprime la séquence de la protéine isolée régulatrice décrite dans SEQ ID NO : 4 ou un variant de celle-ci consistant en une séquence d'acides aminés ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec la SEQ ID NO: 4. Dans un autre mode de réalisation, la sous-unité Cavpb exprime la séquence de la protéine isolée régulatrice décrite dans SEQ ID NO : 5 ou un variant de celle-ci consistant en une séquence d'acides aminés ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec la SEQ ID NO: 5. In another embodiment, the CavPa subunit expresses the sequence of the regulatory isolated protein described in SEQ ID NO: 4 or a variant thereof consisting of an amino acid sequence of at least 90, 91, 92 , 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 Identity% with SEQ ID NO: 4. In another embodiment, the Cavpb subunit expresses the sequence of the regulatory isolated protein described in SEQ ID NO: 5 or a variant thereof consisting of an amino acid sequence of at least 90, 91, 92 , 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 Identity% with SEQ ID NO: 5.
Dans un autre mode de réalisation, la sous-unité CavPc exprime la séquence de la protéine isolée régulatrice décrite dans SEQ ID NO : 107 ou un variant de celle-ci consistant en une séquence d'acides aminés ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec la SEQ ID NO: 107. In another embodiment, the CavPc subunit expresses the sequence of the regulatory isolated protein described in SEQ ID NO: 107 or a variant thereof consisting of an amino acid sequence of at least 90, 91, 92 , 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 % identity with SEQ ID NO: 107.
Avantageusement, selon l'invention le canal calcique isolé d'abeille est un complexe protéique comprenant une sous-unité Caval, une protéine régulatrice Cava2-ô et une protéine régulatrice Cavp. Advantageously, according to the invention, the isolated bee calcium channel is a protein complex comprising a Ca v al subunit, a Ca v a2 -δ regulatory protein and a Ca v p regulatory protein.
La présente invention se rapporte également aux acides nucléiques codant pour une sous-unité Caval selon la présente invention, notamment pour les protéines de séquence SEQ ID n° 1 à 3 ou un variant de celles-ci du listage annexé. Il peut s'agir par exemple d'une séquence nucléotidique comprenant ou constituée de la séquence SEQ ID n° 9 à 11 respectivement du listage de séquences annexé. The present invention also relates to nucleic acids encoding a subunit Ca v al according to the present invention, particularly for protein sequence SEQ ID No. 1 to 3 or a variant thereof of the appended listing. It may be for example a nucleotide sequence comprising or consisting of the sequence SEQ ID No. 9 to 11 respectively of the attached sequence listing.
Dans un mode de réalisation, la séquence d'acide nucléique isolée comprend Cavla telle que décrite dans SEQ ID NO: 9 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 6000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 9. In one embodiment, the isolated nucleic acid sequence comprises Cava as described in SEQ ID NO: 9 or a variant thereof consisting of a nucleic acid sequence of less than 6,000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7 , 99.8, 99.9% identity with SEQ ID NO: 9.
Dans un autre mode de réalisation, la séquence d'acide nucléique isolée comprend Cav2b telle que décrite dans SEQ ID NO: 10 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 5500 paires de bases (pb), plus de 600 pb et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 10. Dans un autre mode de réalisation, la séquence d'acide nucléique isolée comprend Cav3a telle que décrite dans SEQ ID NO: 11 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 7800 paires de bases (pb) et ayant au moins 90, 91, 91,5 ; 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 11. In another embodiment, the isolated nucleic acid sequence comprises Cav2b as described in SEQ ID NO: 10 or a variant thereof consisting of a nucleic acid sequence of less than 5,500 base pairs (bp) , more than 600 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99 , 6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 10. In another embodiment, the isolated nucleic acid sequence comprises Cav3a as described in SEQ ID NO: 11 or a variant thereof consisting of a nucleic acid sequence of less than 7800 base pairs (bp) and having at least 90, 91, 91.5; 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99, 9% identity with SEQ ID NO: 11.
La présente invention se rapporte également à une séquence nucléotidique codant pour la protéine régulatrice Cava2-ô de séquence SEQ ID n° 6 à 8 du listage de séquences annexé. Il peut s'agir par exemple de la séquence SEQ ID n° 15 à 17 respectivement du listage de séquences annexé. Dans un mode de réalisation, la séquence d'acide nucléique isolée comprend Cava2ôl telle que décrite dans SEQ ID NO: 15 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 15. Dans un autre mode de réalisation, la séquence d'acide nucléique isolée comprend Cava2ô2 telle que décrite dans SEQ ID NO: 16 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 paires de bases (pb), plus de 500 pb et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 16. Dans un autre mode de réalisation, la séquence d'acide nucléique isolée comprend Cava2ô3 telle que décrite dans SEQ ID NO: 17 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 17. La présente invention se rapporte également à une séquence nucléotidique codant pour la protéine régulatrice Cavp de séquence SEQ ID n° 4, 5 ou 107 ou un variant de celles- ci du listage de séquences annexé. Il peut s'agir par exemple de la séquence SEQ ID n° 12 à 14 ou un variant de celles-ci respectivement du listage de séquences annexé. Dans un mode de réalisation, la séquence d'acide nucléique isolée comprend CavPa telle que décrite dans SEQ ID NO: 12 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 2000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 12. The present invention also relates to a nucleotide sequence coding for the Ca v a2-δ regulatory protein of sequence SEQ ID Nos. 6 to 8 of the attached sequence listing. It may be, for example, the sequence SEQ ID No. 15 to 17 respectively of the appended sequence listing. In one embodiment, the isolated nucleic acid sequence comprises Cava2δ1 as described in SEQ ID NO: 15 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7 , 99.8, 99.9% identity with SEQ ID NO: 15. In another embodiment, the isolated nucleic acid sequence comprises Cava2O2 as described in SEQ ID NO: 16 or a variant thereof. consisting of a nucleic acid sequence of less than 4000 base pairs (bp), greater than 500 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99, 1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 16. In another embodiment , the isolated nucleic acid sequence comprises Cava2δ3 as described in SEQ ID NO: 17 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5 The present invention also relates to a nucleotide sequence coding for the Ca v p regulatory protein of sequence SEQ ID No. 17. 4, 5 or 107 or a variant thereof of the appended sequence listing. It may be, for example, the sequence SEQ ID No. 12 to 14 or a variant thereof respectively of the appended sequence listing. In one embodiment, the isolated nucleic acid sequence comprises CavPa as described in SEQ ID NO: 12 or a variant thereof consisting of a nucleic acid sequence of less than 2000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7 , 99.8, 99.9% identity with SEQ ID NO: 12.
Dans un autre mode de réalisation, la séquence d'acide nucléique isolée comprend Cavpb telle que décrite dans SEQ ID NO: 13 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 1500 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 13. In another embodiment, the isolated nucleic acid sequence comprises Cavpb as described in SEQ ID NO: 13 or a variant thereof consisting of a nucleic acid sequence of less than 1500 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99, 7, 99.8, 99.9% identity with SEQ ID NO: 13.
Dans un autre mode de réalisation, la séquence d'acide nucléique isolée comprend CavPc telle que décrite dans SEQ ID NO: 14 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 2000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 14. In another embodiment, the isolated nucleic acid sequence comprises CavPc as described in SEQ ID NO: 14 or a variant thereof consisting of a nucleic acid sequence of less than 2000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99, 7, 99.8, 99.9% identity with SEQ ID NO: 14.
La présente invention se rapporte également aux acides nucléiques codant pour un complexe protéique comprenant une sous-unité Caval, une protéine régulatrice Cava2-ô et une protéine régulatrice Cavp selon la présente invention, notamment pour la protéine de séquence SEQ ID n°l à 8 et 107. Il peut s'agir par exemple d'une séquence nucléotidique comprenant ou constituée de la séquence SEQ ID n°9 à 17 ou un variant de celles-ci du listage de séquences annexé. The present invention also relates to the nucleic acids encoding a protein complex comprising a Ca v al subunit, a Ca v a2 -δ regulatory protein and a Ca v p regulatory protein according to the present invention, in particular for the SEQ sequence protein. ID No. 1 to 8 and 107. It may be for example a nucleotide sequence comprising or consisting of the sequence SEQ ID No. 9 to 17 or a variant thereof of the appended sequence listing.
La présente invention se rapporte également à un vecteur comprenant une séquence nucléotidique codant pour une des sous-unité s Caval et/ou une protéine régulatrice Cava2-ô et/ou une protéine régulatrice CavP d'abeille de la présente invention, par exemple un acide nucléique choisi parmi les séquences SEQ ID n° 9 à 17 ou un variant de celles-ci. The present invention also relates to a vector comprising a nucleotide sequence coding for one of the Caval subunits and / or a Cava2-6 regulatory protein and / or a bee CavP regulatory protein of the present invention, for example an acid. nucleic acid selected from the sequences SEQ ID Nos. 9 to 17 or a variant thereof.
Dans un mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cavla telle que décrite dans SEQ ID NO: 9 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 6000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 9. In one embodiment, the vector of the invention comprises the isolated Cavla nucleic acid sequence as described in SEQ ID NO: 9 or a variant thereof consisting of a nucleic acid sequence of less than 6000 pairs of bases (pb) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7 , 99.8, 99.9% identity with SEQ ID NO: 9.
Dans un autre mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cav2b telle que décrite dans SEQ ID NO: 10 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 5500 paires de bases (pb), plus de 600 pb et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 10. In another embodiment, the vector of the invention comprises the isolated nucleic acid sequence Cav2b as described in SEQ ID NO: 10 or a variant thereof consisting of a nucleic acid sequence of less than 5,500. base pairs (bp), more than 600 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 10.
Dans un autre mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cav3a telle que décrite dans SEQ ID NO: 11 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 7800 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5,In another embodiment, the vector of the invention comprises the isolated nucleic acid sequence Cav3a as described in SEQ ID NO: 11 or a variant thereof consisting of a nucleic acid sequence of less than 7800 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5,
99.6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 11. 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 11.
Dans un mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cavla telle que décrite dans SEQ ID NO: 9 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 6000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6,In one embodiment, the vector of the invention comprises the isolated Cavla nucleic acid sequence as described in SEQ ID NO: 9 or a variant thereof consisting of a nucleic acid sequence of less than 6000 pairs of bases (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99 , 6
99.7, 99,8, 99,9% d'identité avec SEQ ID NO: 9 et la séquence d'acide nucléique isolée Cava2ôl telle que décrite dans SEQ ID NO: 15 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 15. 99.7, 99.8, 99.9% identity with SEQ ID NO: 9 and the isolated nucleic acid sequence Cava2δ1 as described in SEQ ID NO: 15 or a variant thereof consisting of a sequence of nucleic acid of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99, 4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 15.
Dans un mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cavla telle que décrite dans SEQ ID NO: 9 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 6000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 9 et la séquence d'acide nucléique isolée Cava2ô2 telle que décrite dans SEQ ID NO: 16 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 paires de bases (pb), plus de 500 pb et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 16. In one embodiment, the vector of the invention comprises the isolated Cavla nucleic acid sequence as described in SEQ ID NO: 9 or a variant thereof consisting of a nucleic acid sequence of less than 6000 pairs of bases (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99 , 6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 9 and the isolated Cava2δ2 nucleic acid sequence as described in SEQ ID NO: 16 or a variant thereof in a nucleic acid sequence of less than 4000 base pairs (bp), more than 500 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7 , 99.8, 99.9% identity with SEQ ID NO: 16.
Dans un mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cavla telle que décrite dans SEQ ID NO: 9 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 6000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6,In one embodiment, the vector of the invention comprises the isolated Cavla nucleic acid sequence as described in SEQ ID NO: 9 or a variant thereof consisting of a nucleic acid sequence of less than 6000 pairs of bases (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99 , 6
99.7, 99,8, 99,9% d'identité avec SEQ ID NO: 9 et la séquence d'acide nucléique isolée amCava2ô3 telle que décrite dans SEQ ID NO: 17 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7,99.7, 99.8, 99.9% identity with SEQ ID NO: 9 and the isolated nucleic acid sequence amCava2δ3 as described in SEQ ID NO: 17 or a variant thereof consisting of a sequence of nucleic acid of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99, 4, 99.5, 99.6, 99.7,
99.8, 99,9% d'identité avec SEQ ID NO: 17. 99.8, 99.9% identity with SEQ ID NO: 17.
Dans un mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cavla telle que décrite dans SEQ ID NO: 9 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 6000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 9 et la séquence d'acide nucléique isolée CavPa telle que décrite dans SEQ ID NO: 12 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 2000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 12. In one embodiment, the vector of the invention comprises the isolated Cavla nucleic acid sequence as described in SEQ ID NO: 9 or a variant thereof consisting of a nucleic acid sequence of less than 6000 pairs of bases (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99 , 6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 9 and the isolated nucleic acid sequence CavPa as described in SEQ ID NO: 12 or a variant thereof consisting of in a nucleic acid sequence of less than 2000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99 , 3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 12.
Dans un mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cavla telle que décrite dans SEQ ID NO: 9 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 6000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 9 et la séquence d'acide nucléique isolée Cavpb telle que décrite dans SEQ ID NO: 13 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 1500 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 13. Dans un mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cavla telle que décrite dans SEQ ID NO: 9 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 6000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 9 et la séquence d'acide nucléique isolée CavPc telle que décrite dans SEQ ID NO: 14 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 2000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 14. Dans un autre mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cav2b telle que décrite dans SEQ ID NO: 10 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 5500 paires de bases (pb) , plus de 600 pb et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 10 et la séquence d'acide nucléique isolée Cava2ôl telle que décrite dans SEQ ID NO: 15 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 15. In one embodiment, the vector of the invention comprises the isolated Cavla nucleic acid sequence as described in SEQ ID NO: 9 or a variant thereof consisting of a nucleic acid sequence of less than 6000 pairs of bases (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99 , 6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 9 and the isolated nucleic acid sequence Cavpb as described in SEQ ID NO: 13 or a variant thereof consisting of in a nucleic acid sequence of less than 1500 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99 , 3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 13. In one embodiment, the vector of the invention comprises the isolated Cavla nucleic acid sequence as described in SEQ ID NO: 9 or a variant thereof consisting of a nucleic acid sequence of less than 6000 pairs of bases (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99 , 6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 9 and the isolated nucleic acid sequence CavPc as described in SEQ ID NO: 14 or a variant thereof in a nucleic acid sequence of less than 2000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99 , 3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 14. In another embodiment, the vector of the invention comprises the isolated nucleic acid sequence Cav2b as described in SEQ ID NO: 10 or a variant thereof consisting of a nucleic acid sequence of less than 5500 bp its (bp), greater than 600 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99 , 5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 10 and the isolated nucleic acid sequence Cava2δ1 as described in SEQ ID NO: 15 or a variant of the latter consisting of a nucleic acid sequence of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99, 99 , 2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 15.
Dans un autre mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cav2b telle que décrite dans SEQ ID NO: 10 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 5500 paires de bases (pb) , plus de 600 pb et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 10 et la séquence d'acide nucléique isolée Cava2ô2 telle que décrite dans SEQ ID NO: 16 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 paires de bases (pb), plus de 500 pb et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 16. In another embodiment, the vector of the invention comprises the isolated nucleic acid sequence Cav2b as described in SEQ ID NO: 10 or a variant thereof consisting of a nucleic acid sequence of less than 5,500. base pairs (bp), more than 600 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4 , 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 10 and the isolated nucleic acid sequence Cava2O2 as described in SEQ ID NO: 16 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp), greater than 500 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 16.
Dans un autre mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cav2b telle que décrite dans SEQ ID NO: 10 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 5500 paires de bases (pb) , plus de 600 pb et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 10 et la séquence d'acide nucléique isolée Cava2ô3 telle que décrite dans SEQ ID NO: 17 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4,In another embodiment, the vector of the invention comprises the isolated nucleic acid sequence Cav2b as described in SEQ ID NO: 10 or a variant thereof consisting of a nucleic acid sequence of less than 5,500. base pairs (bp), greater than 600 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99, 5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 10 and the isolated nucleic acid sequence Cava2δ3 as described in SEQ ID NO: 17 or a variant of that consisting of a nucleic acid sequence of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99, 99, 2, 99.3, 99.4,
99.5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 17. 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 17.
Dans un autre mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cav2b telle que décrite dans SEQ ID NO: 10 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 5500 paires de bases (pb) , plus de 600 pb et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 10 et la séquence d'acide nucléique isolée CavPa telle que décrite dans SEQ ID NO: 12 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 2000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 12. In another embodiment, the vector of the invention comprises the isolated nucleic acid sequence Cav2b as described in SEQ ID NO: 10 or a variant thereof consisting of a nucleic acid sequence of less than 5,500. base pairs (bp), more than 600 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4 , 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 10 and the isolated nucleic acid sequence CavPa as described in SEQ ID NO: 12 or a variant thereof consisting of a nucleic acid sequence of less than 2000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 12.
Dans un autre mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cav2b telle que décrite dans SEQ ID NO: 10 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 5500 paires de bases (pb) , plus de 600 pb et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 10 et la séquence d'acide nucléique isolée Cavpb telle que décrite dans SEQ ID NO: 13 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 1500 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5,In another embodiment, the vector of the invention comprises the isolated nucleic acid sequence Cav2b as described in SEQ ID NO: 10 or a variant thereof consisting of a nucleic acid sequence of less than 5,500. base pairs (bp), more than 600 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4 , 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 10 and the isolated nucleic acid sequence Cavpb as described in SEQ ID NO: 13 or a variant thereof consisting of a nucleic acid sequence of less than 1500 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1 , 99.2, 99.3, 99.4, 99.5,
99.6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 13. Dans un autre mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cav2b telle que décrite dans SEQ ID NO: 10 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 5500 paires de bases (pb) , plus de 600 pb et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 10 et la séquence d'acide nucléique isolée CavPc telle que décrite dans SEQ ID NO: 14 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 2000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 14. 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 13. In another embodiment, the vector of the invention comprises the isolated nucleic acid sequence Cav2b as described in US Pat. SEQ ID NO: 10 or a variant thereof consisting of a nucleic acid sequence of less than 5500 base pairs (bp), greater than 600 bp and having at least 90, 91, 92, 93, 94, 95 , 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 10 and the isolated nucleic acid sequence CavPc as described in SEQ ID NO: 14 or a variant of the latter consisting of a nucleic acid sequence of less than 2000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99, 99 , 2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 14.
Dans un autre mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cav3a telle que décrite dans SEQ ID NO: 11 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 7800 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5,In another embodiment, the vector of the invention comprises the isolated nucleic acid sequence Cav3a as described in SEQ ID NO: 11 or a variant thereof consisting of a nucleic acid sequence of less than 7800 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5,
99.6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 11 et la séquence d'acide nucléique isolée Cava2ôl telle que décrite dans SEQ ID NO: 15 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6,99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 11 and the isolated nucleic acid sequence Cava2δ1 as described in SEQ ID NO: 15 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99, 3, 99.4, 99.5, 99.6,
99.7, 99,8, 99,9% d'identité avec SEQ ID NO: 15. 99.7, 99.8, 99.9% identity with SEQ ID NO: 15.
Dans un autre mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cav3a telle que décrite dans SEQ ID NO: 11 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 7800 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 11 et la séquence d'acide nucléique isolée Cava2ô2 telle que décrite dans SEQ ID NO: 16 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 paires de bases (pb), plus de 500 pb et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 16. In another embodiment, the vector of the invention comprises the isolated nucleic acid sequence Cav3a as described in SEQ ID NO: 11 or a variant thereof consisting of a nucleic acid sequence of less than 7800 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 11 and the isolated nucleic acid sequence Cava2O2 as described in SEQ ID NO: 16 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp), greater than 500 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 16.
Dans un autre mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cav3a telle que décrite dans SEQ ID NO: 11 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 7800 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 11 et la séquence d'acide nucléique isolée Cava2ô3 telle que décrite dans SEQ ID NO: 17 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 17. Dans un autre mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cav3a telle que décrite dans SEQ ID NO: 11 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 7800 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 11 et la séquence d'acide nucléique isolée CavPa telle que décrite dans SEQ ID NO: 12 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 2000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 12. Dans un autre mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cav3a telle que décrite dans SEQ ID NO: 11 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 7800 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 11 et la séquence d'acide nucléique isolée Cavpb telle que décrite dans SEQ ID NO: 13 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 1500 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 13. In another embodiment, the vector of the invention comprises the isolated nucleic acid sequence Cav3a as described in SEQ ID NO: 11 or a variant thereof consisting of a nucleic acid sequence of less than 7800 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 11 and the isolated nucleic acid sequence Cava2δ3 as described in SEQ ID NO: 17 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 17. In another embodiment, the vector of the invention comprises the isolated nucleic acid sequence Cav3a as described in SEQ ID NO: 11 or a variant thereof consisting of a nucleic acid sequence of less than 7800 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 11 and the isolated nucleic acid sequence CavPa as described in SEQ ID NO: 12 or a variant thereof consisting of a nucleic acid sequence of less than 2000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 12. In another embodiment, the vector of the invention comprises the isolated nucleic acid sequence Cav3a as described in SEQ ID NO: 11 or a variant thereof consisting of a nucleic acid sequence of less than 7800 par bases (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 11 and the isolated nucleic acid sequence Cavpb as described in SEQ ID NO: 13 or a variant thereof consisting of a nucleic acid sequence of less than 1500 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 13.
Dans un autre mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cav3a telle que décrite dans SEQ ID NO: 11 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 7800 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 11 et la séquence d'acide nucléique isolée CavPc telle que décrite dans SEQ ID NO: 14 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 2000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 14. In another embodiment, the vector of the invention comprises the isolated nucleic acid sequence Cav3a as described in SEQ ID NO: 11 or a variant thereof consisting of a nucleic acid sequence of less than 7800 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 11 and the isolated nucleic acid sequence CavPc as described in SEQ ID NO: 14 or a variant thereof consisting of a nucleic acid sequence of less than 2000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 14.
Dans un mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cavla telle que décrite dans SEQ ID NO: 9 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 6000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 9 et la séquence d'acide nucléique isolée Cava2ôl telle que décrite dans SEQ ID NO: 15 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 15 et la séquence d'acide nucléique isolée CavPa telle que décrite dans SEQ ID NO: 12 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 2000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 12. In one embodiment, the vector of the invention comprises the isolated Cavla nucleic acid sequence as described in SEQ ID NO: 9 or a variant thereof consisting of a nucleic acid sequence of less than 6000 pairs of bases (pb) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7 , 99.8, 99.9% identity with SEQ ID NO: 9 and the isolated nucleic acid sequence Cava2δ1 as described in SEQ ID NO: 15 or a variant thereof consisting of an acid sequence nucleic of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4 , 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 15 and the isolated nucleic acid sequence CavPa as described in SEQ ID NO: 12 or a variant thereof consisting of a nucleic acid sequence of less than 2000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 12.
Dans un mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cavla telle que décrite dans SEQ ID NO: 9 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 6000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 9 et la séquence d'acide nucléique isolée Cava2ôl telle que décrite dans SEQ ID NO: 15 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 paires de bases (pb) et ayant au moinsIn one embodiment, the vector of the invention comprises the isolated Cavla nucleic acid sequence as described in SEQ ID NO: 9 or a variant thereof consisting of a nucleic acid sequence of less than 6000 pairs of bases (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99 , 6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 9 and the isolated nucleic acid sequence Cava2δ1 as described in SEQ ID NO: 15 or a variant thereof consisting of in a nucleic acid sequence of less than 4000 base pairs (bp) and having at least
90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 15 et la séquence d'acide nucléique isolée Cavpb telle que décrite dans SEQ ID NO: 13 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 1500 paires de bases (pb) et ayant au moins 90,90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99, 8, 99.9% identity with SEQ ID NO: 15 and the isolated nucleic acid sequence Cavpb as described in SEQ ID NO: 13 or a variant thereof consisting of a nucleic acid sequence of less than 1500 base pairs (bp) and having at least 90,
91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 13. 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 13.
Dans un mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cavla telle que décrite dans SEQ ID NO: 9 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 6000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 9 et la séquence d'acide nucléique isolée Cava2ôl telle que décrite dans SEQ ID NO: 15 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 15 et la séquence d'acide nucléique isolée CavPc telle que décrite dans SEQ ID NO: 14 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 2000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 14. In one embodiment, the vector of the invention comprises the isolated Cavla nucleic acid sequence as described in SEQ ID NO: 9 or a variant thereof consisting of a nucleic acid sequence of less than 6000 pairs of bases (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99 , 6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 9 and the isolated nucleic acid sequence Cava2δ1 as described in SEQ ID NO: 15 or a variant thereof consisting of in a nucleic acid sequence of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99, 8, 99.9% identity with SEQ ID NO: 15 and the isolated nucleic acid sequence CavPc as described in SEQ ID NO: 14 or a variant thereof consisting of a nucleic acid sequence of less than 2000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99, 5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 14.
Dans un mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cavla telle que décrite dans SEQ ID NO: 9 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 6000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 9 et la séquence d'acide nucléique isolée Cava2ô2 telle que décrite dans SEQ ID NO: 16 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 paires de bases (pb), plus de 500 pb et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 16 et la séquence d'acide nucléique isolée CavPa telle que décrite dans SEQ ID NO: 12 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 2000 paires de bases (pb) et ayant au moins 90,In one embodiment, the vector of the invention comprises the isolated Cavla nucleic acid sequence as described in SEQ ID NO: 9 or a variant thereof consisting of a nucleic acid sequence of less than 6000 pairs of bases (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99 , 6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 9 and the isolated Cava2δ2 nucleic acid sequence as described in SEQ ID NO: 16 or a variant thereof consisting of in a nucleic acid sequence of less than 4000 base pairs (bp), greater than 500 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 16 and the isolated nucleic acid sequence CavPa as described in SEQ ID NO: 12 or a variant thereof consisting of a nucleic acid sequence of less than 2000 base pairs (bp) and having at least 90,
91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 12. Dans un mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cavla telle que décrite dans SEQ ID NO: 9 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 6000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 9 et la séquence d'acide nucléique isolée Cava2ô2 telle que décrite dans SEQ ID NO: 16 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 paires de bases (pb), plus de 500 pb et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 16 et la séquence d'acide nucléique isolée Cavpb telle que décrite dans SEQ ID NO: 13 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 1500 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 13. 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 12. In one embodiment, the vector of the invention comprises the isolated nucleic acid sequence Cavla as described in SEQ ID NO: 9 or a variant thereof. consisting of a nucleic acid sequence of less than 6,000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2. 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 9 and the isolated nucleic acid sequence Cava2O2 as described. in SEQ ID NO: 16 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp), greater than 500 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 16 and the isolated nucleic acid sequence Cavpb as described in SEQ ID NO: 13 or a variant thereof being in a nucleic acid sequence of less than 1500 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 13.
Dans un mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cavla telle que décrite dans SEQ ID NO: 9 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 6000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 9 et la séquence d'acide nucléique isolée Cava2ô2 telle que décrite dans SEQ ID NO: 16 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 paires de bases (pb), plus de 500 pb et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 16 et la séquence d'acide nucléique isolée CavPc telle que décrite dans SEQ ID NO: 14 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 2000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 14. In one embodiment, the vector of the invention comprises the isolated Cavla nucleic acid sequence as described in SEQ ID NO: 9 or a variant thereof consisting of a nucleic acid sequence of less than 6000 pairs of bases (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99 , 6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 9 and the isolated Cava2δ2 nucleic acid sequence as described in SEQ ID NO: 16 or a variant thereof consisting of in a nucleic acid sequence of less than 4000 base pairs (bp), greater than 500 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 16 and the isolated nucleic acid sequence CavPc as described in SEQ ID NO: 14 or a variant thereof consisting of a nucleic acid sequence of less than 2000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 14.
Dans un mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cavla telle que décrite dans SEQ ID NO: 9 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 6000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 9 et la séquence d'acide nucléique isolée Cava2ô3 telle que décrite dans SEQ ID NO: 17 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 paires de bases (pb) et ayant au moinsIn one embodiment, the vector of the invention comprises the isolated Cavla nucleic acid sequence as described in SEQ ID NO: 9 or a variant thereof consisting of a nucleic acid sequence of less than 6000 pairs of bases (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99 , 6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 9 and the isolated nucleic acid sequence Cava2δ3 as described in SEQ ID NO: 17 or a variant thereof consisting of in a nucleic acid sequence of less than 4000 base pairs (bp) and having at least
90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 17 et la séquence d'acide nucléique isolée CavPa telle que décrite dans SEQ ID NO: 12 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 2000 paires de bases (pb) et ayant au moins 90,90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99, 8, 99.9% identity with SEQ ID NO: 17 and the isolated nucleic acid sequence CavPa as described in SEQ ID NO: 12 or a variant thereof consisting of a nucleic acid sequence of less than 2000 base pairs (bp) and having at least 90,
91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 12. 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 12.
Dans un mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cavla telle que décrite dans SEQ ID NO: 9 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 6000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 9 et la séquence d'acide nucléique isolée Cava2ô3 telle que décrite dans SEQ ID NO: 17 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 17 et la séquence d'acide nucléique isolée Cavpb telle que décrite dans SEQ ID NO: 13 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 1500 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 13. In one embodiment, the vector of the invention comprises the isolated Cavla nucleic acid sequence as described in SEQ ID NO: 9 or a variant thereof consisting of a nucleic acid sequence of less than 6,000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 9 and the isolated nucleic acid sequence Cava2δ3 as described in SEQ ID NO: 17 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 17 and the isolated nucleic acid sequence Cavpb as described in SEQ ID NO: 13 or a variant thereof consisting of a nucleic acid sequence of less than 1500 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99, 9% identity with SEQ ID NO: 13.
Dans un mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cavla telle que décrite dans SEQ ID NO: 9 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 6000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 9 et la séquence d'acide nucléique isolée Cava2ô3 telle que décrite dans SEQ ID NO: 17 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 paires de bases (pb) et ayant au moinsIn one embodiment, the vector of the invention comprises the isolated Cavla nucleic acid sequence as described in SEQ ID NO: 9 or a variant thereof consisting of a nucleic acid sequence of less than 6000 pairs of bases (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99 , 6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 9 and the isolated nucleic acid sequence Cava2δ3 as described in SEQ ID NO: 17 or a variant thereof consisting of in a nucleic acid sequence of less than 4000 base pairs (bp) and having at least
90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 17 et la séquence d'acide nucléique isolée CavPc telle que décrite dans SEQ ID NO: 14 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 2000 paires de bases (pb) et ayant au moins 90,90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99, 8, 99.9% identity with SEQ ID NO: 17 and the isolated nucleic acid sequence CavPc as described in SEQ ID NO: 14 or a variant thereof consisting of a nucleic acid sequence of less than 2000 base pairs (bp) and having at least 90,
91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 14. Dans un autre mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cav2b telle que décrite dans SEQ ID NO: 10 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 5500 paires de bases (pb) , plus de 600 pb et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 10 et la séquence d'acide nucléique isolée Cava2ôl telle que décrite dans SEQ ID NO: 15 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 15 et la séquence d'acide nucléique isolée CavPa telle que décrite dans SEQ ID NO: 12 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 2000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 12. 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 14. In another embodiment, the vector of the invention comprises the isolated nucleic acid sequence Cav2b as described in SEQ ID NO: 10 or a variant of that consisting of a nucleic acid sequence of less than 5,500 base pairs (bp), more than 600 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99 , 1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 10 and the acid sequence isolated nucleic Cava2δ1 as described in SEQ ID NO: 15 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 15 and the isolated nucleic acid sequence CavPa as described in SEQ ID NO: 12 or a variant thereof consisting of a nucleic acid sequence of less than 2000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 12.
Dans un autre mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cav2b telle que décrite dans SEQ ID NO: 10 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 5500 paires de bases (pb) , plus de 600 pb et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 10 et la séquence d'acide nucléique isolée Cava2ôl telle que décrite dans SEQ ID NO: 15 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 15 et la séquence d'acide nucléique isolée Cavpb telle que décrite dans SEQ ID NO: 13 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 1500 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 13. In another embodiment, the vector of the invention comprises the isolated nucleic acid sequence Cav2b as described in SEQ ID NO: 10 or a variant thereof consisting of a nucleic acid sequence of less than 5,500. base pairs (bp), more than 600 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4 , 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 10 and the isolated nucleic acid sequence Cava2δ1 as described in SEQ ID NO: 15 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 15 and the isolated nucleic acid sequence Cavpb as described in SEQ ID NO: 13 or a variant thereof consisting of a nucleic acid sequence of less than 1500 base pairs (bp) and having at least 90, 91, 92, 93 , 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% d identity with SEQ ID NO: 13.
Dans un autre mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cav2b telle que décrite dans SEQ ID NO: 10 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 5500 paires de bases (pb) , plus de 600 pb et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 10 et la séquence d'acide nucléique isolée Cava2ôl telle que décrite dans SEQ ID NO: 15 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 15 et la séquence d'acide nucléique isolée CavPc telle que décrite dans SEQ ID NO: 14 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 2000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 14. In another embodiment, the vector of the invention comprises the isolated nucleic acid sequence Cav2b as described in SEQ ID NO: 10 or a variant thereof consisting of a nucleic acid sequence of less than 5,500. base pairs (bp), more than 600 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4 , 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 10 and the isolated nucleic acid sequence Cava2δ1 as described in SEQ ID NO: 15 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 15 and the isolated nucleic acid sequence CavPc as described in SEQ ID NO: 14 or a variant thereof consisting of a nucleic acid sequence of less than 2000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 14.
Dans un autre mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cav2b telle que décrite dans SEQ ID NO: 10 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 5500 paires de bases (pb) , plus de 600 pb et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2,In another embodiment, the vector of the invention comprises the isolated nucleic acid sequence Cav2b as described in SEQ ID NO: 10 or a variant thereof consisting of a nucleic acid sequence of less than 5,500. base pairs (bp), more than 600 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2,
99.3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 10 et la séquence d'acide nucléique isolée Cava2ô2 telle que décrite dans SEQ ID NO: 16 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 paires de bases (pb), plus de 500 pb et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1,99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 10 and the isolated nucleic acid sequence Cava2O2 as described in SEQ ID NO: 16 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp), greater than 500 bp and having at least 90, 91, 92, 93, 94, 95, 96 , 97, 98, 99, 99.1,
99.2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 16 et la séquence d'acide nucléique isolée CavPa telle que décrite dans SEQ ID NO: 12 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 2000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3,99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 16 and the isolated nucleic acid sequence CavPa as described in SEQ ID NO: 12 or a variant thereof consisting of a nucleic acid sequence of less than 2000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3,
99.4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 12. 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 12.
Dans un autre mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cav2b telle que décrite dans SEQ ID NO: 10 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 5500 paires de bases (pb), plus de 600 pb et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2,In another embodiment, the vector of the invention comprises the isolated nucleic acid sequence Cav2b as described in SEQ ID NO: 10 or a variant thereof consisting of a nucleic acid sequence of less than 5,500. base pairs (bp), more than 600 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2,
99.3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 10 et la séquence d'acide nucléique isolée Cava2ô2 telle que décrite dans SEQ ID NO: 16 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 paires de bases (pb), plus de 500 pb et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 16 et la séquence d'acide nucléique isolée Cavpb telle que décrite dans SEQ ID NO: 13 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 1500 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3,99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 10 and the isolated nucleic acid sequence Cava2O2 as described in SEQ ID NO: 16 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp), greater than 500 bp and having at least 90, 91, 92, 93, 94, 95, 96 , 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO : 16 and the isolated nucleic acid sequence Cavpb as described in SEQ ID NO: 13 or a variant thereof consisting of a nucleic acid sequence of less than 1500 base pairs (bp) and having at least 90 , 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3,
99.4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 13. Dans un autre mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cav2b telle que décrite dans SEQ ID NO: 10 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 5500 paires de bases (pb), plus de 600 pb et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 10 et la séquence d'acide nucléique isolée Cava2ô2 telle que décrite dans SEQ ID NO: 16 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 paires de bases (pb), plus de 500 pb et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1,99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 13. In another embodiment, the vector of the invention comprises the isolated nucleic acid sequence Cav2b as described in SEQ ID NO: 10 or a variant thereof consisting of a nucleic acid sequence of less than 5,500. base pairs (bp), more than 600 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4 , 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 10 and the isolated nucleic acid sequence Cava2O2 as described in SEQ ID NO: 16 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp), greater than 500 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1,
99.2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 16 et la séquence d'acide nucléique isolée CavPc telle que décrite dans SEQ ID NO: 14 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 2000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3,99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 16 and the isolated nucleic acid sequence CavPc as described in SEQ ID NO: 14 or a variant thereof consisting of a nucleic acid sequence of less than 2000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3,
99.4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 14. 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 14.
Dans un autre mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cav2b telle que décrite dans SEQ ID NO: 10 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 5500 paires de bases (pb), plus de 600 pb et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2,In another embodiment, the vector of the invention comprises the isolated nucleic acid sequence Cav2b as described in SEQ ID NO: 10 or a variant thereof consisting of a nucleic acid sequence of less than 5,500. base pairs (bp), more than 600 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2,
99.3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 10 et la séquence d'acide nucléique isolée Cava2ô3 telle que décrite dans SEQ ID NO: 17 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4,99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 10 and the isolated nucleic acid sequence Cava2δ3 as described in SEQ ID NO: 17 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4,
99.5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 17 et la séquence d'acide nucléique isolée CavPa telle que décrite dans SEQ ID NO: 12 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 2000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 12. 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 17 and the isolated nucleic acid sequence CavPa as described in SEQ ID NO: 12 or a variant of that consisting of a nucleic acid sequence of less than 2000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99, 99, 2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 12.
Dans un autre mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cav2b telle que décrite dans SEQ ID NO: 10 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 5500 paires de bases (pb), plus de 600 pb et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 10 et la séquence d'acide nucléique isolée Cava2ô3 telle que décrite dans SEQ ID NO: 17 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 17 et la séquence d'acide nucléique isolée Cavpb telle que décrite dans SEQ ID NO: 13 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 1500 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 13. Dans un autre mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cav2b telle que décrite dans SEQ ID NO: 10 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 5500 paires de bases (pb), plus de 600 pb et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 10 et la séquence d'acide nucléique isolée Cava2ô3 telle que décrite dans SEQ ID NO: 17 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4,In another embodiment, the vector of the invention comprises the isolated nucleic acid sequence Cav2b as described in SEQ ID NO: 10 or a variant thereof consisting of a nucleic acid sequence of less than 5,500. base pairs (bp), more than 600 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 10 and the isolated nucleic acid sequence Cava2δ3 as described in SEQ ID NO: 17 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 17 and the isolated nucleic acid sequence Cavpb as described in SEQ ID NO: 13 or a variant thereof consisting of a nucleic acid sequence of less than 1500 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99, 9% identity with SEQ ID NO: 13. In another embodiment, the vector of the invention comprises the isolated nucleic acid sequence Cav2b as described in SEQ ID NO: 10 or a variant thereof consisting of a nucleic acid sequence of less than 5 500 base pairs (bp), more than 600 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99, 4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 10 and the isolated Cava2δ3 nucleic acid sequence as described in SEQ ID NO: 17 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99, 1, 99.2, 99.3, 99.4,
99.5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 17 et la séquence d'acide nucléique isolée CavPc telle que décrite dans SEQ ID NO: 14 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 2000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 14. 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 17 and the isolated nucleic acid sequence CavPc as described in SEQ ID NO: 14 or a variant of that consisting of a nucleic acid sequence of less than 2000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99, 99, 2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 14.
Dans un autre mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cav3a telle que décrite dans SEQ ID NO: 11 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 7800 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5,In another embodiment, the vector of the invention comprises the isolated nucleic acid sequence Cav3a as described in SEQ ID NO: 11 or a variant thereof consisting of a nucleic acid sequence of less than 7800 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5,
99.6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 11 et la séquence d'acide nucléique isolée Cava2ôl telle que décrite dans SEQ ID NO: 15 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 15 et la séquence d'acide nucléique isolée CavPa telle que décrite dans SEQ ID NO: 12 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 2000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 12. 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 11 and the isolated nucleic acid sequence Cava2δ1 as described in SEQ ID NO: 15 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99, 3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 15 and the isolated nucleic acid sequence CavPa as described in SEQ ID NO: 12 or a variant thereof consisting of a sequence nucleic acid of less than 2000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 12.
Dans un autre mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cav3a telle que décrite dans SEQ ID NO: 11 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 7800 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 11 et la séquence d'acide nucléique isolée Cava2ôl telle que décrite dans SEQ ID NO: 15 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 15 et la séquence d'acide nucléique isolée Cavpb telle que décrite dans SEQ ID NO: 13 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 1500 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 13. In another embodiment, the vector of the invention comprises the isolated nucleic acid sequence Cav3a as described in SEQ ID NO: 11 or a variant thereof consisting of a nucleic acid sequence of less than 7800 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 11 and the isolated nucleic acid sequence Cava2δ1 as described in SEQ ID NO: 15 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 15 and the isolated nucleic acid sequence Cavpb as described in SEQ ID NO: 13 or a variant thereof consisting of a nucleic acid sequence of less than 1500 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 13.
Dans un autre mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cav3a telle que décrite dans SEQ ID NO: 11 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 7800 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5,In another embodiment, the vector of the invention comprises the isolated nucleic acid sequence Cav3a as described in SEQ ID NO: 11 or a variant thereof consisting of a nucleic acid sequence of less than 7800 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5,
99.6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 11 et la séquence d'acide nucléique isolée Cava2ôl telle que décrite dans SEQ ID NO: 15 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6,99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 11 and the isolated nucleic acid sequence Cava2δ1 as described in SEQ ID NO: 15 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99, 3, 99.4, 99.5, 99.6,
99.7, 99,8, 99,9% d'identité avec SEQ ID NO: 15 et la séquence d'acide nucléique isolée CavPc telle que décrite dans SEQ ID NO: 14 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 2000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 14. 99.7, 99.8, 99.9% identity with SEQ ID NO: 15 and the isolated nucleic acid sequence CavPc as described in SEQ ID NO: 14 or a variant thereof consisting of a sequence of nucleic acid of less than 2000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 14.
Dans un autre mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cav3a telle que décrite dans SEQ ID NO: 11 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 7800 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5,In another embodiment, the vector of the invention comprises the isolated nucleic acid sequence Cav3a as described in SEQ ID NO: 11 or a variant thereof consisting of a nucleic acid sequence of less than 7800 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5,
99.6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 11 et la séquence d'acide nucléique isolée Cava2ô2 telle que décrite dans SEQ ID NO: 16 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 paires de bases (pb), plus de 500 pb et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 16 et la séquence d'acide nucléique isolée CavPa telle que décrite dans SEQ ID NO: 12 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 2000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 12. 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 11 and the isolated nucleic acid sequence Cava2δ2 as described in SEQ ID NO: 16 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp), greater than 500 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99, 99 , 2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 16 and the isolated nucleic acid sequence CavPa as as described in SEQ ID NO: 12 or a variant thereof consisting of a nucleic acid sequence of less than 2000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96 , 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO : 12.
Dans un autre mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cav3a telle que décrite dans SEQ ID NO: 11 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 7800 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 11 et la séquence d'acide nucléique isolée Cava2ô2 telle que décrite dans SEQ ID NO: 16 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 paires de bases (pb), plus de 500 pb et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 16 et la séquence d'acide nucléique isolée Cavpb telle que décrite dans SEQ ID NO: 13 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 1500 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6,In another embodiment, the vector of the invention comprises the isolated nucleic acid sequence Cav3a as described in SEQ ID NO: 11 or a variant thereof consisting of a nucleic acid sequence of less than 7800 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 11 and the isolated nucleic acid sequence Cava2O2 as described in SEQ ID NO: 16 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp), greater than 500 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 16 and the isolated nucleic acid sequence Cavpb as described in SEQ ID NO: 13 or a variant thereof consisting of a nucleic acid sequence of less than 1500 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6,
99.7, 99,8, 99,9% d'identité avec SEQ ID NO: 13. 99.7, 99.8, 99.9% identity with SEQ ID NO: 13.
Dans un autre mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cav3a telle que décrite dans SEQ ID NO: 11 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 7800 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5,In another embodiment, the vector of the invention comprises the isolated nucleic acid sequence Cav3a as described in SEQ ID NO: 11 or a variant of the latter consisting of a nucleic acid sequence of less than 7800 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99, 99 , 2, 99.3, 99.4, 99.5,
99.6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 11 et la séquence d'acide nucléique isolée Cava2ô2 telle que décrite dans SEQ ID NO: 16 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 paires de bases (pb), plus de 500 pb et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 16 et la séquence d'acide nucléique isolée CavPc telle que décrite dans SEQ ID NO: 14 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 2000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6,99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 11 and the isolated nucleic acid sequence Cava2δ2 as described in SEQ ID NO: 16 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp), greater than 500 bp and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99, 99 , 2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 16 and the isolated nucleic acid sequence CavPc as as described in SEQ ID NO: 14 or a variant thereof consisting of a nucleic acid sequence of less than 2000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96 , 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6,
99.7, 99,8, 99,9% d'identité avec SEQ ID NO: 14. 99.7, 99.8, 99.9% identity with SEQ ID NO: 14.
Dans un autre mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cav3a telle que décrite dans SEQ ID NO: 11 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 7800 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 11 et la séquence d'acide nucléique isolée Cava2ô3 telle que décrite dans SEQ ID NO: 17 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 17 et la séquence d'acide nucléique isolée CavPa telle que décrite dans SEQ ID NO: 12 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 2000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 12. Dans un autre mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cav3a telle que décrite dans SEQ ID NO: 11 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 7800 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 11 et la séquence d'acide nucléique isolée Cava2ô3 telle que décrite dans SEQ ID NO: 17 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 17 et la séquence d'acide nucléique isolée Cavpb telle que décrite dans SEQ ID NO: 13 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 1500 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 13. In another embodiment, the vector of the invention comprises the isolated nucleic acid sequence Cav3a as described in SEQ ID NO: 11 or a variant thereof consisting of a nucleic acid sequence of less than 7800 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 11 and the isolated nucleic acid sequence Cava2δ3 as described in SEQ ID NO: 17 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 17 and the isolated nucleic acid sequence CavPa as described in SEQ ID NO: 12 or a variant thereof consisting of a nucleic acid sequence of less than 2000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 12. In another embodiment, the vector of the invention comprises the isolated nucleic acid sequence Cav3a as described in SEQ ID NO: 11 or a variant thereof consisting of a nucleic acid sequence of less than 7800 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 11 and the isolated nucleic acid sequence Cava2δ3 as described in SEQ ID NO: 17 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 17 and the isolated nucleic acid sequence Cavpb as described in SEQ ID NO: 13 or a variant thereof consisting of a nucleic acid sequence of less than 1500 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 13.
Dans un autre mode de réalisation, le vecteur de l'invention comprend la séquence d'acide nucléique isolée Cav3a telle que décrite dans SEQ ID NO: 11 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 7800 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5,In another embodiment, the vector of the invention comprises the isolated nucleic acid sequence Cav3a as described in SEQ ID NO: 11 or a variant thereof consisting of a nucleic acid sequence of less than 7800 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5,
99.6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 11 et la séquence d'acide nucléique isolée Cava2ô3 telle que décrite dans SEQ ID NO: 17 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6,99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 11 and the isolated nucleic acid sequence Cava2δ3 as described in SEQ ID NO: 17 or a variant thereof consisting of a nucleic acid sequence of less than 4000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99, 3, 99.4, 99.5, 99.6,
99.7, 99,8, 99,9% d'identité avec SEQ ID NO: 17 et la séquence d'acide nucléique isolée CavPc telle que décrite dans SEQ ID NO: 14 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 2000 paires de bases (pb) et ayant au moins 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9% d'identité avec SEQ ID NO: 14. 99.7, 99.8, 99.9% identity with SEQ ID NO: 17 and the isolated nucleic acid sequence CavPc as described in SEQ ID NO: 14 or a variant thereof consisting of a sequence of nucleic acid of less than 2000 base pairs (bp) and having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99, 4, 99.5, 99.6, 99.7, 99.8, 99.9% identity with SEQ ID NO: 14.
On entend par « vecteur » au sens de la présente invention, des vecteurs d'expression et/ou de sécrétion dans une cellule hôte déterminée. Ils peuvent par exemple être des vecteurs d'origine plasmidique ou virale, comportant, outre la séquence d'acide nucléique, les moyens nécessaires à son expression. Ces moyens peuvent par exemple inclure un promoteur, des signaux d'initiation et de terminaison de la traduction, ainsi que des régions appropriées de régulation de la transcription. Le vecteur d'expression peut également comprendre d'autres éléments tels qu'une origine de réplication, un site de clonage multiple, un enhanceur, un peptide signal qui pourra être fusionné en phase avec le polypeptide produit lors du clonage, et un ou plusieurs marqueurs de sélection. Le vecteur peut être un des vecteurs connus de l'homme du métier pour fabriquer des protéines par recombinaison génétique. Il peut s'agir par exemple d'un vecteur plasmidique, d'un vecteur viral, par exemple un vecteur adénoviral, un vecteur rétroviral, un bactériophage. Il est choisi en général notamment en fonction de l'hôte cellulaire choisi. Le vecteur peut être par exemple choisi parmi les vecteurs listés dans le catalogue http://www.promega.com/vectors/mammalian_express_vectors.htm [7] ou http///wwwqiagen.com [8] ou encore https://www.lifetechnologies.com [18]). Il peut s'agir par exemple du vecteur d'expression décrit dans le document WO 83/004261 [10]. For the purpose of the present invention, the term "vector" is intended to mean expression and / or secretion vectors in a specific host cell. They may for example be vectors of plasmid or viral origin, comprising, in addition to the nucleic acid sequence, the means necessary for its expression. These means may for example include a promoter, translation initiation and termination signals, as well as appropriate transcriptional regulatory regions. The expression vector can also comprise other elements such as an origin of replication, a multiple cloning site, an enhancer, a signal peptide that can be fused in phase with the polypeptide produced during cloning, and one or more selection markers. The vector may be one of the vectors known to those skilled in the art for manufacturing proteins by genetic recombination. It may be for example a plasmid vector, a viral vector, for example an adenoviral vector, a retroviral vector or a bacteriophage. It is generally chosen in particular according to the chosen cellular host. The vector may for example be chosen from the vectors listed in the catalog http://www.promega.com/vectors/mammalian_express_vectors.htm [7] or http /// wwwqiagen.com [8] or https: // www .lifetechnologies.com [18]). It may be for example the expression vector described in WO 83/004261 [10].
Les acides nucléiques de la présente invention ou les vecteurs de la présente invention sont utilisables notamment pour la fabrication par recombinaison génétique ou expression hétérologue des sous-unités Cavccl et/ou des protéines régulatrices de la présente invention. Aussi, la présente invention se rapporte également à une cellule hôte comprenant une séquence d'acides nucléiques selon l'invention ou un vecteur selon l'invention telle que définie ci-dessus. Les acides nucléiques de la présente invention ou les vecteurs de la présente invention sont utilisables notamment pour la fabrication par recombinaison génétique ou expression hétérologue des canaux calciques de la présente invention. Aussi, la présente invention se rapporte également à une cellule transformée comprenant une séquence d'acides nucléiques selon l'invention ou un vecteur selon l'invention. On entend par « cellule transformée » au sens de la présente invention une cellule procaryote ou eucaryote. Les cellules transformables selon la présente invention sont celles couramment utilisées pour les recombinaisons génétiques ou expressions hétérologues. Elles incluent notamment des cellules de bactéries telles que Escherichia coli ou Bacillus sp., des cellules de levures telles que Saccharomyces cerevisiae, des cellules de champignons telles que Aspergillus niger, des cellules d'insectes, telles que SF9, et des cellules de mammifères (notamment humaines) telles que les lignées cellulaires CHO, HEK 293, PER-C6, des cellules d'amphibiens, par exemple des ovocytes de Xénope, etc. Dans un mode de réalisation préféré, la cellule transformée de l'invention est un ovocyte de Xénope. Les techniques de recombinaison génétiques ou expressions hétérologues utilisables dans la présente invention sont celles connues de l'homme du métier. Il peut s'agir par exemple des techniques décrites dans Guide to Molecular Cloning Techniques (Guide to Molecular Cloning Techniques, Editeurs Berger SL et Kimmel AR, Methods in Enzymology, vol. 152 [11]) ou Molecular Cloning, A Laboratory Manual (Molecular Cloning, A Laboratory Manual Editeurs Green MR et Sambrook J., Cold Spring Harbor Laboratory Press [12]) The nucleic acids of the present invention or the vectors of the present invention are useful in particular for the manufacture by genetic recombination or heterologous expression of the Cavc11 subunits and / or regulatory proteins of the present invention. Also, the present invention also relates to a host cell comprising a nucleic acid sequence according to the invention or a vector according to the invention as defined above. The nucleic acids of the present invention or the vectors of the present invention are useful in particular for the manufacture by genetic recombination or heterologous expression of the calcium channels of the present invention. Also, the present invention also relates to a transformed cell comprising a nucleic acid sequence according to the invention or a vector according to the invention. For the purposes of the present invention, the term "transformed cell" means a prokaryotic or eukaryotic cell. Transformable cells according to the present invention are those commonly used for genetic recombinations or heterologous expressions. They include in particular cells of bacteria such as Escherichia coli or Bacillus sp., Yeast cells such as Saccharomyces cerevisiae, fungi cells such as Aspergillus niger, insect cells, such as SF9, and mammalian cells ( especially human) such as cell lines CHO, HEK 293, PER-C6, amphibian cells, for example Xenopus oocytes, etc. In a preferred embodiment, the transformed cell of the invention is a Xenopus oocyte. The genetic recombination techniques or heterologous expressions that can be used in the present invention are those known to those skilled in the art. This may be for example the techniques described in Guide to Molecular Cloning Techniques (Guide to Molecular Cloning Techniques, Berger SL Editors and Kimmel AR, Methods in Enzymology, Vol 152 [11]) or Molecular Cloning, A Laboratory Manual (Molecular Cloning, A Laboratory Manual Editors Green MR and Sambrook J., Cold Spring Harbor Laboratory Press [12])
En fonction de la cellule à transformer, l'homme du métier peut aisément déterminer les moyens nécessaires à l'introduction et à l'expression de la séquence nucléotidique de la présente invention dans la cellule hôte choisie, ainsi que le vecteur d'expression utilisable. Depending on the cell to be transformed, those skilled in the art can easily determine the means necessary for the introduction and expression of the nucleotide sequence of the present invention in the chosen host cell, as well as the usable expression vector. .
La cellule transformée par un vecteur d'expression selon l'invention ou une séquence nucléique selon l'invention exprime alors le polypeptide correspondant de manière stable, comme décrit dans les exemples ci-dessous. L'homme du métier peut aisément vérifier que la cellule hôte exprime le polypeptide de manière stable, par toute technique connue de l'homme du métier permettant d'identifier les peptides de la présente invention en fonction de leur poids moléculaire notamment, par exemple en utilisant la technique du Western blot. The cell transformed with an expression vector according to the invention or a nucleic acid sequence according to the invention then expresses the corresponding polypeptide in a stable manner, as described in the examples below. Those skilled in the art can easily verify that the host cell expresses the polypeptide stably, by any technique known to those skilled in the art to identify the peptides of the present invention according to their molecular weight including, for example in using the Western blot technique.
La cellule transformée peut être toute cellule appropriée pour la fabrication par recombinaison génétique ou expression hétérologue de canaux calciques de la présente invention à partir des séquences nucléiques ou des vecteurs de l'invention. Il peut s'agir par exemple d'E. Coli, par exemple E. coli BL21, E. coli Origami (DE3) de Pischia pastoris, de Saccharomyces cerevisiae, de cellules d'insectes, par exemple un système cellules d'insectes-baculovirus (par exemple cellules d'insecte SF9 utilisant un système d'expression de baculovirus), de mammifères, par exemple des cellules hek293, de batraciens par exemple des ovocytes de Xénope. The transformed cell may be any cell suitable for making by genetic recombination or heterologous expression of calcium channels of the present invention from the nucleic sequences or vectors of the invention. It can be for example E. Coli, e.g. E. coli BL21, E. coli Origami (DE3) from Pischia pastoris, Saccharomyces cerevisiae, insect cells, e.g. insect-baculovirus cell system (e.g., SF9 insect cells using a baculovirus expression system), mammals, for example hek293 cells, amphibians, for example Xenopus oocytes.
Les moyens de culture de ces cellules sont ceux connus de l'homme du métier, par exemple ceux décrits dans les documents précités. Les inventeurs sont les tout premiers à avoir isolé et caractérisé une sous-unité Caval, une protéine régulatrice Cava2-ô et une protéine régulatrice Cavp du canal calcique d'abeille. En particulier, les inventeurs ont en outre montré que ce canal composé d'une sous-unité Caval et/ou de la protéine régulatrice Cava2-ô et/ou de la protéine régulatrice Cavp d'abeille sont sensibles à certains composés qui peuvent modifier les propriétés du canal composé d'une sous-unité Caval et/ou la protéine régulatrice Cava2-ô et/ou de la protéine régulatrice Cavp d'abeille, par exemple par obturation du pore du canal, par exemple par modification des cinétiques du courant calcique ou par exemple par modification de sa sensibilité au voltage, et peuvent donc être utilisés notamment pour analyser la toxicité de molécules. The culture means of these cells are those known to those skilled in the art, for example those described in the aforementioned documents. The inventors are the first to have isolated and characterized a Ca v al subunit, a Ca v a2 -δ regulatory protein and a Ca v p regulatory protein of the bee calcium channel. In particular, the inventors have furthermore shown that this channel composed of a Ca v al subunit and / or the regulatory protein Ca v a2 -δ and / or the regulatory protein Ca v p bee are sensitive to certain compounds which can modify the properties of the Ca v al subunit channel and / or the Ca v a2 -δ regulatory protein and / or the Ca v p protein, for example by plugging the pore the channel, for example by modifying the kinetics of the calcium current or for example by changing its sensitivity to voltage, and can therefore be used in particular to analyze the toxicity of molecules.
Le canal calcique d'insectes comprend un gène Cavla ou Cav2b ou Cav3a qui constitue la sous-unité formant le pore du canal par où transitent les ions. L'épissage alternatif de l'ARN et le montage de ce gène peut générer de nombreuses variantes des canaux calciques avec une voltage-dépendance, des cinétiques et/ou des propriétés pharmacologiques différentes. L'activité du canal calcique est modulée par des sous- unités régulatrices. Ces sous-unités régulatrices peuvent également générer des variantes avec des propriétés différentes. The calcium channel of insects comprises a Cav1a or Cav2b or Cav3a gene which constitutes the subunit forming the pore of the channel through which the ions pass. The alternative splicing of RNA and the assembly of this gene can generate many variants of calcium channels with different voltage-dependence, kinetics and / or pharmacological properties. The activity of the calcium channel is modulated by regulatory subunits. These regulatory subunits can also generate variants with different properties.
Dans un mode de réalisation, les cellules modifiées exprimant le canal calcique d'un insecte pollinisateur sont porteuses de mutations qui confèrent une sensibilité réduite à un composé test. In one embodiment, the modified cells expressing the calcium channel of a pollinating insect carry mutations that confer reduced sensitivity to a test compound.
La présente invention se rapporte donc également à un procédé in vitro de détermination de la toxicité d'une molécule et/ou analyse de la toxicité d'une molécule et/ou détection d'une molécule toxique, ledit procédé comprenant une étape d'analyse électrophysiologique ou d'imagerie calcique comprenant la mise en contact de ladite molécule avec un canal selon l'invention ou avec une cellule transformée selon l'invention. The present invention thus also relates to an in vitro method for determining the toxicity of a molecule and / or analyzing the toxicity of a molecule and / or detecting a toxic molecule, said method comprising a step of analysis electrophysiological or calcium imaging comprising contacting said molecule with a channel according to the invention or with a transformed cell according to the invention.
La présente invention se rapporte également à la détermination de l'interaction entre le canal selon l'invention et une molécule. Dans la présente, on entend par « molécule » toute molécule que l'on souhaite tester afin de déterminer si elle interagit avec la sous-unité Caval et/ou la protéine régulatrice Cava2-ô et/ou de la protéine régulatrice Cavp d'abeille. Il peut s'agir par exemple de molécules chimiques et/ou biologiques, par exemple de molécules utilisées comme insecticide, comme désherbant, comme antifongique, comme engrais, phytosanitaires, et plus généralement de toute molécule utilisée dans les domaines de la production agricole, animalière, viticole, domestique, etc. Il peut s'agir de molécules existantes ou de nouvelles molécules qui grâce à la présente invention pourront être testées avant utilisation dans la nature. Un objet de l'invention est un procédé in vitro pour déterminer l'effet d'un composé test sur l'activité d'un canal calcique d'un insecte pollinisateur, comprenant: a. la mise en contact des cellules transformées décrites ci-dessus, avec un composé test, The present invention also relates to the determination of the interaction between the channel according to the invention and a molecule. As used herein, the term "molecule" means any molecule that it is desired to test in order to determine whether it interacts with the Ca v al subunit and / or the Ca v a2 -δ regulatory protein and / or the regulatory protein. Ca v bee p. It may be for example chemical and / or biological molecules, for example molecules used as an insecticide, as weed killer, as antifungal, as fertilizer, phytosanitary, and more generally any molecule used in the fields of agricultural production, animal , viticultural, domestic, etc. These may be existing molecules or new molecules which, thanks to the present invention, may be tested before use in nature. An object of the invention is an in vitro method for determining the effect of a test compound on the activity of a calcium channel of a pollinating insect, comprising: a. bringing the transformed cells described above into contact with a test compound
b. mesurer l'effet dudit composé sur l'activité du canal calcique, et comparer l'effet dudit composé à l'effet d'un composé contrôle ou une solution de véhicule, en déterminant ainsi une activité de modulation du canal calcique.  b. measuring the effect of said compound on the activity of the calcium channel, and comparing the effect of said compound with the effect of a control compound or a vehicle solution, thereby determining a calcium channel modulation activity.
Un autre objet de l'invention est un procédé in vitro pour déterminer l'effet d'un composé test sur l'activité d'un canal calcique d'un insecte pollinisateur, comprenant: a. la mise en contact d'une cellule transformée telle que décrite ci-dessus avec une solution de véhicule, Another object of the invention is an in vitro method for determining the effect of a test compound on the activity of a calcium channel of a pollinating insect, comprising: a. contacting a transformed cell as described above with a vehicle solution,
b. l'induction d'au moins une impulsion sur ladite cellule transformée,  b. inducing at least one pulse on said transformed cell,
c. la mesure de l'effet de ladite solution de véhicule sur l'activité du canal calcique, d. la mise en contact de ladite cellule modifiée telle que décrite ci-dessus avec un composé test,  vs. measuring the effect of said vehicle solution on calcium channel activity, d. bringing said modified cell as described above into contact with a test compound,
e. l'induction d'au moins une impulsion sur ladite cellule transformée,  e. inducing at least one pulse on said transformed cell,
f. la mesure de l'effet dudit composé test sur l'activité du canal calcique, et comparer l'effet dudit composé à l'effet de ladite solution de véhicule, en déterminant ainsi une activité de modulation du canal calcique. Un autre objet de l'invention est un procédé in vitro pour déterminer l'effet d'un composé test sur l'activité d'un canal calcique d'un pollinisateur insecte, comprenant: a. la mise en contact d'une cellule modifiée telle que décrite ci-dessus avec une solution de véhicule, f. measuring the effect of said test compound on calcium channel activity, and comparing the effect of said compound on the effect of said vehicle solution, thereby determining a calcium channel modulation activity. Another object of the invention is an in vitro method for determining the effect of a test compound on the activity of a calcium channel of an insect pollinator, comprising: a. contacting a modified cell as described above with a vehicle solution,
b. l'induction d'au moins une impulsion sur ladite cellule transformée,  b. inducing at least one pulse on said transformed cell,
c. la mesure de l'effet de ladite solution de véhicule sur l'activité du canal calcique, d. l'induction d'au moins une impulsion sur ladite cellule transformée,  vs. measuring the effect of said vehicle solution on calcium channel activity, d. inducing at least one pulse on said transformed cell,
e. la mise en contact de ladite cellule modifiée telle que décrite ci-dessus avec un composé test,  e. bringing said modified cell as described above into contact with a test compound,
f. la mesure de l'effet dudit composé test sur l'activité du canal calcique, et comparer l'effet dudit composé à l'effet de ladite solution de véhicule, en déterminant ainsi une activité de modulation du canal calcique.  f. measuring the effect of said test compound on calcium channel activity, and comparing the effect of said compound on the effect of said vehicle solution, thereby determining a calcium channel modulation activity.
La solution de véhicule utilisée ici se rapporte à la même solution qui comprend le composé test. The vehicle solution used herein refers to the same solution that comprises the test compound.
Le composé contrôle tel qu'il est utilisé ici, désigne un composé dont l'effet sur l'activité du canal calcique est bien connu de l'homme du métier. The control compound as used herein refers to a compound whose effect on calcium channel activity is well known to those skilled in the art.
Dans un mode de réalisation de l'invention, le composé contrôle est un composé connu pour être toxique sur le canal calcique de l'insecte pollinisateur. In one embodiment of the invention, the control compound is a compound known to be toxic to the calcium channel of the pollinating insect.
Dans un autre mode de réalisation de l'invention, le composé contrôle est un composé connu pour être toxique sur le canal calcique d'autres espèces telles que les espèces invasives. In another embodiment of the invention, the control compound is a compound known to be toxic to the calcium channel of other species such as invasive species.
Des exemples de ces espèces invasives comprennent, mais ne sont pas limitées à : les espèces introduites, abeilles importées, les espèces de l'hyménoptère de l'ordre, la famille Vespidae et la sous-famille Vespinae notamment asiatiques guêpe prédatrice (Vespa velutina), des araignées, des parasites, des endoparasites, ectoparasites de la classe arachnides, la famille Varroidae tels que: Varroa jacobsoni, Varroa destructor, Varroa underwoodi, Varroa rindereri. Des exemples de composés utilisés comme composé contrôle comprennent mais ne sont pas limités à : des modulateurs directs par exemple des pyréthrinoides (perméthrine, tétraméthrine, alléthrine...), des dihydropyridines (nifédipine, nicardipine, BayK 8644..), des benzothiazépines (verapamil), des phénylalkylamines (diltiazem, D600), des toxines animales (conotoxines GVIA, agatoxines AgalVA, atracotoxines, Cû- atracotioxineHvla), ou des modulateurs indirects de la phosphorylation dépendante de la Srckinase, PKA, PKC ou Pi3kinase par exemple (genistein, staurosporine, H89, Wortmannin, LY294002). Ces modulations peuvent être agonistes ou antagonistes. Examples of these invasive species include, but are not limited to: introduced species, imported bees, hymenopteran species of the order, family Vespidae and subfamily Vespinae including Asian predatory wasp (Vespa velutina) , spiders, parasites, endoparasites, ectoparasites of the arachnid class, the Varroidae family such as Varroa jacobsoni, Varroa destructor, Varroa underwoodi, Varroa rindereri. Examples of compounds used as a control compound include but are not limited to: direct modulators for example pyrethrinoids (permethrin, tetramethrin, allethrin ...), dihydropyridines (nifedipine, nicardipine, BayK 8644 ..), benzothiazepines ( verapamil), phenylalkylamines (diltiazem, D600), animal toxins (GVIA conotoxins, AgalVA agonists, atracotoxins, Cu- atracotioxinHvla), or indirect modulators of Srckinase-dependent phosphorylation, PKA, PKC or Pi3kinase for example (genistein, staurosporine, H89, Wortmannin, LY294002). These modulations may be agonist or antagonistic.
Dans un mode de réalisation, le composé contrôle module l'activité du canal calcique. Dans un mode de réalisation, la dose létale d'un composé à tester est ajoutée au milieu de culture. In one embodiment, the control compound modulates the activity of the calcium channel. In one embodiment, the lethal dose of a test compound is added to the culture medium.
Dans un autre mode de réalisation, la dose sub-létale d'un composé à tester est ajoutée au milieu de culture. In another embodiment, the sub-lethal dose of a test compound is added to the culture medium.
Dans un autre mode de réalisation, la dose minimale de modulation d'un composé à tester est ajoutée au milieu de culture. In another embodiment, the minimum modulation dose of a test compound is added to the culture medium.
La présente invention fournit donc un moyen efficace pour lutter contre la disparition des abeilles et/ou en déterminer les causes. The present invention thus provides an effective means for combating the disappearance of bees and / or determining the causes thereof.
À titre d'exemple, les molécules chimiques peuvent être des insecticides, par exemple perméthrine, par exemple alléthrine, des engrais, des pesticides. Des exemples de composés tests comprennent des molécules qui comprennent, mais ne sont pas limités à : des composés chimiques, des entités chimiques nouvelles, siRNA, shRNA, un oligonucléotide antisens, des ribozymes ou aptamères, agoniste ou antagoniste des canaux calciques, des anticorps ou des fragments de celui-ci, diabodies modulant l'activité d'un canal calcique d'un insecte pollinisateur. À titre d'exemple, les composés tests comprennent des molécules d'origines biologiques qui peuvent être dans une liste non-limitative : des venins d'insectes, par exemple d'araignée, des venins de mollusques, par exemple d'escargot ou des venins de vertébrés, par exemple de serpent, des neurotoxines telles que la tétrodotoxine, et batrachotoxine, les toxines de plantes, des toxines de scorpion, ou d'autres produits naturels utilisés dans la gestion intégrée des ravageurs. For example, the chemical molecules can be insecticides, for example permethrin, for example allethrin, fertilizers, pesticides. Examples of test compounds include molecules which include, but are not limited to: chemical compounds, novel chemical entities, siRNA, shRNA, antisense oligonucleotide, ribozymes or aptamers, calcium channel agonist or antagonist, antibodies or fragments of it, diabodies modulating the activity of a calcium channel of a pollinating insect. For example, the test compounds comprise molecules of biological origin which may be in a non-limiting list: insect venom, for example spider, molluscan venom, for example snail or snails. venoms from vertebrates, for example snakes, neurotoxins such as tetrodotoxin, and batrachotoxin, plant toxins, scorpion toxins, or other natural products used in integrated pest management.
Des exemples de composés test comprennent également, mais ne sont pas limités à des composés déjà connus pour être toxiques sur d'autres espèces telles que les espèces invasives comme décrites ci-dessus. Examples of test compounds also include, but are not limited to compounds already known to be toxic to other species such as invasive species as described above.
Dans la présente par « analyse électrophysiologique », on entend toute technique électrophysiologique connue de l'homme du métier. Par exemple, l'analyse électrophysiologique peut être réalisée en voltage imposé à simple ou double électrodes en patch-Clamp, en courant imposé. In the present "electrophysiological analysis" is meant any electrophysiological technique known to those skilled in the art. For example, the electrophysiological analysis can be carried out in imposed voltage with single or double electrodes patch-Clamp, imposed current.
Il peut s'agir par exemple de la technique décrite dans le document Électrophysiologie moléculaire, 2001, Ed. M. Joffre, collection enseignement de sciences, Herman [13] ou de la technique décrite dans le document Microelectrode techniques, The Plymouth Workshop Handbook 1988, Ed. N.B. Standen, P.T.A Gray and M.J. Whitaker, The Company of Biologists Limited ou Single Channel recording 1983 Ed. B. Sackmann and E Neher. Plénum Press, New York [14]. This may be for example the technique described in the document Molecular electrophysiology, 2001, Ed. M. Joffre, science education collection, Herman [13] or the technique described in the document Microelectrode techniques, The Plymouth Workshop Handbook 1988 , Ed. NB Standen, PTA Gray and MJ Whitaker, The Company of Biologists Limited or Single Channel Recording 1983 Ed. B. Sackmann and E Neher. Plenum Press, New York [14].
Au potentiel de repos de membrane, les canaux calciques sont normalement fermés. Ils sont activés (c'est-à-dire ouverts) par des dépolarisations de la membrane. Le gradient de concentration calcique entre le milieu extracellulaire et le milieu intracellulaire favorise alors une entrée massive de calcium tant que le potentiel est inférieur au potentiel d'équilibre pour les ions calcium (en général, ce potentiel d'équilibre est de l'ordre de +80mV dans les conditions normales). At membrane quiescent potential, the calcium channels are normally closed. They are activated (ie open) by depolarizations of the membrane. The calcium concentration gradient between the extracellular medium and the intracellular medium then promotes a massive calcium entry as long as the potential is lower than the equilibrium potential for the calcium ions (in general, this equilibrium potential is of the order of + 80mV under normal conditions).
La co-expression des sous-unités Cava2ô et Cav améliore le niveau d'expression de la sous-unité Cavccl (CaVl ou CaV2) et provoque une augmentation de la probabilité d'ouverture, et une modification des cinétiques d'activation et d'inactivation ainsi qu'une hyperpolarisation de la voltage-dépendance de l'activation et de l'inactivation du canal. Certains de ces effets sont observés en l'absence de la sous-unité β, tandis que, dans d'autres cas, la co-expression de la sous-unité β est nécessaire. La sous-unité β jouerait un rôle important dans la stabilisation de la conformation finale de la sous-unité Cavccl (CaVl ou CaV2) en modifiant son adressage et son trafic vers la membrane plasmique. De plus, la sous-unité β jouerait un rôle dans la régulation des cinétiques d'activation et d'inactivation, ainsi que dans la voltage dépendance de l'activation et de l'inactivation telle que décrite plus haut, sensibilisant le cala à de faibles dépolarisations. The coexpression of the Cava2δ and Cav subunits enhances the expression level of the Cavccl (CaV1 or CaV2) subunit and causes an increase in the probability of opening, and a modification of the kinetics of activation and inactivation as well as a hyperpolarization of the voltage-dependence of the activation and inactivation of the channel. Some of these effects are observed in the absence of the β subunit, while in other cases the coexpression of the β subunit is necessary. The β subunit would play an important role in stabilizing the final conformation of the Cavccl subunit (CaV1 or CaV2) by modifying its targeting and trafficking to the plasma membrane. In addition, the β subunit plays a role in the regulation of activation kinetics and inactivation, as well as in the voltage dependence of activation and inactivation as described above, sensitizing the cala to weak depolarizations.
Dans un mode de réalisation de l'invention, ledit composé test est déjà connu pour moduler l'activité du canal calcique d'un insecte pollinisateur. In one embodiment of the invention, said test compound is already known to modulate the activity of the calcium channel of a pollinating insect.
Dans un autre mode de réalisation de l'invention, ledit composé test n'est pas encore connu pour moduler l'activité du canal calcique d'un insecte pollinisateur. In another embodiment of the invention, said test compound is not yet known to modulate the activity of the calcium channel of a pollinating insect.
Dans un autre mode de réalisation de l'invention, ledit composé test est une nouvelle entité chimique. In another embodiment of the invention, said test compound is a new chemical entity.
Dans un mode de réalisation de l'invention, ledit composé test augmente ou diminue l'expression fonctionnelle du canal calcique dans la cellule modifiée. Dans un mode de réalisation de l'invention, ledit composé test induit ou réduit l'expression du canal calcique à la surface de la cellule. In one embodiment of the invention, said test compound increases or decreases the functional expression of the calcium channel in the modified cell. In one embodiment of the invention, said test compound induces or reduces the expression of the calcium channel on the surface of the cell.
Dans un mode de réalisation, le composé test module au moins une des sous-unités du canal calcique et/ou au moins une des sous-unités régulatrices du canal calcique décrites ci-dessus. Selon le procédé de l'invention, ledit composé test module le courant d'ions calciques par l'intermédiaire d'au moins une des sous-unités du canal calcique et/ou moins une des sous-unités régulatrices du canal calcique décrites ci-dessus. In one embodiment, the test compound modulates at least one of the calcium channel subunits and / or at least one of the calcium channel regulatory subunits described above. According to the method of the invention, said test compound modulates the calcium ion current through at least one of the calcium channel subunits and / or at least one of the calcium channel regulatory subunits described above. above.
Dans un mode de réalisation, ledit composé de test module l'activité du canal calcique de l'invention. Dans un mode de réalisation, ledit composé test modifie la cinétique d'activation du canal calcique. Dans un autre mode de réalisation, ledit composé test module (augmente ou diminue) l'amplitude du courant calcique de l'insecte pollinisateur. In one embodiment, said test compound modulates the activity of the calcium channel of the invention. In one embodiment, said test compound modifies the activation kinetics of the calcium channel. In another embodiment, said test compound modulates (increases or decreases) the amplitude of the calcium current of the pollinating insect.
Dans un autre mode de réalisation, ledit composé test module (augmente ou diminue) l'inactivation pendant la dépolarisation. Dans un autre mode de réalisation, ledit composé test module (augmente ou diminue) la cinétique d'activation ou activation du canal voltage dépendant et/ou la désactivation du canal. In another embodiment, said test compound modulates (increases or decreases) inactivation during depolarization. In another embodiment, said test compound modulates (increases or decreases) the kinetics of activation or activation of the voltage-dependent channel and / or the deactivation of the channel.
Dans un autre mode de réalisation, ledit composé test module l'activité des canaux calcique au cours de dépolarisations répétitives. Dans un autre mode de réalisation, ledit composé test est dépendant des états de fonctionnement du canal calcique avec une affinité préférée pour les états fermés et/ou ouverts et/ou inactivés. In another embodiment, said test compound modulates calcium channel activity during repetitive depolarizations. In another embodiment, said test compound is dependent on the operating states of the calcium channel with a preferred affinity for closed and / or open and / or inactivated states.
Dans un autre mode de réalisation, ledit composé test module (augmente ou diminue) le tri, l'adressage ou la translocation du canal calcique de l'invention. Dans un autre mode de réalisation, ledit composé test module (augmente ou diminue) la stabilité du canal calcique de l'invention. In another embodiment, said test compound modulates (increases or decreases) the sorting, addressing or translocation of the calcium channel of the invention. In another embodiment, said test compound modulates (increases or decreases) the stability of the calcium channel of the invention.
Dans un autre mode de réalisation, ledit composé de test module l'assemblage de sous- unités du canal calcique de l'invention. In another embodiment, said test compound modulates the subunit assembly of the calcium channel of the invention.
Dans un mode de réalisation, le procédé de l'invention est un crible à haut débit. Dans un autre mode de réalisation, le procédé de l'invention est une méthode électrophy siolo gique . In one embodiment, the method of the invention is a high throughput screen. In another embodiment, the method of the invention is an electrophytic method.
Dans un autre mode de réalisation, le procédé de l'invention est un procédé de fluorimétrie ou luminométrie. In another embodiment, the method of the invention is a fluorimetry or luminometry method.
Les procédés de l'invention peuvent être adaptés à un laboratoire classique ou adapté à des cribles moyens ou hauts débits. Le terme « criblage à haut débit » (HTS) se réfère à une conception de l'essai qui permet une analyse facile de plusieurs échantillons à la fois et la capacité de manipulation robotique. Une autre caractéristique désirée de dosages à haut débit est une conception de test qui est optimisée pour réduire l'usage de réactifs, ou réduire au minimum le nombre de manipulations afin d'obtenir l'analyse souhaitée. The methods of the invention can be adapted to a conventional laboratory or adapted to medium or high flow screens. The term "high throughput screening" (HTS) refers to a test design that allows for easy analysis of multiple samples at a time and robotic handling capability. Another desired characteristic of high-throughput assays is a test design that is optimized to reduce the use of reagents, or to minimize the number of manipulations to achieve the desired analysis.
Les méthodes de mesure de l'effet d'un composé test sur un canal calcique sont bien connues dans l'état de l'art de la technique. Par exemple, l'homme du métier sait que des mesures électrophysiologiques des cellules transformées exprimant des canaux calciques fonctionnels peuvent être utilisées pour tester un composé. Dans la présente, on entend par « imagerie calcique » tout procédé d'imagerie calcique connue de l'homme du métier. Il peut s'agir par exemple du procédé décrit dans Calcium Measurement Methods, 2010 Ed Alexei, Verkhratsky; Petersen, Ole H. Séries: Neuromethods, vol. 43 Humana Press [15]. Methods for measuring the effect of a test compound on a calcium channel are well known in the state of the art. For example, one skilled in the art knows that electrophysiological measurements of transformed cells expressing functional calcium channels can be used to test a compound. As used herein, "calcium imaging" refers to any calcium imaging method known to those skilled in the art. This may be for example the process described in Calcium Measurement Methods, 2010 Ed Alexei, Verkhratsky; Petersen, Ole H. Series: Neuromethods, vol. 43 Humana Press [15].
Avantageusement, la détermination de la toxicité d'une molécule peut être effectuée par comparaison de l'activité et/ou des propriétés du canal selon l'invention en présence de ladite molécule candidate par rapport à l'activité et/ou des propriétés du canal selon l'invention en l'absence de ladite molécule candidate. Advantageously, the determination of the toxicity of a molecule can be performed by comparing the activity and / or properties of the channel according to the invention in the presence of said candidate molecule with respect to the activity and / or properties of the channel. according to the invention in the absence of said candidate molecule.
Lors de cette détermination, on peut utiliser l'une des cellules hôtes précitées, transformée au moyen d'une séquence nucléotidique ou d'un vecteur selon l'invention, et exprimant l'une ou plusieurs des protéines de la présente invention. On favorise de préférence des cellules qui expriment l'une ou plusieurs des protéines de la présente invention. Il peut s'agir par exemple de cellules de Xénope ou de cellules HEK293 telles que présentées dans les exemples ci-dessous. In this determination, one of the aforementioned host cells, transformed by means of a nucleotide sequence or a vector according to the invention, and expressing one or more of the proteins of the present invention can be used. Cells which express one or more of the proteins of the present invention are preferably favored. It may be, for example, Xenopus cells or HEK293 cells as shown in the examples below.
On peut également réaliser la détermination par l'une des techniques de chromatographie, ou d'immunoprécipitation connues de l'homme du métier adaptées pour réaliser des essais d'interaction entre la ou les protéines de la présente invention et les molécules à tester. Il peut s'agir par exemple d'une méthode de chromatographie par affinité, adsorption, etc. Un objet de l'invention est un procédé in vitro pour déterminer la toxicité d'un composé test sur un insecte pollinisateur comprenant: a. la mise en contact des cellules transformées décrites ci-dessus, avec un composé test, It is also possible to carry out the determination by one of the chromatography or immunoprecipitation techniques known to those skilled in the art adapted to perform interaction tests between the protein (s) of the present invention and the test molecules. It may be for example a method of affinity chromatography, adsorption, etc. An object of the invention is an in vitro method for determining the toxicity of a test compound on a pollinating insect comprising: a. bringing the transformed cells described above into contact with a test compound
b. la mesure de l'effet dudit composé test sur l'activité de canal calcique, et la comparaison de l'effet dudit composé test à l'effet d'un composé contrôle ou une solution de véhicule, de manière à déterminer la toxicité dudit canal calcique.  b. measuring the effect of said test compound on calcium channel activity, and comparing the effect of said test compound with the effect of a control compound or a vehicle solution, so as to determine the toxicity of said channel calcium.
Avantageusement, une molécule candidate peut être déterminée comme étant toxique lorsqu'elle inhibe, diminue, augmente ou altère le courant du canal selon l'invention. Advantageously, a candidate molecule can be determined to be toxic when it inhibits, decreases, increases or impairs the channel current according to the invention.
Dans un mode de réalisation de l'invention, un composé test est considéré comme toxique une fois qu'un effet modulateur est mesuré sur le canal calcique d'un insecte pollinisateur. In one embodiment of the invention, a test compound is considered toxic once a modulating effect is measured on the calcium channel of a pollinating insect.
Dans un mode de réalisation, un composé test est considéré comme toxique une fois qu'il modifie la cinétique d'activation du canal calcique. In one embodiment, a test compound is considered toxic once it modifies the activation kinetics of the calcium channel.
Dans un autre mode de réalisation, un composé test est considéré comme toxique une fois qu'il module (augmente ou diminue) l'amplitude d'un courant calcique d'un canal calcique d'insectes pollinisateurs. In another embodiment, a test compound is considered toxic once it modulates (increases or decreases) the amplitude of a calcium stream of a pollinating insect calcium channel.
Dans un autre mode de réalisation, un composé test est considéré comme toxique une fois qu'il module (augmente ou diminue) l'inactivation pendant une ou des impulsions dépolarisantes. In another embodiment, a test compound is considered toxic once it modulates (increases or decreases) inactivation during one or more depolarizing pulses.
Dans un autre mode de réalisation, un composé test est considéré comme toxique une fois qu'il modifie la cinétique d'activation ou l'activation dépendante du voltage du canal. In another embodiment, a test compound is considered toxic once it modifies the activation kinetics or voltage-dependent activation of the channel.
Dans un autre mode de réalisation, un composé test est considéré comme toxique une fois qu'il module (augmente ou diminue) l'activité du canal lors de dépolarisations répétitives. Dans un autre mode de réalisation, un composé test est considéré comme toxique une fois qu'il induit une hyperexcitabilité neuronale délétère. In another embodiment, a test compound is considered toxic once it modulates (increases or decreases) the activity of the channel during repetitive depolarizations. In another embodiment, a test compound is considered toxic once it induces deleterious neuronal hyperexcitability.
Dans un autre mode de réalisation, un composé d'essai est considéré comme toxique une fois son affinité modulée (augmentée ou diminuée) lors de l'ouverture du canal. Dans un autre mode de réalisation, un composé test est considéré comme toxique dès qu'il module l'état fermé du canal. In another embodiment, a test compound is considered toxic once its affinity is modulated (increased or decreased) upon opening of the channel. In another embodiment, a test compound is considered toxic as soon as it modulates the closed state of the channel.
Dans un autre mode de réalisation, un composé test est considéré comme toxique une fois que ledit composé est dépendant des états de fonctionnement du canal calcique avec une affinité préférée pour les états fermés et/ou ouverts et/ou inactivés. Dans un autre mode de réalisation, un composé test est considéré comme toxique une fois que l'assemblage, l'adressage ou la translocation du canal calcique de l'invention sont modifiés. In another embodiment, a test compound is considered toxic once said compound is dependent on the operating states of the calcium channel with a preferred affinity for closed and / or open and / or inactivated states. In another embodiment, a test compound is considered toxic once assembly, addressing or translocation of the calcium channel of the invention is modified.
Dans un autre mode de réalisation, un composé test est considéré comme toxique une fois que la stabilité du canal calcique de l'invention est modifiée. Dans un autre mode de réalisation, un composé test est considéré comme toxique une fois que la dégradation du canal calcique de l'invention est modifiée. In another embodiment, a test compound is considered toxic once the stability of the calcium channel of the invention is changed. In another embodiment, a test compound is considered toxic once the degradation of the calcium channel of the invention is changed.
Dans un autre mode de réalisation, un composé test est considéré comme toxique une fois que l'assemblage de sous-unités du canal calcique de l'invention est modifié. In another embodiment, a test compound is considered toxic once the subunit assembly of the calcium channel of the invention is modified.
Dans un mode de réalisation, le composé test n'est pas toxique pour un insecte pollinisateur de l'invention. In one embodiment, the test compound is not toxic to a pollinating insect of the invention.
Dans un autre mode de réalisation, le composé test est toxique pour un insecte pollinisateur de l'invention. In another embodiment, the test compound is toxic to a pollinating insect of the invention.
Dans un autre mode de réalisation, le composé test est toxique pour les espèces invasives telles que décrites ci-dessus tandis que ledit composé test n'est pas toxique pour les insectes pollinisateurs de l'invention. Selon l'invention, l'analyse de la toxicité d'une molécule peut être effectuée par comparaison de l'activité et/ou des propriétés du canal selon l'invention en présence de ladite molécule candidate par rapport à l'activité et/ou aux propriétés du canal selon l'invention en l'absence de ladite molécule candidate ou en présence d'une molécule de référence dont on connaît l'interaction avec la ou les protéines du canal. Des mesures d'étalonnage peuvent également être effectuées, avec une molécule de référence, à différentes concentrations, comme par exemple le cadnium, ou la nifédipine. In another embodiment, the test compound is toxic to the invasive species as described above while said test compound is not toxic to the pollinating insects of the invention. According to the invention, the analysis of the toxicity of a molecule can be carried out by comparing the activity and / or the properties of the channel according to the invention in the presence of said candidate molecule with respect to the activity and / or the properties of the channel according to the invention in the absence of said candidate molecule or in the presence of a reference molecule whose interaction with the protein or proteins of the channel is known. Calibration measurements can also be performed, with a reference molecule, at different concentrations, such as for example cadmium or nifedipine.
D'autres avantages pourront encore apparaître à l'homme du métier à la lecture des exemples ci-dessous, illustrés par les figures annexées, données à titre illustratif. Un autre objet de l'invention est un procédé in vitro de criblage de composés qui modulent l'activité du canal calcique d'un insecte pollinisateur qui comprend: a. la mise en contact des cellules transformées décrites ci-dessus, avec un composé test, Other advantages may still appear to those skilled in the art on reading the examples below, illustrated by the appended figures, given for illustrative purposes. Another object of the invention is an in vitro method of screening for compounds that modulate the calcium channel activity of a pollinating insect that comprises: a. bringing the transformed cells described above into contact with a test compound
b. la mesure de l'effet dudit composé test sur l'activité du canal calcique, et comparer l'effet dudit composé test à l'effet d'un composé contrôle ou une solution de véhicule, en classant ainsi ledit composé en tant que bloqueur de canal calcique, activateur du canal calcique, modificateur de déclenchement.  b. measuring the effect of said test compound on calcium channel activity, and comparing the effect of said test compound with the effect of a control compound or a vehicle solution, thus classifying said compound as a blocker of calcium channel, calcium channel activator, trigger modifier.
Les composés connus pour moduler l'activité des canaux calciques chez les mammifères ne modulent pas forcément l'activité des canaux calciques chez les insectes de l'invention. C'est donc un autre avantage de la présente application que de trouver des composés spécifiquement toxiques ou non des canaux calciques des insectes. Compounds known to modulate calcium channel activity in mammals do not necessarily modulate calcium channel activity in insects of the invention. It is therefore another advantage of the present application to find compounds that are specifically toxic or non-calcium channels of insects.
Un autre objet de l'invention est un kit comprenant le vecteur de l'invention ou la cellule modifiée exprimant le canal calcique de l'invention et des réactifs pour conduire un des procédés de l'invention décrits ci-dessus. Éventuellement, le kit peut comprendre un milieu de culture, des séquences d'acides nucléiques recombinantes, des réactifs, des composés de contrôle, etc. Ainsi, le kit comprendrait typiquement un support compartimenté adapté pour maintenir en confinement étroit au moins un récipient. Le support devrait comprendre en outre des réactifs utiles pour effectuer ces méthodes. Le support peut également contenir un moyen de détection tel que des substrats enzymatiques ou analogues marqués. Les instructions peuvent être fournies pour détailler l'utilisation des composants du kit, des présentations vidéo ou des instructions dans un format qui peut être ouvert sur un ordinateur (par exemple une disquette ou CD-ROM). Ces instructions pourraient indiquer, par exemple, comment utiliser les cellules pour cribler des composés tests d'intérêt (tels que les médicaments inotropes). Another subject of the invention is a kit comprising the vector of the invention or the modified cell expressing the calcium channel of the invention and reagents for carrying out one of the methods of the invention described above. Optionally, the kit may include culture medium, recombinant nucleic acid sequences, reagents, control compounds, and the like. Thus, the kit typically comprises a compartmentalized support adapted to keep in close confinement at least one container. The support should also include reagents useful for performing these methods. The carrier may also contain a detection means such as labeled enzyme substrates or the like. Instructions may be provided to detail the use of kit components, video presentations, or instructions in a format that can be opened on a computer (for example, a floppy disk or CD-ROM). These instructions could indicate, for example, how to use the cells to screen test compounds of interest (such as inotropic drugs).
BRÈVE DESCRIPTION DES FIGURES BRIEF DESCRIPTION OF THE FIGURES
La figure 1 représente un schéma des exons présents dans le gène codant la sous-unité amCavl, la séquence nucléique de l'ADNc de la sous-unité amCavl (SEQ ID n°9) et la séquence peptidique correspondante (SEQ ID n°l). FIG. 1 represents a diagram of the exons present in the gene coding for the amCavl subunit, the nucleic sequence of the amCav1 subunit cDNA (SEQ ID No. 9) and the corresponding peptide sequence (SEQ ID No. 1). ).
La figure 2 représente un schéma des exons présents dans le gène codant la sous-unité amCav2, la séquence nucléique de l'ADNc de la sous-unité amCav2 (SEQ ID n°10), la séquence peptidique correspondante (SEQ ID n°2) et la séquence peptidique des exons alternatifs du gène codant la sous-unité amCav2. FIG. 2 represents a diagram of the exons present in the gene coding for the amCav2 subunit, the nucleic sequence of the amCav2 subunit cDNA (SEQ ID No. 10), and the corresponding peptide sequence (SEQ ID No. 2). ) and the peptide sequence of the alternative exons of the gene encoding the amCav2 subunit.
La figure 3 représente un schéma des exons présents dans le gène codant la sous-unité amCav3a, la séquence nucléique de l'ADNc de la sous-unité amCav3 (SEQ ID n°l l), séquence peptidique correspondante (SEQ ID n°3) et la séquence peptidique des exons alternatifs du gène codant la sous-unité amCav3. FIG. 3 represents a diagram of the exons present in the gene coding for the amCav3a subunit, the nucleic sequence of the cDNA of the amCav3 subunit (SEQ ID No. 11), corresponding peptide sequence (SEQ ID No. 3) and the peptide sequence of the alternative exons of the gene encoding the amCav3 subunit.
La figure 4 représente un schéma des exons du gène codant la sous-unité CavP^ la séquence nucléique de l'ADNc de la sous-unité amCavPa (SEQ ID n° 12) et la séquence peptidique correspondante (SEQ ID n°4) La figure 5 représente les séquences nucléotidiques de l'ADNc de deux autres variants de la sous-unité CavP, amCavpb (SEQ ID 13) et amCavPc (SEQ ID n° 14) et leur séquence peptidique, amCavpb (SEQ ID n°5) et amCavPc (SEQ ID n° 107). La figure 6 représente un schéma des exons du gène codant la sous-unité amCava2ôl, la séquence nucléique de l'ADNc de la sous-unité amCava2ôl (SEQ ID n° 15) et la séquence peptidique correspondante (SEQ ID n°6) FIG. 4 represents a diagram of the exons of the gene encoding the CavP subunit, the nucleic sequence of the cDNA of the amCavPa subunit (SEQ ID No. 12) and the corresponding peptide sequence (SEQ ID No. 4). FIG. 5 shows the nucleotide sequences of the cDNA of two other variants of the CavP subunit, amCavpb (SEQ ID 13) and amCavPc (SEQ ID No. 14) and their peptide sequence, amCavpb (SEQ ID No. 5) and amCavPc (SEQ ID NO: 107). Figure 6 is a schematic of the exons of the gene encoding the amCava2δ1 subunit, the nucleic sequence of the amCava2δ1 subunit cDNA (SEQ ID NO: 15) and the corresponding peptide sequence (SEQ ID NO: 6).
La figure 7 représente un schéma des exons du gène codant la sous-unité amCava2ô2, la séquence nucléique de l'ADNc de la sous-unité amCava2ô2 (SEQ ID n° 16) et la séquence peptidique correspondante (SEQ ID n°7) FIG. 7 represents a diagram of the exons of the gene coding for the amCava2δ2 subunit, the nucleic sequence of the cDNA of the amCava2δ2 subunit (SEQ ID No. 16) and the corresponding peptide sequence (SEQ ID No. 7).
La figure 8 représente un schéma des exons du gène codant la sous-unité amCava2ô3, la séquence nucléique de l'ADNc de la sous-unité amCava2ô3 (SEQ ID n° 17) et la séquence peptidique correspondante (SEQ ID n°8) La figure 9 représente les traces de courants enregistrés en voltage-imposé des canaux calciques d'Apis mellifera Caval (AmCaVla en haut, ou AmCav2b en bas) avec les protéines Cavp (AmCavPa) et Cava2-ôl (AmCaV α2-δ1) après injection dans des ovocytes de Xénopes d'ARN synthétisé in vitro. A : Courants enregistrés en voltage- imposé sur ces deux types d'ovocytes (trois jours post-injection) lors de l'application d'une dépolarisation de -80 mV à +10 ou +20 mV de 400 ms de durée. B Courbes courant-voltage enregistrées sur ces ovocytes montrant la voltage-dépendance de l'ouverture de ces canaux calciques d'Apis mellifera. L'ordonné représente le courant calcique normalisé à -1 par rapport à son maximum d'amplitude à +10mV, l'abscisse représente la valeur de la dépolarisation en millivolt (mV), à gauche avec AmCaVla et à droite avec AmCav2b, dans les deux cas en présence de AmCavPa et AmCaV α2-δ1. FIG. 8 represents a diagram of the exons of the gene coding for the amCava2δ3 subunit, the nucleic sequence of the amCava2δ3 subunit cDNA (SEQ ID No. 17) and the corresponding peptide sequence (SEQ ID No. 8). FIG. 9 represents the traces of currents recorded in voltage-imposed Apis mellifera Caval calcium channels (AmCaVla at the top, or AmCav2b at the bottom) with the Ca v p (AmCavPa) and Cava2-δ1 (AmCaV α2-δ1) proteins after injection into oocytes of RNA Xenopes synthesized in vitro. A: Currents recorded in voltage- imposed on these two types of oocytes (three days post-injection) during the application of a depolarization of -80 mV at +10 or +20 mV of 400 ms duration. B Current-voltage curves recorded on these oocytes showing the voltage-dependence of the opening of these calcium channels of Apis mellifera. The ordinate represents the normalized calcium current at -1 with respect to its maximum amplitude at + 10mV, the abscissa represents the value of the depolarization in millivolt (mV), on the left with AmCaVla and on the right with AmCav2b, in the two cases in the presence of AmCavPa and AmCaV α2-δ1.
La figure 10 A représente les traces de courants calciques Cav (AmCaV2b) avec les protéines Cavp (AmCavPa) et Cava2-ô (AmCava2-ôl) enregistrées en voltage-imposé 3 jours après injection d'ARN dans un ovocyte de Xénopes. La trace référencée cont représente le courant enregistré dans des conditions contrôles, la trace notée perm a été enregistrée à l'état stable après perfusion de perméthrine à 20 μΜ dans le milieu d'incubation. La figure 10 B représente un diagramme en bâton (histogramme) montrant le pourcentage moyen de l'amplitude du courant (ordonné) en absence (cont) ou en présence (perm) de la perméthrine (20μΜ), normalisé par rapport au contrôle à 100%. La figure 10 C représente les variations de l'amplitude du courant (normalisée par rapport au début de l'enregistrement fixe à 1, ordonné) en fonction du temps (en secondes) après perfusion de la perméthrine à 20 μΜ dans le milieu extracellulaire (début de la perfusion marqué par une flèche). Figure 10A shows traces of calcium currents Ca v (AmCaV2b) with the proteins Ca v p (AmCavPa) and Cava2-δ (AmCava2-ol) recorded in voltage-imposed 3 days after injection of RNA in a Xenopus oocyte . The trace referenced cont represents the current recorded under control conditions, the trace noted perm was recorded in the stable state after perfusion of permethrin to 20 μΜ in the incubation medium. FIG. 10B shows a bar graph (histogram) showing the average percentage of the amplitude of the current (ordinate) in absence (cont) or in the presence (perm) of permethrin (20μΜ), normalized with respect to the control at 100 %. Figure 10C shows the variations of the current amplitude (normalized compared to the beginning of the fixed record at 1, ordered) as a function of time (in seconds) after perfusion of permethrin at 20 μΜ into the extracellular medium (beginning of the infusion marked by an arrow).
La figure 11 A représente un gel de RT-PCR de l'analyse de l'expression des deux variants de CavP d'abeille à différents stades de développement d'une larve et d'une pupe, aux jours 6 à 16 après l'éclosion. La figure 11 B représente un Western-blot d'extraits cellulaires de cellules Hek T293 transfectées avec le cDNA codant les sous- unité s amCav a (Am-CavPa) ou amCav b (Am-Cavpb) (a, b, respectivement), ou de cerveau (B) et de thorax (T) d'abeille adulte en utilisant des anticorps primaires dirigés soit contre la partie amino-terminale (Nt-Ab) soit contre la partie carboxy-terminale (Ct- Ab) de la sous-unité amCav a. La figure 11 C représente une tranche de cerveau (25 μιη d'épaisseur) marquée avec l'anticorps Nt-Ab. La coloration est observée dans le complexe central (CC), le calice des corps pédonculés (MB), le lobe optique (OL) (lam = lamina, lob = lobula et med = médullaire), et les lobes antennaires (AL). La figure 11 D représente une photographie d'immunofluorescence marquant l'expression de la protéine CavP dans les neurones des lobes antennaires en culture. La figure 11 E représente une photographie d'immunofluorescence marquant l'expression de la protéine CavP dans une culture primaire de cellules musculairesT Le marquage du noyau (pointes de flèches) n'est observé que dans les cellules musculaires. En parties D et E l'anticorps primaire Ct-Ab a été utilisé. FIG. 11A shows an RT-PCR gel for the analysis of the expression of the two bee CavP variants at different stages of development of a larva and a pupa, on days 6 to 16 after hatching. Figure 11B shows a Western blot of cell extracts of Hek T293 cells transfected with the cDNA encoding the amCav α (Am-CavPa) or amCav b (Am-Cavpb) subunits (a, b, respectively), or adult brain (B) and thorax (T) using primary antibodies directed against either the amino-terminal portion (Nt-Ab) or the carboxy-terminal portion (Ct-Ab) of the subtype. amCav unit a. Figure 11C shows a brain slice (25μιη thick) labeled with the Nt-Ab antibody. Staining is observed in the central complex (CC), the calyx of the pedunculate bodies (MB), the optic lobe (OL) (lam = lamina, lob = lobula and med = medullary), and the antennal lobes (AL). Figure 11D shows an immunofluorescence photograph stating the expression of CavP protein in antennal lobe neurons in culture. Figure 11 E shows an immunofluorescence photograph stating the expression of CavP protein in a primary culture of muscle cells. Staining of the nucleus (arrowheads) is only observed in muscle cells. In parts D and E the primary antibody Ct-Ab was used.
La figure 12 A représente des photographies de larves 10 jours (J10), 11 jours (Jl l) et 16 jours (J16) après éclosion. La figure 12 B représente des gels d'agaroses d'acides nucléiques montrant le profil d'expression déterminé par RT-PCR de deux des variants de la sous-unités CavP (amCav a (AmCavPa) et amCav b (AmCavPb)), des sous-unités Caval (amCavla (CaVl), amCav2b (CaV2) et amCav3a (CaV3)), et des sous-unités Caya-δ (amCavCc2ôl (Cava2-ôl), amCavCc2ô2 (Cava2-ô2) et amCavCc2ô3 (Cava2-ô3)) des canaux calciques d'Apis mellifera au cours du développement de J6 à J16. Figure 12A shows photographs of larvae 10 days (D10), 11 days (D11) and 16 days (D16) after hatching. Figure 12B shows nucleic acid agarose gels showing the expression pattern determined by RT-PCR of two of the variants of the CavP subunit (amCav a (AmCavPa) and amCav b (AmCavPb)), subunits Ca v al (amCavla (LVLC) amCav2b (CAV2) and amCav3a (CAV3)), and subunit Caya-δ (amCavCc2ôl (Ca v a2-ol), amCavCc2ô2 (Ca v a2-a2) and amCavCc2δ3 (Ca v a2-δ3)) of the calcium channels of Apis mellifera during development from D6 to D16.
La figure 13 A représente des traces de courants de canaux calciques de lapin (rabbit CaV2.2), avec les protéines Cay 2-ôl de lapin et AmCavPa d'abeille, exprimés dans l'ovocyte de Xénope et enregistrés en voltage-imposé 3 jours post-injection lors de dépolarisation de -80 mV à +10 mV de 400 ms de durée. Les deux traces superposées montrent les traces enregistrées en absence (control) et en présence (Allet) d'alléthrine (20μΜ). La figure 13 B représente un diagramme en bâton montrant l'effet moyen sur l'amplitude des courants de canaux calciques de lapin (rabbitCaY2.2) en présence de CaV2.2 + Caya2-ôlde lapin seul (H20) ou avec la protéine d'abeille CavP (variants a (AmCavPa) ou b (AmCavPb)). La figure 13 C représente l'effet sur l'amplitude du courant en μΑιηρέΓε (ordonné) en fonction du temps (en secondes) de la perfusion de l'alléthrine dans le milieu extracellulaire sur un ovocyte de Xénope exprimant un canal calcique de lapin (rabbitCaV2.2) avec la protéine CaVa2-ô de lapin et la protéine CaVPa d'abeille. Cet exemple montre le rôle de la sous-unité AmCavb sur l'inhibition par l'alléthrine. Figure 13A shows traces of rabbit calcium channel currents (rabbit CaV2.2), with rabbit Cay 2-ol proteins and Bee AmCavPa, expressed in the Xenopus oocyte and recorded in voltage-imposed 3 days post-injection during depolarization from -80 mV to +10 mV of 400 ms duration. The two superimposed traces show the traces recorded in absence (control) and presence (Allet) of allethrin (20μΜ). FIG. 13B is a bar graph showing the average effect on the amplitude of rabbit calcium channel currents (rabbitCaY2.2) in the presence of CaV2.2 + Caya2-rabbit alone (H 2 0) or with CavP bee protein (variants a (AmCavPa) or b (AmCavPb)). FIG. 13C represents the effect on the amplitude of the current in μΑιηρέΓε (ordered) as a function of the time (in seconds) of the perfusion of allethrin in the extracellular medium on a Xenopus oocyte expressing a rabbit calcium channel ( rabbitCaV2.2) with rabbit CaVa2-δ protein and bee CaVPa protein. This example shows the role of the AmCavb subunit on inhibition by allethrin.
La figure 14 représente les propriétés fonctionnelles des sous-unités Am-CaVPa et Am- CaVpb. La figure 14 A gauche: représente les traces des courants enregistrés à partir de trois différents ovocytes exprimant le canal calcique CaV2.3 et CaVa2-ô de lapin sans (H20) ou avec la protéine Cavp d'abeille (variants a (AmCavPa) ou b (AmCavpb)) pendant une dépolarisation de 400 ms de -80 mV à +10 ou +20 mV (les traces sont superposées). À droite: un diagramme en bâton représente les moyennes de pics d'amplitude de courants mesurés durant les dépolarisations similaires à celles de la partie gauche. La figure 14 B gauche représente la cinétique d'inactivation, quantifiée en R400 (courant relatif résiduel après une dépolarisation de 400 ms à +10 mV), pour les canaux calciques CaV2.3 et CaVa2-ô de lapin sans (H20) ou avec la protéine CavP d'abeille (variant a (AmCavPa) ou b (AmCavPb)). La figure 14 B droite représente la moyenne de temps pour le pic de courant en millisecondes (ms) pour les canaux calciques CaV2.3 et CaVa2-ô de lapin sans (H20) ou avec la protéine Cavp d'abeille (variant a (AmCavPa) ou b (AmCavPb)). La figure 14 C représentent les courbes courant-voltage (à gauche) et inactivation dépendante du voltage (isochrone à 2,5 sec, à droite) pour les canaux calciques CaV2.3 et CaVa2-ô de lapin sans (H20) ou avec la protéine Cavp d'abeille (variant a (AmCavpa)). Dans les deux cas, l'amplitude du courant est normalisée à 1 par rapport à l'amplitude la plus grande de la courbe (courant relatif, Rel. Current, en ordonné), et le voltage est exprimé en millivolts (mV). La figure 15 représente la différence des cinétiques d' inactivation des canaux calciques CaV2.3 et CaVa2-ô de lapin sans (H20) ou avec la protéine CavP (variant abeille (AmCavPa), ou de rat (βΐ ou β2). La figure 15 A gauche représente les traces de courants enregistrés à partir d'ovocytes exprimant le canal calcique CaV2.3 et CaVa2-ô de lapin sans (H20) ou avec la protéine Cavp d'abeille (Am-Pa), CavP2a de rat, ou Cavpib de rat). La figure 15 A droite représente un diagramme en bâton de la cinétique d' inactivation moyenne du courant exprimée en R400 (courant résiduel après 400ms) de canaux calciques CaV2.3 et CaVa2-ô de lapin sans (H20) ou avec la protéine Cavp d'abeille (CavPa), CavP2a de rat, ou Cavpib de rat. La figure 15 B représente des photographies de cellules HeK-293 transfectées avec la protéine CavP d'abeille (Am- CavPa) marquées avec un anticorps Ct-Ab (contre la partie carboxy terminale de Am- CavPa) et un anticorps secondaire de lapin couplé à l'alexa 488 (image de gauche), marquées au colorant de Hoecht (milieu) et l'image fusionnée (droite). La figure 15 C représente un diagramme en bâton de l'effet sur inactivation, exprimé en R400, du canal CaV2.3 de lapin en présence de CavP d'abeille (Am-CavPa) ou de CavP2a de rat, de la présence (+) ou l'absence (-) de 2Br-palmitate (injecté 30-60 min avant l'enregistrement dans les ovocytes). La figure 15 D représente des courbes de constantes de temps d' inactivation (xinac) exprimées en seconde et du pourcentage d' inactivation lente ( xslow) par rapport à inactivation totale en fonction du voltage pour le canal CaV2.3 de lapin en présence de Cavp d'abeille (Am-CavPa) ou de CavP2a de rat. La figure 15 E représente les traces de courants unitaires de canaux enregistrés dans des ovocytes exprimant le canal CaV2.3 de lapin en présence du CavP d'abeille (Am-CavPa, à gauche) ou CavP2a (à droite) de rat. Sont mis en évidence, au début et à la fin des courbes, les phases de dépolarisations utilisées pour calculer les probabilités d'ouverture. La courbe rouge en dessous de chaque enregistrement représente la moyenne de 100 enregistrements en canal unitaire pour le canal CaV2.3 de lapin en présence du CavP d'abeille (Am-CavPa, à gauche) ou CavP2a (à droite) de rat. La figure 15 F gauche représente un diagramme en bâton de la probabilité d'ouverture moyenne du canal dans la phase précoce (E) ou tardive (L) de dépolarisation enregistrée dans des ovocytes exprimant le canal CaV2.3 de lapin en présence du CavP d'abeille (Am- CavPa, grisé) ou CavP2a (en blanc) de rat. La figure 15 F droite représente un diagramme en bâton représentant la moyenne en milliseconde des constantes d'ouverture rapide et lente (fast tau et slow tau) enregistrées dans des ovocytes exprimant le canal CaV2.3 en présence du Cavp d'abeille (Am-CavPa, grisé) ou CavP2a (en blanc) de rat à deux potentiels différents (-20 mV et 0 mV). La figure 16 A représente des diagrammes en bâton de la moyenne de inactivation exprimée en R400 de canaux CaV2.3 de lapin exprimés avec le CavP d'abeille (Am- CavPa ou Am-Cavpb) ou CavP2a de rat dans des conditions contrôles (C) ou en présence de genistein (G), staurosporine (S), H89 (H), Wortmannin (W), ou LY294002 (L). La figure 16 B gauche représente la trace de courant enregistrée durant une rampe de voltage de -80 à +80mV pendant 150ms sur un neurone antennaire d'abeille, milieu : traces de courants superposées enregistrées à partir de trois neurones d'abeille en culture après incubation dans une solution contrôle (C), ou avec un inhibiteur de S/T kinases H89 (H), ou un inhibiteur de PDkinase Wortmannin (W) durant une dépolarisation de -80 à +10mV de 100 ms de durée, droite : diagramme en bâton représentant inactivation moyenne quantifiée en R90 (courant résiduel après une dépolarisation de 90 ms à +10 mV) après incubation de 30-60 min des neurones en culture dans une solution contrôle (C), ou additionnée d'un inhibiteur de S/T kinases H89 (H, 50μΜ), ou d'un inhibiteur de PDkinase Wortmannin (W, 10μΜ). La figure 16 C gauche : représente une trace de courant enregistré durant une rampe de voltage de -80 à +80mV pendant 150ms à partir de cellules musculaires de pattes méthatoraciques d'abeille fraîchement dissociées ; milieu : traces de courant enregistrées à partir de cellules musculaires de pattes méthatoraciques après incubation dans une solution contrôle (C), ou additionnée d'un inhibiteur de S/T kinases H89 (H, 50μΜ), ou un inhibiteur de PDkinase Wortmannin (W, 10μΜ) durant une dépolarisation de -80 à +10mV d'une durée de 400ms ; droite : diagramme en bâton représentant inactivation moyenne quantifiée en R400 après incubation des cellules musculaires dans une solution contrôle (C), ou additionnée d'un inhibiteur de S/T kinases H89 (H), ou d'un inhibiteur de PDkinase Wortmannin (W). Figure 14 shows the functional properties of Am-CaVPa and Am-CaVpb subunits. Figure 14 Left: represents the traces of the currents recorded from three different oocytes expressing CaV2.3 and CaVa2-δ free rabbit channel (H20) or with Ca v P protein (A variants) (AmCa v Pa) or b (AmCa v pb)) during a depolarization of 400 ms from -80 mV to +10 or +20 mV (traces are superimposed). Right: A bar graph represents the averages of current amplitude peaks measured during depolarizations similar to those on the left side. Figure 14 B shows the kinetics of inactivation, quantified in R400 (residual relative current after a depolarization of 400 ms at +10 mV), for calcium channels CaV2.3 and CaVa2-o rabbit without (H20) or with bee CavP protein (variant a (AmCavPa) or b (AmCavPb)). FIG. 14B is the time average for the current peak in milliseconds (ms) for CaV2.3 and CaVa2-δ rabbit calcium channels without (H20) or with Ca v P protein (variant a). (AmCavPa) or b (AmCavPb)). Figure 14C shows the current-voltage (left) and voltage-dependent inactivation curves (isochronous at 2.5 sec, right) for CaV2.3 and CaVa2-o rabbit channels without (H20) or with protein Ca v p bee (variant has (AMCA v pa)). In both cases, the amplitude of the current is normalized to 1 with respect to the largest amplitude of the curve (relative current, Rel Current, ordinate), and the voltage is expressed in millivolts (mV). Figure 15 shows the difference in the inactivation kinetics of CaV2.3 and CaVa2-δ free rabbit calcium channels (H20) or with the CavP protein (bee variant (AmCavPa), or rat variant (βΐ or β2). On the left represents the traces of currents recorded from oocytes expressing the calcium channel CaV2.3 and rabbit CaVa2-o without (H20) or with the protein Ca v p of bee (Am-Pa), rat CavP2a , or rat Cavpib). Figure 15 to the right represents a bar graph of the average inactivation kinetics of the current expressed in R400 (residual current after 400 ms) of calcium channel CaV2.3 and rabbit CaVa2-δ without (H20) or with Ca v protein. bee (CavPa), rat CavP2a, or rat Cavpib. Figure 15B shows photographs of HeK-293 cells transfected with bee CavP protein (Am-CavPa) labeled with a Ct-Ab antibody (against the carboxy terminal portion of Am-CavPa) and a coupled rabbit secondary antibody. at alexa 488 (left image), labeled with Hoecht's dye (middle) and the merged image (right). FIG. 15C is a bar graph of the effect on inactivation, expressed in R400, of the rabbit CaV2.3 channel in the presence of rat CavPa (Am-CavPa) or rat CavP2a, of the presence (+ ) or the absence (-) of 2Br-palmitate (injected 30-60 min before the recording in the oocytes). FIG. 15 D represents curves of inactivation time constants (xinac) expressed in seconds and percentage of slow inactivation (xslow) relative to total inactivation as a function of voltage for the rabbit CaV2.3 channel in the presence of Ca v p bee (Am-CavPa) or rat CavP2a. Figure 15E shows the channel stream traces recorded in oocytes expressing the rabbit CaV2.3 channel in the presence of the rat CavP (Am-CavPa, left) or CavP2a (right) rat. The depolarization phases used to calculate the probabilities of opening are shown at the beginning and at the end of the curves. The red curve below each record represents the average of 100 single-channel recordings for the rabbit CaV2.3 channel in the presence of the rat CavP (Am-CavPa, left) or rat CavP2a (right). Figure 15 F shows a bar graph of the probability of mean channel opening in the early (E) or late (L) phase of depolarization recorded in oocytes expressing the rabbit CaV2.3 channel in the presence of CavP d bee (Am-CavPa, grayed) or CavP2a (in white) rat. Figure 15 F is a straight line bar chart showing the mean millisecond constants of fast and slow opening (fast and slow tau tau) recorded in oocytes expressing CaV2.3 channel in the presence of Ca v p bee (Am-CavPa, dimmed) or Rat CavP2a (in white) at two different potentials (-20 mV and 0 mV). FIG. 16A represents rod diagrams of the mean inactivation expressed in R400 of rabbit CaV2.3 channels expressed with rat CavP (Am-CavPa or Am-Cavpb) or rat CavP2a under control conditions (C ) or in the presence of genistein (G), staurosporine (S), H89 (H), Wortmannin (W), or LY294002 (L). Figure 16 B shows the current trace recorded during a voltage ramp of -80 to + 80mV for 150 ms on a bee antennal neuron, medium: traces of superimposed currents recorded from three bee neurons in culture after incubation in a control solution (C), or with an inhibitor of S / T kinases H89 (H), or a PDkinase inhibitor Wortmannin (W) during a depolarization of -80 to + 10mV of 100 ms duration, right: diagram quantum knockdown assay R90 (residual current after 90 ms depolarization at +10 mV) after 30-60 min incubation of cultured neurons in a control solution (C), or supplemented with an inhibitor of S / T kinases H89 (H, 50μΜ), or a PDkinase inhibitor Wortmannin (W, 10μΜ). Figure 16C left: represents a trace of current recorded during a voltage ramp of -80 to + 80mV for 150ms from muscle cells of freshly dissociated bee meta-phosphate legs; medium: current traces recorded from muscle cells of metastoracic legs after incubation in a control solution (C), or supplemented with an inhibitor of S / T kinases H89 (H, 50 μΜ), or a PDkinase inhibitor Wortmannin (W) , 10μΜ) during a depolarization of -80 to + 10mV with a duration of 400ms; right: rod plot representing mean inactivation quantified at R400 after incubation of muscle cells in a control solution (C), or supplemented with an inhibitor of S / T kinases H89 (H), or a PDkinase inhibitor Wortmannin (W) ).
La figure 17 représente l'expression fonctionnelle de AmCaVl(A), AmCaV2 (B) avec AmCaVa2-ôl et AmCaVPc et AmCaV3(C) dans l'ovocyte de Xénope en voltage imposé. En A, B, C, les traces de courants en réponse à une dépolarisation sont montrées. En D, les courbes courant-voltage sont représentées. Figure 17 shows the functional expression of AmCaV1 (A), AmCaV2 (B) with AmCaVa2-δ1 and AmCaVPc and AmCaV3 (C) in the Xenopus oocyte in voltage imposed. In A, B, C, traces of currents in response to a depolarization are shown. In D, current-voltage curves are shown.
La figure 18 représente l'inactivation à l'état stable des canaux AmCaVl et AmCaV2 avec AmCaVa2-ôl et AmCaVPc et AmCaV3. A : montre des exemples de traces de courants enregistrées lors de ces protocoles de double puises. B montre les courbes d' inactivation à l'état stable pour ces trois canaux (notez l'inactivation hyperpolarisée de CaV3). C : montre les paramètres des différentes courbes après régression en utilisant l'équation : rel cur.= R+(l-R)/(l+exp((V-Vin)/k)). Figure 18 shows the steady-state inactivation of AmCaV1 and AmCaV2 channels with AmCaVa2-δ1 and AmCaVPc and AmCaV3. A: shows examples of current traces recorded during these double tap protocols. B shows the steady - state inactivation curves for these three channels (note the hyperpolarized inactivation of CaV3). C: shows the parameters of the different curves after regression using the equation: rel = R + (l-R) / (l + exp ((V-Vin) / k)).
La figure 19 représente l'expression fonctionnelle de CaV2.3+a2ôl +AmCaV a, AmCaV b ou AmCaV c A. Traces de courant en réponse à une dépolarisation de -100 à +10 ou +20 mV, superposées, montrant l'effet sur les cinétiques d' inactivation, et quantification des effets de la coexpression de la sous-unité AmCaV a, b ou c sur l'amplitude du courant. B. Quantification des effets des sous-unités AmCaV a, b ou c sur les cinétiques d' inactivation (R400) et d'activation (Temps au pic : T-t-P). C. Absence d'effet de la sous-unité AmCaV sur l'expression du canal AmCaV3. Figure 19 shows the functional expression of CaV2.3 + α2δ1 + AmCaV α, AmCaV b or AmCaV c A. Traces of current in response to a depolarization of -100 to +10 or +20 mV, superimposed, showing the effect on the kinetics of inactivation, and quantification of the effects of the coexpression of the AmCaV subunit a, b or c on the amplitude of the current. B. Quantification of the effects of AmCaV subunits a, b or c on the kinetics of inactivation (R400) and activation kinetics (peak time: T-t-P). C. Absence of effect of the AmCaV subunit on the expression of the AmCaV3 channel.
La figure 20 représente l'expression fonctionnelle des différentes sous-unités AmCaVcc2-ôl, 2 ou 3 co-exprimées avec AmCaV2a et AmCaV c A : exemples de traces de courants enregistrés lors de dépolarisations de -lOOmV à +10 mV avec AmCaVcc2-ôl, AmCaVcc2-ô2 ou AmCaVcc2-ô. B : courbes courant- voltage obtenues à partir d'ovocytes exprimant AmCaV2 + AmCaV c + AmCaVcc2-ôl, AmCaVcc2-ô2 ou AmCaVcc2-ô3. C : paramètres des différentes courbes après régression en utilisant l'équation cur.= G*(V-Erev)/(l+exp((V-Vact)/k)). FIG. 20 represents the functional expression of the different AmCaVcc2-δ1, 2 or 3 subunits co-expressed with AmCaV2a and AmCaV cA: examples of traces of currents recorded during depolarizations of -100 mV to +10 mV with AmCaVcc2-ôl , AmCaVcc2-δ2 or AmCaVcc2-δ. B: current-voltage curves obtained from oocytes expressing AmCaV2 + AmCaV c + AmCaVcc2-δ1, AmCaVcc2-ô2 or AmCaVcc2-δ3. C: parameters of the different curves after regression using the equation cur = G * (V-Erev) / (l + exp ((V-Vact) / k)).
EXEMPLES La présente invention se comprendra mieux à la lecture des exemples suivants qui illustrent non-limitativement l'invention. EXAMPLES The present invention will be better understood on reading the following examples which illustrate the invention in a nonlimiting manner.
Exemple 1 : identification et production d'un canal calcique isolé d'abeille Les protocoles suivants ont été appliqués pour l'identification et la production d'un canal calcique isolé d'abeille. Example 1 Identification and Production of an Isolated Bee Calcium Channel The following protocols have been applied for the identification and production of an isolated bee calcium channel.
1. Extraction des ARNs totaux du cerveau d'abeille. 1. Extraction of the total RNAs of the bee brain.
Pour l'extraction des ARN totaux, les pistons broyeurs, les micropipettes ainsi que la paillasse ont été soigneusement nettoyés avec la solution RNaseZap (Life Technologies, Saint Aubin, France). Les tubes de 1,5ml (Eppendorf France SAS, Le Pecq, France) ont été autoclavés. L'eau utilisée dans toute la procédure est de l'eau stérile et dépourvue d'activité nucléase (Swampscott, MA, USA). Les abeilles butineuses adultes ont été anesthésiées à 4°C ou par inhalation de C02. Le cerveau a été prélevé rapidement sous une loupe binoculaire et placé dans un tube de 1,5ml gardé dans la glace. L'ARN a été extrait en utilisant le kit RNeasy Mini Kit (QIAGEN SAS, Courtaboeuf, France). Les cerveaux, environ 12 cerveaux par extraction représentant environ 25mg de tissu, ont été broyés à l'aide d'un piston dans 600 μΐ^ de tampon RLT. Les recommandations du fabricant ont été suivies pour le reste de la procédure. Les ARN totaux ont également été extraits à partir de têtes entières. Les têtes d'environ 20 à 30 abeilles ont été broyées dans un porter dans 4ml de RNAwiz (Life Technologies SAS, Saint Aubin, France). Le lysat a été transféré dans un tube stérile de 14 ml (BD, NJ, USA). Le volume a été ajusté à 4ml avec du RNAwiz, agité au vortex pendant 1 minute et incubé pendant 5 minutes à température ambiante, à savoir 20°C. Un millilitre de chloroforme a été ajouté au lysat. Ce mélange a été agité au vortex pendant 1 minute, incubé 10 minutes à température ambiante, puis centrifugé à 5000g pendant 40 minutes à 4°C dans un rotor F-34-6-38 équipé d'adaptateurs (Eppendorf France SAS, Le Pecq, France). La phase aqueuse, surnageante, a été très proprement récupérée, en évitant toute contamination par l'interface, et transférée dans un nouveau tube de 14 ml. Le volume de phase aqueuse a été ajusté à 2,5ml avec de l'eau et 5 ml d'isopropanol ont été ajoutés. Ce mélange a été agité au vortex pendant 30 secondes, incubé pendant 10 minutes à température ambiante, puis centrifugé à 5000g pendant 60 minutes à 4°C. Le culot obtenu a été lavé avec 5ml d'une solution d'éthanol à 75% et centrifugé à 5000g pendant 10 minutes à 4°C. Après élimination du surnageant, le culot a été laissé à sécher pendant 5 minutes à température ambiante avant d'être resuspendu dans 50 à ΙΟΟμί d'eau. La concentration des ARNs totaux a été mesurée par spectrophotométrie sur un Biophotomètre (Eppendorf France SAS, Le Pecq, France). L'intégrité de l'ARN a été vérifiée en faisant migrer sur un gel d'agarose un aliquot, à savoir environ 500ng d'ARN en solution. Les solutions d'ARN ont ensuite été stockées à -80°C pour une utilisation ultérieure. 2. Synthèse du premier brin d'ADNc. For extraction of the total RNA, the grinding pistons, the micropipettes and the benchtop were thoroughly cleaned with the RNaseZap solution (Life Technologies, Saint Aubin, France). 1.5ml tubes (Eppendorf France SAS, Le Pecq, France) were autoclaved. The water used throughout the procedure is sterile water and lacks nuclease activity (Swampscott, MA, USA). Adult foraging bees were anesthetized at 4 ° C or by inhalation of C0 2 . The brain was removed quickly under a binocular loupe and placed in a 1.5ml tube kept in the ice. RNA was extracted using the RNeasy Kit Mini kit (QIAGEN SAS, Courtaboeuf, France). The brain, approximately 12 brain by extraction representing approximately 25mg tissue were ground using a piston in 600 μΐ ^ of Buffer RLT. The manufacturer's recommendations were followed for the rest of the procedure. Total RNAs were also extracted from whole heads. The heads of about 20 to 30 bees were ground in a 4ml RNAwiz holder (Life Technologies SAS, Saint Aubin, France). The lysate was transferred to a sterile 14 ml tube (BD, NJ, USA). The volume was adjusted to 4ml with RNAwiz, vortexed for 1 minute and incubated for 5 minutes at room temperature, ie 20 ° C. One milliliter of chloroform was added to the lysate. This mixture was vortexed for 1 minute, incubated for 10 minutes at room temperature and then centrifuged at 5000 g for 40 minutes at 4 ° C. in an F-34-6-38 rotor equipped with adapters (Eppendorf France SAS, Le Pecq). , France). The aqueous phase, supernatant, was very cleanly recovered, avoiding any contamination by the interface, and transferred to a new 14 ml tube. The volume of aqueous phase was adjusted to 2.5 ml with water and 5 ml of isopropanol was added. This mixture was vortexed for 30 seconds, incubated for 10 minutes at room temperature, and then centrifuged at 5000g for 60 minutes at 4 ° C. The pellet obtained was washed with 5 ml of a 75% ethanol solution and centrifuged at 5000 g for 10 minutes at 4 ° C. After removal of the supernatant, the pellet was allowed to dry for 5 minutes at room temperature before being resuspended in 50 to ΙΟΟμί of water. Concentration total RNAs were measured spectrophotometrically on a Biophotometer (Eppendorf France SAS, Le Pecq, France). The integrity of the RNA was verified by migrating an aliquot on an agarose gel, namely approximately 500ng of RNA in solution. The RNA solutions were then stored at -80 ° C for later use. 2. Synthesis of the first strand of cDNA.
La synthèse du premier brin d'ADNc a été réalisée en utilisant la SuperScript II Reverse Transcriptase (Life Technologies, Saint Aubin, France). Un mélange réactionnel de l2μL· composé de 3μg d'ARN total, de Ιμί d'une solution d'amorces 01igo(dT)18 à O^g^L (Fermentas France, Saint Rémy Lès Chevreuse, France), de Ιμί d'une solution de nucléotides dNTP à lOmM, et d'eau a été réalisé. Ce mélange a été incubé pendant 5 minutes à 65°C puis gardé sur la glace. A ce mélange ont été ajoutés :
Figure imgf000056_0001
du tampon de réaction (5X First Strand Buffer) et 2μL· d'une solution de dithiothréitol (DTT) à lOOmM fournie par le fabricant avec l'enzyme, et Ιμί d'inhibiteur de RNases RiboLock (Fermentas France, Saint Rémy Lès Chevreuse, France). Ce mélange a été incubé pendant 2 minutes à 37°C puis Ιμί de Reverse Transcriptase a été ajouté. La réaction a été incubée pendant 50 minutes à 42°C et stoppée en l'incubant pendant 15 minutes à 70°C. La réaction a été refroidie 2 minutes sur la glace, Ιμί de RNase H (Fermentas France, Saint Rémy Lès Chevreuse, France) a été ajouté, et la réaction a été incubée pendant 20 minutes à 37°C. L'extrémité 5' de l'ADNc a été obtenue par RACE-PCR en utilisant 10μ§ d'ARN total et le kit First Choice RLM-RACE (Life Technologies, Saint Aubin, France) en suivant les recommandations du fabricant. Les solutions d'ADNc ont été stockées à -20°C pour une utilisation ultérieure. First strand cDNA synthesis was performed using SuperScript II Reverse Transcriptase (Life Technologies, Saint Aubin, France). A reaction mixture of 12μL · composed of 3μg of total RNA, Ιμί of a solution of primers 01igo (dT) 18 to O ^ g ^ L (Fermentas France, Saint Rémy Lès Chevreuse, France), of Ιμί d a solution of dNTP nucleotides at 10 mM, and water was made. This mixture was incubated for 5 minutes at 65 ° C. and then kept on ice. To this mixture were added:
Figure imgf000056_0001
reaction buffer (5X First Strand Buffer) and 2μL · 100mM solution of dithiothreitol (DTT) supplied by the manufacturer with the enzyme, and RiboLock RNase inhibitor (μί (Fermentas France, Saint Rémy Lès Chevreuse, France). This mixture was incubated for 2 minutes at 37 ° C. then Ιμί of Reverse Transcriptase was added. The reaction was incubated for 50 minutes at 42 ° C and stopped by incubating for 15 minutes at 70 ° C. The reaction was cooled for 2 minutes on ice, Ιμί of RNase H (Fermentas France, Saint Rémy Lès Chevreuse, France) was added, and the reaction was incubated for 20 minutes at 37 ° C. The 5 'end of the cDNA was obtained by RACE-PCR using 10μ of total RNA and the First Choice RLM-RACE Kit (Life Technologies, Saint Aubin, France) following the manufacturer's recommendations. The cDNA solutions were stored at -20 ° C for later use.
3. Amplification de l'ADNc par Réaction de Polymérisation en Chaîne (PCR) et clonage des fragments. Dans cet exemple, les amplifications ont été réalisées selon le procédé suivant : la polymérase Herculase II Fusion (Agilent Technologies France SAS, Les Ulis, France) a été utilisée pour amplifier des fragments d'ADNc dans des réactions de 50μί comprenant : Ιμί d'enzyme, l0μL· de tampon de réaction (5X Herculase II Reaction Buffer) fourni par le fabricant, Ιμί d'une solution de nucléotides dNTP à lOmM, Ιμΐ de chaque amorce à ΙΟμΜ, 0 à 8% diméthylsulfoxyde (DMSO, fourni avec l'enzyme par le fabricant), de l'eau et la matrice d'ADN consistant en soit Ιμΐ de cDNA issu de la réaction de Reverse Transcription décrite ci-dessus, soit lOOng de vecteur plasmidique. Le nombre de cycle, les températures et durées des cycles de dénaturation (92-98°C ; 20-60s), d'hybridation (55-65°C, 20-60s), et d'élongation (68 ou 72°C, 30s-3mn) des PCR pour obtenir les fragments ont été optimisés empiriquement pour chaque couple d'amorces et sont indiqués ci-dessous. Les réactions de PCR ont été réalisées en utilisant un PTC-150 MiniCycler (MJ Research Inc, MA, USA) équipé d'un couvercle chauffant. Le résultat de l'amplification a été analysé en faisant migrer un aliquot, à savoir environ 5μ1 de la réaction de PCR sur un gel d'agarose. Pour les réactions positives identifiées, le volume restant des réactions d'amplification, soit 45 1, a été déposé sur un gel d'agarose, les bandes ont été excisées du gel et purifiées avec le kit NucleoSpin Extract II (Macherey-Nagel EURL, Hoerd, France). Les fragments purifiés ont été traités avec Ιμί de T4 Polynucleotide Kinase (Life Technologies, Saint Aubin, France) dans un volume réactionnel de 50μί en présence de : l0μL· de tampon de réaction (5X Forward Buffer) fourni par le fabricant et 5μί d'une solution d'ATP à lOmM. Les fragments phosphorylés ont été insérés dans le vecteur de clonage pBluescript-II SK (Agilent Technologies France SAS, Les Ulis, France) ouvert par l'enzyme de restriction EcoRV (New England Biolabs France, Evry, France) et déphosphorylé par la Phosphatase Alkaline CIF (New England Biolabs France, Evry, France), en utilisant la T4 DNA ligase (New England Biolabs France, Evry, France), en suivant les recommandations du fabricant. Les vecteurs recombinants ont été séquencés sur les deux brins par Eurofins MWG Operon (Ebersberg, Germany). Les séquences ont été analysées grâce à la suite logicielle Vector NTI 5.0 (InforMax, MD, USA). Les digestions enzymatiques ont été réalisées en suivant les recommandations du fabricant (New England Biolabs France, Evry, France). Les fragments issus de la digestion enzymatique ont été séparés sur un gel d'agarose et les bandes d'intérêt ont été excisées et purifiées avec le kit NucleoSpin Extract II (Macherey-Nagel EURL, Hoerd, France) en suivant les recommandations du fabricant. Les fragments purifiés ont été insérés dans les vecteurs de clonage en utilisant la T4 DNA ligase (New England Biolabs France, Evry, France), en suivant les recommandations du fabricant. Construction du vecteur de clonage pBS-PL4 3. Amplification of the cDNA by Chain Polymerization Reaction (PCR) and cloning of the fragments. In this example, the amplifications were carried out according to the following method: Herculase II Fusion polymerase (Agilent Technologies France SAS, Les Ulis, France) was used to amplify cDNA fragments in 50μί reactions comprising: Ιμί d enzyme, 10μL · of reaction buffer (5X Herculase II Reaction Buffer) supplied by the manufacturer, Ιμί of a solution of dNTP nucleotides at 10mM, Ιμΐ of each primer at ΙΟμΜ, 0 to 8% dimethylsulfoxide (DMSO, supplied with the enzyme by the manufacturer), water, and the DNA template consisting of either Ιμΐ cDNA from the Reverse Transcription reaction described above or 100ng of plasmid vector. The number of cycles, the temperatures and the duration of denaturation cycles (92-98 ° C, 20-60s), hybridization (55-65 ° C, 20-60s), and elongation (68 or 72 ° C , 30s-3mn) PCRs to obtain the fragments were optimized empirically for each pair of primers and are shown below. PCR reactions were performed using a PTC-150 MiniCycler (MJ Research Inc., MA, USA) equipped with a heated lid. The result of the amplification was analyzed by migrating an aliquot, namely about 5 μl of the PCR reaction on an agarose gel. For the positive reactions identified, the remaining volume of the amplification reactions, ie 45 l, was deposited on an agarose gel, the bands were excised from the gel and purified with the NucleoSpin Extract II kit (Macherey-Nagel EURL, Hoerd, France). The purified fragments were treated with Ιμί of T4 polynucleotide kinase (Life Technologies, Saint Aubin, France) in a reaction volume of 50 μί in the presence of: 10 μl of reaction buffer (5 × Forward Buffer) supplied by the manufacturer and 5 μl of a solution of ATP at 10 mM. The phosphorylated fragments were inserted into the pBluescript-II SK cloning vector (Agilent Technologies France SAS, Les Ulis, France) opened with the restriction enzyme EcoRV (New England Biolabs France, Evry, France) and dephosphorylated by the Alkaline Phosphatase. CIF (New England Biolabs France, Evry, France), using T4 DNA ligase (New England Biolabs France, Evry, France), following the manufacturer's recommendations. The recombinant vectors were sequenced on both strands by Eurofins MWG Operon (Ebersberg, Germany). The sequences were analyzed using the Vector NTI 5.0 software suite (InforMax, MD, USA). Enzymatic digestion was performed following the manufacturer's recommendations (New England Biolabs France, Evry, France). Fragments from enzymatic digestion were separated on an agarose gel and the bands of interest were excised and purified with the NucleoSpin Extract II kit (Macherey-Nagel EURL, Hoerd, France) following the manufacturer's recommendations. The purified fragments were inserted into the cloning vectors using T4 DNA ligase (New England Biolabs France, Evry, France), following the manufacturer's recommendations. Construction of the cloning vector pBS-PL4
Les oligonucléotides PL006 et PL007 ont été repris à ^g^L, aliquotés à lOOng^L et stockés à -20°C pour une utilisation ultérieure. Pour chacun des oligonucléotides, un mélange réactionnel de 25 μΐ^ comprenant lOOng d'oligonucléotides, 5μί de tampon de réaction (5X Forward Buffer) fourni par le fabricant, 2,5μί d'une solution d'ATP à lOmM, Ιμί de T4 Polynucleotide kinase (Life Technologies, Saint Aubin, France) et de l'eau a été réalisé, incubé 30 minutes à 37°C puis 30 minutes à 65°C. Un mélange comprenant 5μί de chacun des oligonucléotides phosphorylés (PL006 et PL007) et l0μL· d'une solution de Tris à 5mM a été réalisé, placé dans le thermocycleur PTC- 150 MiniCycler (MJ Research Inc, MA, USA). Le mélange a été chauffé pendant 3 minutes à 90°C puis la température a été abaissée de 1°C par minute jusqu'à 30°C, pour obtenir un fragment double brin (« linker PL4 »), qui a été stocké à -20°C pour une utilisation ultérieure. Le vecteur pBluescript-II SK a été ouvert par les enzymes de restriction Sacl et Kpnl comme décrit ci-dessus et purifié sur gel d'agarose en utilisant le kit NucleoSpin Extract II (Macherey-Nagel EURL, Hoerd, France), en suivant les recommandations du fabricant. Le linker PL4 a été inséré dans le vecteur pBluescript-II SK ouvert Sacl-Kpnl en utilisant la T4 DNA ligase (New England Biolabs France, Evry, France), 3μί de « linker PL4 », lOOng de vecteur,
Figure imgf000058_0001
de tampon de réaction (10X T4 DNA ligase Reaction Buffer) fourni par le fabricant et de l'eau pour obtenir un volume de réaction de 20μί. La réaction a été incubée 5 heures à température ambiante (20°C). Un vecteur recombinant dénommé pBS-PL4 a été séquencé pour vérifier l'insertion du linker PL4. Oligonucleotides PL006 and PL007 were taken up to 100 μL, aliquoted at 100 μL and stored at -20 ° C. for later use. For each oligonucleotide a reaction mixture comprising 25 μΐ ^ Loong oligonucleotide, 5μί reaction buffer (5X Forward Buffer) provided by the manufacturer, 2,5μί an ATP solution to lOmM, Ιμί of T4 Polynucleotide kinase (Life Technologies, Saint Aubin, France) and water was made, incubated 30 minutes at 37 ° C and then 30 minutes at 65 ° C. A mixture comprising 5 μl of each of the phosphorylated oligonucleotides (PL006 and PL007) and 10 μl of a 5 mM Tris solution was made, placed in the PTC-150 MiniCycler thermocycler (MJ Research Inc, MA, USA). The mixture was heated for 3 minutes at 90 ° C and then the temperature was lowered from 1 ° C per minute to 30 ° C, to obtain a double-stranded fragment ("PL4 linker"), which was stored at - 20 ° C for later use. The pBluescript-II SK vector was opened by the restriction enzymes SacI and KpnI as described above and purified on agarose gel using the NucleoSpin Extract II kit (Macherey-Nagel EURL, Hoerd, France), following the manufacturer's recommendations. The PL4 linker was inserted into the SacI-KpnI open pBluescript-II SK vector using T4 DNA ligase (New England Biolabs France, Evry, France), 3 μl of "PL4 linker," 100 ng of vector,
Figure imgf000058_0001
of reaction buffer (10X T4 DNA ligase Reaction Buffer) provided by the manufacturer and water to obtain a reaction volume of 20μί. The reaction was incubated for 5 hours at room temperature (20 ° C). A recombinant vector called pBS-PL4 was sequenced to verify the insertion of the PL4 linker.
4. Construction du vecteur de clonage pBS-PL6. 4. Construction of the cloning vector pBS-PL6.
Les oligonucléotides PL10 et PLU ont été repris à ^g^L, aliquotés à lOOng^L et stockés à -20°C pour une utilisation ultérieure. Pour chacun des oligonucléotides, un mélange réactionnel de 25 μΐ^ comprenant lOOng d'oligonucléotides, 5μί de tampon de réaction (5X Forward Buffer) fourni par le fabricant, 2,5μί d'une solution d'ATP à lOmM, Ιμί de T4 Polynucleotide kinase (Life Technologies, Saint Aubin, France) et de l'eau a été réalisé, incubé 30 minutes à 37°C puis 30 minutes à 65°C. Un mélange comprenant 5μί de chacun des oligonucléotides phosphorylés (PL10 et PLU) et l0μL· d'une solution de Tris à 5mM a été réalisé, placé dans le thermocycleur PTC- 150 MiniCycler (MJ Research Inc, MA, USA). Le mélange a été chauffé pendant 3 minutes à 90°C puis la température a été abaissée de 1°C par minute jusqu'à 30°C, pour obtenir un fragment double brin (« linker PL6 »), qui a été stocké à -20°C pour une utilisation ultérieure. Le vecteur pBluescript-II SK a été ouvert par les enzymes de restriction Notl et Kpnl comme décrit ci-dessus et purifié sur gel d'agarose en utilisant le kit NucleoSpin Extract II (Macherey-Nagel EURL, Hoerd, France), en suivant les recommandations du fabricant. Le linker PL6 a été inséré dans le vecteur pBluescript-II SK ouvert Notl-Kpnl en utilisant la T4 DNA ligase (New England Biolabs France, Evry, France), 3μί de « linker PL6 », lOOng de vecteur,
Figure imgf000059_0001
de tampon de réaction (10X T4 DNA ligase Reaction Buffer) fourni par le fabricant et de l'eau pour obtenir un volume de réaction de 20μί. La réaction a été incubée 5 heures à température ambiante (20°C). Un vecteur recombinant dénommé pBS-PL6 a été séquencé pour vérifier l'insertion du linker PL6. 5. Construction du vecteur de clonage pBS-PL7. Oligonucleotides PL10 and PLU were taken up to 40 μL, aliquoted at 100 μL and stored at -20 ° C. for later use. For each oligonucleotide a reaction mixture comprising 25 μΐ ^ Loong oligonucleotide, 5μί reaction buffer (5X Forward Buffer) provided by the manufacturer, 2,5μί an ATP solution to lOmM, Ιμί of T4 Polynucleotide kinase (Life Technologies, Saint Aubin, France) and water was made, incubated 30 minutes at 37 ° C and then 30 minutes at 65 ° C. A mixture comprising 5 μl of each of the phosphorylated oligonucleotides (PL10 and PLU) and 10 μL. a 5mM Tris solution was made, placed in the PTC-150 MiniCycler thermal cycler (MJ Research Inc, MA, USA). The mixture was heated for 3 minutes at 90 ° C and then the temperature was lowered from 1 ° C per minute to 30 ° C, to obtain a double-stranded fragment ("PL6 linker"), which was stored at - 20 ° C for later use. The pBluescript-II SK vector was opened by the NotI and KpnI restriction enzymes as described above and purified on agarose gel using the NucleoSpin Extract II kit (Macherey-Nagel EURL, Hoerd, France), following the manufacturer's recommendations. The PL6 linker was inserted into the vector pBluescript-II SK open NotI-KpnI using the T4 DNA ligase (New England Biolabs France, Evry, France), 3 μl of "linker PL6", 100 ng of vector,
Figure imgf000059_0001
of reaction buffer (10X T4 DNA ligase Reaction Buffer) provided by the manufacturer and water to obtain a reaction volume of 20μί. The reaction was incubated for 5 hours at room temperature (20 ° C). A recombinant vector called pBS-PL6 was sequenced to verify the insertion of the PL6 linker. 5. Construction of the cloning vector pBS-PL7.
Les oligonucléotides PL12 et PL13 ont été repris à ^g^L, aliquotés à lOOng^L et stockés à -20°C pour une utilisation ultérieure. Pour chacun des oligonucléotides, un mélange réactionnel de 25μί comprenant lOOng d' oligonucléotides, 5μί de tampon de réaction (5X Forward Buffer) fourni par le fabricant, 2,5μί d'une solution d'ATP à lOmM, Ιμί de T4 Polynucleotide kinase (Life Technologies, Saint Aubin, France) et de l'eau a été réalisé, incubé 30 minutes à 37°C puis 30 minutes à 65°C. Un mélange comprenant 5μί de chacun des oligonucléotides phosphorylés (PL12 et PL13) et ΙΟμί d'une solution de Tris à 5mM a été réalisé, placé dans un thermocycleur PTC-150 MiniCycler (MJ Research Inc, MA, USA). Le mélange a été de chauffé pendant 3 minutes à 90°C puis la température a été abaissée de 1°C par minute jusqu'à 30°C, pour obtenir un fragment double brin (« linker PL7 »), qui a été stocké à -20°C pour une utilisation ultérieure. Le vecteur pBluescript-II SK a été ouvert par les enzymes de restriction Notl et Kpnl comme décrit ci-dessus et purifié sur gel d'agarose en utilisant le kit NucleoSpin Extract II (Macherey-Nagel EURL, Hoerd, France), en suivant les recommandations du fabricant. Le linker PL7 a été inséré dans le vecteur pBluescript II- SK ouvert Notl-Kpnl en utilisant la T4 DNA ligase (New England Biolabs France, Evry, France), 3μί de « linker PL7 », lOOng de vecteur,
Figure imgf000060_0001
de tampon de réaction (10X T4 DNA ligase Reaction Buffer) fourni par le fabricant et de l'eau pour obtenir un volume de réaction de 20μ1. La réaction a été incubée 5 heures à température ambiante (20°C). Un vecteur recombinant dénommé pBS-PL7 a été séquencé pour vérifier l'insertion du linker PL7. Oligonucleotides PL12 and PL13 were taken up to 90 μL, aliquoted at 100 μL and stored at -20 ° C. for later use. For each of the oligonucleotides, a reaction mixture of 25 μί comprising 100 ng of oligonucleotides, 5 μί of reaction buffer (5 × Forward Buffer) supplied by the manufacturer, 2.5 μί of a solution of ATP at 10 mM, Ι μί of T4 polynucleotide kinase ( Life Technologies, Saint Aubin, France) and water was made, incubated 30 minutes at 37 ° C and then 30 minutes at 65 ° C. A mixture comprising 5μί of each of the phosphorylated oligonucleotides (PL12 and PL13) and ΙΟμί of a 5mM Tris solution was made, placed in a PTC-150 MiniCycler thermocycler (MJ Research Inc, MA, USA). The mixture was heated for 3 minutes at 90 ° C and then the temperature was lowered from 1 ° C per minute to 30 ° C, to obtain a double-stranded fragment ("PL7 linker"), which was stored at -20 ° C for later use. The pBluescript-II SK vector was opened by the NotI and KpnI restriction enzymes as described above and purified on agarose gel using the NucleoSpin Extract II kit (Macherey-Nagel EURL, Hoerd, France), following the manufacturer's recommendations. The PL7 linker has been inserted into the vector pBluescript II- SK Open Notl-Kpnl using T4 DNA ligase (New England Biolabs France, Evry, France), 3μί of "PL7 linker," 100ng of vector,
Figure imgf000060_0001
of reaction buffer (10X T4 DNA ligase Reaction Buffer) supplied by the manufacturer and water to obtain a reaction volume of 20μ1. The reaction was incubated for 5 hours at room temperature (20 ° C). A recombinant vector called pBS-PL7 was sequenced to verify the insertion of the PL7 linker.
6. Amplification de la séquence nucléotidique de la sous-unité amCavla. 6. Amplification of the nucleotide sequence of the amCavla subunit.
Une RACE-PCR utilisant les amorces 5' OUTER Primer (fourni par le fabricant dans le kit First Choice RLM-RACE) et amcavl-019AS pour la 1ère PCR, selon le protocole décrit ci-dessus (avec 4% DMSO et 35 cycles : (1min à 94°C, 1min à 55°C, 1min à 72°C), et les amorces 5'INNER Primer (fourni par le fabricant dans le kit First Choice RLM-RACE) et amcav 1-025 AS pour la seconde PCR, selon le protocole décrit ci- dessus (avec 4% DMSO et 35 cycles : 1min à 94°C, 1min à 55°C, 1min à 72°C), a été réalisée, et a permis d'identifier les nucléotides 1 à 442 de la séquence SEQ ID NO°9. Le fragment amplifié, dénommé Cavl(50Bl l), a été cloné dans pBluescript-II SK selon le protocole décrit ci-dessus. Une PCR utilisant les amorces amcavl-016S et amcavl- 024AS a été réalisée, selon le protocole décrit ci-dessus (sans DMSO et 35 cycles : 1min à 94°C, 1min à 60°C, 1min à 72°C), et a permis d'identifier les nucléotides 367 à 1122 de la séquence SEQ ID NO°9. Le fragment amplifié, dénommé Cavl(35), a été cloné dans pBluescript-II SK selon le protocole décrit ci-dessus. Une PCR utilisant les amorces amcav 1-007S et amcav 1-010AS a été réalisée selon le protocole décrit ci- dessus (avec 4% DMSO et 35 cycles : 30s à 95°C, 30s à 54°C, 3min à 72°C), et a permis d'identifier les nucléotides 511 à 3526 de la séquence SEQ ID NO°9. Le fragment amplifié, dénommé Cavl(12), a été cloné dans pBluescript-II SK selon le protocole décrit ci-dessus. Une PCR utilisant les amorces amcavl-OUS et amcavl- 009AS a été réalisée selon le protocole décrit ci-dessus (avec 4% DMSO et 35 cycles : 30s à 95°C, 1min à 54°C, 3min à 72°C), et a permis d'identifier les nucléotides 3085 à 5143 de la séquence SEQ ID NO°9. Le fragment amplifié, dénommé Cavl(l l), a été cloné dans pBluescript-II SK selon le protocole décrit ci-dessus. Une PCR utilisant les amorces amcav 1-003S et amcav 1-004AS a été réalisée selon le protocole décrit ci- dessus (avec 4% DMSO et 30 cycles : 30s à 95°C, 30s à 58°C, 2min à 72°C), et a permis d'identifier les nucléotides 2174 à 4445 de la séquence SEQ ID NO°9. Le fragment amplifié, dénommé Cavl(5), a été cloné dans pBluescript-II SK selon le protocole décrit ci-dessus. Une PCR utilisant les amorces amcavl-005S et amcavl- 006AS a été réalisée selon le protocole décrit ci-dessus (avec 4% DMSO et 30 cycles : 30s à 95°C, 30s à 58°C, 2min à 72°C), et a permis d'identifier les nucléotides 4446 à 5850 de la séquence SEQ ID NO°9. Le fragment amplifié, dénommé Cavl(6), a été cloné dans pBluescript-II SK selon le protocole décrit ci-dessus. Une PCR utilisant les amorces amcavl-008S et amcavl-012AS (localisé dans l'extrémité 3' non codante) a été réalisée selon le protocole décrit ci-dessus (avec 4% DMSO et 35 cycles : 30s à 95°C, 30s à 60°C, 2min à 72°C), et a permis d'identifier les nucléotides 5121 à 5937 de la séquence SEQ ID NO°9. Le fragment amplifié, dénommé Cavl(23), a été cloné dans pBluescript-II SK selon le protocole décrit ci-dessus. A RACE-PCR using primers 5 'OUTER Primer (supplied by the manufacturer in the First Choice RLM-RACE kit) and amcavl-019AS for the 1st PCR, according to the protocol described above (with 4% DMSO and 35 cycles: (1min at 94 ° C, 1min at 55 ° C, 1min at 72 ° C), and the primers 5'INNER Primer (supplied by the manufacturer in the First Choice RLM-RACE kit) and amcav 1-025 AS for the second PCR, according to the protocol described above (with 4% DMSO and 35 cycles: 1 min at 94 ° C., 1 min at 55 ° C., 1 min at 72 ° C.), was carried out, and made it possible to identify the nucleotides 1 at 442 of the sequence SEQ ID No. 9. The amplified fragment, designated Cav1 (50Bl1), was cloned into pBluescript-II SK according to the protocol described above.A PCR using primers amcavl-016S and amcavl-024AS was carried out, according to the protocol described above (without DMSO and 35 cycles: 1min at 94 ° C, 1min at 60 ° C, 1min at 72 ° C), and made it possible to identify the nucleotides 367 to 1122 of the sequence SEQ ID No. 9. amplified fragment, named Cav1 (35), was cloned into pBluescript-II SK according to the protocol described above. A PCR using primers amcav 1-007S and amcav 1-010AS was carried out according to the protocol described above (with 4% DMSO and 35 cycles: 30s at 95 ° C., 30s at 54 ° C., 3 min at 72 ° C. ), and identified nucleotides 511 to 3526 of the sequence SEQ ID NO: 9. The amplified fragment, designated Cav1 (12), was cloned into pBluescript-II SK according to the protocol described above. PCR using primers amcavl-OUS and amcavl-009AS was carried out according to the protocol described above (with 4% DMSO and 35 cycles: 30s at 95 ° C, 1min at 54 ° C, 3min at 72 ° C), and made it possible to identify nucleotides 3085 to 5143 of the sequence SEQ ID No. 9. The amplified fragment, designated Cavl (II), was cloned into pBluescript-II SK according to the protocol described above. PCR using primers amcav 1-003S and amcav 1-004AS was performed according to the protocol described above. above (with 4% DMSO and 30 cycles: 30s at 95 ° C, 30s at 58 ° C, 2min at 72 ° C), and identified nucleotides 2174 to 4445 of the sequence SEQ ID No. 9. The amplified fragment, designated Cav1 (5), was cloned into pBluescript-II SK according to the protocol described above. PCR using primers amcavl-005S and amcavl-006AS was carried out according to the protocol described above (with 4% DMSO and 30 cycles: 30s at 95 ° C, 30s at 58 ° C, 2min at 72 ° C), and identified nucleotides 4446 to 5850 of the sequence SEQ ID NO: 9. The amplified fragment, designated Cav1 (6), was cloned into pBluescript-II SK according to the protocol described above. PCR using primers amcavl-008S and amcavl-012AS (located in the 3 'non-coding end) was carried out according to the protocol described above (with 4% DMSO and 35 cycles: 30s at 95 ° C., 30s at 30 ° C.). 60 ° C, 2min at 72 ° C), and identified nucleotides 5121 to 5937 of the sequence SEQ ID No. 9. The amplified fragment, named Cav1 (23), was cloned into pBluescript-II SK according to the protocol described above.
7. Construction de la séquence nucléotidique de la sous-unité amCavla. Une réaction de PCR chevauchante (« overlap PCR ») a été réalisée pour obtenir le fragment Cavl(42) en utilisant les fragments de PCR Cavl(42A) et Cavl(42B) amplifiés en utilisant respectivement les amorces amcavl-029S (localisé dans l'extrémité 5' non codante) et amcaval-026AS, et amcavl-016S et amcavl-019AS pour introduire un site de restriction Notl en 5' du codon Start de la SEQ ID n°9. Les fragments Cavl(42A) et Cavl(42B) ont été obtenus selon le protocole décrit ci-dessus (sans DMSO et 30 cycles : 30s à 92°C, 30s à 56°C, lmn à 72°C), en utilisant comme matrice lOOng de plasmide contenant respectivement le fragment Cavl(50Bl l) et Cavl(12). Les fragments Cavl(42A) et Cavl(42B) ont été purifiés sur gel d'agarose comme décrit ci-dessus. Le fragment Cavl(42) a été obtenu en réalisant une PCR selon le protocole décrit ci-dessus (sans DMSO, et 25 cycles : lmn à 94°C, lmn à 56°C, 90s à 72°C), 3μ1 de chacun des fragments Cavl(42A) et Cavl(42B) purifiés et les amorces amcavl-029S et amcavl-019AS. Le fragment Cavl(42) a été cloné dans pBluescript-II SK selon le protocole décrit ci-dessus. Une PCR utilisant les amorces amcavl-008S et amcavl-030AS (localisé dans l'extrémité 3' non codante) a été réalisée selon le protocole décrit ci-dessus (sans DMSO et 30 cycles : 30s à 92°C, 30s à 56°C, lmn à 72°C), en utilisant comme matrice lOOng de plasmide contenant le fragment Cavl(23), pour introduire un site de restriction Kpnl en 3' du codon Stop de la SEQ ID n°9. Le fragment obtenu, dénommé Cavl(43) a été cloné dans pBluescript-II SK selon le protocole décrit ci-dessus. La séquence de la sous-unité amCavla entière a été obtenue en joignant les différents fragments de PCR en utilisant des sites de restriction présents dans les fragments chevauchants dans le vecteur pBS-PL7. Pour ce faire, le fragment Cavl(43) issu de la digestion enzymatique du fragment Cavl(43) inséré dans le vecteur pBluescript-II SK a été sous cloné dans le vecteur pBS-PL7 en utilisant les enzymes de restriction Agel (position 5258 dans la SEQ ID n°9) et Kpnl selon le protocole décrit ci- dessus. Un fragment Cavl(5a) issu de la digestion enzymatique du fragment Cavl(5) inséré dans le vecteur pBluescript-II SK a été sous cloné dans le vecteur pBluescript-II KS (Agilent Technologies) en utilisant les enzymes de restriction Xbal (position 2750 dans la SEQ ID n°9) et Xhol (position 3758 dans la SEQ ID n°9) selon le protocole décrit ci-dessus. Le fragment Cavl(42) issu de la digestion enzymatique du fragment Cavl(42) inséré dans le vecteur pBluescript-II SK a été sous cloné dans le vecteur pBS- PL7 en utilisant les enzymes de restriction Notl et BamHI (position 911 dans la SEQ ID n°9) selon le protocole décrit ci-dessus. Un fragment issu la digestion enzymatique du fragment Cavl(l l) inséré dans le vecteur pBluescript-II SK a été sous cloné dans le vecteur pBluescript-II SK contenant le fragment Cavl(6) en utilisant les enzymes de restriction Aatll (position 4803 dans la SEQ ID n°9) et Notl selon le protocole décrit ci- dessus pour générer le fragment Cavl(l lb+6). Un fragment issu de la digestion enzymatique du fragment Cavl(l lb+6) inséré dans le vecteur pBluescript-II SK a été sous cloné dans le vecteur pBS-PL7 contenant le fragment Cavl(43) en utilisant les enzymes de restriction Xhol (position 3758 dans SEQ ID n°9) et Agel (position 5258 dans SEQ ID n°9) selon le protocole décrit ci-dessus pour générer le fragment Cavl(l lb+6+43). Un fragment issu de la digestion enzymatique du fragment Cavl(l lb+6+43) inséré dans le vecteur pBS-PL7 a été sous cloné dans le vecteur pBluescript-II KS contenant le fragment Cav(5a) en utilisant les enzymes de restriction Xho (postion 3758 dans SEQ ID n°9) et Kpnl selon le protocole décrit ci-dessus pour générer le fragment Cavl(5+11+6+43). Un fragment issu de la digestion enzymatique du fragment Cavl(12) inséré dans le vecteur pBluescript-II SK a été sous cloné dans le vecteur pBS-PL7 contenant le fragment Cavl(42) en utilisant les enzymes de restriction BamHI (position 911 dans SEQ ID n°9) et Xbal (position 2750 dans SEQ ID n°9) selon le protocole décrit ci-dessus pour générer le fragment Cavl(42+12). Un fragment issu de la digestion enzymatique du fragment Cavl(5+11+6+43) inséré dans le vecteur pBluescript-II KS a été sous cloné dans le vecteur pBS-PL7 contenant le fragment Cavl(42+12) en utilisant les enzymes de restriction Xbal (position 2750 dans SEQ ID n°9) et Kpnl selon le protocole décrit ci-dessus pour générer le fragment amCavla. 7. Construction of the nucleotide sequence of the amCavla subunit. An overlapping PCR reaction ("overlap PCR") was performed to obtain the Cav1 fragment (42) using the amplified PCR Cav1 (42A) and Cav1 (42B) fragments using respectively primers amcavl-029S (localized in US Pat. 5 'non-coding end) and amcaval-026AS, and amcavl-016S and amcavl-019AS to introduce a 5' NotI restriction site of the Start codon of SEQ ID NO: 9. Cav1 (42A) and Cav1 (42B) fragments were obtained according to the protocol described above (without DMSO and 30 cycles: 30s at 92 ° C, 30s at 56 ° C, 1 min at 72 ° C), using matrix 100ng of plasmid respectively containing the fragment Cav1 (50Bl1) and Cav1 (12). Cav1 (42A) and Cav1 (42B) fragments were purified on agarose gel as described above. The Cav1 fragment (42) was obtained by carrying out a PCR according to the protocol described above (without DMSO, and 25 cycles: 1 min at 94 ° C., 1 min at 56 ° C., 90 sec at 72 ° C.), 3 μl each. purified Cav1 (42A) and Cav1 (42B) fragments and primers amcavl-029S and amcavl-019AS. The Cav1 fragment (42) was cloned into pBluescript-II SK according to the protocol described above. PCR using primers amcavl-008S and amcavl-030AS (located in the 3 'non-coding end) was carried out according to the protocol described above (without DMSO and 30 cycles: 30s at 92 ° C., 30s at 56 ° C.). C, lmn to 72 ° C), using as template 100ng of plasmid containing the Cav1 fragment (23), to introduce a KpnI restriction site 3 'of the Stop codon of SEQ ID No. 9. The resulting fragment, named Cav1 (43) was cloned into pBluescript-II SK according to the protocol described above. The entire amCavla subunit sequence was obtained by joining the different PCR fragments using restriction sites present in the overlapping fragments in the pBS-PL7 vector. To do this, the Cav1 fragment (43) resulting from the enzymatic digestion of the Cav1 fragment (43) inserted into the vector pBluescript-II SK was subcloned into the vector pBS-PL7 using the restriction enzymes Agel (position 5258 in SEQ ID No. 9) and KpnI according to the protocol described above. A Cav1 fragment (5a) from the enzymatic digestion of the Cav1 (5) fragment inserted into the pBluescript-II SK vector was subcloned into the pBluescript-II KS vector (Agilent Technologies) using Xbal restriction enzymes (position 2750). in SEQ ID NO: 9) and XhoI (position 3758 in SEQ ID NO: 9) according to the protocol described above. The Cav1 fragment (42) resulting from the enzymatic digestion of the Cav1 fragment (42) inserted into the pBluescript-II SK vector was subcloned into the vector pBS-PL7 using the NotI and BamHI restriction enzymes (position 911 in SEQ ID No. 9) according to the protocol described above. A fragment resulting from the enzymatic digestion of the Cav1 (ll) fragment inserted into the pBluescript-II SK vector was subcloned into the pBluescript-II SK vector containing the Cav1 fragment (6) using the AatII restriction enzymes (position 4803 in FIG. SEQ ID No. 9) and NotI according to the protocol described above to generate the fragment Cav1 (1 lb + 6). A fragment from the enzymatic digestion of the Cav1 (1 lb + 6) fragment inserted into the pBluescript-II SK vector was subcloned into the pBS-PL7 vector containing the Cav1 fragment (43) using the XhoI restriction enzymes (position 3758 in SEQ ID No. 9) and Agel (position 5258 in SEQ ID No. 9) according to the protocol described above to generate the Cav1 fragment (1 lb + 6 + 43). A fragment from the enzymatic digestion of the Cav1 fragment (1 lb + 6 + 43) inserted into the pBS-PL7 vector was subcloned into the pBluescript-II KS vector containing the Cav (5a) fragment using the Xho restriction enzymes. (position 3758 in SEQ ID No. 9) and KpnI according to the protocol described above to generate the Cav1 fragment (5 + 11 + 6 + 43). A fragment from the enzymatic digestion of the Cav1 (12) fragment inserted into the pBluescript-II SK vector was subcloned into the pBS-PL7 vector containing the Cav1 fragment (42) using the restriction enzymes BamHI (position 911 in SEQ ID No. 9) and XbaI (position 2750 in SEQ ID No. 9) according to the protocol described above to generate the Cav1 fragment (42 + 12). A fragment from the enzymatic digestion of the Cav1 fragment (5 + 11 + 6 + 43) inserted into the vector pBluescript-II KS was subcloned into the vector pBS-PL7 containing the Cav1 fragment (42 + 12) using the enzymes Xbal restriction (position 2750 in SEQ ID No. 9) and KpnI according to the protocol described above to generate the amCavla fragment.
8. Amplification de séquence nucléotidique de la sous-unité amCav2b. 8. Amplification of the nucleotide sequence of the amCav2b subunit.
Une RACE PCR utilisant les amorces 5'OUTER Primer et amcav2-021AS pour la 1ère PCR, selon le protocole décrit ci-dessus (avec 4% DMSO et 35 cycles : 30s à 94°C, 30s à 56°C, 2mn à 72°C), et les amorces 5'INNER Primer et amcav2-022AS pour la seconde PCR, selon le protocole décrit ci-dessus (avec 4% DMSO et 35 cycles : 30s à 94°C, 30s à 56°C, lmn à 72°C), a été réalisée et a permis d'identifier les nucléotides 47 à 342 de la séquence SEQ ID NO010. Le fragment amplifié, dénommé Cav2(22Jj), a été cloné dans le vecteur pBluescript-II SK selon le protocole décrit ci-dessus. Une RACE PCR utilisant les amorces 5' OUTER Primer et amCav2-021AS pour la lère PCR, selon le protocole décrit ci-dessus (avec 4% DMSO et 40 cycles : 30s à 94°C, 30s à 56°C, 2mn à 72°C), et les amorces amcav2-025S et amcav2-022AS pour la seconde PCR, selon le protocole décrit ci-dessus (sans DMSO et 40 cycles : 30s à 94°C, 30s à 56°C, 2mn à 72°C) a été réalisée, et a permis d'identifier les nucléotides 1 à 342 de la séquence SEQ ID NO°10. Le fragment amplifié, dénommé Cav2(36a), a été cloné dans le vecteur pBluescript-II SK selon le protocole décrit ci-dessus. Une PCR utilisant les amorces amcav2-007S et amcav2-002AS a été réalisée selon le protocole décrit ci- dessus (avec 4% DMSO et 30 cycles : 30s à 95°C, 30s à 56°C, 2mn à 72°C), et a permis d'identifier les nucléotides 132 à 1710 de la séquence SEQ ID NO°10. Le fragment obtenu, dénommé Cav2(l.l), a été cloné dans le vecteur pBluescript-II SK selon le protocole décrit ci-dessus. Une PCR utilisant les amorces amcav2-024S et amcav2- 023AS a été réalisée selon le protocole décrit ci-dessus (sans DMSO et 40 cycles : lmn à 94°C, lmn à 56°C, lmn à 72°C°), et a permis d'identifier les nucléotides 1475 à 2110 de la séquence SEQ ID NO°10. Le fragment amplifié, dénommé Cav2(28), a été cloné dans le vecteur pBluescript-II SK selon le protocole décrit ci-dessus. Une PCR utilisant les amorces amcav2-003S et amcav2-006AS a été réalisée selon le protocole décrit ci- dessus (avec 4% DMSO et 35 cycles : 30s à 95°C, 30s à 56°C, 4mn à 72°C), et a permis d'identifier les nucléotides 1689 à 5460 de la SEQ ID n°10, incluant les exons 21a, 25 et 29 mais pas les exons 18 et 26. Le fragment amplifié, dénommé Cav2(18), a été cloné dans le vecteur pBluescript-II SK selon le protocole décrit ci-dessus. RACE PCR using the primers 5'OUTER Primer and amcav2-021AS for the 1st PCR, according to the protocol described above (with 4% DMSO and 35 cycles: 30s at 94 ° C., 30s at 56 ° C., 2 minutes at 72 ° C.). ° C), and primers 5'INNER Primer and amcav2-022AS for the second PCR, according to the protocol described above (with 4% DMSO and 35 cycles: 30s at 94 ° C, 30s at 56 ° C, 1 min to 72 ° C), was performed and identified nucleotides 47 to 342 of the sequence SEQ ID NO 0 10. The amplified fragment, designated Cav2 (22Jj), was cloned into the vector pBluescript-II SK according to protocol described above. RACE PCR using the primers 5 'Primer and OUTER amCav2-021AS era for the PCR according to the protocol described above (with 4% DMSO and 40 cycles: 30s at 94 ° C, 30s at 56 ° C, 2 minutes 72 ° C), and the primers amcav2-025S and amcav2-022AS for the second PCR, according to the protocol described above (without DMSO and 40 cycles: 30s at 94 ° C, 30s at 56 ° C, 2mn at 72 ° C) was carried out, and made it possible to identify nucleotides 1 to 342 of the sequence SEQ ID No. 10. The amplified fragment, called Cav2 (36a), was cloned into the vector pBluescript-II SK according to the protocol described above. PCR using primers amcav2-007S and amcav2-002AS was performed according to the protocol described above (with 4% DMSO and 30 cycles: 30s at 95 ° C, 30s at 56 ° C, 2mn at 72 ° C), and identified nucleotides 132 to 1710 of the sequence SEQ ID NO: 10. The fragment obtained, called Cav2 (II), was cloned into the pBluescript-II SK vector according to the protocol described above. PCR using the primers amcav2-024S and amcav2-023AS was carried out according to the protocol described above (without DMSO and 40 cycles: 1 min at 94 ° C., 1 min at 56 ° C., 1 min at 72 ° C.), and identified nucleotides 1475 to 2110 of the sequence SEQ ID NO: 10. The amplified fragment, called Cav2 (28), was cloned into the vector pBluescript-II SK according to the protocol described above. PCR using primers amcav2-003S and amcav2-006AS were carried out according to the protocol described above (with 4% DMSO and 35 cycles: 30s at 95 ° C., 30s at 56 ° C., 4 minutes at 72 ° C.), and allowed to identify nucleotides 1689 to 5460 of SEQ ID NO: 10, including exons 21a, 25 and 29 but not exons 18 and 26. The amplified fragment, designated Cav2 (18), was cloned into the vector pBluescript- II SK according to the protocol described above.
9. Construction de la séquence nucléotidique de la sous-unité amCav2b 9. Construction of the nucleotide sequence of the amCav2b subunit
Une réaction de PCR chevauchante (« overlap PCR ») a été réalisée pour obtenir le fragment Cav2(54) en utilisant les fragments de PCR Cav2(54A) et Cav2(29B) amplifiés en utilisant respectivement les amorces amcav2-031S (localisé dans l'extrémité 5' non codante) et amcav2-028AS, et amcav2-007S et amcav2-016AS pour introduire un site de restriction Notl en 5' du codon Start de la SEQ ID n°10. Les fragments Cav2(54A) et Cav2(29B) ont été obtenus selon le protocole décrit ci-dessus (avec 4% DMSO et 25 cycles : 20s à 98°C, 20s à 56°C, lmn à 68°C), en utilisant comme matrice lOOng de plasmide contenant respectivement le fragment Cav2(36a) et Cav2(l. l). Les fragments Cav2(54A) et Cav2(29B ont été purifiés sur gel d'agarose comme décrit ci-dessus. Le fragment Cav2(54) a été obtenu en réalisant une PCR selon le protocole décrit ci-dessus (sans DMSO et 25 cycles : 20s à 98°C, 20s à 56°C, lmn à 68°C), 3μ1 de chacun de fragments Cav2(54a) et Cav2(29B) purifiés et les amorces amcav2-031S et amcav2-016AS. Le fragment Cav2(54) a été cloné dans le vecteur pBluescript-II SK selon le protocole décrit ci-dessus. Une PCR utilisant les amorces amcav2-013S et amcav2-015AS a été réalisée selon le protocole décrit ci-dessus (avec 4% DMSO et 35 cycles : 30s à 95°C, 30s à 60°C, 2mn à 72°C). Le fragment amplifié, dénommé Cav2(21), a été cloné dans pBluescript-II SK selon le protocole décrit ci- dessus. Une PCR utilisant les amorces amcav2-013S et amcav2-026AS (localisé dans l'extrémité 3' non codante) a été réalisée selon le protocole décrit ci-dessus (sans DMSO et 25 cycles : lmn à 94°C, lmn à 56°C, lmn à 72°C), en utilisant comme matrice lOOng de plasmide contenant le fragment Cav2(21), pour introduire un site de restriction Kpnl en 3' du codon Stop de la SEQ ID n°10. An overlapping PCR reaction ("overlap PCR") was performed to obtain the Cav2 fragment (54) using amplified Cav2 (54A) and Cav2 (29B) PCR fragments using primers amcav2-031S (located in the 5 'non-coding end) and amcav2-028AS, and amcav2-007S and amcav2-016AS to introduce a 5' NotI restriction site of the Start codon of SEQ ID NO: 10. The Cav2 (54A) and Cav2 (29B) fragments were obtained according to the protocol described above (with 4% DMSO and 25 cycles: 20s at 98 ° C., 20s at 56 ° C., 1 minute at 68 ° C.), using as matrix 100 ng of plasmid respectively containing the fragment Cav2 (36a) and Cav2 (1-1). The Cav2 (54A) and Cav2 (29B) fragments were purified on an agarose gel as described above.The Cav2 fragment (54) was obtained by carrying out a PCR according to the protocol described above (without DMSO and 25 cycles 20s at 68 ° C., 20s at 56 ° C., 1 min at 68 ° C.), 3 μl of each of purified Cav2 (54a) and Cav2 (29B) fragments and the primers amcav2-031S and amcav2-016AS. 54) was cloned into the vector pBluescript-II SK according to the protocol described above.A PCR using the primers amcav2-013S and amcav2-015AS was carried out according to the protocol described above (with 4% DMSO and 35 cycles). 30s at 95 ° C., 30s at 60 ° C., 2 minutes at 72 ° C.) The amplified fragment, called Cav2 (21), was cloned into pBluescript-II SK according to the protocol described above. primers amcav2-013S and amcav2-026AS (located in the 3 'non-coding end) was carried out according to the protocol described above (without DMSO and 25 cycles: 1 min at 94 ° C., 1 min at 56 ° C., 1 min. at 72 ° C), using as template 100ng of plasmid containing the Cav2 fragment (21), to introduce a KpnI restriction site 3 'of the stop codon of SEQ ID No. 10.
La séquence de la sous-unité amCav2b entière a été obtenue en joignant les différents fragments de PCR en utilisant des sites de restriction présents dans les fragments chevauchants dans le vecteur pBS-PL6. Un fragment Cav2(18b) issu de la digestion enzymatique du fragment Cav2(18) inséré dans le vecteur pBluescript-II SK a été sous cloné dans le vecteur pBS-PL6 en utilisant les enzymes de restriction BamHI (position 4177 dans SEQ ID n°10) et Xhol (position 4446 dans SEQ ID n°10) en utilisant le protocole décrit ci-dessus. Un fragment issu de la digestion enzymatique du fragment Cav2(30) inséré dans le vecteur pBluescript-II SK a été sous cloné dans le vecteur pBS- PL6 contenant le fragment Cav2(18b) en utilisant les enzymes de restriction Xhol (position 4646 dans SEQ ID n°10) et Kpnl selon le protocole décrit ci-dessus pour générer le fragment Cav2(18b+30). Un fragment Cav2(28) issu de la digestion enzymatique du fragment Cav2(28) inséré dans le vecteur pBluescript-II SK a été sous cloné dans le vecteur pBS-PL6 en utilisant les enzymes de restriction Csp45I (position 1566 dans SEQ ID n°10) et Sali (position 2012 dans SEQ ID n°10) selon le protocole décrit ci-dessus. Un fragment issu de la digestion enzymatique du fragment Cav2(l. l) inséré dans le vecteur pBluescript-II SK a été sous cloné dans le vecteur pBS-PL6 contenant le fragment Cav2(28) en utilisant les enzymes de restriction MluI (position 442 dans SEQ ID n°10) et Csp45I (position 1560 dans SEQ ID n°10) selon le protocole décrit ci-dessus pour générer le fragment Cav2(l.l+28). Un fragment issu de la digestion enzymatique du fragment Cav2(54) inséré dans le vecteur pBluescript-II SK a été sous cloné dans le vecteur pBS-PL6 contenant le fragment Cav2( 1.1+28) en utilisant les enzymes de restriction Notl et MluI (position 442 dans SEQ ID n°10) selon le protocole décrit ci-dessus pour générer le fragment Cav2(54+l. l+28). Un fragment Cav2(18a) issu de la digestion enzymatique du fragment Cav2(18) inséré dans le vecteur pBluescript-II SK a été sous cloné dans le vecteur pBS-PL6 contenant le fragment Cav2(54+l. l+28) en utilisant les enzymes de restriction Sali (position 2012 dans SEQ ID n°10) et BamHI (position 4177 dans SEQ ID n°10) selon le protocole décrit ci-dessus pour générer un fragment Cav2(54+l.l+28+18a). Un fragment issu de la digestion enzymatique du fragment Cav2(54+l. l+28+18a) inséré dans le vecteur pBS-PL6 a été sous cloné dans le vecteur pBS-PL6 contenant le fragment Cav2(18b+30) en utilisant les enzymes de restriction Notl et BamHI (position 4177 dans SEQ ID n°10) selon le protocole décrit ci-dessus pour générer le fragment amCav2b. 10. Amplification de la séquence nucléotidique de variants de la sous-unité amCav2. The sequence of the entire amCav2b subunit was obtained by joining the different PCR fragments using restriction sites present in the fragments. overlapping in the vector pBS-PL6. A Cav2 fragment (18b) resulting from the enzymatic digestion of the Cav2 (18) fragment inserted into the pBluescript-II SK vector was subcloned into the vector pBS-PL6 using the BamHI restriction enzymes (position 4177 in SEQ ID No. 10) and XhoI (position 4446 in SEQ ID No. 10) using the protocol described above. A fragment derived from the enzymatic digestion of the Cav2 (30) fragment inserted into the pBluescript-II SK vector was subcloned into the vector pBS-PL6 containing the Cav2 fragment (18b) using the XhoI restriction enzymes (position 4646 in SEQ ID No. 10) and KpnI according to the protocol described above to generate the Cav2 fragment (18b + 30). A Cav2 fragment (28) resulting from the enzymatic digestion of the Cav2 fragment (28) inserted in the vector pBluescript-II SK was subcloned into the vector pBS-PL6 using the restriction enzymes Csp45I (position 1566 in SEQ ID No. 10) and SalI (position 2012 in SEQ ID No. 10) according to the protocol described above. A fragment from the enzymatic digestion of the Cav2 (l.1) fragment inserted into the pBluescript-II SK vector was subcloned into the vector pBS-PL6 containing the Cav2 fragment (28) using the MluI restriction enzymes (position 442). in SEQ ID No. 10) and Csp45I (position 1560 in SEQ ID No. 10) according to the protocol described above to generate the fragment Cav2 (l.l + 28). A fragment resulting from the enzymatic digestion of the Cav2 fragment (54) inserted into the pBluescript-II SK vector was subcloned into the pBS-PL6 vector containing the Cav2 fragment (1.1 + 28) using the NotI and MluI restriction enzymes ( position 442 in SEQ ID No. 10) according to the protocol described above to generate the Cav2 fragment (54 + 1, 1 + 28). A Cav2 fragment (18a) from the enzymatic digestion of the Cav2 (18) fragment inserted into the pBluescript-II SK vector was subcloned into the vector pBS-PL6 containing the Cav2 fragment (54 + 1, 1 + 28) using the SalI restriction enzymes (position 2012 in SEQ ID No. 10) and BamHI (position 4177 in SEQ ID No. 10) according to the protocol described above to generate a Cav2 fragment (54 + 1, 1 + 28 + 18a) . A fragment from the enzymatic digestion of the Cav2 fragment (54 + 1, 1 + 28 + 18a) inserted into the pBS-PL6 vector was subcloned into the vector pBS-PL6 containing the Cav2 fragment (18b + 30) using the restriction enzymes NotI and BamHI (position 4177 in SEQ ID No. 10) according to the protocol described above to generate the amCav2b fragment. 10. Amplification of the nucleotide sequence of variants of the amCav2 subunit.
Une PCR utilisant les amorces amcav2-003S et amcav2-004AS a été réalisée selon le protocole décrit ci-dessus (avec 4% DMSO et 30 cycles : 30s à 95°C, 30s à 58°C, 2mn à 72°C), et a permis d'identifier un fragment Cav2(2) localisé entre les nucléotides 1689 et 3778 de la SEQ ID n°10, incluant les exons 18 et 21a (figure 2 4/4). Le fragment amplifié a été cloné dans le vecteur pBluescript-II SK selon le protocole décrit ci- dessus. Une PCR utilisant les amorces amcav2-012S et amcav2-006AS a été réalisée selon le protocole décrit ci-dessus (avec 4% DMSO et 35 cycles : 30s à 95°C, lmn à 54°C, 3mn à 72°C), et a permis d'identifier un fragment dénommé Cav2(3.1) localisé entre les nucléotides 3593 et 5460 de SEQ ID n°10, incluant les exons 21b, 25, 26 et 29. Le fragment amplifié a été cloné dans le vecteur pBluescript-II SK selon le protocole décrit ci-dessus. Une PCR utilisant les amorces amcav2-012S et amcav2-006AS a été réalisée selon le protocole décrit ci-dessus (avec 4% DMSO et 35 cycles : 30s à 95°C, lmn à 54°C, 3mn à 72°C), et a permis d'identifier un fragment dénommé Cav2(3.2) localisé entre les nucléotides 3593 et 5460 de la SEQ ID n°10, incluant les exons 21a et 25, mais pas les exons 26 et 29. Le fragment amplifié a été cloné dans le vecteur pBluescript-II SK selon le protocole décrit ci-dessus. Une PCR utilisant les amorces amcav2-012S et amcav2-006AS a été réalisée selon le protocole décrit ci-dessus (avec 4% DMSO et 35 cycles : 30s à 95°C, lmn à 54°C, 3mn à 72°C), et a permis d'identifier un fragment dénommé Cav2(3.3) localisé entre les nucléotides 3593 et 5460 de la SEQ ID n°10, incluant les exons 21a et 26, mais pas les exons 25 et 29. Le fragment amplifié a été cloné dans le vecteur pBluescript-II SK selon le protocole décrit ci-dessus. Une PCR utilisant les amorces amcav2-013S et amcav2-015AS (localisé dans l'extrémité 3' non codante) a été réalisée selon le protocole décrit ci-dessus (avec 4% DMSO et 35 cycles : 30s à 95°C, 30s à 60°C, 2mn à 72°C), et a permis d'identifier un fragment, dénommé Cav2(21) localisé entre les nucléotides 4371 et 5460 de la SEQ ID n°10, incluant les exons 26 et 29, mais pas l'exon 25.. Le fragment amplifié a été cloné dans le vecteur pBluescript-II SK selon le protocole décrit ci-dessus. PCR using primers amcav2-003S and amcav2-004AS was carried out according to the protocol described above (with 4% DMSO and 30 cycles: 30s at 95 ° C, 30s at 58 ° C, 2mn at 72 ° C), and identified a Cav2 (2) fragment located between nucleotides 1689 and 3778 of SEQ ID NO: 10, including exons 18 and 21a (Figure 24/4). The amplified fragment was cloned into the pBluescript-II SK vector according to the protocol described above. PCR using the primers amcav2-012S and amcav2-006AS was carried out according to the protocol described above (with 4% DMSO and 35 cycles: 30s at 95 ° C., 1 min at 54 ° C., 3 minutes at 72 ° C.), and identified a fragment designated Cav2 (3.1) located between nucleotides 3593 and 5460 of SEQ ID NO: 10, including exons 21b, 25, 26 and 29. The amplified fragment was cloned into the vector pBluescript-II SK according to the protocol described above. PCR using the primers amcav2-012S and amcav2-006AS was carried out according to the protocol described above (with 4% DMSO and 35 cycles: 30s at 95 ° C., 1 min at 54 ° C., 3 minutes at 72 ° C.), and identified a fragment called Cav2 (3.2) located between nucleotides 3593 and 5460 of SEQ ID NO: 10, including exons 21a and 25, but not exons 26 and 29. The amplified fragment was cloned into the pBluescript-II SK vector according to the protocol described above. PCR using the primers amcav2-012S and amcav2-006AS was carried out according to the protocol described above (with 4% DMSO and 35 cycles: 30s at 95 ° C., 1 min at 54 ° C., 3 minutes at 72 ° C.), and identified a fragment called Cav2 (3.3) located between nucleotides 3593 and 5460 of SEQ ID NO: 10, including exons 21a and 26, but not exons 25 and 29. The amplified fragment was cloned into the pBluescript-II SK vector according to the protocol described above. PCR using the primers amcav2-013S and amcav2-015AS (located in the 3 'non-coding end) was carried out according to the protocol described above (with 4% DMSO and 35 cycles: 30s at 95 ° C., 30s at 30 ° C.). 60 ° C, 2 min at 72 ° C), and identified a fragment, designated Cav2 (21) located between nucleotides 4371 and 5460 of SEQ ID NO: 10, including exons 26 and 29, but not Exon 25. The amplified fragment was cloned into the vector pBluescript-II SK according to the protocol described above.
11. Amplification de la séquence nucléotidique de la sous-unité amCav3a. Une RACE PCR utilisant les amorces 5' OUTER Primer et amcav3-018AS pour la 1ère PCR, selon le protocole décrit ci-dessus (avec 4 % DMSO et 40 cycles : lmn à 94°C, lmn à 55°C, lmn à 72°C), et les amorces 5' INNER Primer et amcav3-019AS pour la seconde PCR selon le protocole décrit ci-dessus (avec 4% DMSO et 40 cycles : lmn à 94°C, lmn à 55°C, lmn à 72°C) a été réalisée et a permis d'identifier les nucléotides 1 à 426 de la séquence SEQ ID N° 11. Le fragment amplifié, dénommé Cav3(49E13), a été cloné dans le vecteur pBluescript-II SK selon le protocole décrit ci-dessus. Une PCR utilisant les amorces amcav3-023S (localisé dans l'extrémité 5' non codante) et amcav3-007AS a été réalisée selon le protocole décrit ci-dessus (sans DMSO et 35 cycles : lmn à 94°C, lmn à 60°C, 2mn à 72°C), et a permis d'identifier les nucléotides 1 à 891 de la séquence SEQ ID N°l l. Le fragment amplifié, dénommé Cav3(59), a été cloné dans le vecteur pBluescript-II SK selon le protocole décrit ci-dessus. Une PCR utilisant les amorces amcav3-021S et amcav3-012AS a été réalisée selon le protocole décrit ci-dessus (sans DMSO et 35 cycles : lmn à 94°C, lmn à 60°C, 2mnn à 72°C), et a permis d'identifier les nucléotides 2720 à 4909 de la SEQ ID n° 11, incluant l'exon 17a. Le fragment amplifié, dénommé Cav3(56), a été cloné dans le vecteur pBLuescript-II SK selon le protocole décrit ci-dessus. Une PCR utilisant les amorces amcav3-001S et amcav3-020AS a été réalisée selon le protocole décrit ci-dessus (sans DMSO et 35 cycles : lmn à 94°C, lmn à 60°C, 2mnn à 72°C), et a permis d'identifier un fragment localisé entre les nucléotides 606 et 3302 de la SEQ ID n°l l, incluant l'exon 17b. Le fragment amplifié, dénommé Cav3(55), a été cloné dans le vecteur pBluescript-II SK selon le protocole décrit ci-dessus. Une PCR utilisant les amorces amcav3-003S et amcav3-004AS a été réalisée selon le protocole décrit ci-dessus (sans DMSO et 35 cycles : lmn à 94°C, lmn à 60°C, 2mnn à 72°C), et a permis d'identifier un fragment localisé entre les nucléotides 3112 et 5698 de la SEQ ID n°l l, incluant l'exon 17b (figure 3 5/5). Le fragment amplifié, dénommé Cav3(32), a été cloné dans le vecteur pBluescript-II SK selon le protocole décrit ci-dessus. Une PCR utilisant les amorces amcav3-005S et amcav3-006AS (localisé dans l'extrémité 3' non codante) a été réalisée selon le protocole décrit ci-dessus (sans DMSO et 35 cycles : lmn à 94°C, lmn à 60°C, 2mnn à 72°C), et a permis d'identifier les nucléotides 5591 à 7701 de la séquence SEQ ID N°l l. Le fragment amplifié, dénommé Cav3(33), a été cloné dans le vecteur pBluescript-II SK selon le protocole décrit ci-dessus. 12. Construction de la séquence nucléotidique de la sous-unité amCav3a 11. Amplification of the nucleotide sequence of the amCav3a subunit. RACE PCR using the primers 5 'OUTER Primer and amcav3-018AS for the 1st PCR, according to the protocol described above (with 4% DMSO and 40 cycles: 1 min at 94 ° C., 1 min at 55 ° C., 1 min at 72 ° C.). ° C), and primers 5 'INNER Primer and amcav3-019AS for the second PCR according to the protocol described above (with 4% DMSO and 40 cycles: 1 min at 94 ° C, 1 min at 55 ° C, 1 min at 72 ° C). ° C) was carried out and made it possible to identify nucleotides 1 to 426 of the sequence SEQ ID No. 11. The amplified fragment, called Cav3 (49E13), was cloned into the vector pBluescript-II SK according to the protocol described above. PCR using primers amcav3-023S (located in the 5 'non-coding end) and amcav3-007AS was carried out according to the protocol described above (without DMSO and 35 cycles: 1 min at 94 ° C., 1 min at 60 ° C. C., 2 min at 72 ° C.), and made it possible to identify nucleotides 1 to 891 of the sequence SEQ ID No. 11. The amplified fragment, called Cav3 (59), was cloned into the vector pBluescript-II SK according to the protocol described above. PCR using the primers amcav3-021S and amcav3-012AS was carried out according to the protocol described above (without DMSO and 35 cycles: 1 min at 94 ° C., 1 min at 60 ° C., 2 min at 72 ° C.), and identified nucleotides 2720 to 4909 of SEQ ID NO: 11, including exon 17a. The amplified fragment, called Cav3 (56), was cloned into the pBLuescript-II SK vector according to the protocol described above. PCR using the primers amcav3-001S and amcav3-020AS was carried out according to the protocol described above (without DMSO and 35 cycles: 1 min at 94 ° C., 1 min at 60 ° C., 2 min at 72 ° C.), and identified a fragment located between nucleotides 606 and 3302 of SEQ ID NO: 11, including exon 17b. The amplified fragment, called Cav3 (55), was cloned into the pBluescript-II SK vector according to the protocol described above. PCR using primers amcav3-003S and amcav3-004AS was performed according to the protocol described above (without DMSO and 35 cycles: 1 min at 94 ° C, 1 min at 60 ° C, 2 min at 72 ° C), and identified a fragment located between nucleotides 3112 and 5698 of SEQ ID NO: 11, including exon 17b (Figure 35/5). The amplified fragment, named Cav3 (32), was cloned into the pBluescript-II SK vector according to the protocol described above. PCR using the primers amcav3-005S and amcav3-006AS (located in the 3 'non-coding end) was carried out according to the protocol described above (without DMSO and 35 cycles: 1 min at 94 ° C., 1 min at 60 ° C.). C., 2 min at 72 ° C.), and made it possible to identify nucleotides 5591 to 7701 of the sequence SEQ ID No. 11. The amplified fragment, called Cav3 (33), was cloned into the pBluescript-II SK vector according to the protocol described above. 12. Construction of the nucleotide sequence of the amCav3a subunit
La séquence de la sous-unité amCav3a entière a été obtenue en joignant les différents fragments de PCR en utilisant des sites de restriction présents dans les fragments chevauchants dans le vecteur pBluescript-II SK (Agilent Technologies France SAS, Les Ulis, France). Une PCR utilisant les amorces amcav3-011S et amcav3-004AS selon le protocole décrit ci-dessus (sans DMSO et 35 cycles : lmn à 94°C, lmn à 60°C, 2mnn à 72°C) a été réalisée. Le fragment amplifié, dénommé Cav3(57), a été cloné dans le vecteur pBluescript-II SK selon le protocole décrit ci-dessus. Une PCR utilisant les amorces amcav3-013S et amcav3-022AS (localisé dans l'extrémité 3' non codante) a été réalisé selon le protocole décrit ci-dessus (sans DMSO et 25 cycles : lmn à 94°C, lmn à 56°C, lmnn à 72°C) en utilisant comme matrice lOOng de plasmide contenant le fragment Cav3(33) pour introduire un site de restriction AflII et un site de restriction Kpnl en 3' du codon Stop de la SEQ ID n° l l. Le fragment amplifié, dénommé Cav3(58), a été cloné dans le vecteur pBluescript-II-SK selon le protocole décrit ci- dessus. Un fragment Cav3(58a) issu de la digestion enzymatique du fragment Cav3(58) inséré dans le vecteur pBluescript-II SK a été sous cloné dans le vecteur pBluescript-II SK en utilisant les enzymes de restriction Sali (position 7348 dans SEQ ID n°l l) et Kpnl en suivant le protocole décrit ci-dessus. Un fragment issu de la digestion enzymatique du fragment Cav3(33) inséré dans le vecteur pBluescript-II SK a été sous cloné dans le vecteur pBluescript-II SK contenant le fragment Cav3(58a) en utilisant les enzymes de restriction HindIII (position 5669 dans SEQ ID n°l l) et Sali (position 7348 dans SEQ ID n°l l) selon le protocole décrit ci-dessus pour générer le fragment Cav3(60). Un fragment issu de la digestion enzymatique du fragment Cav3(59) inséré dans le vecteur pBluescript-II SK a été sous cloné dans le vecteur pBluescript-II SK contenant le fragment Cav3(60) en utilisant les enzymes de restriction Notl et EcoRI (position 741 dans SEQ ID n°l l) selon le protocole décrit ci-dessus pour générer le fragment Cav3(59+60). Un fragment issu de la digestion enzymatique du fragment Cav3(56) inséré dans le vecteur pBluescript-II SK a été sous cloné dans le vecteur pBluescript-II SK contenant le fragment Cav3(55) en utilisant les enzymes de restriction Espl (position 2789 dans SEQ ID n°l l) et Xbal (position 4267 dans SEQ ID n°l l) selon le protocole décrit ci-dessus pour générer le fragment Cav3(55+56). Un fragment issu de la digestion enzymatique du fragment Cav3(59) inséré dans le vecteur pBluescript-II SK a été sous cloné dans le vecteur pBluescript-II SK contenant le fragment Cav3 (55+56) en utilisant les enzymes de restriction Kpnl et Spel (position 760 dans SEQ ID n°l l) selon le protocole décrit ci-dessus pour générer le fragment Cav3(59+55+56). Un fragment Cav3(57) issu de la digestion enzymatique du fragment Cav3(57) inséré dans le vecteur pBluescript-II SK a été sous cloné dans le vecteur pBS- PL4 en utilisant les enzymes de restriction Xbal (position 4267 dans SEQ ID n°l l) et HindIII (position 5669 dans SEQ ID n°l l) selon le protocole décrit ci-dessus. Un fragment issu de la digestion enzymatique du fragment Cav3(57) inséré dans le vecteur pBS-PL4 a été sous cloné dans le vecteur pBluescript-II SK contenant le fragment Cav3(59+60) en utilisant les enzymes de restriction EcoRI et HindIII (position 5669 dans SEQ ID n°l l) selon le protocole décrit ci-dessus pour générer le fragment Cav3(59+57+60). Un fragment issu de la digestion enzymatique du fragment Cav3(59+55+56) inséré dans le vecteur pBluescript-II SK a été sous cloné dans le vecteur pBluescript-II SK contenant le fragment Cav3(59+57+60) en utilisant les enzymes de restriction Notl et Xbal (position 4267 dans SEQ ID n°l l) selon le protocole décrit ci-dessus pour générer le fragment amCav3a. The sequence of the entire amCav3a subunit was obtained by joining the different PCR fragments using restriction sites present in the overlapping fragments in the pBluescript-II SK vector (Agilent Technologies France SAS, Les Ulis, France). PCR using primers amcav3-011S and amcav3-004AS according to the protocol described above (without DMSO and 35 cycles: 1 min at 94 ° C, 1 min at 60 ° C, 2 min at 72 ° C) was performed. The amplified fragment, called Cav3 (57), was cloned into the vector pBluescript-II SK according to the protocol described above. PCR using primers amcav3-013S and amcav3-022AS (located in the 3 'non-coding end) was carried out according to the protocol described above (without DMSO and 25 cycles: 1 min at 94 ° C., 1 min at 56 ° C.). 1mnn at 72 ° C) using as template 100ng of plasmid containing the Cav3 fragment (33) to introduce an AflII restriction site and a KpnI restriction site 3 'of the Stop codon of SEQ ID No. 11. The amplified fragment, designated Cav3 (58), was cloned into the vector pBluescript-II-SK according to the protocol described above. A Cav3 fragment (58a) resulting from the enzymatic digestion of the Cav3 fragment (58) inserted into the pBluescript-II SK vector was subcloned into the pBluescript-II SK vector using the SalI restriction enzymes (position 7348 in SEQ ID No. 11) and KpnI following the protocol described above. A fragment from the enzymatic digestion of the Cav3 (33) fragment inserted into the pBluescript-II SK vector was subcloned into the vector pBluescript-II SK containing the Cav3 fragment (58a) using the restriction enzymes HindIII (position 5669 in SEQ ID No. 11) and SalI (position 7348 in SEQ ID No. 11) according to the protocol described above to generate the Cav3 fragment (60). A fragment from the enzymatic digestion of the Cav3 fragment (59) inserted into the pBluescript-II SK vector was subcloned into the pBluescript-II SK vector containing the Cav3 fragment (60) using the NotI and EcoRI restriction enzymes (position 741 in SEQ ID No. 11) according to the protocol described above to generate the Cav3 fragment (59 + 60). A fragment from the enzymatic digestion of the Cav3 fragment (56) inserted into the pBluescript-II SK vector was subcloned into the vector pBluescript-II SK containing the Cav3 fragment (55) using the Espl restriction enzymes (position 2789 in SEQ ID No. 11) and XbaI (position 4267 in SEQ ID No. 11) according to the protocol described above to generate the Cav3 fragment (55 + 56). A fragment from the enzymatic digestion of the Cav3 fragment (59) inserted into the pBluescript-II SK vector was subcloned into the pBluescript-II SK vector containing the Cav3 fragment (55 + 56) using the restriction enzymes KpnI and Spel (position 760 in SEQ ID No. 11) according to the protocol described above to generate the Cav3 fragment (59 + 55 + 56). A Cav3 fragment (57) resulting from the enzymatic digestion of the Cav3 fragment (57) inserted in the pBluescript-II SK vector was subcloned into the vector pBS-PL4 using the XbaI restriction enzymes (position 4267 in SEQ ID No. 11) and HindIII (position 5669 in SEQ ID No. 11) according to the protocol described above. A fragment resulting from the enzymatic digestion of the Cav3 fragment (57) inserted into the vector pBS-PL4 was subcloned into the pBluescript-II SK vector containing the Cav3 fragment (59 + 60) using the restriction enzymes EcoRI and HindIII ( position 5669 in SEQ ID No. 11) according to the protocol described above to generate the Cav3 fragment (59 + 57 + 60). A fragment from the enzymatic digestion of the Cav3 fragment (59 + 55 + 56) inserted into the pBluescript-II SK vector was subcloned into the vector pBluescript-II SK containing the Cav3 fragment (59 + 57 + 60) using the restriction enzymes NotI and Xbal (position 4267 in SEQ ID No. 11) according to the protocol described above to generate the amCav3a fragment.
13. Amplification de la séquence nucléotidique de la sous-unité amCav a. 13. Amplification of the nucleotide sequence of the amCav subunit a.
Une PCR utilisant les amorces amb2-003S et amb2-004AS a été réalisée selon le protocole décrit ci-dessus (avec 4 % DMSO et 30 cycles : 30s à 98°C, 30s à 50°C, 2mn à 72°C), et a permis d'identifier les nucléotides 1 à 1635 de la SEQ ID n°12, incluant les exons la, 4b et 9. PCR using the amb2-003S and amb2-004AS primers was carried out according to the protocol described above (with 4% DMSO and 30 cycles: 30s at 98 ° C., 30s at 50 ° C., 2 minutes at 72 ° C.), and identified nucleotides 1 to 1635 of SEQ ID NO: 12, including exons 1a, 4b and 9.
14. Construction de la séquence nucléotidique de la sous-unité amCav a. 14. Construction of the nucleotide sequence of the amCav subunit a.
Le fragment amplifié au point précédent, dénommé amCav a, a été cloné dans pBluescript-II SK selon le protocole décrit ci-dessus. The fragment amplified in the previous point, called amCav a, was cloned into pBluescript-II SK according to the protocol described above.
15. Amplification de la séquence nucléotidique de la sous-unité amCav b. 15. Amplification of the nucleotide sequence of the amCav subunit b.
Une PCR utilisant les amorces amb2-006S (localisé dans l'extrémité 5' non codante) et amb2-007AS (localisé dans l'extrémité 3' non codante) a été réalisée selon le protocole décrit ci-dessus (avec 4% DMSO et 35 cycles : 30 s à 95°C, 30s à 60°C, 2mn à 72°C), et a permis d'identifier les nucléotides 1 à 1413 de la SEQ ID n°13, incluant les exons lb et 4b mais pas l'exon 9. PCR using primers amb2-006S (located in the 5 'non-coding end) and amb2-007AS (located in the 3' non-coding end) was carried out according to the protocol described above (with 4% DMSO and 35 cycles: 30 sec at 95 ° C, 30s at 60 ° C, 2 min at 72 ° C), and identified nucleotides 1 to 1413 of SEQ ID No. 13, including exons 1b and 4b but not exon 9.
16. Construction de la séquence nucléotidique de la sous-unité amCav b. Le fragment amplifié au point précédent, dénommé amCav b, a été cloné dans pBluescript-II SK selon le protocole décrit ci-dessus. 16. Construction of the nucleotide sequence of the amCav subunit b. The fragment amplified in the previous point, called amCav b, was cloned into pBluescript-II SK according to the protocol described above.
17. Amplification de la séquence nucléotidique de la sous-unité amCav c 17. Amplification of the nucleotide sequence of the amCav subunit c
Une PCR utilisant les amorces amb2-008S (localisé dans l'extrémité 5' non codante) et amb2-007AS (localisé dans l'extrémité 3' non codante) a été réalisée selon le protocole décrit ci-dessus (avec 4% DMSO et 35 cycles : 30 s à 95°C, 30s à 60°C, 2mn à 72°C), et a permis d'identifier les nucléotides 1 à 1632 de la SEQ ID n°14, incluant les exons la et 4a mais pas l'exon 9. PCR using primers amb2-008S (located in the 5 'non-coding end) and amb2-007AS (located in the 3' non-coding end) was carried out according to the protocol described above (with 4% DMSO and 35 cycles: 30 sec at 95 ° C, 30 sec at 60 ° C, 2 min at 72 ° C), and identified nucleotides 1 through 1632 of SEQ ID NO: 14, including exons la and 4a but not Exon 9.
18. Construction de la séquence nucléotidique de la sous-unité amCav c 18. Construction of the nucleotide sequence of the amCav subunit c
Le fragment amplifié au point précédent, dénommé amCav c, a été cloné dans le vecteur pBluescript-II SK selon le protocole décrit ci-dessus. The fragment amplified in the previous point, called amCav c, was cloned into the vector pBluescript-II SK according to the protocol described above.
19. Amplification de la séquence nucléotidique de la sous-unité amCav(x2ôl. 19. Amplification of the nucleotide sequence of the amCav subunit (x2δ1.
Une PCR utilisant les amorces amcava2d-012S (localisé dans l'extrémité 5' non codante) et amcava2d-013AS a été réalisée selon le protocole décrit ci-dessus (sans DMSO et 35 cycles : lmn à 94°C, lmn à 60°C, 2mn à 72°C) et a permis d'identifier les nucléotides 1 à 1314 de la SEQ ID n°15. Une PCR utilisant les amorces amcava2d-014S et amcava2d-015AS a été réalisée selon le protocole décrit ci-dessus (sans DMSO et 35 cycles : lmn à 94°C, lmn à 60°C, 2mn à 72°C), et a permis d'identifier les nucléotides 1264 à 2344 de la SEQ ID n°15. Une PCR utilisant les amorces amcava2d-016S et amcava2d-017AS (localisé dans l'extrémité 3' non codante) a été réalisée selon le protocole décrit ci-dessus (sans DMSO et 35 cycles : lmn à 94°C, lmn à 60°C, 2mn à 72°C), et a permis d'identifier les nucléotides 2322 à 3615 de la SEQ ID n° 15. 20. Construction de la séquence nucléotidique de la sous-unité amCavCc2ôl. A PCR using primers amcava2d-012S (located in the 5 'non-coding end) and amcava2d-013AS was carried out according to the protocol described above (without DMSO and 35 cycles: 1 min at 94 ° C., 1 min at 60 ° C. C, 2 min at 72 ° C) and identified nucleotides 1 to 1314 of SEQ ID NO: 15. PCR using primers amcava2d-014S and amcava2d-015AS was carried out according to the protocol described above (without DMSO and 35 cycles: 1 min at 94 ° C., 1 min at 60 ° C., 2 min at 72 ° C.), and identified nucleotides 1264 to 2344 of SEQ ID NO: 15. A PCR using the primers amcava2d-016S and amcava2d-017AS (located in the 3 'non-coding end) was carried out according to the protocol described above (without DMSO and 35 cycles: 1 min at 94 ° C., 1 min at 60 ° C. C, 2 min at 72 ° C), and identified nucleotides 2322 to 3615 of SEQ ID NO: 15. 20. Construction of the nucleotide sequence of the amCavCc2δ1 subunit.
Une PCR utilisant les amorces amcava2d-012S et amcava2d-017AS a été réalisée selon le protocole décrit ci-dessus (sans DMSO et 30 cycles : lmn à 94°C, lmn à 60°C, 3mn à 72°C). Le fragment amplifié, dénommé amCavCc2ôl, a été cloné dans le vecteur pBluescript-II SK selon le protocole décrit ci-dessus. PCR using primers amcava2d-012S and amcava2d-017AS was performed according to the protocol described above (without DMSO and 30 cycles: 1 min at 94 ° C, 1 min at 60 ° C, 3 min at 72 ° C). The amplified fragment, called amCavCc2δ1, was cloned into the vector pBluescript-II SK according to the protocol described above.
21. Amplification de la séquence nucléotidique de la sous-unité amCav(x2ô2. 21. Amplification of the nucleotide sequence of the amCav subunit (x2O2.
Une PCR utilisant les amorces amcava2d-018S (localisé dans l'extrémité 5' non codante) et amcava2d-019AS (localisé dans l'extrémité 3' non codante) a été réalisée selon le protocole décrit ci-dessus (sans DMSO et 32 cycles : lmn à 94°C, lmn à 60°C, 3mn à 72°C), et a permis d'identifier les nucléotides 1 à 3597 de la SEQ ID n°16. PCR using primers amcava2d-018S (located in the 5 'non-coding end) and amcava2d-019AS (located in the 3' non-coding end) was carried out according to the protocol described above (without DMSO and 32 cycles). 1 min at 94 ° C, 1 min at 60 ° C, 3 min at 72 ° C), and identified nucleotides 1 to 3597 of SEQ ID NO: 16.
22. Construction de la séquence nucléotidique de la sous-unité amCav(x2ô2 22. Construction of the nucleotide sequence of the amCav subunit (x2O2
Le fragment amplifié au point précédent, dénommé amCav(x2ô2, a été cloné dans le vecteur pBluescript-II SK selon le protocole décrit ci-dessus. The fragment amplified in the previous point, called amCav (x2O2), was cloned into the vector pBluescript-II SK according to the protocol described above.
23. Amplification de la séquence nucléotidique de la sous-unité amCav(x2ô3. Une PCR utilisant les amorces amcava2d-010S (localisé dans l'extrémité 5' non codante) et amcava2d-007AS a été réalisée selon le protocole décrit ci-dessus (avec 4% DMSO et 35 cycles : 30s à 95°C, 30s à 60°C, 2mn à 72°C), et a permis d'identifier les nucléotides 1 à 864 de la SEQ ID n° 17. Le fragment amplifié, dénommé Cava2d(25), a été cloné dans le vecteur pBluescript-II SK selon le protocole décrit ci-dessus. Une PCR utilisant les amorces amcava2d-001S et amcava2d-002AS a été réalisée selon le protocole décrit ci-dessus (avec 4% DMSO et 30 cycles : 30s à 95°C, 30s à 58°C, 2mn à 72°C), et a permis d'identifier les nucléotides 1 à 1716 de la SEQ ID n°17. Le fragment amplifié, dénommé Cava2d(7), a été cloné dans le vecteur pBluescript-II SK selon le protocole décrit ci-dessus. Une PCR utilisant les amorces amcava2d-003S et amcava2d- 004AS a été réalisée selon le protocole décrit ci-dessus (avec 4% DMSO et 30 cycles : 30s à 95°C, 30s à 58°C, 2mn à 72°C), et a permis d'identifier les nucléotides 1690 à 3529 de la SEQ ID n°17.Le fragment amplifié, dénommé Cava2d(8), a été cloné dans le vecteur pBluescript-II SK selon le protocole décrit ci-dessus. Une PCR utilisant les amorces amcava2d-005S et amcava2d-011AS (localisé dans l'extrémité 3' codante) a été réalisée selon le protocole décrit ci-dessus (avec 4% DMSO et 35 cycles : 30s à 95°C, 30s à 60°C, 2mn à 72°C), et à permis d'identifier les nucléotides 2999 à 3582 de la SEQ ID n°17. Le fragment amplifié, dénommé Cava2d(26), a été cloné dans le vecteur pBluescript-II SK selon le protocole décrit ci-dessus. 23. Amplification of the nucleotide sequence of the amCav subunit (x2δ3) A PCR using the primers amcava2d-010S (located in the 5 'non-coding end) and amcava2d-007AS was carried out according to the protocol described above ( with 4% DMSO and 35 cycles: 30s at 95 ° C, 30s at 60 ° C, 2mn at 72 ° C), and identified nucleotides 1-864 of SEQ ID NO: 17. The amplified fragment, called Cava2d (25), was cloned into the vector pBluescript-II SK according to the protocol described above.A PCR using the primers amcava2d-001S and amcava2d-002AS was carried out according to the protocol described above (with 4% DMSO and 30 cycles: 30s at 95 ° C., 30s at 58 ° C., 2 minutes at 72 ° C.), and identified nucleotides 1 to 1716 of SEQ ID No. 17. The amplified fragment, called Cava2d ( 7), was cloned into the vector pBluescript-II SK according to the protocol described above.A PCR using the primers amcava2d-003S and amcava2d-004AS was performed according to the protocol described above (with 4% DMSO and 30 cycles: 30s at 95 ° C, 30s at 58 ° C, 2mn at 72 ° C), and identified nucleotides 1690 to 3529 of SEQ ID NO. 17.The amplified fragment, called Cava2d (8), was cloned into the pBluescript-II SK vector according to the protocol described above. A PCR using primers amcava2d-005S and amcava2d-011AS (located in the coding 3 'end) was carried out according to the protocol described above (with 4% DMSO and 35 cycles: 30s at 95 ° C., 30s at 60 ° C.). ° C, 2min to 72 ° C), and to identify nucleotides 2999 to 3582 of SEQ ID NO: 17. The amplified fragment, called Cava2d (26), was cloned into the vector pBluescript-II SK according to the protocol described above.
24. Construction de la séquence nucléotidique de la sous-unité amCav(x2ô3. 24. Construction of the nucleotide sequence of the amCav subunit (x2O3.
La séquence de la sous-unité amCava2d3 entière a été obtenue en joignant les différents fragments de PCR en utilisant des sites de restriction présents dans les fragments chevauchants. Une réaction de PCR chevauchante (« overlap PCR ») a été réalisée pour obtenir le fragment Cava2d(27) en utilisant les fragments de PCR Cava2d(27A) et Cava2d(27B) amplifiés en utilisant respectivement les amorces amcava2d-006S et amcava2d-002AS et amcava2d-003S et amcava2d-009AS. Les fragments Cava2d(27A) et Cava2d(27B) ont été obtenus selon le protocole décrit ci-dessus (avec 4% DMSO et 25 cycles : 30s à 92°C, 30s à 55°C, 30s à 72°C), en utilisant comme matrice lOOng de plasmide contenant respectivement le fragment Cava2d(7) et Cava2d(8). Les fragments Cava2d(27A) et Cava2d(27B) ont été purifiés sur gel d'agarose comme décrit ci-dessus. Le fragment Cava2d(27) a été obtenu en réalisant une PCR selon le protocole décrit ci- dessus (avec 4% DMSO et 25 cycles : 30s à 92°C, 30s à 55°C, 45s à 72°C), 3 1 de chacun des fragments Cava2d(27A) et Cava2d(27B) et les amorces amcava2d-006S et amcava2d-009AS. Le fragment Cava2d(27) a été cloné dans le vecteur pBluescript-II SK selon le protocole décrit ci-dessus. Un fragment issu de la digestion enzymatique du fragment Cava2d(25) inséré dans le vecteur pBluescript-II SK a été sous cloné dans le vecteur pBluescript-II SK contenant le fragment Cava2d(7) en utilisant les enzymes de restriction Hindlll et MluI (position 798 dans SEQ ID n°17) pour générer le fragment Cava2d(25+7) selon le protocole décrit ci-dessus. Un fragment issu de la digestion enzymatique du fragment Cava2d(26) inséré dans le vecteur pBluescript-II SK a été sous cloné dans le vecteur pBluescript-II SK contenant le fragment Cava2a(8) en utilisant les enzymes de restriction Agel (position 3287 dans SEQ ID n°17) et Notl selon le protocole décrit ci-dessus, pour générer le fragment Cava2d(8+26). Un fragment issu de la digestion enzymatique du fragment Cava2d(27) inséré dans le vecteur pBluescript-II SK a été sous cloné dans le vecteur pBluescript-II SK contenant le fragment Cava2d(8+26) en utilisant les enzymes de restriction HindlII et Aatll (position 1834 dans SEQ ID n°17) selon le protocole décrit ci-dessus, pour générer le fragment Cava2d(27+8+26). Un fragment issu de la digestion enzymatique du fragment Cava2d(25+7) a été sous cloné dans le vecteur pBluescript-II SK contenant le fragment Cava2d(27+8+26) en utilisant les enzymes de restriction HindlII et PshAI (position 1206 dans SEQ ID n°17) selon le protocole décrit ci-dessus, pour générer le fragment amCavCc2ô3. La séquence nucléique des amorces utilisées dans les différentes réactions / protocoles précités est indiquée dans le tableau 1 suivant. The sequence of the entire amCava2d3 subunit was obtained by joining the different PCR fragments using restriction sites present in the overlapping fragments. An overlapping PCR reaction ("overlap PCR") was performed to obtain the Cava2d fragment (27) using amplified Cava2d (27A) and Cava2d (27B) PCR fragments using primers amcava2d-006S and amcava2d-002AS, respectively. and amcava2d-003S and amcava2d-009AS. The fragments Cava2d (27A) and Cava2d (27B) were obtained according to the protocol described above (with 4% DMSO and 25 cycles: 30s at 92 ° C., 30s at 55 ° C., 30s at 72 ° C.), using as matrix 100ng of plasmid respectively containing the fragment Cava2d (7) and Cava2d (8). The Cava2d (27A) and Cava2d (27B) fragments were purified on agarose gel as described above. The Cava2d fragment (27) was obtained by carrying out a PCR according to the protocol described above (with 4% DMSO and 25 cycles: 30s at 92 ° C., 30s at 55 ° C., 45s at 72 ° C.). of each of the fragments Cava2d (27A) and Cava2d (27B) and the primers amcava2d-006S and amcava2d-009AS. The Cava2d fragment (27) was cloned into the pBluescript-II SK vector according to the protocol described above. A fragment from the enzymatic digestion of the Cava2d fragment (25) inserted into the pBluescript-II SK vector was subcloned into the pBluescript-II SK vector containing the Cava2d fragment (7) using HindIII and MluI restriction enzymes (position 798 in SEQ ID No. 17) to generate the Cava2d fragment (25 + 7) according to the protocol described above. A fragment from the enzymatic digestion of the Cava2d fragment (26) inserted into the pBluescript-II SK vector was subcloned into the pBluescript-II SK vector containing the Cava2a fragment (8) using the restriction enzymes Agel (position 3287 in SEQ ID No. 17) and NotI according to the protocol described above, to generate the Cava2d fragment (8 + 26). A fragment from the enzymatic digestion of the Cava2d fragment (27) inserted into the pBluescript-II SK vector was subcloned into the pBluescript-II SK vector containing the Cava2d fragment (8 + 26) using the HindIII and AatII restriction enzymes ( position 1834 in SEQ ID No. 17) according to the protocol described above, to generate the fragment Cava2d (27 + 8 + 26). A fragment from the enzymatic digestion of the Cava2d fragment (25 + 7) was subcloned into the pBluescript-II SK vector containing the Cava2d fragment (27 + 8 + 26) using the HindIII and PshAI restriction enzymes (position 1206 in SEQ ID No. 17) according to the protocol described above, to generate the amCavCc2δ3 fragment. The nucleic sequence of the primers used in the various reactions / protocols mentioned above is indicated in the following Table 1.
Les oligonucléotides/amorces ont été fournis sous forme lyophilisée par Eurofins MWG Operon (Ebersberg, Germany). Les amorces ont été resuspendues à ΙΟΟμΜ dans de l'eau, aliquotées à ΙΟμΜ et stockées à -20°C pour une utilisation ultérieure. Oligonucleotides / primers were supplied in freeze-dried form by Eurofins MWG Operon (Ebersberg, Germany). The primers were resuspended at ΙΟΟμΜ in water, aliquoted at ΙΟμΜ and stored at -20 ° C for later use.
Tableau 1 : séquence nucléique des amorces utilisées Table 1: Nucleic Sequence of the Primers Used
SEQ Nom Séquences (5 '-3') Orientation SEQ Name Sequences (5 '-3') Orientation
ID N° ID N °
18 PL10 GGCCGCTTACGCGTAATTCGAATTGTCGACT /  18 PL10 GGCCGCTTACGCGTAATTCGAATTGTCGACT /
TGGATCCTTCTCGAGAAGGTAC  TGGATCCTTCTCGAGAAGGTAC
19 PLU CTTCTCGAGAAGGATCCAAGTCGACAATTC /  19 PLU CTTCTCGAGAAGGATCCAAGTCGACAATTC /
GAATTACGCGTAAGC  GAATTACGCGTAAGC
20 PL12 GGCCGCTTGGATCCAATCTAGATTCTCGAGT /  20 PL12 GGCCGCTTGGATCCAATCTAGATTCTCGAGT /
TACCGGTAAGGTAC  TACCGGTAAGGTAC
21 PLI 3 CTTACCGGTAACTCGAGAATCTAGATTGGA /  21 PLI 3 CTTACCGGTAACTCGAGAATCTAGATTGGA /
TCCAAGC  TCCAAGC
22 Amorce GCTGATGGCGATGAATGAACACTG (Life /  Primer GCTGATGGCGATGAATGAACACTG (Life /
5'OUT Technologies)  5'OUT Technologies)
ER  ER
23 5 'INNE CGCGGATCCGAACACTGCGTTTGCTGGCTTT  23 5 'INNE CGCGGATCCGAACACTGCGTTTGCTGGCTTT
R GATG (Life Technologies)  R GATG (Life Technologies)
Amorce  bait
24 amcavl CGTCCTCGATGTTGTAAAGCACCTC Antisens  24 amcavl CGTCCTCGATGTTGTAAAGCACCTC Antisens
-019 AS  -019 AS
25 amcavl GGTTGGTCAAATTAGAATCGCCG Antisens  25 amcavl GGTTGGTCAAATTAGAATCGCCG Antisens
-025AS  -025AS
26 amcavl ATGACGATATTCGCCAACTGCATCG Sens  26 amcavl ATGACGATATTCGCCAACTGCATCG Meaning
-016S amcavl AACGAAGAATGCCCCAAGTATGACC Antisens-016S amcavl AACGAAGAATGCCCCAAGTATGACC Antisens
-024AS -024AS
amcavl GCTTACGGCTTCGTCGCTCACC Sensamcavl GCTTACGGCTTCGTCGCTCACC Meaning
-007S -007S
amcavl GCTGATTTTTATCGAGCTCGCAG Antisensamcavl GCTGATTTTTATCGAGCTCGCAG Antisens
-010AS -010AS
amcavl CAGTTCGTGTTCGCCGTCGTTG Sensamcavl CAGTTCGTGTTCGCCGTCGTTG Meaning
-011S -011S
amcavl CTCTGTGGAACGACGAGTACGGC Antisensamcavl CTCTGTGGAACGACGAGTACGGC Antisens
-009AS -009AS
amcavl CCGAATCGTTGACTGCCATCGA Sensamcavl CCGAATCGTTGACTGCCATCGA Meaning
-003S -003S
amcavl GGGTCGTACTCGGACCACAGACGA Antisensamcavl GGGTCGTACTCGGACCACAGACGA Antisens
-004AS -004AS
amcavl CGACGCCAAAGGTCGTATCAAGCAT Sensamcavl CGACGCCAAAGGTCGTATCAAGCAT Meaning
-005S -005S
amcavl TTATATCGATGGATCCGAGGTCGTG Antisensamcavl TTATATCGATGGATCCGAGGTCGTG Antisens
-006AS -006AS
amcavl GCCGTACTCGTCGTTCCACAGAG Sensamcavl GCCGTACTCGTCGTTCCACAGAG Meaning
-008S -008S
amcavl GAACACTAGAATCTATCGGCCGATGG Antisensamcavl GAACACTAGAATCTATCGGCCGATGG Antisens
-012AS -012AS
amcavl TAGCGGCCGCAGAAGGAGAAGAGAGGAAG Sensamcavl TAGCGGCCGCAGAAGGAGAAGAGAGGAAG Meaning
-029S GGAGGG -029S GGAGGG
amcava GGATACGGTGTGTAGACCGCAAGG Antisensamcava GGATACGGTGTGTAGACCGCAAGG Antisens
1-1-
026AS 026AS
amcavl ATGGTACCGAACACTAGAATCTATCGGCCG Antisensamcavl ATGGTACCGAACACTAGAATCTATCGGCCG Antisense
-030AS ATGG -030AS ATGG
amcav2 CAACGTGCGCAGATCCATATCC Antisensamcav2 CAACGTGCGCAGATCCATATCC Antisens
-021AS -021AS
amcav2 GATGTTGCGCAAATAGGAGCCAC Antisensamcav2 GATGTTGCGCAAATAGGAGCCAC Antisens
-022AS -022AS
amcav2 CTTAAAGTGGTGCCTCAGCACGAAG Sensamcav2 CTTAAAGTGGTGCCTCAGCACGAAG Meaning
-025S -025S
amcav2 GCCCTTCGAGTACGCCGTCC Sensamcav2 GCCCTTCGAGTACGCCGTCC Meaning
-007S -007S
amcav2 GCTACGCATCGAGCTGAGCAGC Antisensamcav2 GCTACGCATCGAGCTGAGCAGC Antisens
-002AS -002AS
amcav2 TGTTCATCAAGGTGTACGCGCTC Sensamcav2 TGTTCATCAAGGTGTACGCGCTC Meaning
-024S -024S
amcav2 GGATCTCTTTCTCGATCTCCTGCG Antisensamcav2 GGATCTCTTTCTCGATCTCCTGCG Antisens
-023AS -023AS
amcav2 GCTGCTCAGCTCGATGCGTAGC Sensamcav2 GCTGCTCAGCTCGATGCGTAGC Meaning
-003S -003S
amcav2 CTAGCACCAGTCGTCCTCGTCGC Antisensamcav2 CTAGCACCAGTCGTCCTCGTCGC Antisens
-006AS amcav2 GTGCGGCCGCTACCTGGTCTGGTGGACATG Sens-006AS amcav2 GTGCGGCCGCTACCTGGTCTGGTGGACATG Meaning
-031S G -031S G
amcav2 GGCGATGATGGTGAGCAG Antisensamcav2 GGCGATGATGGTGAGCAG Antisens
-028AS -028AS
amcav2 CTCGGATTTGTTGTCCGTGTTACACG Antisensamcav2 CTCGGATTTGTTGTCCGTGTTACACG Antisens
-016AS -016AS
amcav2 CACGATCAGAAGTATTTGGCCTCTGCAG Sensamcav2 CACGATCAGAAGTATTTGGCCTCTGCAG Meaning
-013S -013S
Amcav AAGAATTCACGCGCAAACCCTAAGACG Antisens Amcav AAGAATTCACGCGCAAACCCTAAGACG Antisens
2-2-
015AS 015AS
amcav2 TCGGTACCACGCGCAAACCCTAAGAC Antisensamcav2 TCGGTACCACGCGCAAACCCTAAGAC Antisens
-026AS -026AS
amcav2 GCGCGATGTTACCGAATACCTGC Antisensamcav2 GCGCGATGTTACCGAATACCTGC Antisens
-004AS -004AS
amcav2 TCGGCTTCCTGAGGCTGTTTCG Sensamcav2 TCGGCTTCCTGAGGCTGTTTCG Meaning
-012S -012S
amcav2 AAGAATTCACGCGCAAACCCTAAGACG Antisensamcav2 AAGAATTCACGCGCAAACCCTAAGACG Antisens
-015AS -015AS
amcav3 TCGACGCATGGTTGGTACATCC Antisensamcav3 TCGACGCATGGTTGGTACATCC Antisens
-018 AS -018 AS
amcav3 CATGCTCACCCTTTCGAACCAC Antisensamcav3 CATGCTCACCCTTTCGAACCAC Antisens
-019 AS -019 AS
amcav3 GTGCGGCCGCCTGCCGCTGAACGCTTATCA Sensamcav3 GTGCGGCCGCCTGCCGCTGAACGCTTATCA Meaning
-023S AG -023S AG
amcav3 CAGGAAGCACCGTTGACGCA Antisensamcav3 CAGGAAGCACCGTTGACGCA Antisens
-007 AS -007 AS
amcav3 CTGGATCCTAATCGCGGAAGGTCCATTTGG Sensamcav3 CTGGATCCTAATCGCGGAAGGTCCATTTGG Meaning
-021 S -021 S
amcav3 CCCGTAATGGCCCTTAATGACC Antisensamcav3 CCCGTAATGGCCCTTAATGACC Antisens
-012AS -012AS
amcav3 CGCAGATTCCTGGAATAGATTGGAC Sensamcav3 CGCAGATTCCTGGAATAGATTGGAC Meaning
-001S -001S
amcav3 CTGGATCCGAACGTTCTCAACACACTCAGC Antisensamcav3 CTGGATCCGAACGTTCTCAACACACTCAGC Antisens
-020AS C -020AS C
amcav3 CATTTCAACGACATCGTCTGGGC Sensamcav3 CATTTCAACGACATCGTCTGGGC Sens
-003S -003S
amcav3 GATAAAGATGTAACCCTAAGGCAAGAAGC Antisensamcav3 GATAAAGATGTAACCCTAAGGCAAGAAGC Antisens
-004AS -004AS
amcav3 TGCCAAAAGCTCTGACTTACGCTC Sensamcav3 TGCCAAAAGCTCTGACTTACGCTC Meaning
-005S -005S
amcav3 CAACATTGAACCCTTGCAGCACTC Antisensamcav3 CAACATTGAACCCTTGCAGCACTC Antisens
-006AS -006AS
amcav3 GTGCGGCCGCCTGCCGCTGAACGCTTATCA Sensamcav3 GTGCGGCCGCCTGCCGCTGAACGCTTATCA Meaning
-023S AG -023S AG
amcav3 CGGAAGATGAATCTCCTCGTAGAG Sensamcav3 CGGAAGATGAATCTCCTCGTAGAG Meaning
-011S amcav3 AAGAGAATTGGCCGCAGAGCA Sens -013S -011S amcav3 AAGAGAATTGGCCGCAGAGCA Sens -013S
amcav3 GAGGTACCCTTAAGCAACATTGAACCCTTG Antisens -022AS CAGCACTC amcav3 GAGGTACCCTTAAGCAACATTGAACCCTTG Antisens -022AS CAGCACTC
amb2- ATGTCGAGGCAGCTTCGCGCTGAACGGGAC Sens 003S CA amb2- ATGTCGAGGCAGCTTCGCGCTGAACGGGAC Sens 003S CA
amb2- CTAAATGGCGTTCAATGCGCGCGGGTCTTG Antisens 004AS CT amb2- CTAAATGGCGTTCAATGCGCGCGGGTCTTG Antisense 004AS CT
amb2- GAGCGAGAGTTTAGCGGAGAGTCAACGC Sens 006S amb2- GAGCGAGAGTTTAGCGGAGAGTCAACGC Sens 006S
amb2- GACCCCCACTAAAGAGCAGTGGTGC Antisens 007AS amb2- GACCCCCACTAAAGAGCAGTGGTGC Antisens 007AS
amb2- CGAGGCGTAGGATCGTGAGTGGAAG Sens 008S amb2- CGAGGCGTAGGATCGTGAGTGGAAG Meaning 008S
amcava AACGACAACGACGACGACGG Sensamcava AACGACAACGACGACGACGG Sens
2d-2d-
012S 012S
amcava ATCTGTTACGTCAGCGTAGACCGG Antisens 2d-amcava ATCTGTTACGTCAGCGTAGACCGG Antisens 2d-
013AS 013AS
amcava CGTACGGATCATCCAACGATCTGG amcava CGTACGGATCATCCAACGATCTGG
2d- 2d-
014S 014S
amcava CAAACCACTGGGTTACCTTCGCA Antisens 2d-amcava CAAACCACTGGGTTACCTTCGCA Antisens 2d-
015AS 015AS
amcava TGCGAAGGTAACCCAGTGGTTTG Sensamcava TGCGAAGGTAACCCAGTGGTTTG Meaning
2d-2d-
016S 016S
amcava TCCTAATGAAAAAATTAATGTTGACCAAGG Antisens 2d-amcava TCCTAATGAAAAAATTAATGTTGACCAAGG Antisens 2d-
017AS 017AS
amcava ACACAAACGTGCGGTCACCG Sensamcava ACACAAACGTGCGGTCACCG Meaning
2d-2d-
018S 018S
amcava ACATTCGTATCGTACACGATGAGTGATAA Antisens 2d-amcava ACATTCGTATCGTACACGATGAGTGATAA Antisens 2d-
019AS 019AS
amcava GGTGAAGACGCATATGTACAAACTTCTACG Sensamcava GGTGAAGACGCATATGTACAAACTTCTACG Meaning
2d-2d-
010S 010S
amcava CGGGCCTAACGTGTCGAGGAT Antisens 2d-amcava CGGGCCTAACGTGTCGAGGAT Antisens 2d-
007AS 007AS
amcava ATGTTTCTATCCGTCAAGAAATTTGTACA Sensamcava ATGTTTCTATCCGTCAAGAAATTTGTACA Meaning
2d-2d-
001S 91 amcava TGGATGTAATGGGCCGTCGTATTC Antisens 2d-001s 91 amcava TGGATGTAATGGGCCGTCGTATTC Antisense 2d-
002AS 002AS
92 amcava GCCGAATACGACGGCCCATTACATC Sens  92 amcava GCCGAATACGACGGCCCATTACATC Meaning
2d- 2d-
003S 003S
93 amcava AGGGACGATTCGCGCTACCG Antisens  93 amcava AGGGACGATTCGCGCTACCG Antisens
2d- 2d-
004AS 004AS
94 amcava TGGACGATTCGATCGGACAAG Sens  94 amcava TGGACGATTCGATCGGACAAG Meaning
2d- 2d-
005S 005S
95 amcava GTCTCTCATATCCGTCTGTCTGTCCGTC Antisens  95 amcava GTCTCTCATATCCGTCTGTCTGTCCGTC Antisense
2d- 2d-
011AS 011AS
96 amcava ATCCTCGACACGTTAGGCCCG Sens  96 amcava ATCCTCGACACGTTAGGCCCG Meaning
2d- 2d-
006S 006S
97 amcava TGGATGTAATGGGCCGTCGTATTC Antisens  97 amcava TGGATGTAATGGGCCGTCGTATTC Antisens
2d- 2d-
002AS 002AS
98 amcava GGATGTACCTTCCAATTGTTCCCC Antisens  98 amcava GGATGTACCTTCCAATTGTTCCCC Antisens
2d- 2d-
009AS 009AS
108 PL006 cactagtaagcttcatatgggcgccgcggccgcacgcgtttcgaatcta  108 PL006 cactagtaagcttcatatgggcgccgcggccgcacgcgtttcgaatcta
gagaattcctcgagggtac  gagaattcctcgagggtac
109 PL007 cctcgaggaattctctagattcgaaacgcgtgcggccgcggcgcccat 109 PL007 cctcgaggaattctctagattcgaaacgcgtgcggccgcggcgcccat
atgaagcttactagtgagct  atgaagcttactagtgagct
Tel que démontré précédemment, les séquences entières du canal calcique, à savoir trois sous-unité s Caval (amCavla, amCav2b et amCav3a) et une sous-unité CavP (trois variants identifiés et clonés amCav a, amCav b et amCav c) et trois sous-unité s Cava2-ô (amCavCc2ôl, amCav(x2ô2 et amCavCc2ô3) d'abeille, ont été pour la première fois isolées et séquencées. As previously demonstrated, the entire calcium channel sequences, namely three Caval subunits (amCavla, amCav2b and amCav3a) and one CavP subunit (three variants identified and cloned amCav a, amCav b and amCav c) and three subunits Cava2-δ (amCavCc2δ1, amCav (x2ô2 and amCavCc2ô3) bee, were isolated for the first time and sequenced.
Une étude de l'expression du canal calcique Cava et des protéines CavP et Cava2-ô d'abeille a été réalisée sur des larves d'abeille au cours de son développement par analyse par transcription inverse et Réaction de Polymérisation en Chaîne (RT- PCR) à partir d'ARNm obtenus à différents stades du développement comme décrit, par exemple dans (Schlenstedt et al (2006) (Schlenstedt J., Balfanz S., Baumann A. & Blenau W. Am5-HT7 : Molecular and pharmacological characterization of the first serotonin receptor of the honeybee (Apis mellifera). J. Neurochem, 98 : 1958-1998 [16]); Moignot et al (2009) (Moignot B., Lemaire C, Quinchard S., Lapied B. & Legros C. The discovery of a novel sodium channel in the cockroach Periplaneta americana: Evidence for an early duplication of the para-like gene. Insect Biochem and Mol. Biol. 39 : 814-823 [17]), en utilisant les amorces suivantes amCav a : ATGTCGAGGCAGCTTCGCGCTGAACGGGACCA SEQ ID N°75 et CCTGCTGCCTCAGGGCCTCC SEQ ID N°99, amCav b :A study of the expression of the Cava calcium channel and of the CavP and Cava2-δ bee proteins was carried out on bee larvae during its development by reverse transcription analysis and chain polymerization reaction (RT-PCR). ) from mRNAs obtained at different stages of development as described, for example in (Schlenstedt et al (2006) (Schlenstedt J., Balfanz S., Baumann A. & Blenau W. Am5-HT7: Molecular and pharmacological characterization of the first serotonin receptor of the honeybee (Apis mellifera). J. Neurochem, 98: 1958-1998 [16]); Moignot et al (2009) (Moignot B., Lemaire C, Quinchard S., Lapied B. & Legros C. The discovery of a novel sodium channel in the cockroach Periplaneta americana: Evidence for an early duplication of the para-like gene. Insect Biochem and Mol Biol 39: 814-823 [17]), using the following primers amCav a: ATGTCGAGGCAGCTTCGCGCTGAACGGGACCA SEQ ID NO: 75 and CCTGCTGCCTCAGGGCCTCC SEQ ID NO: 99, amCav b:
ATGATCGGATACAATCAACACAATTCCGG SEQ ID N°100 et CCTGCTGCCTCAGGGCCTCC SEQ ID N°99, amCavla : GCCGTACTCGTCGTTCCACAGAG SEQ ID N°36 etATGATCGGATACAATCAACACAATTCCGG SEQ ID NO: 100 and CCTGCTGCCTCAGGGCCTCC SEQ ID NO: 99, amCavla: GCCGTACTCGTCGTTCCACAGAG SEQ ID NO: 36 and
GAACACTAGAATCTATCGGCCGATGG SEQ ID N°37, amCav2b : CACGATCAGAAGTATTTGGCCTCTGCAG SEQ ID N°53 et AAGAATTCACGCGCAAACCCTAAGACG SEQ ID N°54, amCav3a : TGGACGATTCGATCGGACAAG SEQ ID N°94 et CGTACGGATCATCCAACGATCTGG SEQ ID N°82, amCavCc2ôl : TGCGAAGGTAACCCAGTGGTTTG SEQ ID N°84 etGAACACTAGAATCTATCGGCCGATGG SEQ ID NO: 37, amCav2b: CACGATCAGAAGTATTTGGCCTCTGCAG SEQ ID NO: 53 and SEQ ID NO AAGAATTCACGCGCAAACCCTAAGACG 54, amCav3a: TGGACGATTCGATCGGACAAG SEQ ID NO: 94 and SEQ ID NO CGTACGGATCATCCAACGATCTGG 82, amCavCc2ôl: TGCGAAGGTAACCCAGTGGTTTG SEQ ID N ° 84 and
TCCTAATGAAAAAATTAATGTTGACCAAGG SEQ ID N°85, amCavCc2ô2 : CAATTCGACCTTGATGAACTGCG SEQ ID N°110 etTCCTAATGAAAAAATTAATGTTGACCAAGG SEQ ID NO: 85, amCavCc2O2: CAATTCGACCTTGATGAACTGCG SEQ ID NO: 110 and
ACATTCGTATCGTACACGATGAGTGATAA SEQ ID N°l l l et pour amCavCc2ô3 : TGGACGATTCGATCGGACAAG SEQ ID N°94 et AGGGACGATTCGCGCTACCG SEQ ID N°93. ACATTCGTATCGTACACGATGAGTGATAA SEQ ID No. 11 and for amCavCc2O3: TGGACGATTCGATCGGACAAG SEQ ID No. 94 and AGGGACGATTCGCGCTACCG SEQ ID No. 93.
Les photographies des gels d'agarose obtenus sont représentées sur la figure 12. Comme montré sur cette figure, les trois sous-unités Caval du canal calcique (amCavla (CaVl), amCav2b (CaV2) et amCav3a (CaV3)) et deux des variants de la sous-unité CavP (AmCaVpb et AmCaVPa) et les sous-unités Cava2ô (amCavCc2ôl (Cava2-ôl), amCav(x2ô2 (Cava2-ô2) et amCav(x2ô3 (Cava2-ô3)) isolés, sont exprimés au cours du développement de l'abeille. Exemple 2 : Mesure de la régulation de l'activité du canal calcique après expression dans des lignées cellulaires. The photographs of the agarose gels obtained are shown in FIG. 12. As shown in this figure, the three Caval subunits of the calcium channel (amCavla (CaV1), amCav2b (CaV2) and amCav3a (CaV3)) and two of the variants of the CavP subunit (AmCaVpb and AmCaVPa) and the Cava2δ subunits (amCavCc2δ1 (Cava2-δ1), amCav (x2ô2 (Cava2-ô2) and amCav (x2δ3 (Cava2-δ3)) isolated, are expressed during the development of the bee. EXAMPLE 2 Measurement of the Regulation of the Activity of the Calcium Channel After Expression in Cell Lines
Dans cet exemple, le canal calcique Cava et les protéines CavP et Cava2-ô isolés ont été exprimés dans des cellules Hek TSA201, dérivées des HEK, qui sont des cellules embryonnaires humaines de rein. Elles ont été transfectées de façon stable par le large antigène T du virus SV40. Ce large antigène T est produit par la cellule. Lors de la transfection transitoire de plasmide contenant l'origine de réplication du virus SV40, l'antigène T va venir interagir avec le site de réplication et va ainsi amplifier la réplication du plasmide provoquant une production massive de la protéine d'intérêt. La préparation des boites de culture a été réalisée comme suit. Des boites de Pétri de 35mm de diamètre utilisées pour la culture ont été recouvertes avant toute transfection. Il s'agit d'un traitement avec de la polyomithine (réf. P3655, Sigma) préparée comme suit : 10 mg de polyomithine sont dissous dans 66 ml d'eau stérile ou de PBS. La solution est filtrée sur un filtre avec des pores d'un diamètre de 0,22μιη, aliquotée par 1 ml / dans des tubes de 15 ml avant stockage à -20°C. La polyomithine a été utilisée diluée au 1/106 (soit 15μg /ml) dans du PBS trois jours avant culture (J-3). Un ml de la solution a été placé dans chaque boite de Pétri de 35mm et laissé sécher à 37°C. Le jour de culture (J), toutes les boites 35mm sont rincées 3 fois avec du PBS, avant de repiquer les cellules. Le milieu de culture utilisé dans cet exemple est un milieu complet qui a été préparé frais avant chaque expérimentation comme suit : Décomplémentation du sérum: ½ heures à 56°C DMEM HG (GIBCO ref 41965); 10% SVF (GIBCO ref 10106). In this example, the Cava calcium channel and the isolated CavP and Cava2-δ proteins were expressed in Hek TSA201 cells, derived from HEKs, which are human embryonic kidney cells. They were stably transfected with the large SV40 virus T antigen. This large T antigen is produced by the cell. During the transient plasmid transfection containing the replication origin of the SV40 virus, the T antigen will come to interact with the replication site and will thus amplify the replication of the plasmid causing massive production of the protein of interest. The preparation of the culture dishes was carried out as follows. Petri dishes of 35mm in diameter used for culture were covered before transfection. This is a treatment with polyomithine (P3655, Sigma) prepared as follows: 10 mg of polyomithine are dissolved in 66 ml of sterile water or PBS. The solution is filtered on a filter with pores with a diameter of 0.22 μm, aliquoted with 1 ml / in 15 ml tubes before storage at -20.degree. The polyornithine was used diluted 1:10 6 (either 15μg / ml) in PBS three days before cultivation (J-3). One ml of the solution was placed in each 35mm petri dish and allowed to dry at 37 ° C. On the day of culture (J), all the 35mm dishes are rinsed 3 times with PBS, before transplanting the cells. The culture medium used in this example is a complete medium that was prepared fresh before each experiment as follows: Serum Decompletion: ½ hour at 56 ° C. DMEM HG (GIBCO ref 41965); 10% FCS (GIBCO ref 10106).
Dans cet exemple, le repiquage des cellules a été effectuée avec les solution suivantes : 5 ml de milieu (DMEM HG) ont été placés dans un tube à centrifuger de 15 ml (tube 1), 2 ml de Trypsine soit ΙΟΟμΙ de trypsine (GIBCO ref 25090) et 1,9 ml de PBS (sans Ca, sans Mg), 15 ml de PBS, 10 ml de milieu complet (pour un repiquage simple, 900μ1 de milieu DMEM HG : permet le comptage d'une solution diluée 10X). L'ensemble de ces solutions a été mis à 37°C pendant quelques minutes. Le milieu de culture a été aspiré, 4 ml de PBS ont été ajoutés, puis mélangés pour rincer le fond de la boite, et réaspirés. 2 ml de trypsine diluée ont été ajoutés directement sur les cellules et sans précaution. Les boites de culture ont été incubées sous la hotte pendant quelques secondes. Les boites ont alors été tapotées avec la main pour finir de décoller les cellules encore attachées. 2 ml de PBS ont été alors rajoutés directement sur les cellules. Les 4ml de suspension cellulaire ont été alors récupérés et placés dans le tube (1) contenant 5 ml de milieu de base. Un second rinçage des boites de culture est effectué avec 3ml de PBS afin de recueillir les cellules résiduelles. Cette suspension est ajoutée au tube (1). Le tube a été ensuite centrifugé 3 min à 1500 tr/mn à température ambiante, à savoir 20°C. Le surnageant a été enlevé en laissant 200/300μ1 de milieu résiduel au-dessus du culot de cellules. Les cellules ont alors été resuspendues en agitant le fond du tube avec les doigts. Enfin 2 ml de milieu frais ont été ajoutés pour finir la remise en suspension des cellules à l'aide d'une pipette Pasteur stérile rodée à 50%. In this example, subculturing of the cells was carried out with the following solutions: 5 ml of medium (DMEM HG) were placed in a 15 ml centrifuge tube (tube 1), 2 ml of trypsin or ΙΟΟμΙ of trypsin (GIBCO ref 25090) and 1.9 ml of PBS (without Ca, without Mg), 15 ml of PBS, 10 ml of complete medium (for a single subculture, 900 μl of DMEM medium HG: allows the counting of a diluted 10 × solution) . All of these solutions were put at 37 ° C for a few minutes. The culture medium was aspirated, 4 ml of PBS was added, then mixed to rinse the bottom of the box, and re-aspirated. 2 ml of diluted trypsin was added directly to the cells and without precaution. The culture dishes were incubated under the hood for a few seconds. The boxes were then tapped with the hand to finish off the still attached cells. 2 ml of PBS were then added directly to the cells. The 4 ml of cell suspension was then recovered and placed in the tube (1) containing 5 ml of basal medium. A second rinsing of the culture dishes is carried out with 3 ml of PBS in order to collect the residual cells. This suspension is added to the tube (1). The tube was then centrifuged for 3 min at 1500 rpm at room temperature, i.e. 20 ° C. The supernatant was removed leaving 200 / 300μl of residual medium above the cell pellet. The cells were then resuspended by shaking the bottom of the tube with the fingers. Finally 2 ml of fresh medium were added to finish the resuspension of the cells using a sterile Pasteur pipette lapped at 50%.
Les cellules ont été comptées avec une cellule de Malassez et ensemencées à raison de 3.105 cellules par boîte de 35mm. La transfection des cellules a été réalisée comme suit. Les cellules ont été ensemencées à 3.105 cellules par boîte de 35mm (recouvertes (« coatés » en poly O), puis incubées à 37°C et sous 5% de C02 pendant 24 h. 5 μg d'un mélange d'ADN (Ιμ μϊ) codant pour les différentes sous-unités des canaux calciques ont été mixés avec du milieu de base (qsp ΙΟΟμΙ) à température ambiante, à savoir 21°C+/- 1°C. 10 μΐ de superfect (Qiagen) ont été ajoutés et mélangés (haut et bas 5 fois à la pipette PI 00) à cette solution, puis laissés incuber à température ambiante , à savoir 21°C+/-1°C pendant 5- 10 min. Pendant ce temps, le milieu de culture complet a été aspiré et les boites rincées avec 2,5 ml de PBS- (préchauffés à 37°C). 900 μΐ de milieu de croissance (à 37°C ont été ajoutés au mélange ADN-Superfect et mélanger haut et bas 2 fois. Le PBS des boites de culture a été enlevé et remplacé par le mélange de transfection. Ces boites ont été incubées 2h à 37°C et sous 5% de C02. Puis, le mélange de transfection a été doucement aspiré, et les cellules ont été lavées avec 2,5 ml de PBS. 2 ml de milieu de croissance a été finalement ajouté et les cellules ont été stockées à 37°C sous 5% de C02 pour l'analyse des courants calciques. Les mélanges d'ADN utilisés ont été réalisés à partir de solutions stock d'ADN à 1μ /μ1 contenant l'ADN codant pour une des différentes sous-unités des canaux calciques, insérées dans un vecteur d'expression eucaryote avec ou sans étiquette N ou C- terminale obtenu à l'exemple 1 précité. Pour le premier et le second variant du canal calcique Cava, (AmCaVl et AmCaV2), les vecteurs d'expression codant pour les protéines CavP et Cava2-ô ont été mélangés dans un rapport 1 : 1 : 1 avec le canal. Cells were counted with a Malassez cell and seeded at 3.10 5 cells per 35mm dish. Transfection of the cells was performed as follows. The cells were seeded at 3.10 5 cells per 35mm dish (coated ("coated" in poly O), then incubated at 37 ° C. and 5% CO 2 for 24 h 5 μg of a DNA mixture (Ιμ μϊ) coding for the different subunits of the calcium channels were mixed with basal medium (qsp ΙΟΟμΙ) at room temperature, ie 21 ° C +/- 1 ° C. 10 μΐ of superfect (Qiagen) were added and mixed (up and down 5 times with PI 00 pipette) to this solution and then incubated at room temperature, ie 21 ° C +/- 1 ° C for 5- 10 min. The whole was aspirated and the dishes rinsed with 2.5 ml of PBS- (preheated to 37 ° C.) 900 μl of growth medium (at 37 ° C. were added to the DNA-Superfect mixture and mix up and down twice) The PBS from the culture dishes was removed and replaced with the transfection mixture These dishes were incubated for 2 h at 37 ° C. and 5% CO 2. Then, the transfection mixture was gently aspirated, and the cells were washed with 2.5 ml of PBS. 2 ml of growth medium was finally added and the cells were stored at 37 ° C under 5% CO 2 for analysis of calcium currents. The DNA mixtures used were made from 1 μ / μl DNA stock solutions containing the DNA coding for one of the different calcium channel subunits, inserted into a eukaryotic expression vector with or without an N label. or C-terminal obtained in Example 1 above. For the first and second variants of the Cava calcium channel, (AmCaV1 and AmCaV2), the expression vectors encoding the CavP and Cava2-δ proteins were mixed in a 1: 1: 1 ratio with the channel.
Ces mélanges ont été transfectés dans les cellules selon le procédé qui vient d'être décrit: Des vecteurs contenant les séquences pIRES et deux gènes (CaVl et CavP par exemple) peuvent aussi être préparés par biologie moléculaire pour ce type de transfection. Dans tous les cas, soit une des sous-unités est étiquetée avec une protéine fluorescente de type GFP, soit un vecteur codant pour une protéine fluorescente de ce type est cotransfecté avec les sous-unités du canal (dans un rapport 10 : 1 : 1 : 1 pour GFP : Cava : CavP et Cava2-ô). Les cellules exprimant le canal sont ensuite visualisées grâce à un microscope équipé de la fluorescence These mixtures were transfected into the cells according to the method which has just been described: The vectors containing the pIRES sequences and two genes (CaV1 and CavP for example) can also be prepared by molecular biology for this type of transfection. In any case, either one of the subunits is labeled with a GFP fluorescent protein, or a vector encoding such a fluorescent protein is cotransfected with the channel subunits (in a 10: 1: 1 ratio : 1 for GFP: Cava: CavP and Cava2-ô). The cells expressing the channel are then visualized thanks to a microscope equipped with fluorescence
Enregistrement de l'activité des canaux calciques Recording calcium channel activity
Sur cellules isolées, exprimant transitoirement ou de manière stable le canal Cava, et/ou la protéine CavP et/ou la protéine Cava2-ô, différentes méthodes ont été utilisées pour analyser l'effet de substances sur les canaux calciques. On isolated cells, transiently or stably expressing the Cava channel, and / or the CavP protein and / or the Cava2-δ protein, different methods were used to analyze the effect of substances on the calcium channels.
La mesure de l'activité des canaux calciques a été réalisée, dans cet exemple, avec un procédé électrophysiologique et/ou par imagerie calcique. a. Méthode électrophysiologique. The measurement of the activity of the calcium channels was carried out, in this example, with an electrophysiological method and / or by calcium imaging. at. Electrophysiological method.
Les cellules transfectées, ont été repiquées à faible densité, à savoir 1.105 cellules/boite à J-l dans plusieurs boites de Pétri de 35mm. Le jour J, ces boites ont été rincées une fois avec du PBS, et une fois avec une solution d'enregistrement de type extracellulaire (en mM : TEA-C1, 155 ; MgC12, 2 ; HEPES, 10 ; Glucose, 10 ; CaCl ou BaCl entre 2 et 20 ; pH=7.4 (TEA-OH)) ou tout type de solution permettant d'enregistrer l'activité électrique du canal calcique. Cette boite a été transférée sur la platine d'un microscope inversé (type Leica DMIRB ou équivalent) équipé d'un système d'épifluorescence, et d'un système de perfusion de la boite de Pétri. L'enregistrement de l'activité du canal a alors été réalisé en Whole cell recording en utilisant un amplificateur de patch-clamp Axopatch 200 ou équivalent, connecté à un ordinateur par une interface de type Digidata 1200 (Axon Ist, ou équivalent). Les sauts de potentiels appliqués à la cellule comme l'enregistrement des courants ont été réalisés grâce au logiciel pClamp (ver 7, Axon Inst, ou équivalent). Les pipettes d'enregistrement ont été en général étirées à partir de verre capillaire (marque Clark electromedical Instrument GC150T10, ou équivalent) par une étireuse programmable horizontale (type P-93 Sutter Inst. ou équivalent), pour donner des pipettes qui ont une résistances de 2-15 ΜΩ quand elles ont été remplies avec une solution de type intracellulaire (en mM : CsCl, 110 ; HEPES, 25 ; EGTA ou BAPTA, 10 ; ATP(Mg), 4 ; GTP(Na), 0,3 ; Tris-phosphocréatine 10; pH=7,3 CsOH 290 mOsm). The transfected cells were subcultured at a low density, namely 1.10 5 cells / dish at 1 liter in several 35 mm petri dishes. On day D, these dishes were rinsed once with PBS, and once with an extracellular recording solution (in mM: TEA-C1, 155, MgCl2, 2, HEPES, 10, Glucose, 10, CaCl2 or BaCl between 2 and 20, pH = 7.4 (TEA-OH)) or any type of solution for recording the electrical activity of the calcium channel. This box was transferred to the stage of an inverted microscope (Leica DMIRB type or equivalent) equipped with an epifluorescence system, and a perfusion system of the petri dish. The recording of the channel activity was then made in Whole cell recording using an Axopatch 200 patch-clamp amplifier or equivalent, connected to a computer by a Digidata 1200 type interface (Axon Ist, or equivalent). The potential jumps applied to the cell as the currents were recorded using the software pClamp (ver 7, Axon Inst, or equivalent). The recording pipettes have generally been drawn from capillary glass (Clark Electromedical Instrument GC150T10 or equivalent) by a horizontal programmable puller (type P-93 Sutter Inst or equivalent) to give pipettes which have a resistance. of 2-15 ΜΩ when filled with an intracellular solution (in mM: CsCl, 110, HEPES, 25, EGTA or BAPTA, 10, ATP (Mg), 4, GTP (Na), 0.3; Tris-phosphocreatine 10, pH = 7.3 CsOH 290 mOsm).
De manière générale l'activité du canal a été enregistrée lors de sauts de potentiels à partir d'un potentiel de repos de -80 mV vers un potentiel entre -40 et +60 mV (généralement à +10 mV, maximum de la courbe courant-voltage). L'effet de substance sur le canal calcique est alors évalué en enregistrant les modifications dans l'amplitude, les cinétiques ou activation voltage dépendant du courant lors de la perfusion de la substance à différentes concentrations. In general, the activity of the channel was recorded during potential jumps from a resting potential of -80 mV to a potential between -40 and +60 mV (generally at +10 mV, maximum of the current curve -voltage). The substance effect on the calcium channel is then evaluated by recording changes in amplitude, kinetics, or voltage-dependent voltage activation during the infusion of the substance at different concentrations.
La mesure de l'activité du canal peut aussi être enregistrée en canal unitaire avec d'autres méthodes déjà décrites par exemple en « cell-attached », « inside-out », « outside-out » patch clamp tel que décrit dans « Electrophysiologie moléculaire » 2001 Ed. M. Joffre, collection enseignement de sciences, Herman [13] ou « Microelectrode techniques, The Plymouth Workshop Handbook » 1988, Ed. N.B. Standen, P.T.A Gray and M.J. Whitaker, The Company of Biologists Limited ou « Single Channel recording » 1983 Ed. B. Sackmann and E Neher. Plénum Press, New York [14]. b. Méthode imagerie calcique The measurement of the activity of the channel can also be recorded in unitary channel with other methods already described for example in "cell-attached", "inside-out", "outside-out" patch clamp as described in "Electrophysiology Molecular "2001 Ed. M. Joffre, Science Teaching Collection, Herman [13] or" Technical Microelectrode, The Plymouth Workshop Handbook "1988, NB Ed. Standen, PTA Gray and MJ Whitaker, The Company of Biologists Limited or" Single Channel recording 1983 Ed. B. Sackmann and E Neher. Plenum Press, New York [14]. b. Calcium imaging method
Les cellules transfectées ont été repiquées à faible densité à J-l sur des couvercles (« coverslips ») recouvertes (« coatés ») comme précédemment et placées dans plusieurs boites de Pétri de 35mm. Le jour J, ces boites ont été rincées deux fois avec du PBS. Elles sont ensuite incubées en présence d'un indicateur calciques fluorescent traversant les membranes, souvent sous une version AM, (c'est-à-dire acetoxymethyl ester,) radiométrique ou non, comme par exemple le fluo-3 ; fura-2, à une concentration de 5μg Fura2-AM/ml PBS+lmg/ml BSA fatty acid free) entre 30min à 2h. Cette boite est ensuite rincée 2 à 3 fois avec du PBS, et une fois avec une solution d'enregistrement de type extracellulaire comprenant en mM : NaCl, 155 ; MgC12, 2 ;HEPES, 10 ; Glucose, 10 ; CaCl entre 2 et 20 ; pH=7,4 (TEA-OH) permettant d'enregistrer l'activité électrique du canal calcique 15-30 min après ce dernier lavage. The transfected cells were subcultured at low density on coverlips coated as before and placed in several 35 mm petri dishes. On day D, these dishes were rinsed twice with PBS. They are then incubated in the presence of a fluorescent calcium indicator passing through the membranes, often in an AM version (that is to say, acetoxymethyl ester) radiometric or otherwise, such as for example fluo-3; fura-2, at a concentration of 5μg Fura2-AM / ml PBS + 1mg / ml BSA fatty acid free) between 30min to 2h. This box is then rinsed 2 to 3 times with PBS, and once with an extracellular recording solution comprising in mM: NaCl, 155; MgCl 2, HEPES, 10; Glucose, 10; CaCl 2 to 20; pH = 7.4 (TEA-OH) to record the electrical activity of the calcium channel 15-30 min after this last wash.
La boîte est transférée sur la platine d'un microscope inversé (type Leica DMIRB ou équivalent) équipé d'un système d'épifluorescence, et d'un système de perfusion de la boite de Pétri. L'enregistrement de l'activité du canal se fait alors en imagerie à l'aide d'une caméra CCD ou autre montée sur le microscope, ou par un ou deux photomultiplicateurs. L'activité du canal est donnée par la mesure des variations de la concentration calcique intracellulaire (mesurée comme une variation de fluorescence, ou un rapport de variation de fluorescence) après une dépolarisation de la cellule obtenue soit par la perfusion d'un concentration de KC1 de 20 à 60mM extérieure, soit par l'activation de canal dépolarisant sensible à la lumière (channelrhodopsine-2) et activé par un flash bleu (488 nm, opto génétique). Le contrôle positif pour la mesure de la concentration calcique est effectué par la perfusion de 20μΜ ionomycine (ionophore calcique) successivement avec 10 mM EGTA ou 20 mM Ca2+ pour obtenir le ratio, minimum (Rmin) et maximum (Rmax). The box is transferred to the stage of an inverted microscope (Leica DMIRB type or equivalent) equipped with an epifluorescence system, and a perfusion system of the petri dish. The channel activity is then recorded using a CCD or other microscope-mounted camera or one or two photomultipliers. Channel activity is given by measuring changes in intracellular calcium concentration (measured as a fluorescence change, or a fluorescence variation ratio) after depolarization of the cell obtained either by infusion of a KC1 concentration from 20 to 60mM outside, either by activation of light-sensitive depolarizing channel (channelrhodopsin-2) and activated by a blue flash (488 nm, genetic opto). The positive control for the measurement of the calcium concentration is carried out by the infusion of 20μΜ ionomycin (calcium ionophore) successively with 10 mM EGTA or 20 mM Ca 2+ to obtain the ratio, minimum (Rmin) and maximum (Rmax).
Le rapport de fluorescence Fura-2 350/380 est alors converti en concentration calcique [Ca]i, par l'équation standard: [Ca]i = Kd* [(R-Rmin)/(Rmax-R)]*Sf/Sb The fluorescence ratio Fura-2 350/380 is then converted to calcium concentration [Ca] i, by the standard equation: [Ca] i = K d * [(RR min ) / (R max -R)] * S f / S b
Où Sf and Sb sont respectivement les intensités d'émission à 380 nm pour le Calcium libre et le Calcium fixé au Fura2. Cet ensemble d'opération est réalisé par divers types de logiciel, dont Tillvision (dTill photonics GmbH), ou équivalent, en imagerie ou directement avec des photomultiplicateurs (on peut utiliser aussi Clampex ver 7) Where S f and S b are the emission intensities at 380 nm for Free Calcium and Fura2-bound Calcium, respectively. This set of operations is realized by various types of software, including Tillvision (dTill photonics GmbH), or equivalent, in imaging or directly with photomultipliers (we can also use Clampex ver 7)
L'analyse de l'effet de substance sur cette activité du canal calcique est obtenue en comparant l'activité du canal, mesurée dans ces conditions avec ou sans la substance dans le milieu. Une diminution ou une altération de l'activité du canal en présence de la substance test montrant que celle-ci touche le fonctionnement du canal et est donc potentiellement toxique. The analysis of the effect of substance on this activity of the calcium channel is obtained by comparing the activity of the channel, measured under these conditions with or without the substance in the medium. A decrease or an alteration of the activity of the channel in the presence of the test substance showing that it affects the operation of the channel and is therefore potentially toxic.
Exemple 3 : procédé d'analyse de la toxicité d'une molécule Dans cet exemple, l'analyse de la toxicité d'une molécule a été réalisée par étude des courants calciques en fonction de ladite molécule. Example 3 Method for Analyzing the Toxicity of a Molecule In this example, the analysis of the toxicity of a molecule was carried out by studying the calcium currents as a function of said molecule.
Deux méthodes sont utilisées, avec des variantes : Two methods are used, with variants:
- la mesure de courants calciques par électrophysiologie (sur ovocytes ou lignée cellulaire), - la mesure de courants calciques par imagerie calcique de fluorescence sur lignée cellulaire. measurement of calcium currents by electrophysiology (on oocytes or cell line), measurement of calcium currents by calcium imaging of fluorescence on cell line.
La mesure de la régulation de l'activité du canal calcique après expression dans des ovocytes de Xénope. Measurement of the regulation of calcium channel activity after expression in Xenopus oocytes.
Préparation des ARN Les vecteurs contenant les sous-unités amCavla, amCav2b, amCav3a, amCav a, amCav b, amCav c, amCavCc2ôl, amCavCc2ô2 et amCav(x2ô3, tels qu'obtenus ci- dessus, ont été linéarisés en utilisant une enzyme de restriction coupant en 3' du codon Stop (voir Tableau 2). Un volume réactionnel de 50μ1 contenant 10 μg de plasmide, 3μ1 de l'enzyme appropriée (New England Biolabs France, Evry, France), 5 μΐ de tampon de réaction fourni par le fabricant et de l'eau a été incubé pendant 3 heures à 37°C. La linéarisation du plasmide a été vérifiée en faisant migrer un aliquot de la réaction, à savoir 3μ1, sur un gel d'agarose. Le plasmide linéarisé a été purifié avec le kit NucleoSpin Extract II (Macherey-Nagel EURL, Hoerd, France) en suivant les recommandations du fabricant excepté que l'élution du plasmide linéarisé a été réalisée dans 30μ1 d'eau. Le cDNA a été dosé par spectrophotomètrie sur un Biophotomètre (Eppendorf France SAS, Le Pecq, France). La transcription in vitro a été réalisée en utilisant le kit T3 ou T7 mMessage mMachine (Life Technologies, Saint Aubin, France) en suivant les recommandations du fabriquant. L'ARN a été purifié en utilisant le kit RNeasy Mini Kit (Qiagen SAS, Courtaboeuf, France) en suivant les recommandations du fabricant, excepté que l'élution de l'ARN purifié a été réalisée dans 30μ1 d'eau. L'ARN a été dosé par spectrophométrie, la concentration ramenée à 1 §/ 1 avec de l'eau. L'intégrité de l'ARN a été vérifiée en faisant migrer un aliquot, à savoir 500ng d'ARN, sur un gel d' agarose. L'ARN a ensuite été stocké à -20°C pour une utilisation ultérieure. Preparation of the RNAs The vectors containing the subunits amCavla, amCav2b, amCav3a, amCav a, amCav b, amCav c, amCavCc2δ1, amCavCc2ô2 and amCav (x2δ3, as obtained above, were linearized using a restriction enzyme cutting at 3 'of the stop codon (see Table 2) A reaction volume of 50 μl containing 10 μg of plasmid, 3 μl of the appropriate enzyme (New England Biolabs France, Evry, France), 5 μl of reaction buffer provided by the manufacturer and water was incubated for 3 hours at 37 ° C. The linearization of the plasmid was verified by migrating an aliquot of the reaction, namely 3 μl, on an agarose gel The linearized plasmid was purified with the kit NucleoSpin Extract II (Macherey-Nagel EURL, Hoerd, France) according to the manufacturer's recommendations except that the elution of the linearized plasmid was carried out in 30 μl of water. CDNA was determined by spectrophotometry on a biophotometer (Eppendorf France SAS, Le Pecq, France). In vitro transcription was performed using the T3 or T7 mMessage mMachine kit (Life Technologies, Saint Aubin, France) following the manufacturer's recommendations. The RNA was purified using the RNeasy Mini Kit Kit (Qiagen SAS, Courtaboeuf, France) following the manufacturer's recommendations, except that elution of the purified RNA was performed in 30μl of water. The RNA was determined by spectrophotometry, the concentration reduced to 1 / / 1 with water. The integrity of the RNA was verified by migrating an aliquot, namely 500ng of RNA, onto an agarose gel. The RNA was then stored at -20 ° C for later use.
Tableau 2 : Table 2:
ADNc, vecteur, enzyme de restriction et polymérase utilisées pour la transcription in vitro. CDNA, vector, restriction enzyme and polymerase used for in vitro transcription.
ADNc  cDNA
Vecteur Enzyme Polymérase SEQ ID  Vector Enzyme Polymerase SEQ ID
amCavla  amCavla
pBS-PL7 Kpnl T3  pBS-PL7 Kpnl T3
SEQ ID n°9  SEQ ID No. 9
amCav2b  amCav2b
pBS-PL6 Kpnl T3  pBS-PL6 Kpnl T3
SEQ ID no10 SEQ ID No. 10
amCav3a  amCav3a
pBluescript-II SK AflII T3  pBluescript-II SK AflII T3
SEQ ID n0l l SEQ ID No. 0 ll
amCavCÛôl  amCavCÛôl
pBluescript-II SK BamHI T7  pBluescript-II SK BamHI T7
SEQ ID n015 SEQ ID No. 0 15
amCava2ô2  amCava2ô2
pBluescript-II SK Xbal T7  pBluescript-II SK Xbal T7
SEQ ID n016 SEQ ID No. 0 16
amCava2ô3  amCava2ô3
pBluescript-II SK BamHI T7  pBluescript-II SK BamHI T7
SEQ ID n017 SEQ ID No. 0 17
amCavPa  amCavPa
pBluescript-II SK Xbal T3  pBluescript-II SK Xbal T3
SEQ ID n012 SEQ ID No. 0 12
amCavPb  amCavPb
pBluescript-II SK Xbal T7  pBluescript-II SK Xbal T7
SEQ ID n013 SEQ ID No. 0 13
amCavβc  amCavβc
pBluescript-II SK Xbal T7  pBluescript-II SK Xbal T7
SEQ ID n014 Préparation des ovocytes SEQ ID No. 0 14 Oocyte preparation
Matériel Equipment
-une pince à bouts pointus -une pince à bouts ronds -fil de suture  -a sharp-pointed forceps -a round-ended forceps-suture thread
-une pince à bouts coupes -une paire de ciseaux -une boite de pétri -OR2 à 20°C pointus (50mm) -a clip with cut ends -a pair of scissors -a petri dish -OR2 at 20 ° C pointed (50mm)
Isolement des ovocytes Isolation of oocytes
Une femelle Xenopus laevis, obtenue par le laboratoire CRBM, UMR 5237 du CNRS à Montpellier, a été plongée dans un bocal contenant de l'eau additionnée une solution aqueuse de MS222 (éthyl- aminobenzoate méthane sulfonate, ref A5040, Sigma) à 0,2% à 4°C pendant 15 à 20 minutes. Une fois le Xénope endormi, il a été placé sur de la glace en decubitus dorsal. Deux incisions ont alors été réalisées, au niveau de l'épiderme et du plan musculaire sous-jacent, sur 1cm à 1,5cm sur le côté, dans la partie basse de l'abdomen. Les sacs ovariens contenant les ovocytes ont été retirés à l'aide d'une pince courbe à bouts ronds, isolés et placés dans une boite de Pétri remplie d'OR2. Le muscle, puis l'épiderme ont ensuite été recousus, et le Xénope replacé dans son aquarium pour le réveil. Les sacs ovariens ont été alors dilacérés avec deux pinces dans la boite de Pétri, puis transférés dans un tube Falcon de 50ml et rincés 3 fois avec 30 ml d'OR2 à chaque fois. A female Xenopus laevis, obtained by the CRBM laboratory, UMR 5237 from the CNRS in Montpellier, was immersed in a jar containing water added with an aqueous solution of MS222 (ethylaminobenzoate methanesulfonate, ref A5040, Sigma) at 0, 2% at 4 ° C for 15 to 20 minutes. Once the Xenope was asleep, he was placed on ice in supine decubitus. Two incisions were then made, at the level of the epidermis and the underlying muscular plane, on 1cm to 1.5cm on the side, in the lower part of the abdomen. The ovarian sacs containing the oocytes were removed using round-shaped curved pliers, isolated and placed in a Petri dish filled with OR2. The muscle, then the epidermis were then sewn, and the Xenopus returned to his aquarium for awakening. The ovarian sacs were then dilacerated with two forceps in the Petri dish, then transferred to a 50ml Falcon tube and rinsed 3 times with 30 ml of OR2 each time.
Au dernier rinçage, le tube Falcon a été rempli d'une solution contenant 30 ml d'OR2 et 30 mg de collagénase 1A (ref C9891 Sigma) afin de dissocier les ovocytes des cellules folliculaire. Ce tube a alors été placé sous agitation orbitale (1 révolution/sec.) pendant 2 heures. Après 2h (ou dès que les cellules folliculaires ont été dissociées des ovocytes, visualisable par une inspection sous loupe binoculaire 30x), les ovocytes ont été rincés 2 à 3 fois avec une solution OR2 (30ml à chaque fois), puis 2 fois avec une solution ND96S. Les ovocytes isolés sont alors transférés dans cette solution dans une boite de Pétri de 100mm. A partir de cette boite, des lots de 30-40 ovocytes sont sélectionnés puis isolés dans des boites de Pétri de 30mm pour l'injection. Tableau 3 : composition des solutions OR2 et ND96S At the last rinse, the Falcon tube was filled with a solution containing 30 ml of OR2 and 30 mg of collagenase 1A (ref C9891 Sigma) in order to dissociate the oocytes from the follicular cells. This tube was then placed under orbital agitation (1 revolution / sec.) For 2 hours. After 2h (or as soon as the follicular cells were dissociated from the oocytes, visualizable by inspection under a 30x binocular loupe), the oocytes were rinsed 2 to 3 times with an OR2 solution (30ml each time), then twice with a ND96S solution. The isolated oocytes are then transferred into this solution in a Petri dish of 100 mm. From this box, lots of 30-40 oocytes are selected and then isolated in 30mm Petri dishes for injection. Table 3: composition of OR2 and ND96S solutions
Figure imgf000087_0001
Figure imgf000087_0001
Injection des ovocytes avec des ARN ou des ADNc  Injection of oocytes with RNA or cDNA
Des pipettes en verre pour l'injection des acides nucléiques ont été préparées à partir de capillaires en verre Clark Electromedical Instrument CG150T10 qui ont été étirés à chaud sur une étireuse verticale (de type Sutter Inst. P-30) ou horizontale (de type Sutter Inst. P93) pour donner une ouverture finale de quelques μιη. L'injection d'acide nucléique se fait sous loupe binoculaire (x30). La pipette a été montée sur un micromanipulateur et connectée à un système d'injection. Elle a été remplie de 1 à 2 μΐ de mélange d'acides nucléiques, et a ensuite été utilisée pour injecter les acides nucléiques dans 20 à 30 ovocytes. Le même type d'injection a été réalisé pour les différents mélanges d'acide nucléique de séquences nucléiques. Quand le mélange d'acides nucléique est de l'ADN, l'injection a été réalisée au milieu du pôle animal, quand il s'agit d'ARN, l'injection a été réalisée dans la zone équatoriale. Glass pipettes for injection of the nucleic acids were prepared from Clark Electromedical Instrument CG150T10 glass capillaries which were hot-drawn on a vertical (Sutter Inst. P-30) or horizontal (Sutter type) Inst P93) to give a final aperture of a few μιη. The nucleic acid injection is under a binocular loupe (x30). The pipette was mounted on a micromanipulator and connected to an injection system. It was filled with 1 to 2 μΐ of nucleic acid mixture, and was then used to inject the nucleic acids into 20 to 30 oocytes. The same type of injection was performed for the different nucleic acid mixtures of nucleic sequences. When the nucleic acid mixture is DNA, the injection was carried out in the middle of the animal pole, when it is RNA, the injection was made in the equatorial zone.
Les mélanges d'ADN ou d'ARN utilisés ont été comme suit : pour le canal, l'ADNc codant pour le Cava et ses variants, à savoir les séquences SEQ ID NO 1, ou 2 et 6 et 4 ont été injectées. L'ADNc codant pour le Cava (2 et 3) de séquences SEQ ID NO 1 ou 2 ont été injectées avec un ADNc codant pour le CaVP (SEQ ID NO 4 ou 5), et un ADNc codant pour CaVal-ô2 et ses variants (SEQ ID NO 6). Les ADNc ou ARNc ont été préparés à une concentration de ^g/μΐ Après injection, les ovocytes comprenant respectivement l'ADNc/ ARN codant pour le Cava (2 et 3) de séquences SEQ ID NO 1 ou 2, la CaVP (SEQ ID NO 4 ou 5), et la CaVal-ô2 (SEQ ID NO 6) ont été obtenus. Une fois injectés, les ovocytes sont replacés dans leur boite qui est étiquetée, puis conservés en ND96S pendant 2-5 jours. The DNA or RNA mixtures used were as follows: for the channel, the cDNA coding for Cava and its variants, namely the sequences SEQ ID No. 1, or 2 and 6 and 4, were injected. The cava coding for Cava (2 and 3) of SEQ ID NO 1 or 2 were injected with a cDNA encoding CaVP (SEQ ID No. 4 or 5), and a cDNA encoding CaVal-6 and its variants. (SEQ ID NO 6). The cDNAs or cRNA were prepared at a concentration of g / μl. After injection, the oocytes respectively comprising the cava / RNA coding for Cava (2 and 3) of sequences SEQ ID No. 1 or 2, CaVP (SEQ ID NO 4 or 5), and CaVal-6 (SEQ ID NO 6) were obtained. Once injected, the oocytes are returned to their labeled box and stored in ND96S for 2-5 days.
Enregistrement électrophysiologique. Electrophysiological recording.
Après injection, les œufs ont été placés, un à un, dans une cuve d'enregistrement (connectée à la masse par le biais d'une pipette remplie d'Agar dissout à 2% dans du KC1 3M reliée à la tête de «bain » de l'amplificateur de courant (de type Geneclamp 500, Axon Inst. ou équivalent). Deux électrodes construites comme les électrodes d'injection mais remplies de KC1 3M, ont été connectées aux têtes « voltage » et « courant » de l'amplificateur. Après avoir testé la résistance de ces deux électrodes (0,2-1 ΜΩ), elles ont été introduites dans l'ovocyte, et l'amplificateur réglé sur le mode « voltage imposé ». L'ovocyte ainsi empalé a été perfusé avec une solution permettant l'enregistrement de l'activité des canaux calciques à savoir une solution BantlO (composition (en mM) : BaOH, 10; TEAOH, 20 ; CsOH, 2 ; NMDG, 50 ; HEPES, 10 ; pH =7,2 avec de l'acide méthane sulfonique). Le courant de baryum résultants de l'expression des canaux codés par les différents acides nucléiques a été enregistré en appliquant les sauts de voltage à partir d'un potentiel de repos fixé à -80mV, vers des potentiels supérieurs (de -50 à +80 mV) durant 50 à 1000 msec ou plus. L'ensemble stimulation de l'ovocyte et enregistrement des courants a été réalisé grâce au logiciel pclamp (Clampex ver 7, Axon Inst. ou supérieur) ou équivalent, tournant sur un ordinateur connecté à l'amplificateur grâce à une carte d'acquisition Digidata 1200 (Axon Inst) ou équivalent. After injection, the eggs were placed, one by one, in a recording tank (connected to the mass by means of a pipette filled with Agar dissolved in 2% in 3M KC1 connected to the head of "bath" Of the current amplifier (type Geneclamp 500, Axon Inst or equivalent) Two electrodes built as the injection electrodes but filled with KC1 3M, were connected to the heads "voltage" and "current" of the amplifier After testing the resistance of these two electrodes (0.2-1 ΜΩ), they were introduced into the oocyte, and the amplifier set to the "forced voltage" mode.The oocyte thus impaled was perfused with a solution allowing the recording of the activity of the calcium channels, namely a BantlO solution (composition (in mM): BaOH, 10, TEAOH, 20, CsOH, 2, NMDG, 50, HEPES, pH = 7, 2 with methanesulfonic acid.) The barium current resulting from the expression of the channels coded by the Different nucleic acids were recorded by applying voltage jumps from a resting potential set at -80mV, to higher potentials (from -50 to +80mV) for 50 to 1000 msec or more. The oocyte stimulation and recording of currents was realized thanks to the pclamp software (Clampex ver 7, Axon Inst or higher) or equivalent, running on a computer connected to the amplifier thanks to a Digidata acquisition card 1200 (Axon Inst) or equivalent.
L'expression de ces ADNs a été obtenue d'un point de vue fonctionnel, les substances à tester ont été injectées dans le milieu extérieur, dans l'exemple présent dissoutes dans du Bant 10, et l'effet de la substance sur le canal et les protéines régulatrice est alors enregistré. L'effet de la substance testée peut être une diminution ou une augmentation du courant de baryum, des modifications dans les autres paramètres liés au canal calcique : les cinétiques du courant ou l'activation dépendante du voltage ou l'inactivation du canal. Des variations dans ces différents éléments sont le signe d'un effet toxique sur l'entrée de Ca2+. Ainsi, une variation/modification de ces paramètres permet d'identifier des composés potentiellement toxiques pour les abeilles. La figure 9 représente les résultats obtenus avec les canaux calciques d'abeille Cava (AmCaVal) et CaVa (AmCava2) co-exprimés avec les protéines régulatrices d'abeille CavP (AmCavPa) et Cava2-ô (AmCava2-ôl) de façon fonctionnelle dans des ovocytes de Xénopes. Des courbes courant-voltage classiques sont obtenues. En ce qui concerne les canaux AmCaV3a d'abeille, les sous-unités CaVa2ô et CavP n'étant pas nécessaires à son expression, leur ADN/ARN n'a pas été injecté. Les traces de courant obtenues lors de dépolarisation de -100 mV à -30 mV sont montrées Figure 17 C et la courbe courant-potentiel Figure 17 D. Notez que le pic de la courbe courant-potentiel se trouve à des potentiels hyperpolarisés par rapport à AmCaVl ou CaV2. Cette expérience démontre clairement l'expression des trois types de canaux calciques d'abeilles dans les ovocytes de Xénopes. The expression of these DNAs was obtained from a functional point of view, the substances to be tested were injected into the external medium, in the present example dissolved in Bant 10, and the effect of the substance on the channel. and the regulatory proteins is then registered. The effect of the test substance may be a decrease or increase of the barium stream, changes in other parameters related to the calcium channel: kinetics of the current or voltage-dependent activation or inactivation of the channel. Variations in these different elements are signs of a toxic effect on the entry of Ca 2+ . Thus, a variation / modification of these parameters makes it possible to identify potentially toxic compounds for bees. FIG. 9 represents the results obtained with the Cava (AmCaVal) and CaVa (AmCava2) calcium bee channels coexpressed with the CavP (AmCavPa) and Cava2-6 (AmCava2-ol) bee regulatory proteins in a functional manner in FIG. Xenopus oocytes. Conventional current-voltage curves are obtained. As regards the AmCaV3a bee channels, the CaVa2δ and CavP subunits not being necessary for its expression, their DNA / RNA was not injected. The current traces obtained during depolarization from -100 mV to -30 mV are shown in Figure 17 C and the current-potential curve Figure 17 D. Note that the peak of the current-potential curve is at hyperpolarized potentials with respect to AmCaVl or CaV2. This experiment clearly demonstrates the expression of the three types of bee calcium channels in Xenopus oocytes.
Après expression, 20 μΜ de permethrine, un pyréthrinoide connu comme insecticide, a été perfusé dans le milieu de culture de l'ovocyte exprimant les canaux calciques d'abeilles Cava (AmCaVal) et CaVa (AmCava2) co-exprimés avec les protéines régulatrices d'abeille CavP (AmCavPa) et Cava2-ô (AmCava2-ôl) de façon fonctionnelle et une observation des courants calciques a été réalisée telle que décrit ci- dessus. La figure 10 démontre clairement que les canaux calciques d'abeille sont sensibles à l'insecticide qui provoque une inhibition du courant calcique. After expression, 20 μl of permethrin, a pyrethroid insecticide, was perfused into the oocyte culture medium expressing the calcium channels of Cava bees (AmCaVal) and CaVa (AmCava2) coexpressed with the regulatory proteins of bee CavP (AmCavPa) and Cava2-δ (AmCava2-ol) in a functional manner and an observation of the calcium currents was carried out as described above. Figure 10 clearly demonstrates that bee calcium channels are sensitive to the insecticide that causes calcium current inhibition.
Cette expérience démontre clairement que le canal calcique d'abeille Cava, et les protéines CavP et Cava2-ôl isolés peuvent être utilisés afin de détecter des molécules toxiques et/ou déterminer la toxicité de molécule et/ou d'analyser la toxicité d'une molécule. This experiment clearly demonstrates that the Cava bee calcium channel, and the isolated CavP and Cava2-ol proteins can be used to detect toxic molecules and / or determine the molecule toxicity and / or to analyze the toxicity of a molecule. molecule.
En outre, cet exemple démontre clairement que le canal calcique d'abeille Cava, et les protéines CavP et Cava2-ôl isolées peuvent être utilisées afin de détecter une interaction entre le canal calcique d'abeille Cava, et les protéines CavP et Cava2-ôl et une molécule. In addition, this example clearly demonstrates that the Cava bee calcium channel, and the isolated CavP and Cava2-δ1 proteins can be used to detect an interaction between the Cava bee calcium channel, and the CavP and Cava2-ole proteins. and a molecule.
La figure 18 représente les résultats obtenus avec les canaux calciques d'abeille Cava (AmCaVal) et CaVa (AmCava2) co-exprimés avec les protéines régulatrices d'abeille CavP (AmCavPc) et Cava2-ô (AmCava2-ôl) et AmCaVcc3 de façon fonctionnelle dans des ovocytes de Xénopes. A. Les traces de courants en réponse à un protocole de «double puise » permettent de tester la disponibilité du canal à différents voltages. Une première dépolarisation conditionnante (de -100 à 30mV, et de 2.5s de durée) précède la dépolarisation test à +10mV (CaVl ou CaV2) ou -30 mV (CaV3) qui révèle les canaux disponibles. B. L'amplitude des courants enregistrés lors de cette dépolarisation pour les différentes dépolarisations conditionnantes est normalisée par rapport à leurs valeurs maximales, et portée sur un graphe avec le potentiel de la première dépolarisation en abscisse. Des courbes d'inactivation sont ainsi obtenues. C. Tableaux des paramètres typiques de ces courbes (Vin, K, R) pour les trois combinaisons de sous-unités obtenues par régression des courbes inactivations avec l'équation : FIG. 18 represents the results obtained with the Cava (AmCaVal) and CaVa (AmCava2) bee calcium channels coexpressed with the CavP (AmCavPc) and Cava2-δ (AmCava2-ol) and AmCaVcc3 bee regulatory proteins. functional in Xenopus oocytes. A. The current traces in response to a "double-tap" protocol make it possible to test the availability of the channel at different voltages. A first conditional depolarization (from -100 to 30mV, and 2.5s duration) precedes the test depolarization at + 10mV (CaV1 or CaV2) or -30mV (CaV3) which reveals the available channels. B. The amplitude of the currents recorded during this depolarization for the different conditioning depolarizations is normalized with respect to their maximum values, and carried on a graph with the potential of the first depolarization on the abscissa. Inactivation curves are thus obtained. C. Tables of the typical parameters of these curves (Vin, K, R) for the three combinations of subunits obtained by regression of the inactivation curves with the equation:
I / I max =R + (1 - R)/ (1 + exp ((V - Vin)/ k dans laquelle I était l'amplitude du courant mesuré pendant l'impulsion d'essai à +10 mV ou -30 mV (pour CaV3) pour un potentiel de conditionnement variant de -100 à 50 mV, Imax l'amplitude du courant maximum; Vin le potentiel de demi-inactivation; V le potentiel de conditionnement, k la pente, et R la proportion de canaux non-inactivés. En ce qui concerne les canaux AmCaV3a d'abeille, les sous-unités CaVa2d et Cav n'étant pas nécessaires à son expression, leur ADN/ARN n'a pas été injecté. On note l'inactivation pour des potentiels hyperpolarisés. I / I max = R + (1 - R) / (1 + exp ((V - V in ) / k where I was the amplitude of the current measured during the test pulse at +10 mV or -30 mV (for CaV3) for a conditioning potential varying from -100 to 50 mV, Imax the amplitude of the maximum current, Vi n the half-inactivation potential, V the conditioning potential, k the slope, and R the proportion of In the case of bee channels AmCaV3a, the CaVa2d and Cav subunits are not necessary for its expression, their DNA / RNA has not been injected. hyperpolarized potentials.
Cette expérience démontre clairement l'expression des trois types de canaux calciques d'abeilles dans les ovocytes de Xénopes. This experiment clearly demonstrates the expression of the three types of bee calcium channels in Xenopus oocytes.
Exemple 4 : Caractérisation de l'activité de la protéine d'abeille Cavp. Example 4 Characterization of the activity of the Cavp bee protein.
Abeilles larves, nymphes et adultes ont été anesthésiés par refroidissement à 4°C. L'ARN total a été extrait à l'aide RNeasy Mini kit (Qiagen) ou le réactif Trizol (Invitrogen). Premier brin d'ADNc a été obtenu à partir d'oligo-dT amorcées ARN total en utilisant le Superscript II de la transcriptase inverse (Invitrogen). H-CavPa et Am- Cavpb ADNc ont été amplifiés avec amb2-008S (SEQ ID NO 79) et amb2-007AS (SEQ ID NO 78), et avec les oligonucléotides amb2-006S (SEQ ID NO 77) et amb2-007AS (SEQ ID NO 78), respectivement, en utilisant l'Herculase polymérase II Fusion (Agilent Technologies). Les ADNc ont été clonés dans pBluescript (Agilent Technologies) et entièrement séquencés. L'analyse par réaction en chaîne polymérase-transcriptase inverse (RT-PCR) de l'expression de CavP dans différents tissus d'abeilles adultes a été réalisé avec les amorces amb2-003S (SEQ ID NO 75) et amb2-004AS (SEQ ID NO 76) qui amplifient un fragment del635-pb par la réaction de polymérisation en chaîne (PCR). L'analyse de l'expression par RT-PCR de CavPa et Cavpb au cours du développement d'abeilles a été réalisée avec les amorce amb2-003S (SEQ ID NO 75) et amb-013AS (CCTGCTGCCTCAGGGCCTCC (SEQ ID NO 99) et amb-014S (ATGATCGGATACAATCAACACAATTCCGG (SEQ ID NO 100) et AMB-013AS qui amplifient respectivement un fragment de 574 pb et un fragment de 391-pb. Am- PTF1 qui correspond à Am-CavPa tronqué de ses 78 premiers acides aminés qui a été obtenu par PCR avec les amorces amb-005SLarvae, nymphs and adults were anesthetized by cooling to 4 ° C. Total RNA was extracted using RNeasy Mini kit (Qiagen) or Trizol reagent (Invitrogen). First strand cDNA was obtained from total primed oligo-dT RNA using Superscript II reverse transcriptase (Invitrogen). H-CavPa and Am-Cavpb cDNA were amplified with amb2-008S (SEQ ID NO. 79) and amb2-007AS (SEQ ID NO. 78), and with oligonucleotides amb2-006S (SEQ ID NO. 77) and amb2-007AS ( SEQ ID NO: 78), respectively, using Herculase polymerase II Fusion (Agilent Technologies). The cDNAs were cloned into pBluescript (Agilent Technologies) and fully sequenced. Reverse polymerase reverse transcriptase (RT-PCR) chain reaction analysis of CavP expression in different adult bee tissues was performed with primers amb2-003S (SEQ ID NO. 75) and amb2-004AS (SEQ. ID No. 76) which amplify a del635-bp fragment by the polymerase chain reaction (PCR). RT-PCR expression analysis of CavPa and Cavpb during bee development was performed with the amb2-003S (SEQ ID NO. 75) and amb-013AS (CCTGCTGCCTCAGGGCCTCC (SEQ ID NO. amb-O14S (ATGATCGGATACAATCAACACAATTCCGG (SEQ ID NO: 100) and AMB-013AS which respectively amplify a fragment of 574 bp and a fragment of 391-pb.Am-PTF1 which corresponds to truncated Am-CavPa of its first 78 amino acids which has been obtained by PCR with amb-005S primers
(CCCTCGAGCCACCATGGGCTCGGCAGACTCGAACTAC (SEQ ID NO 101)), séquence Xhol et séquence Kosak) et amb-007AS. AM-pb-mut correspondant à Am- Cavpb muté sur quatre résidus dans son extrémité N-terminale a été obtenue par une PCR chevauchante de deux fragments amplifiés avec T7 (séquence présente dans pBluescript) et amb-016AS(CCCTCGAGCCACCATGGGCTCGGCAGACTCGAACTAC (SEQ ID NO: 101)), XhoI sequence and Kosak sequence) and amb-007AS. AM-pb-mut corresponding to Am-Cavpb mutated on four residues in its N-terminus was obtained by overlapping PCR of two amplified fragments with T7 (sequence present in pBluescript) and amb-016AS
(GAGCCCTGCGCGAATAGCTTGTTGGCGCCGGCATTGTGTTGATTGGCTCCG ATCATC (SEQ ID NO 102) et amb-015S(GAGCCCTGCGCGAATAGCTTGTTGGCGCCGGCATTGTGTTGATTGGCTCCG ATCATC (SEQ ID NO. 102) and amb-015S
(GATGATCGGAGCCAATCAACACAATGCCGGCGCCAACAAGCTATTCGCGC AGGGCTC (SEQ ID NO 103)) et amb-017AS(GATGATCGGAGCCAATCAACACAATGCCGGCGCCAACAAGCTATTCGCGC AGGGCTC (SEQ ID NO: 103)) and amb-017AS
(GAACAACGCCTTCTGCATCATGTCC (SEQ ID NO 104), respectivement. (GAACAACGCCTTCTGCATCATGTCC (SEQ ID NO. 104), respectively.
Toutes les constructions ont été vérifiées par séquençage. All constructs were verified by sequencing.
Anticorps Antibody
Anticorps polyclonaux de lapin ont été générés contre des peptides synthétiques correspondant aux extrémités N-terminale de AmCavPa (NH2- MSRQLRAERDHVSRC-CONH2 (SEQ ID NO 105)) ou à l'extrémité C terminale commune C (NH2-CRQQQDPRALNAI-COOH (SEQ ID NO 106)): Nt-Ab et Ct-Ab, respectivement. Les sérums ont été recueillis, et anticorps ont été purifiés par affinité contre le peptide ayant servi à l'immunisation. Leur spécificité a été vérifiée à l'aide d'un gel protéique (« Western Blot ») en utilisant des extraits cellulaires de cellules HEK 293 transfectées avec les deux variant d'épissages ou des tissus du cerveau des abeilles, et par immunofluorescence sur des cellules transfectées, ou des tranches de cerveau. Rabbit polyclonal antibodies were generated against synthetic peptides corresponding to the N-terminus of AmCavPa (NH2-MSRQLRAERDHVSRC-CONH2 (SEQ ID NO. 105)) or at the C-terminal common end (NH2-CRQQQDPRALNAI-COOH (SEQ ID No. 106)): Nt-Ab and Ct-Ab, respectively. Sera were collected, and antibodies were affinity purified against the peptide used for immunization. Their specificity was verified using a protein gel ("Western Blot") using cellular extracts of cells HEK 293 transfected with both splice variants or brain tissues of bees, and by immunofluorescence on transfected cells, or brain slices.
Électrophysiologie Des ovocytes de Xenopus ont été préparés et injectés in vitro avec de l'ARN transcrit (20-40 ni de mélange de CaV2.3 (Genbank No accession: X67855) + α2-δ (M86621) + / - AmCaVP ou CavP2a (M80545) ou Cavpib (X61394) à 1 μg/μl, stœchiométrie 1: 1: 1) comme déjà décrit dans Restituito S, Cens T, Barrere C, Geib S, Galas S, De Waard M, Charnet P (2000) The P2a subunit is a molecular groom for the Ca2+ channel inactivation gâte. J Neurosci 20:9046-9052 [11]. Des Cav2.1 (X57476) et Cav2.2 (D14157) de lapin ont également été utilisées. Des courants macroscopiques ont été enregistrées en voltage-imposé à deux électrodes et analysés dans la solution BANT10 d'enregistrement: (en mM): BaOH, 10; TEAOH, 20; NMDG, 50; CsOH, 2; HEPES, 10; pH 7,2 avec de l'acide méthanesulfonique. Les courants ont été filtrées (500 Hz) et numérisés (2 kHz) à l'aide d'une interface de Digidata-1200 (Axon Instruments). L'acquisition des données a été faite en utilisant la version 7 du logiciel pClamp (Axon Instruments). Environ 30 ni de BAPTA (en mM: BAPTA acide libre, 100; CsOH, 10; HEPES, 10; pH 7,2 CsOH) ont été injectés dans chaque ovocyte (10 psi, 150 ms) au début de l'enregistrement en utilisant une troisième électrode afin de minimiser la contamination par le courant Cl" activé par le Ca2+. Des courbes d'inactivation isochrones (2,5 s de potentiel de conditionnement suivies d'une dépolarisation test de 400 ms à +10 mV) ont été analysées à l'aide des équations suivantes: Electrophysiology Xenopus oocytes were prepared and injected in vitro with transcribed RNA (20-40 nor mixture of CaV2.3 (Genbank Accession # X67855) + α2-δ (M86621) + / - AmCaVP or CavP2a ( M80545) or Cavpib (X61394) at 1 μg / μl, 1: 1: 1 stoichiometry as already described in Restituito S, Cens T, Barrere C, Geib S, Galas S, De Waard M, Charnet P (2000) The P2a subunit is a molecular groom for the Ca 2+ channel inactivation spoils. J Neurosci 20: 9046-9052 [11]. Rabbit Cav2.1 (X57476) and Cav2.2 (D14157) were also used. Macroscopic currents were recorded at voltage-imposed two-electrode and analyzed in recording solution BANT10: (in mM): BaOH, 10; TEAOH, 20; NMDG, 50; CsOH, 2; HEPES, 10; pH 7.2 with methanesulfonic acid. The currents were filtered (500 Hz) and digitized (2 kHz) using a Digidata-1200 interface (Axon Instruments). The data acquisition was done using version 7 of the pClamp software (Axon Instruments). About 30 ul of BAPTA (in mM: BAPTA free acid, 100, CsOH, 10, HEPES, pH 7.2 CsOH) were injected into each oocyte (10 psi, 150 ms) at the start of the recording using a third electrode to minimize contamination by the Ca 2+ activated " Cl " current, and isochronous inactivation curves (2.5 s of conditioning potential followed by a test depolarization of 400 ms at + 10 mV) were were analyzed using the following equations:
I / I max =Rin + (1 - Rin)/ (1 + exp ((V - Vin)/ kin dans laquelle I était l'amplitude du courant mesuré pendant l'impulsion d'essai à +10 mV pour un potentiel de conditionnement variant de -80 à 50 mV; Imax l'amplitude du courant maximum; Vin le potentiel de demi-inactivation; V le potentiel de conditionnement, kin la pente, et Rin la proportion de canaux non-inactivés. La cinétique d'inactivation a été quantifiée comme R400, le rapport de l'amplitude du pic du courant sur l'amplitude du courant enregistrée à la fin d'une dépolarisation de 400ms. Les traces de courant ont été également définies à l'aide d'une équation bi-exponentielle donnant la valeur des constantes de temps d'inactivation lente et rapide (ôfast et ôslow), et l'amplitude relative de ôslow. Les courbes courant-voltage ont été définies à l'aide de l'équation suivante: I / I max = G x (V- Erev)/ ( 1 + exp ((V- Vact) / kact)) dans laquelle I est l'amplitude du courant mesuré pendant la dépolarisation variant de - 80 à +50 mV; Imax l'amplitude du courant maximum de la courbe courant-voltage; la conductance G normalisée macroscopique, Erev le potentiel d'inversion apparent extrapolé, Vact le potentiel de demi-activation, V la valeur de la dépolarisation et kact un facteur de pente. Pour les enregistrements en canal unique, la membrane vitelline ovocyte a été éliminée en utilisant une pince après immersion dans une solution hypertonique (200 mM NaCl, 10 mM de HEPES), et l'ovocyte a ensuite été placé dans la chambre d'enregistrement remplie d'une solution dépolarisante (100 mM KC1, 5 mM de HEPES, 10 mM d'EGTA, pH 7,2 ajusté avec du KOH; l'osmolarité à ~ 250 mosmol). Les pipettes de patch, une fois recouverte (coatée) (Sylgard ®) et polies avait une résistance de 8-12 ΜΩ, quand elles sont remplies avec une solution contenant 100 mM BaCl2, 5 mM de HEPES (pH 7,2 a été ajusté avec NaOH; ~ 290 mOsm). Les courants en cellules attachées été enregistrés avec un amplificateur Axo-patch 200B (Molecular Devices), filtrés à 2 kHz, et numérisé à 10 kHz en utilisant une interface Digidata 1200 et stockés sur un ordinateur en utilisant le logiciel Clampex. Les potentiels de jonction étaient de 1-3 mV et ont donc été négligés. Les courants ont été analysés avec le logiciel Clampfit (Molecular Devices). Les courants de fuites ont été soustraits au moyen de la commande de réglage manuel de Clampfit. Les ouvertures des canaux ont été détectées par un seuil fixé à 50% du courant. La conductance du canal et les constantes de temps d'ouverture ont été calculées à partir de régressions non linéaires effectuées sur les histogrammes d'amplitude et de temps ouvert obtenus à différents potentiels en utilisant des modèles gaussien et multi-exponentielle, respectivement. La Popen a été calculée en divisant le temps total que le canal passe à l'état ouvert sur le temps total d'enregistrement. Cette Popen a aussi été déterminée sur les phases précoce (Po précoce, premières 40 ms) ou tardive (Po tardive, dernières 40 ms) de chaque dépolarisation pendant 100 dépolarisations successives. La moyenne des Popen a été calculée à partir de ces 100 courbes consécutives. I / I max = R in + (1 - R in ) / (1 + exp ((V - V in ) / k in where I was the amplitude of the current measured during the test pulse at + 10 mV for a conditioning potential ranging from -80 to 50 mV, Imax the amplitude of the maximum current, Vi n the half-inactivation potential, V the conditioning potential, k in the slope, and R in the proportion of non-ion channels. Inactivation kinetics were quantified as R400, the ratio of peak current amplitude to current amplitude recorded at the end of a depolarization of 400 ms. of current were also defined using a bi-exponential equation giving the value of slow and fast inactivation time constants (δfast and ôslow), and the relative amplitude of ôslow. The current-voltage curves were defined using the following equation: I / I max = G x (V-E rev ) / (1 + exp ((V-V act ) / k act )) in which I is the magnitude of the current measured during depolarization ranging from -80 to +50 mV; Imax the amplitude of the maximum current of the current-voltage curve; the normalized macroscopic G conductance, E rev the apparent inversion potential extrapolated, V act the half-activation potential, V the depolarization value and k act a slope factor. For single-channel recordings, the oocyte vitelline membrane was removed using forceps after immersion in a hypertonic solution (200 mM NaCl, 10 mM HEPES), and the oocyte was then placed in the filled recording chamber of a depolarizing solution (100 mM KCl, 5 mM HEPES, 10 mM EGTA, pH 7.2 adjusted with KOH, osmolarity at ~ 250 mosmol). Patch pipettes, once coated (coated) (Sylgard ®) and polished had a resistance of 8-12 ΜΩ, when filled with a solution containing 100 mM BaCl 2 , 5 mM HEPES (pH 7.2 was adjusted with NaOH ~ 290 mOsm). The attached cell currents were recorded with an Axo-patch 200B (Molecular Devices) amplifier, filtered at 2 kHz, and digitized at 10 kHz using a Digidata 1200 interface and stored on a computer using Clampex software. The junction potentials were 1-3 mV and were therefore neglected. Currents were analyzed with Clampfit software (Molecular Devices). Leakage currents were subtracted by means of the manual Clampfit control. The openings of the channels were detected by a threshold set at 50% of the current. Channel conductance and open time constants were calculated from nonlinear regressions performed on amplitude and open time histograms obtained at different potentials using Gaussian and multi-exponential models, respectively. The Popen was calculated by dividing the total time that the channel goes to the open state over the total recording time. This Popen was also determined on the early (early Po, first 40 ms) or late (late Po, last 40 ms) phases of each depolarization during 100 successive depolarizations. The average of the Popen was calculated from these 100 consecutive curves.
Le test t de Student ou ANOVA a été utilisé pour tester les différences entre les valeurs moyennes. Toutes les valeurs sont des moyennes ± l'écart-type. Tranches de cerveau d'abeilles : des cerveaux d'abeilles domestiques ont été disséqués à 4°C dans du PBS supplémenté avec du paraformaldéhyde 4% et fixés dans la même solution pendant 2 h 30 min. Après rinçage dans du PBS, ils ont été successivement mis en incubation dans 15% et 30% de saccharose pendant respectivement 4 h et pendant la nuit. Des tranches de cerveau (25 μιη d'épaisseur) ont été faites et perméabilisées avec 0,1% de Triton-X100 dans du PBS et bloquées avec PBS-0,1% Triton X100 et 0,5% de sérum albumine de bovin (BSA) et 10% de sérum de chèvre normal (NGS). Elles ont ensuite été incubés pendant 2 h à température ambiante, à savoir 21°C +/-2°C avec l'anticorps Nt-Ab anticorps dilué au 1/1000 dans du PBS-0,1% de Triton X100 et 10% de NGS. Après lavage au PBS, la réaction a été bloquée avec PBS- 0,5% de BSA et 10% NGS. Dans le cas d'une révélation par immunofluorescence, des anticorps secondaires anti-lapin TRITC (AB-Cam, France) ont été appliqués au 1/100 pendant lh30 min dans du PBS-1%BSA. Après lavage dans du PBS, les tranches ont été montés dans du Mowiol-4-88 (Polysciences Inc, Warrington, PA) et observées au microscope. Dans le cas du système de détection à base de peroxydase, des anti-anticorps de lapin biotinylés (Vector Laboratories, USA) ont été appliqués au 1/500 dans du PBS NGS- 10%. Le kit VectaStain ABC (Vector Laboratories, USA) a été utilisé selon les recommandations du fabricant. Après rinçage dans du PBS, les coupes ont été incubées avec une solution de 3,3'-diaminobenzidine additionné de 3% de NiCl2. La réaction a été bloquée avec du PBS - 0,05% d'azide sodium, et les tranches ont été déshydratées par incubation successives dans des solutions d'éthanol (de 50% à 100%). Après rinçage avec du limonène, les tranches ont été montées en utilisant la solution Eukitt (Kindler GmbH et Co, Allemagne). The Student t test or ANOVA was used to test the differences between the mean values. All values are means ± standard deviation. Slices of bee brain: honeybee brains were dissected at 4 ° C in PBS supplemented with 4% paraformaldehyde and fixed in the same solution for 2 h 30 min. After rinsing in PBS, they were successively incubated in 15% and 30% sucrose for 4 h and overnight respectively. Slices of brain (25 μιη thick) were made and permeabilized with 0.1% Triton-X100 in PBS and blocked with PBS-0.1% Triton X100 and 0.5% bovine serum albumin ( BSA) and 10% normal goat serum (NGS). They were then incubated for 2 hours at room temperature, namely 21 ° C. ± 2 ° C. with the antibody Nt-Ab antibody diluted 1/1000 in PBS-0.1% Triton X100 and 10%. of NGS. After washing with PBS, the reaction was blocked with PBS-0.5% BSA and 10% NGS. In the case of immunofluorescence revelation, TRITC (AB-Cam, France) anti-rabbit secondary antibodies were applied 1/100 for 1 h 30 min in PBS-1% BSA. After washing in PBS, the slices were mounted in Mowiol-4-88 (Polysciences Inc., Warrington, PA) and observed under a microscope. In the case of the peroxidase-based detection system, biotinylated rabbit anti-antibodies (Vector Laboratories, USA) were applied at 1/500 in 10% PBS NGS. The VectaStain ABC kit (Vector Laboratories, USA) was used according to the manufacturer's recommendations. After rinsing in PBS, the sections were incubated with a solution of 3,3'-diaminobenzidine supplemented with 3% NiCl 2 . The reaction was blocked with PBS-0.05% sodium azide, and the slices were dehydrated by successive incubation in ethanol solutions (50% to 100%). After rinsing with limonene, the slices were mounted using the Eukitt solution (Kindler GmbH and Co, Germany).
Immunoblot : des cellules HEK293 ont été transfectées avec pCS4-AmCaVPa ou AmCaVpb obtenus comme décrit ci-dessus et cultivées pendant 48 h. Huit A. mellifera ont été anesthésiées à 4°C pendant 30 min, et l'antenne, le cerveau, les jambes, le thorax, l'abdomen et ont été recueillis. Les tissus d'abeille et les cellules HEK ont été lysées dans 50 mM de Tris pH = 7,2, NaCl 150 mM, EDTA 2 mM complété par un cocktail inhibiteur de la protéase (Complète, Roche Applied Sciences). Les cellules ont été ensuite centrifugées à 14000 tours par minutes à 4°C durant 15 minutes, et le surnageant a été soumis à un gel de protéine (Western Blot) en déposant 10μg/puits de protéines sur un gel à 10%, soumis à une migration pendant deux heures à 100V, puis un transfert de 1 heure à 100V à 4°C. On révèle l'expression de AmCaV en utilisant les anticorps Nt-Ab ou Ct-Ab dilué au 1/1000. Immunoblot: HEK293 cells were transfected with pCS4-AmCaVPa or AmCaVpb obtained as described above and cultured for 48 h. Eight A. mellifera were anesthetized at 4 ° C for 30 min, and the antenna, brain, legs, chest, abdomen and were collected. The bee tissues and the HEK cells were lysed in 50 mM Tris pH = 7.2, 150 mM NaCl, 2 mM EDTA supplemented with a protease inhibitor cocktail (Complete, Roche Applied Sciences). The cells were then centrifuged at 14,000 rpm at 4 ° C for 15 minutes, and the supernatant was subjected to a protein gel (Western Blot) by depositing 10 μg / well of protein on a 10% gel, subjected to a migration for two hours at 100V, then a transfer of 1 hour at 100V at 4 ° C. The expression of AmCaV is revealed using the Nt-Ab or Ct-Ab antibodies diluted 1/1000.
Dans cet exemple, les composés chimiques inhibiteurs ont été utilisés comme suit : Genistein (10 μΜ), la staurosporine (2 μΜ), H89 (2-50 uM), Wortmannin (10 μΜ), et LY294002 (10 μΜ) ont été ajoutés au milieu d'incubation 1-2 h avant les enregistrements. Le 2Br-palmitate a été injecté à 1 mM dans des ovocytes 4 h avant les enregistrements (concentration intra-ovocytaire calculée ~ 10 pM) et ajouté dans le milieu extérieur. L'alléthrine (20μΜ) a été soit ajoutée au milieu d'incubation 2 h avant les enregistrements, et/ou perfusée à cette concentration pendant les enregistrements. In this example, the inhibitory chemical compounds were used as follows: Genistein (10 μΜ), staurosporine (2 μΜ), H89 (2-50 μM), Wortmannin (10 μΜ), and LY294002 (10 μΜ) were added in the incubation medium 1-2 h before the recordings. 2Br-palmitate was injected at 1 mM into oocytes 4 h before the recordings (calculated intra-oocyte concentration ~ 10 μM) and added to the external medium. Allethrin (20μΜ) was either added to the incubation medium 2 h before the recordings, and / or perfused at this concentration during the recordings.
Pour les muscles et les neurones, les cultures ont été traitées avec Wortmannin ou H89 pendant 30-60 min avant les enregistrements via l'ajout dans le milieu de culture. Les courants ont été enregistrés sur quatre à dix cellules dans chaque condition et les R90 ou R400 ont été calculés et moyennés pour chaque situation. Tel que montré sur la figure 11 l'expression de CavP a été confirmé dans l'ensemble des larves et des pupes à différentes étapes de développement d'abeilles et dans les tissus nerveux et musculaires (Figure 11 A). Deux anticorps spécifiques dirigés contre l'extrémité N-terminale (Nt-Ab) de CavP et l'extrémité C-terminale commune (Ct-Ab) ont été produits et purifiés par affinité. Leurs spécificités ont été testées sur des cellules HEK293 exprimant AmCavPa ou le variant AmCavPb. Comme attendu, l'anticorps Ct- Ab a révélé deux espèces de ~ 70 et ~ 55 kDa dans respectivement les lysats cellulaire de cellules HEK 293 transfectées avec Am-CavPa et Am-Cavpb (Figure 11 B). Dans des extraits cellulaires de cerveaux des abeilles (Figure 11 B, colonne B), le Ct-Ab a révélé deux transcris migrant à 70 et 55 kDa correspondant aux variantes a et b. Fait intéressant, la bande de 70 kDa migre sous forme d'un doublet chez les abeilles. Ce doublet a également été observée avec le Nt-Ab anticorps, que le plus petit variant n'a pas été détecté (Figure 11 B). Dans les extraits de muscle (à partir de thorax, Figure 11 B, colonne T), la coloration par le Ct-Ab a été beaucoup plus faible, mais une bande principale à mobilité légèrement plus faible (c'est-à-dire supérieur à 70 kDa) était néanmoins visible. Cette bande a également été révélée par la coloration avec le Nt-Ab, mais des bandes supplémentaires de masses moléculaires inférieures et supérieures ont également été observées. Immunomarquage de coupes de cerveau axial avec Nt-Ab a confirmé la large expression de l'Am-CavP dans tout le cerveau, avec un marquage ponctuée de plusieurs structures telles que le complexe central, le lobe optique, le calice des corps pédonculés, ou les lobes antennaires (AL) (Figure 11 C), concordant avec l'existence de flux voltage-dépendants de Ca2+ dans les neurones de ces structures. Cette expression a été confirmée par analyse RT-PCR (donnée non fournie). En culture primaire de neurones à partir de lobes antennaires, des images d'immunofluorescence utilisant Ct-Ab ont montré une expression d'Am-CavP dans le soma et les dendrites (Figure 11 D). Dans les cellules musculaires, la coloration avec le Ct-Ab a révélé une localisation spécifique supplémentaire dans certains noyaux de la fibre (Figure 11 E) qui n'a pas été trouvée dans les neurones ou dans les cellules HEK293. For muscles and neurons, cultures were treated with Wortmannin or H89 for 30-60 min prior to recordings via addition into the culture medium. The currents were recorded on four to ten cells in each condition and the R90 or R400 were calculated and averaged for each situation. As shown in Figure 11 CavP expression was confirmed in all larvae and pupae at different stages of bee development and in nerve and muscle tissues (Figure 11A). Two specific antibodies directed against the N-terminus (Nt-Ab) of CavP and the common C-terminus (Ct-Ab) were produced and purified by affinity. Their specificities were tested on HEK293 cells expressing AmCavPa or AmCavPb variant. As expected, the Ct-Ab antibody revealed two ~ 70 and ~ 55 kDa species in respectively the cell lysates of HEK 293 cells transfected with Am-CavPa and Am-Cavpb (Figure 11B). In bee brain cell extracts (Figure 11B, column B), Ct-Ab revealed two transcripts migrating at 70 and 55 kDa corresponding to variants a and b. Interestingly, the 70 kDa band migrates as a doublet in bees. This doublet was also observed with the Nt-Ab antibody, as the smallest variant was not detected (Figure 11B). In muscle extracts (from thorax, Figure 11B, column T), Ct-Ab staining was much weaker, but a slightly weaker (ie superior) at 70 kDa) was nonetheless visible. This band was also revealed by staining with Nt-Ab, but additional bands of lower and higher molecular weights were also observed. Immunolabelling of axial brain slices with Nt-Ab confirmed the broad expression of Am-CavP throughout the brain, with punctuated markings of several structures such as the central complex, the optic lobe, the calyx of the pedunculate bodies, or antennal lobes (AL) (Figure 11C), concordant with the existence of voltage-dependent Ca2 + fluxes in the neurons of these structures. This expression was confirmed by RT-PCR analysis (data not provided). In primary culture of neurons from antennal lobes, immunofluorescence images using Ct-Ab showed expression of Am-CavP in soma and dendrites (Figure 11D). In muscle cells, staining with Ct-Ab revealed additional specific localization in some nuclei of the fiber (Figure 11E) that was not found in neurons or HEK293 cells.
Comme montré dans la figure 14, la co-expression dans des ovocytes de Xenopus de CavP d'abeille (Am-CavPa), de CaV2.3 et de CaVa2ô de lapin a augmenté l'amplitude du courant qui a plus que doublé (Figure 14 A), a déplacé la courbe courant-tension vers les potentiels hyperpolarisés, augmenté la pente d'activation, et a augmenté le pourcentage du courant non-inactivant dans les courbes d'inactivation isochrones (Figure 14 B et C). Les cinétiques d'activation et d'inactivation de courant ont également été modifiées. Le temps au pic du courant a été retardée de l4 ± l à 31 ± l ms (n = 60 et 150, sans ou avec la sous-unité Am-CavPa, respectivement, figure 14 B), et une forte diminution de l'inactivation a été enregistrée, ce qui conduit à une augmentation du courant restant en fin de dépolarisation par rapport au pic du courant (R400, Figure 14 B). Des résultats similaires ont également été trouvés lorsque CavP d'abeille (Am-Cavpb et Am-CavPc) ont été exprimées avec les canaux Cav2.1 ou CaV2.2. L'expression des variants b et c de la CavP d'abeille (AmCavPb et Am-CavPc) à la place de l'AmCavPa a également retardé l'activation et réduit l'inactivation (Figure 14 A et B et Figure 19 A et B). L'inactivation lente enregistrée avec ces trois variants rappelle l'effet de la sous-unité de rat CaVp2a (Fig. 15A), qui est connue pour ralentir l'inactivation du canal par une interaction, via le palmitate, avec la membrane plasmique et un site polybasique situé à la limite du domaine GK. Comme prévu, l'inactivation induite par CaVp2a lente a été accélérée par l'injection de 2Br-palmitate (un inhibiteur de la palmitoyle transférase). La CavP d'abeille (AmCavPa) a également été localisée à la membrane plasmique lorsqu'elle est exprimée seule dans des cellules HEK293 (Figure 15B), mais, à la différence de la sous-unité Cav 2a il n'existe pas de signal de palmitisation dans l'extrémité N-terminal du CavP d'abeille. L'analyse de la cinétique d'inactivation a démontré que, dans tous les cas, l'inactivation peut être décrite par la somme de deux composantes exponentielles. Dans le cas d'AmCavPa, l'inactivation tardive pourrait être clairement attribuée à un ralentissement de la composante rapide s'accompagnant d'une augmentation de la contribution de la composante lente (Figure 15D) alors que pour le CaVp2a de rat, le principal changement a été un ralentissement de la constante de temps lente d'inactivation (non représenté). En accord avec un mécanisme différent, l'inactivation lente induite par CavP d'abeille (AmCavPa) était insensible aux 2Br-palmitate (Figure 15C). Au niveau d'un canal unique, l'inactivation lente est clairement visible pour les canaux associés au CavP d'abeille (AmCavPa) et au CaVp2a de rat comme une persistance de la probabilité d'ouverture du canal au cours de la dépolarisation (Figure 15E et Popen Figure 15F), tout en ayant une grande différence dans les constantes de temps lentes d'ouverture des canaux CaV2.3 avec ces deux protéines (Figure 15F droite) confirmant que les mécanismes de régulation du canal sont différentes. As shown in FIG. 14, co-expression in Xenopus oocytes of rabbit Bee's CavP (Am-CavPa), CaV2.3 and CaVa2δ increased the amplitude of the current which more than doubled (FIG. 14A), shifted the current-voltage curve to the hyperpolarized potentials, increased the activation slope, and increased the percentage of the non-inactivating current in the isochronous inactivation curves (Figure 14 B and C). The kinetics of activation and inactivation of current have also been modified. The time at the peak of the current was delayed from 14 ± 1 ms to 31 ± 1 ms (n = 60 and 150, with or without the Am-CavPa subunit, respectively, Figure 14 B), and a sharp decrease in inactivation was recorded, which leads to an increase in the remaining end-of-depolarization current relative to the current peak (R400, Figure 14B). Similar results were also found when Bee CavP (Am-Cavpb and Am-CavPc) were expressed with Cav2.1 or CaV2.2 channels. The expression of the b and c variants of the Bee CavP (AmCavPb and Am-CavPc) in place of AmCavPa also delayed activation and reduced inactivation (Figure 14A and B and Figure 19A and B). The slow inactivation recorded with these three variants recalls the effect of the CaVp2a rat subunit (Fig. 15A), which is known to slow the inactivation of the channel by an interaction, via palmitate, with the plasma membrane and a polybasic site located at the boundary of the GK domain. As expected, slow CaVp2a induced inactivation was accelerated by injection of 2Br-palmitate (a palmitoyl transferase inhibitor). Bee CavP (AmCavPa) has also been localized to the plasma membrane when expressed alone in HEK293 cells (Figure 15B), but, unlike the Cav 2a subunit, there is no signal of palmitization in the N-terminal end of the bee CavP. Analysis of the inactivation kinetics has shown that in all cases the inactivation can be described by the sum of two exponential components. In the case of AmCavPa, late inactivation could be clearly attributed to a slowdown of the fast component accompanied by an increase in the contribution of the slow component (Figure 15D) while for rat CaVp2a, the main change was a slowdown in the slow time constant of inactivation (not shown). According to a different mechanism, the slow inactivation induced by bee CavP (AmCavPa) was insensitive to 2Br-palmitate (FIG. 15C). At the single-channel level, slow inactivation is clearly visible for the channels associated with rat CavP (AmCavPa) and rat CaVp2a as a persistence of the probability of channel opening during depolarization (Figure 15E and Popen Figure 15F), while having a large difference in the slow opening time constants CaV2.3 channels with these two proteins (Figure 15F right) confirming that the mechanisms of regulation of the channel are different.
Plusieurs régulateurs potentiels de l'activité des canaux ont été également testés. Différents lots d'ovocytes ont donc été incubées avec des inhibiteurs de tyrosine kinases (génistéine, 10 μΜ), de sérine/thréonine kinases (staurosporine, 10 μΜ ou H89, 50 μΜ) ou des phosphoinositides kinases (PI3K) (Wortmannin, 10 μΜ, ou LY294002, 10 μΜ), et l'inactivation des courants Ba2+ a été analysée dans ces différentes conditions. Les canaux contenant la CavP d'abeille (AmCavPa) sont clairement sensibles aux inhibiteurs de PI3K, la Wortmannine et LY294002 (W, L, Figure 16 A), tout en étant insensible ou peu sensible aux inhibiteurs de tyrosine et Sérine/thréonine kinases, à savoir la génistéine, la staurosporine ou le H89, respectivement (G, S, H, Figure 16 A). Par contre Les canaux contenant la CavP d'abeille (AmCavpb) sont eux clairement sensibles aux inhibiteurs de tyrosine et Sérine/thréonine kinases, (la génistéine, la staurosporine ou le H89, respectivement: G, S, H, Figure 16 A), alors qu'ils sont insensibles aux inhibiteurs de la PDkinase (W et L). Dans des cultures de neurones d'abeilles (Figure 16 B), ainsi que dans les cellules musculaires fraîchement dissociées (Figure 16 C), un courant Ca2+ à haut seuil a pu être enregistré. Dans les deux cas, l'inactivation de ces courants est sensible à Wortmannin et H89. En collaboration avec l'analyse par Western blot (Figure 11 A), ceci confirme l'expression fonctionnelle des deux variants de CavP d'abeille dans les neurones et les muscles abeilles. Several potential regulators of channel activity were also tested. Different lots of oocytes were therefore incubated with inhibitors of tyrosine kinases (genistein, 10 μΜ), serine / threonine kinases (staurosporine, 10 μΜ or H89, 50 μΜ) or phosphoinositide kinases (PI3K) (Wortmannin, 10 μΜ , or LY294002, 10 μΜ), and the inactivation of Ba 2+ currents was analyzed under these different conditions. Channels containing Bee CavP (AmCavPa) are clearly sensitive to PI3K inhibitors, Wortmannine and LY294002 (W, L, Figure 16A), while being insensitive or insensitive to tyrosine and serine / threonine kinase inhibitors, at namely genistein, staurosporin or H89, respectively (G, S, H, Figure 16 A). On the other hand, the channels containing the Bee CavP (AmCavpb) are clearly sensitive to the tyrosine and serine / threonine kinase inhibitors (genistein, staurosporin or H89, respectively: G, S, H, Figure 16 A), while they are insensitive to inhibitors of PDkinase (W and L). In cultures of bee neurons (Figure 16B), as well as in freshly dissociated muscle cells (Figure 16C), a high-threshold Ca 2+ current could be recorded. In both cases, the inactivation of these currents is sensitive to Wortmannin and H89. In collaboration with Western blot analysis (Figure 11A), this confirms the functional expression of both bee CavP variants in bee neurons and muscles.
La Figure 19C montre que la co-expression de AmCaVPc avec la sous-unité AmCaV3 ne modife ni l'amplitude ni les cinétiques du canal, suggérant que l'association fonctionnelle entre CaV3 et Cavp, si elle existe, ne modifie pas ces paramètres. Figure 19C shows that the coexpression of AmCaVPc with the AmCaV3 subunit neither modulates the amplitude nor the kinetics of the channel, suggesting that the functional association between CaV3 and Ca v p, if it exists, does not modify these settings.
Des expériences similaires ont été réalisées avec des cellules de Xenope co-exprimant le canal CaV2.2, le CaVa2ô de lapin avec un CavP d'abeille (Am-CavPa ou Am-CavPa) après incubation ou non (H20) avec de l'AUéthrine (Allet). Comme montré sur la figure 13, l'AUéthrine diminue l'amplitude des courants des canaux calciques en présence du CavP d'abeille et montrent un rôle régulateur de Am-Cav (variant a ou b) sur le blocage des canaux par l'allethrine. Enfin la figure 20 montre les effets de la co-expression de chacune des sous-unités CaVa2ôl, CaVa2ô2 ou CaVa2ô3 avec AmCaV2 et AmCaVPc sur l'amplitude et la voltage dépendance des courants calciques. En A, traces enregistrées sur des ovocytes exprimant chacune de ces combinaisons en réponse à des dépolarisations de -lOOmV à +10 mV et 400ms de durée. B. Courbes courant-voltage pour chacune de ces combinaisons en réponses à des dépolarisations de -100 à +50 mV par incrément de 10 mV. Noter le déplacement vers des potentiels hyperpolarisés de la combinaison avec AmCaVa2ô2. C : paramètres spécifiques de chacune de ces courbes : Vac, k, Erev, définis tel que plus haut. Ces différences de propriétés justifient l'emploi des sous- unités d'abeille pour les tests pharmacologiques. Cette expérience démontre clairement que le canal calcique d'abeille Cava, et les protéines CavP et Cava2-ôl isolés peuvent être utilisés afin de détecter des molécules toxiques et/ou déterminer la toxicité de molécule et/ou d'analyser la toxicité d'une molécule. En outre cet exemple démontre clairement que le canal calcique d'abeille Cava, et les protéines CavP et Cava2-ôl isolés peuvent être utilisés afin de détecter une interaction entre le canal calcique d'abeille Cava, et les protéines CavP et Cava2-ôl et une molécule. Similar experiments were performed with Xenope cells co-expressing the CaV2.2 channel, rabbit CaVa2δ with a Bee CavP (Am-CavPa or Am-CavPa) after incubation or not (H 2 0) with AUethrin (Allet). As shown in FIG. 13, AUethrin decreases the amplitude of the calcium channel currents in the presence of the Bee CavP and shows a regulatory role of Am-Cav (variant a or b) on the blocking of the channels by allethrin. . Finally, FIG. 20 shows the effects of the co-expression of each of the CaVa2O1, CaVa2O2 or CaVa2O3 subunits with AmCaV2 and AmCaVPc on the amplitude and voltage dependence of the calcium currents. In A, traces recorded on oocytes expressing each of these combinations in response to depolarizations of -100 mV to +10 mV and 400 ms duration. B. Current-voltage curves for each of these combinations in response to depolarizations of -100 to +50 mV in increments of 10 mV. Note the shift to hyperpolarized potentials of the combination with AmCaVa2O2. C: specific parameters of each of these curves: Vac, k, Erev, defined as above. These differences in properties justify the use of bee subunits for pharmacological tests. This experiment clearly demonstrates that the Cava bee calcium channel, and the isolated CavP and Cava2-ol proteins can be used to detect toxic molecules and / or determine the molecule toxicity and / or to analyze the toxicity of a molecule. molecule. Furthermore this example clearly demonstrates that the Cava bee calcium channel, and the isolated CavP and Cava2-ol proteins can be used to detect an interaction between the Cava bee calcium channel, and the CavP and Cava2-δl proteins and a molecule.
Liste de références List of references
1. Suchail et al., "Discrepancy between acute and chronic toxicity induced by imidacloprid and its metabolites in Apis mellifera." Environ Toxicol Chem Vol 20 No 11 November 2001 pp. 2482-6. 1. Suchail et al., "Discrepancy between acute and chronic toxicity induced by imidacloprid and its metabolites in Apis mellifera." About Toxicol Chem Vol 20 No 11 November 2001 pp. 2482-6.
2. Kadala,A., Charreton,M., Le Conte,Y., Jakob,L, and Collet,C. (2010). Pyrethroids alter sodium channel gating in honeybee olfactory receptor neurons. Chem2. Kadala, A., Charreton, M., The Tale, Y., Jakob, L, and Collet, C. (2010). Pyrethroids alter sodium channel gating in honeybee olfactory receptor neurons. Chem
Sensés 36, E61. Sense 36, E61.
3. Ray,D.E. and FryJ.R. (2006). A reassessment of the neurotoxicity of pyrethroid insecticides. Pharmacol.Ther. 111, 174-193. 3. Ray, D.E. and FryJ.R. (2006). A reassessment of the neurotoxicity of pyrethroid insecticides. Pharmacol.Ther. 111, 174-193.
4. Catterall,W.A. (2000). Structure and régulation of voltage-gated Ca2+ channels. Annu.Rev.Cell Dev.Biol. 16, 521-555. 4. Catterall, W.A. (2000). Structure and regulation of voltage-gated Ca2 + channels. Annu.Rev.Cell Dev.Biol. 16, 521-555.
5. Grunewald,B. (2003). Differential expression of voltage-sensitive K+ and Ca2+ currents in neurons of the honeybee olfactory pathway. J.Exp.Biol. 206, 117-129. 5. Grunewald, B. (2003). Differential expression of voltage-sensitive K + and Ca2 + currents in the neurons of the honeybee olfactory pathway. J.Exp.Biol. 206, 117-129.
6. Weinstock,G.M., Robinson G.E., Gibbs,R.A., and et al. (2006). Insights into social insects from the génome of the honeybee Apis mellifera. Nature 443, 931-949. 7. http://www.promega.com/vectors/mammalian_express_vectors.htm. 8. http///wwwqiagen.com 6. Weinstock, GM, GE Robinson, Gibbs, RA, et al. (2006). Insights into social insects from the genome of the honeybee Apis mellifera. Nature 443, 931-949. 7. http://www.promega.com/vectors/mammalian_express_vectors.htm. 8. http /// wwwqiagen.com
9. WO 83/004261. 9. WO 83/004261.
10. Restituito S, Cens T, Barrere C, Geib S, Galas S, De Waard M, Charnet P (2000) The P2a subunit is a molecular groom for the Ca2+ channel inactivation gâte. J Neurosci 20:9046-9052 10. Restituito S, Cens T, Barrere C, Geib S, Galas S, De Waard M, Charnet P (2000) The P2a subunit is a molecular groom for the Ca2 + channel inactivation pattest. J Neurosci 20: 9046-9052
11. Guide to Molecular Cloning Techniques, Editeurs Berger SL et Kimmel AR, Methods in Enzymology, vol. 152 11. Guide to Molecular Cloning Techniques, Editors Berger SL and Kimmel AR, Methods in Enzymology, vol. 152
12. Molecular Cloning, A Laboratory Manual [REF = Molecular Cloning, A Laboratory Manual Editeurs Green MR et Sambrook J., Cold Spring Harbor Laboratory Press 12. Molecular Cloning, A Laboratory Manual [REF = Molecular Cloning, A Laboratory Manual Editors Green MR and Sambrook J., Cold Spring Harbor Laboratory Press
13. Electrophysiologie moléculaire 2001 Ed. M. Joffre, collection enseignement de sciences, Herman 13. Molecular Electrophysiology 2001 Ed. M. Joffre, Science Education Collection, Herman
14. Microelectrode techniques, The Plymouth Workshop Handbook 1988, Ed. N.B. Standen, P.T.A Gray and M.J. Whitaker, The Company of Biologists Limited ou Single Channel recording 1983 Ed. B. Sackmann and E Neher. Plénum Press, New York 14. Microelectrode Techniques, The Plymouth Workshop Handbook 1988, Ed. N.B. Standen, P.T.A Gray and M.J. Whitaker, The Company of Biologists Limited or Single Channel Recording 1983 Ed B. Sackmann and E Neher. Plenum Press, New York
15. Calcium Measurement Methods, 2010 Ed Alexei, Verkhratsky; Petersen, Ole H. Séries: Neuromethods, vol. 43 Humana Press. 15. Calcium Measurement Methods, 2010 Ed Alexei, Verkhratsky; Petersen, Ole H. Series: Neuromethods, vol. 43 Humana Press.
16. Schlenstedt J., Balfanz S., Baumann A. & Blenau W. Am5-HT7 : Molecular and pharmacological characterization of the first serotonin receptor of the honeybee (Apis mellifera). J. Neurochem, 98 : 1958-1998 16. Schlenstedt J., Balfanz S., Baumann A. & Blenau W. Am5-HT7: Molecular and pharmacological characterization of the first serotonin receptor of the honeybee (Apis mellifera). J. Neurochem, 98: 1958-1998
17. Moignot B., Lemaire C, Quinchard S., Lapied B. & Legros C. The discovery of a novel sodium channel in the cockroach Periplaneta americana : Evidence for an early duplication of the para-like gene. Insect Biochem and Mol. Biol. 39 : 814-823 https://www.lifetechnologies.com 17. Moignot B., Lemaire C, Quinchard S., Lapied B. & Legros C. The discovery of a novel sodium channel in the cockroach Periplaneta americana: Evidence for an early duplication of the para-like gene. Insect Biochem and Mol. Biol. 39: 814-823 https://www.lifetechnologies.com

Claims

REVENDICATIONS
1. Canal calcique isolé d'abeille comprenant une sous-unité Caval de séquence choisie dans le groupe comprenant les séquences SEQ ID n° 1 à 3. An isolated bee calcium channel comprising a Caval subunit of a sequence selected from the group consisting of SEQ ID NO: 1 to 3.
2. Canal calcique isolé d'insecte pollinisateur Cavl comprenant la séquence SEQ ID NO : 1 ou un variant de celle-ci consistant en une séquence d'acides aminés de moins de 2000 acides aminés et ayant au moins 99% d'identité avec SEQ ID NO : 1. 2. Isolated Cavl pollinating insect calcium channel comprising the sequence SEQ ID NO: 1 or a variant thereof consisting of an amino acid sequence of less than 2000 amino acids and having at least 99% identity with SEQ ID NO: 1.
3. Canal calcique isolé d'insecte pollinisateur Cav2 comprenant une sous-unité de séquence SEQ ID NO: 2 ou un variant de celle-ci consistant en une séquence d'acides aminés de moins de 1900 acides aminés et ayant au moins 99% d'identité avec la SEQ ID NO: 2. 3. Isolated calcium channel of pollinating insect Cav2 comprising a subunit of sequence SEQ ID NO: 2 or a variant thereof consisting of an amino acid sequence of less than 1900 amino acids and having at least 99% d identity with SEQ ID NO: 2.
4. Canal calcique isolé d'insecte pollinisateur comprenant une sous-unité Cav3 de séquence SEQ ID NO: 3 ou un variant de celle-ci consistant en une séquence d'acides aminés ayant au moins 92% d'identité avec la SEQ ID NO: 3. 4. Isolated pollinator insect calcium channel comprising a Cav3 subunit of sequence SEQ ID NO: 3 or a variant thereof consisting of an amino acid sequence having at least 92% identity with SEQ ID NO : 3.
5. Canal calcique selon la revendication 1 comprenant en outre au moins une protéine régulatrice choisie parmi une protéine régulatrice Cava2-ô de séquence choisie dans le groupe comprenant la séquence SEQ ID NO 6 à 8 et/ou une protéine régulatrice Cavp de séquence choisie dans le groupe comprenant la séquence SEQ ID n° 4, 5 et 107. 5. Calcium channel according to claim 1 further comprising at least one regulatory protein selected from a Ca v a2-δ regulatory protein of sequence selected from the group consisting of the sequence SEQ ID No. 6 to 8 and / or a regulatory protein Ca v p of sequence chosen from the group comprising the sequence SEQ ID No. 4, 5 and 107.
6. Canal calcique isolé d'insecte pollinisateur selon l'une quelconque des revendications 1 à 4 comprenant en outre au moins une protéine régulatrice Cava2-ôl comprenant la séquence SEQ ID NO : 6 ou un variant de celle-ci consistant en une séquence d'acides aminés ayant au moins 99% d'identité avec la SEQ ID NO: 6 et/ou une protéine régulatrice Cava2-ô2 comprenant la séquence6. Insect pollinator isolated calcium channel according to any one of claims 1 to 4 further comprising at least one Ca v a2-δ1 regulatory protein comprising the sequence SEQ ID NO: 6 or a variant thereof consisting of amino acid sequence having at least 99% identity with SEQ ID NO: 6 and / or a Ca v a2-δ2 regulatory protein comprising the sequence
SEQ ID NO : 7 ou un variant de celle-ci consistant en une séquence d'acides aminés ayant au moins 99% d'identité avec la SEQ ID NO: 7 et/ou une protéine régulatrice Cava2-ô3 comprenant la séquence SEQ ID NO : 8 ou un variant de celle-ci consistant en une séquence d'acides aminés ayant au moins 99% d'identité avec la SEQ ID NO: 8. SEQ ID NO: 7 or a variant thereof consisting of an amino acid sequence having at least 99% identity with SEQ ID NO: 7 and / or a Ca v a2-δ3 regulatory protein comprising SEQ sequence ID NO: 8 or a variant of this consisting of an amino acid sequence having at least 99% identity with SEQ ID NO: 8.
7. Canal calcique selon la revendication 5, comprenant un canal Caval, une protéine régulatrice Cava2-ô et une protéine régulatrice Cavp. The calcium channel of claim 5 comprising a Caval channel, a Ca v a2 -δ regulatory protein and a Ca v p regulatory protein.
8. Canal calcique isolé d'insecte pollinisateur selon l'une quelconque des revendications 1 à 6 comprenant en outre au moins une protéine régulatrice Cav a comprenant la séquence SEQ ID NO : 4 ou un variant de celle-ci consistant en une séquence d'acides aminés ayant au moins 99% d'identité avec la SEQ ID NO: 4 et/ou une protéine régulatrice Cav b comprenant SEQ ID NO : 5 ou un variant de celle-ci consistant en une séquence d'acides aminés ayant au moins 99% d'identité avec la SEQ ID NO: 5 et/ou une protéine régulatrice Cav c comprenant SEQ ID NO : 107 ou un variant de celle-ci consistant en une séquence d'acides aminés ayant au moins 99% d'identité avec la SEQ ID NO: 107. 8. Insect pollinator isolated calcium channel according to any one of claims 1 to 6 further comprising at least one regulatory protein Cav a comprising the sequence SEQ ID NO: 4 or a variant thereof consisting of a sequence of amino acids having at least 99% identity with SEQ ID NO: 4 and / or a regulatory protein Cav b comprising SEQ ID NO: 5 or a variant thereof consisting of an amino acid sequence having at least 99 % identity with SEQ ID NO: 5 and / or a Cav c regulatory protein comprising SEQ ID NO: 107 or a variant thereof consisting of an amino acid sequence having at least 99% identity with the SEQ ID NO: 107.
9. Acide nucléique codant pour un canal Caval et/ou une protéine régulatrice Cava2- δ et/ou une protéine régulatrice Cavp telle(s) que définies selon l'une quelconque des revendications 1 à 8. 9. Nucleic acid encoding a Caval channel and / or a Ca v a2-δ regulatory protein and / or a Ca v p regulatory protein as defined in any one of Claims 1 to 8.
10. Acide nucléique codant pour le canal calcique Cavl comprenant SEQ ID NO : 9 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 6000 paires de bases (pb) et ayant au moins 99% d'identité avec SEQ ID NO: 9. 10. A nucleic acid encoding the Cav1 calcium channel comprising SEQ ID NO: 9 or a variant thereof consisting of a nucleic acid sequence of less than 6,000 base pairs (bp) and having at least 99% identity. with SEQ ID NO: 9.
11. Acide nucléique codant pour le canal calcique Cav2 comprenant SEQ ID NO: 10 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 5500 pb, plus de 600 pb et ayant au moins 99% d'identité avec SEQ ID NO: 10. 11. A nucleic acid encoding the Cav2 calcium channel comprising SEQ ID NO: 10 or a variant thereof consisting of a nucleic acid sequence of less than 5,500 bp, greater than 600 bp and having at least 99% identity. with SEQ ID NO: 10.
12. Acide nucléique codant pour le canal calcique Cav3 comprenant SEQ ID NO: 11 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 7800 pb et ayant au moins 91 % d'identité avec SEQ ID NO: 11. 12. A nucleic acid encoding the Cav3 calcium channel comprising SEQ ID NO: 11 or a variant thereof consisting of a nucleic acid sequence of less than 7800 bp and having at least 91% identity with SEQ ID NO: 11.
13. Acide nucléique codant pour la sous-unité régulatrice Cava2ôl comprenant SEQ ID NO: 15 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 pb et ayant au moins 99% d'identité avec SEQ ID NO: 15. A nucleic acid encoding the Cava2δ1 regulatory subunit comprising SEQ ID NO: 15 or a variant thereof consisting of a nucleic acid sequence of less than 4000 bp and having at least 99% identity with SEQ ID NO: 15.
14. Acide nucléique codant pour la sous-unité régulatrice Cava2ô2 comprenant SEQ ID NO: 16 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 pb, plus de 500 pb et ayant au moins 99% d'identité avec SEQ ID NO: 16. 14. A nucleic acid encoding the regulatory subunit Cava2O2 comprising SEQ ID NO: 16 or a variant thereof consisting of a nucleic acid sequence of less than 4000 bp, greater than 500 bp and having at least 99% d identity with SEQ ID NO: 16.
15. Acide nucléique codant pour la sous-unité régulatrice Cava2ô3 comprenant SEQ ID NO: 17 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 4000 pb et ayant au moins 99% d'identité avec SEQ ID NO: 17. 15. A nucleic acid encoding the Cava2δ3 regulatory subunit comprising SEQ ID NO: 17 or a variant thereof consisting of a nucleic acid sequence of less than 4000 bp and having at least 99% identity with SEQ ID NO: 17.
16. Acide nucléique codant pour la sous-unité régulatrice CavPa comprenant SEQ ID NO: 12 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 2000 pb et ayant au moins 99% d'identité avec SEQ ID NO: 12. A nucleic acid encoding the CavPa regulatory subunit comprising SEQ ID NO: 12 or a variant thereof consisting of a nucleic acid sequence of less than 2000 bp and having at least 99% identity with SEQ ID NO: 12.
17. Acide nucléique codant pour la sous-unité régulatrice Cavpb comprenant décrite dans SEQ ID NO: 13 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 1500 pb et ayant au moins 99% d'identité avec SEQ ID NO: 13. A nucleic acid encoding the Cavpb regulatory subunit comprising comprising SEQ ID NO: 13 or a variant thereof consisting of a nucleic acid sequence of less than 1500 bp and having at least 99% identity with SEQ ID NO: 13.
18. Acide nucléique codant pour la sous-unité régulatrice CavPc comprenant dans SEQ ID NO: 14 ou un variant de celle-ci consistant en une séquence d'acide nucléique de moins de 2000 pb et ayant au moins 99% d'identité avec SEQ ID18. A nucleic acid encoding the CavPc regulatory subunit comprising in SEQ ID NO: 14 or a variant thereof consisting of a nucleic acid sequence of less than 2000 bp and having at least 99% identity with SEQ ID
NO: 14. NO: 14.
19. Vecteur comprenant au moins un acide nucléique selon l'une quelconque des revendications 9 à 18. Vector comprising at least one nucleic acid according to any one of claims 9 to 18.
20. Cellule transformée comprenant au moins une séquence d'acide nucléique selon l'une quelconque des revendications 9 à 18 ou un vecteur selon la revendication 19. 20. Transformed cell comprising at least one nucleic acid sequence according to any one of claims 9 to 18 or a vector according to claim 19.
21. Cellule transformée exprimant un canal selon l'une quelconque des revendications 1 à 8 ou un vecteur selon la revendication 19. A transformed cell expressing a channel according to any one of claims 1 to 8 or a vector according to claim 19.
22. Procédé de fabrication d'un canal calcique selon l'une quelconque des revendications 1 à 8 par recombinaison génétique utilisant un acide nucléique selon l'une quelconque des revendications 9 à 18 ou un vecteur selon la revendication 19. A method of manufacturing a calcium channel according to any one of claims 1 to 8 by genetic recombination using a nucleic acid according to any one of claims 9 to 18 or a vector according to claim 19.
23. Procédé de détermination de la toxicité d'une molécule et/ou de détection d'une molécule toxique et/ou d'analyse de la toxicité d'une molécule comprenant : une étape d'analyse électrophysiologique et/ou d'imagerie calcique comprenant la mise en contact de ladite molécule avec un canal selon l'une quelconque des revendications 1 à 8 ou avec une cellule transformée selon la revendication 20 ou 21. 23. A method for determining the toxicity of a molecule and / or detecting a toxic molecule and / or analyzing the toxicity of a molecule comprising: a step of electrophysiological analysis and / or calcium imaging comprising contacting said molecule with a channel according to any one of claims 1 to 8 or with a transformed cell according to claim 20 or 21.
24. Utilisation d'un canal calcique tel que défini dans l'une quelconque des revendications 1 à 8 pour la détermination de l'interaction moléculaire entre ledit canal et une molécule. 24. Use of a calcium channel as defined in any one of claims 1 to 8 for determining the molecular interaction between said channel and a molecule.
25. Procédé in vitro pour déterminer l'effet d'un composé test sur l'activité d'un canal calcique d'un insecte pollinisateur, comprenant: a. la mise en contact des cellules transformées selon la revendication 25. In vitro method for determining the effect of a test compound on the activity of a calcium channel of a pollinating insect, comprising: a. bringing the transformed cells into contact according to the claim
20 ou 21, avec un composé test,  20 or 21, with a test compound,
b. mesurer l'effet dudit composé sur l'activité du canal calcique, et comparer l'effet dudit composé à l'effet d'un composé contrôle ou une solution de véhicule, en déterminant ainsi une activité de modulation du canal calcique.  b. measuring the effect of said compound on the activity of the calcium channel, and comparing the effect of said compound with the effect of a control compound or a vehicle solution, thereby determining a calcium channel modulation activity.
26. Procédé selon la revendication 20, pour déterminer la toxicité d'un composé test sur un insecte pollinisateur. 26. The method of claim 20 for determining the toxicity of a test compound on a pollinating insect.
27. Procédé in vitro de criblage de composés qui modulent l'activité du canal calcique d'un insecte pollinisateur comprenant: a. la mise en contact des cellules transformées selon la revendication 20 ou 21, avec un composé test, 27. In vitro method for screening compounds that modulate the calcium channel activity of a pollinating insect comprising: at. bringing the transformed cells of claim 20 or 21 into contact with a test compound,
b. la mesure de l'effet dudit composé test sur l'activité du canal calcique, et comparer l'effet dudit composé test à l'effet d'un composé contrôle ou une solution de véhicule, en classant ainsi ledit composé en tant que bloqueur de canal calcique, activateur du canal calcique, modificateur de déclenchement  b. measuring the effect of said test compound on calcium channel activity, and comparing the effect of said test compound with the effect of a control compound or a vehicle solution, thus classifying said compound as a blocker of calcium channel, calcium channel activator, trigger modifier
Kit comprenant au moins un vecteur selon la revendication 19 ou une cellule transformée selon la revendication 20 ou 21 et des réactifs. Kit comprising at least one vector according to claim 19 or a transformed cell according to claim 20 or 21 and reagents.
PCT/FR2014/050749 2013-03-28 2014-03-28 Bee calcium channel and uses WO2014155021A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FR1352795 2013-03-28
FR1352795A FR3003863B1 (en) 2013-03-28 2013-03-28 BEE CALCIUM CHANNEL AND USES THEREOF

Publications (1)

Publication Number Publication Date
WO2014155021A1 true WO2014155021A1 (en) 2014-10-02

Family

ID=48613930

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/FR2014/050749 WO2014155021A1 (en) 2013-03-28 2014-03-28 Bee calcium channel and uses

Country Status (2)

Country Link
FR (1) FR3003863B1 (en)
WO (1) WO2014155021A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3040345A1 (en) * 2014-12-31 2016-07-06 Centre National de la Recherche Scientifique (CNRS) Sodium channel subunits of pollinator insects and uses thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1983004261A1 (en) 1982-06-02 1983-12-08 Elf Bio-Recherches New cloning and expression vector, yeast transformed by such vector and applications thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1983004261A1 (en) 1982-06-02 1983-12-08 Elf Bio-Recherches New cloning and expression vector, yeast transformed by such vector and applications thereof

Non-Patent Citations (38)

* Cited by examiner, † Cited by third party
Title
"collection enseignement de sciences", 2001, HERMAN
"Electrophysiologie moléculaire", 2001, HERMAN
"Guide to Molecular Cloning Techniques", vol. 152
"Guide to Molecular Cloning Techniques", vol. 152, article "Methods in Enzymology"
"Microelectrode techniques, The Plymouth Workshop Handbook", 1988, THE COMPANY OF BIOLOGISTS LIMITED
"Molecular Cloning, A Laboratory Manual", COLD SPRING HARBOR LABORATORY PRESS
"Neuromethods", vol. 43, 2010, HUMANA PRESS, article "Calcium Measurement Methods"
"Single Channel recording", 1983, PLENUM PRESS
"The Plymouth Workshop Handbook", 1988
CATTERALL,W.A.: "Structure and regulation of voltage-gated Ca2+ channels", ANNU.REV.CELL DEV.BIOL., vol. 16, 2000, pages 521 - 555, XP002313942, DOI: doi:10.1146/annurev.cellbio.16.1.521
DATABASE EMBL [online] 18 October 2010 (2010-10-18), "TSA: Apis mellifera isotig01580.Amelbrova mRNA sequence.", XP002726290, retrieved from EBI accession no. EM_TSA:HP485244 Database accession no. HP485244 *
DATABASE EMBL [online] 18 October 2010 (2010-10-18), "TSA: Apis mellifera isotig01584.Amelbrova mRNA sequence.", XP002726293, retrieved from EBI accession no. EM_TSA:HP485248 Database accession no. HP485248 *
DATABASE EMBL [online] 18 October 2010 (2010-10-18), "TSA: Apis mellifera isotig09847.Amelbrova mRNA sequence.", XP002713185, retrieved from EBI accession no. EM_TSA:HP493675 Database accession no. HP493675 *
DATABASE EMBL [online] 18 October 2010 (2010-10-18), "TSA: Apis mellifera isotig10252.Amelbrova mRNA sequence.", XP002726295, retrieved from EBI accession no. EM_TSA:HP494081 Database accession no. HP494081 *
DATABASE EMBL [online] 21 October 2010 (2010-10-21), "TSA: Apis mellifera isotig02391.Amelova mRNA sequence.", XP002713184, retrieved from EBI accession no. EM_TSA:HP554725 Database accession no. HP554725 *
DATABASE EMBL [online] 21 October 2010 (2010-10-21), "TSA: Apis mellifera isotig03577.Amelembr mRNA sequence.", XP002726296, retrieved from EBI accession no. EM_TSA:HP513069 Database accession no. HP513069 *
DATABASE EMBL [online] 21 October 2010 (2010-10-21), "TSA: Apis mellifera isotig03684.Amelmixant mRNA sequence.", XP002726289, retrieved from EBI accession no. EM_TSA:HP532140 Database accession no. HP532140 *
DATABASE EMBL [online] 21 October 2010 (2010-10-21), "TSA: Apis mellifera isotig03685.Amelmixant mRNA sequence.", XP002726291, retrieved from EBI accession no. EM_TSA:HP532141 Database accession no. HP532141 *
DATABASE EMBL [online] 21 October 2010 (2010-10-21), "TSA: Apis mellifera isotig21888.Amelova mRNA sequence.", XP002726294, retrieved from EBI accession no. EM_TSA:HP574268 Database accession no. HP574268 *
DATABASE EMBL [online] 28 July 2006 (2006-07-28), "Apis mellifera head cDNA, RIKEN full-length enriched library, clone:BH10072G08, 3' end partial sequence.", XP002726292, retrieved from EBI accession no. EM_EST:DB775223 Database accession no. DB775223 *
DATABASE PROTEIN [online] 12 April 2011 (2011-04-12), "PREDICTED: voltage-dependent calcium channel subunit alpha-2/delta-3-like [Apis mellifera].", XP002713181, retrieved from NCBI Database accession no. XP_003251101 *
DATABASE PROTEIN [online] 12 April 2011 (2011-04-12), "PREDICTED: voltage-dependent L-type calcium channel subunit beta-2 [Apis mellifera].", XP002713182, retrieved from NCBI Database accession no. XP_623190 *
DATABASE UniProt [online] 3 November 2009 (2009-11-03), "RecName: Full=Voltage-dependent calcium channel type A subunit alpha-1; AltName: Full=Cacophony protein;", XP002713180, retrieved from EBI accession no. UNIPROT:C9D7C2 Database accession no. C9D7C2 *
DAVID M SODERLUND: "Molecular mechanisms of pyrethroid insecticide neurotoxicity: recent advances", ARCHIVES OF TOXICOLOGY, vol. 86, no. 2, 28 June 2011 (2011-06-28), SPRINGER-VERLAG, BERLIN, DE, pages 165 - 181, XP035002036, ISSN: 1432-0738, DOI: 10.1007/S00204-011-0726-X *
ED ALEXEI; VERKHRATSKY, CALCIUM MEASUREMENT METHODS, 2010
GRUNEWALD,B.: "Differential expression of voltage-sensitive K+ and Ca2+ currents in neurons of the honeybee olfactory pathway", J.EXP.BIOL., vol. 206, 2003, pages 117 - 129
KADALA,A.; CHARRETON,M.; LE CONTE,Y.; JAKOB,!.; COLLET,C.: "Pyrethroids alter sodium channel gating in honeybee olfactory receptor neurons", CHEM SENSES, vol. 36, 2010, pages E61
MOIGNOT B.; LEMAIRE C.; QUINCHARD S.; LAPIED B.; LEGROS C.: "The discovery of a novel sodium channel in the cockroach Periplaneta americana : Evidence for an early duplication of the para-like gene", INSECT BIOCHEM AND MOL. BIOL., vol. 39, pages 814 - 823, XP026777045, DOI: doi:10.1016/j.ibmb.2009.09.006
MOIGNOT B.; LEMAIRE C.; QUINCHARD S.; LAPIED B.; LEGROS C.: "The discovery of a novel sodium channel in the cockroach Periplaneta americana: Evidence for an early duplication of the para-like gene", INSECT BIOCHEM AND MOL. BIOL., vol. 39, pages 814 - 823, XP026777045, DOI: doi:10.1016/j.ibmb.2009.09.006
P.T.A GRAY; M.J. WHITAKER: "The Company of Biologists Limited ou Single Channel recording", 1983, PLENUM PRESS
PETERSEN, OLE: "Neuromethods", vol. 43, HUMANA PRESS
RAY,D.E.; FRY,J.R.: "A reassessment of the neurotoxicity of pyrethroid insecticides", PHARMACOL.THER., vol. 111, 2006, pages 174 - 193, XP025038488, DOI: doi:10.1016/j.pharmthera.2005.10.003
RESTITUITO S; CENS T; BARRERE C; GEIB S; GALAS S; DE WAARD M; CHARNET P: "The ?2a subunit is a molecular groom for the Ca2+ channel inactivation gate", J NEUROSCI, vol. 20, 2000, pages 9046 - 9052
RESTITUITO S; CENS T; BARRERE C; GEIB S; GALAS S; DE WAARD M; CHARNET P: "The 2a subunit is a molecular groom for the Ca2+ channel inactivation gate", J NEUROSCI, vol. 20, 2000, pages 9046 - 9052
SCHLENSTEDT J.; BALFANZ S.; BAUMANN A.; BLENAU W.: "Am5-HT7 : Molecular and pharmacological characterization of the first serotonin receptor of the honeybee (Apis mellifera)", J. NEUROCHEM, vol. 98, pages 1958 - 1998
SUCHAIL ET AL.: "Discrepancy between acute and chronic toxicity induced by imidacloprid and its metabolites in Apis mellifera.", ENVIRON TOXICOL CHEM, vol. 20, no. 11, November 2001 (2001-11-01), pages 2482 - 6
WEINSTOCK GEORGE M ET AL: "Insights into social insects from the genome of the honeybee Apis mellifera", NATURE, vol. 443, no. 7114, October 2006 (2006-10-01), (LONDON), pages 931 - 949, XP002713179 *
WEINSTOCK,G.M.; ROBINSON G.E.; GIBBS,R.A. ET AL.: "Insights into social insects from the genome of the honeybee Apis mellifera", NATURE, vol. 443, 2006, pages 931 - 949, XP002713179, DOI: doi:10.1038/nature05260

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3040345A1 (en) * 2014-12-31 2016-07-06 Centre National de la Recherche Scientifique (CNRS) Sodium channel subunits of pollinator insects and uses thereof

Also Published As

Publication number Publication date
FR3003863A1 (en) 2014-10-03
FR3003863B1 (en) 2016-07-29

Similar Documents

Publication Publication Date Title
Riddiford et al. A role for juvenile hormone in the prepupal development of Drosophila melanogaster
Sarov et al. A genome-wide resource for the analysis of protein localisation in Drosophila
Grosjean et al. An olfactory receptor for food-derived odours promotes male courtship in Drosophila
Monastirioti et al. Drosophila Hey is a target of Notch in asymmetric divisions during embryonic and larval neurogenesis
Xu et al. Odorant-binding proteins of the malaria mosquito Anopheles funestus sensu stricto
Ádám et al. The retinoic-like juvenile hormone controls the looping of left-right asymmetric organs in Drosophila
JP2006516884A (en) Isolation and use of ryanodine receptor
Sun et al. Chemosensillum immunolocalization and ligand specificity of chemosensory proteins in the alfalfa plant bug Adelphocoris lineolatus (Goeze)
Sajadi et al. CAPA neuropeptides and their receptor form an anti-diuretic hormone signaling system in the human disease vector, Aedes aegypti
Zhang et al. Identification and functional characterization of an odorant receptor in pea aphid, Acyrthosiphon pisum
Ma et al. Olfactory co‐receptor is involved in host recognition and oviposition in Ophraella communa (Coleoptera: Chrysomelidae)
Xu et al. Two odorant receptors regulate 1-octen-3-ol induced oviposition behavior in the oriental fruit fly
Čižmár et al. Multiple neuropeptides produced by sex-specific neurons control activity of the male accessory glands and gonoducts in the silkworm Bombyx mori
Sun et al. Molecular screening of behaviorally active compounds with CmedOBP14 from the rice leaf folder Cnaphalocrocis medinalis
JP6789051B2 (en) Olfactory receptor complex and cells expressing it
Li et al. The short neuropeptide F receptor regulates olfaction-mediated foraging behavior in the oriental fruit fly Bactrocera dorsalis (Hendel)
Song et al. Male tarsi specific odorant-binding proteins in the diving beetle Cybister japonicus sharp
Wang et al. Report on D rosophila melanogaster larvae without functional tracheae
Zhang et al. Response of odorant receptors with phenylacetaldehyde and the effects on the behavior of the rice water weevil (Lissorhoptrus oryzophilus)
WO2007056043A2 (en) Use of potassium channels for identifying compounds that have an insecticidal effect
Thakur et al. RNAi knockdown of CAPAr gene affects survival and fecundity of Bemisia tabaci (Gennadius)
Bitan et al. Asymmetric microtubule function is an essential requirement for polarized organization of the Drosophila bristle
WO2014155021A1 (en) Bee calcium channel and uses
Cottam et al. Non‐centrosomal microtubule‐organising centres in cold‐treated cultured Drosophila cells
Finetti et al. The octopamine receptor OAα1 influences oogenesis and reproductive performance in Rhodnius prolixus

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14718690

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 14718690

Country of ref document: EP

Kind code of ref document: A1