WO2014151279A1 - Vaccines having an antigen and interleukin-23 as an adjuvant - Google Patents
Vaccines having an antigen and interleukin-23 as an adjuvant Download PDFInfo
- Publication number
- WO2014151279A1 WO2014151279A1 PCT/US2014/025348 US2014025348W WO2014151279A1 WO 2014151279 A1 WO2014151279 A1 WO 2014151279A1 US 2014025348 W US2014025348 W US 2014025348W WO 2014151279 A1 WO2014151279 A1 WO 2014151279A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- antigen
- nucleic acid
- vaccine
- seq
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/39—Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/002—Protozoa antigens
- A61K39/015—Hemosporidia antigens, e.g. Plasmodium antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0002—Galenical forms characterised by the drug release technique; Application systems commanded by energy
- A61K9/0009—Galenical forms characterised by the drug release technique; Application systems commanded by energy involving or responsive to electricity, magnetism or acoustic waves; Galenical aspects of sonophoresis, iontophoresis, electroporation or electroosmosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
- A61P31/16—Antivirals for RNA viruses for influenza or rhinoviruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
- A61P31/18—Antivirals for RNA viruses for HIV
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/20—Antivirals for DNA viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P33/00—Antiparasitic agents
- A61P33/02—Antiprotozoals, e.g. for leishmaniasis, trichomoniasis, toxoplasmosis
- A61P33/06—Antimalarials
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/54—Interleukins [IL]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/02—Preparation of hybrid cells by fusion of two or more cells, e.g. protoplast fusion
- C12N15/03—Bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P21/00—Preparation of peptides or proteins
- C12P21/02—Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/53—DNA (RNA) vaccination
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/54—Medicinal preparations containing antigens or antibodies characterised by the route of administration
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
- A61K2039/55511—Organic adjuvants
- A61K2039/55522—Cytokines; Lymphokines; Interferons
- A61K2039/55527—Interleukins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/20011—Papillomaviridae
- C12N2710/20033—Use of viral protein as therapeutic agent other than vaccine, e.g. apoptosis inducing or anti-inflammatory
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/20011—Papillomaviridae
- C12N2710/20034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Definitions
- Figure 1A and Figure IB show general maps of the IL-23 adjuvant constructs with an antigen on a different plasmid ( Figure 1A) and the same plasmid ( Figure IB).
- Figure 3 shows expression of IL-23 in supernatants from transfected HEK 293T cells.
- the present invention relates to vaccines that can be used to increase an immune response to an antigen in a subject by using IL-23 as an adjuvant.
- IL-23 can be a heterodimer of a p40 subunit and a pi 9 subunit, and, unlike the cytokine IL-12, can safely direct inflammatory responses in multiple tissues such as skin, muscle, etc.
- IL-23 can function as a universal adjuvant because a greater immune response is elicited in the subject regardless of the source of the antigen or the route of administration as compared to a vaccine comprising the antigen alone.
- nucleic acid or "oligonucleotide” or “polynucleotide” as used herein means at least two nucleotides covalently linked together.
- the depiction of a single strand also defines the sequence of the complementary strand.
- a nucleic acid also encompasses the complementary strand of a depicted single strand.
- Many variants of a nucleic acid can be used for the same purpose as a given nucleic acid.
- a nucleic acid also encompasses substantially identical nucleic acids and complements thereof.
- a single strand provides a probe that may hybridize to a target sequence under stringent hybridization conditions.
- a nucleic acid also encompasses a probe that hybridizes under stringent hybridization conditions.
- the T m may be the temperature (under defined ionic strength, pH, and nucleic concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at T m , 50% of the probes are occupied at equilibrium).
- Stringent conditions may be those in which the salt concentration is less than about 1.0 M sodium ion, such as about 0.01-
- Treatment can mean protecting an animal from a disease through means of preventing, suppressing, repressing, or completely eliminating the disease.
- Preventing the disease involves administering a vaccine of the present invention to an animal prior to onset of the disease.
- Suppressing the disease involves administering a vaccine of the present invention to an animal after induction of the disease but before its clinical appearance.
- Repressing the disease involves administering a vaccine of the present invention to an animal after clinical appearance of the disease.
- the vaccine of the present invention can have features required of effective vaccines such as being safe so that the vaccine itself does not cause illness or death; being protective against illness resulting from exposure to live pathogens such as viruses or bacteria; inducing neutralizing antibody to prevent infection of cells; inducing protective T cell responses against intracellular pathogens; and providing ease of administration, few side effects, biological stability, and low cost per dose.
- the vaccine can accomplish some or all of these features by combining the antigen with the adjuvant as discussed below.
- the adjuvant can be interleukin-23 (IL-23).
- IL-23 can be a heterodimer of the pi 9 and p40 subunits, fragments thereof, variants thereof, or the combination thereof.
- the p40 subunit can also be used by interleukin-12 (IL-12), while the pi 9 subunit can be distinct to IL-23.
- IL-23 is secreted by activated dendritic cells and activated macrophages in peripheral tissues (e.g., skin, intestinal mucosa, lung, etc.), and controls inflammation in peripheral tissues. Overexpression of the p 19 subunit can produce inflammation in multiple organs and epithelial tissues, for example, the skin.
- IL-23 can increase the immune response to the antigen by about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 11 1%, 1 12%, 1 13%, 114%, 115%, 1 16%, 1 17%, 118%, 119%, 120%, 121%, 122%, 123%, 124%, 125%, 126%, 127%, 128%, 129% or 130%.
- the macaque p 19 subunit can be the nucleic acid sequence SEQ ID NO: 3, which encodes for GenBank Accession No. NP_001181598.1 (SEQ ID NO: 4).
- the macaque pi 9 subunit can be the nucleic acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%,
- the human pl9 subunit can be the nucleic acid sequence that encodes the amino acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity over an entire length of the amino acid sequence set forth in SEQ ID NO: 6.
- the human p 19 subunit can be the amino acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity over an entire length of the amino acid sequence set forth in SEQ ID NO:6.
- the human p 19 subunit can be the optimized nucleic acid sequence SEQ ID NO:22.
- the human pl9 subunit can be the nucleic acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity over an entire length of the nucleic acid sequence set forth in SEQ ID NO:22.
- a nucleic acid encoding the p40 subunit of IL-23 can be from any number of organisms, for example, mouse (Mus musculus), macaque (Macacac mulatto), and human (Homo sapiens).
- the nucleic acid encoding the p40 subunit can be optimized with regards to codon usage and corresponding RNA transcripts.
- the nucleic acid encoding the p40 subunit can be codon and RNA optimized for expression.
- the nucleic acid encoding the p40 subunit of IL-23 can include a Kozak sequence (e.g., GCC ACC) to increase the efficiency of translation.
- the nucleic acid encoding the p40 subunit of IL-23 can include multiple stop codons (e.g., TGA TGA) to increase the efficiency of translation termination.
- the nucleic acid encoding the p40 subunit can also encode an immunoglobulin E (IgE) leader sequence.
- the IgE leader sequence can be located 5' to the p40 subunit in the nucleic acid.
- the nucleic acid encoding the p40 subunit of IL-23 can also include a nucleotide sequence encoding the IgE leader sequence.
- the nucleic acid encoding the p40 subunit of IL-23 is free of or does not contain a nucleotide sequence encoding the IgE leader sequence.
- the mouse p40 subunit can be the nucleic acid sequence that encodes the amino acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity over an entire length of the amino acid sequence set forth in SEQ ID NO:8.
- the mouse p40 subunit can be the amino acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity over an entire length of the amino acid sequence set forth in SEQ ID NO:8.
- the mouse p40 subunit can be the amino acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity over an entire length of the amino acid sequence set forth in SEQ ID NO:21.
- the mouse p40 subunit can be the optimized nucleic acid sequence located at 5034 to 6101 of plasmid WLV009-mIL-23 Opt (SEQ ID NO: 13), which encodes for SEQ ID NO:21.
- the mouse p40 subunit can be the nucleic acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity over an entire length of the nucleic acid sequence set forth in 5034 to 6101 of plasmid WLV009-mIL-23 Opt (SEQ ID NO: 13).
- the macaque p40 subunit can be the nucleic acid sequence SEQ ID NO: 9, which encodes for GenBank Accession No. NP_001038190. (SEQ ID NO: 10).
- the macaque p40 subunit can be the nucleic acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity over an entire length of the nucleic acid sequence set forth in SEQ ID NO:9.
- the macaque p40 subunit can be the nucleic acid sequence that encodes the amino acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity over an entire length of the amino acid sequence set forth in SEQ ID NO: 10.
- the macaque p40 subunit can be the amino acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity over an entire length of the amino acid sequence set forth in SEQ ID NO: 10.
- the human p40 subunit can be the nucleic acid sequence that encodes the amino acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity over an entire length of the amino acid sequence set forth in SEQ ID NO: 12.
- the human p40 subunit can be the amino acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity over an entire length of the amino acid sequence set forth in SEQ ID NO: 12.
- the human p40 subunit can be the optimized nucleic acid sequence SEQ ID NO:23.
- the human p40 subunit can be the nucleic acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity over an entire length of the nucleic acid sequence set forth in SEQ ID NO:23.
- Some embodiments relate to fragments of SEQ ID NO: 1, SEQ ID NO:3, SEQ ID NO:
- fragments can comprise at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of SEQ ID NO: l, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO: 11, SEQ ID NO: 18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:23, 2549 to 3199 of SEQ ID NO: 13, and/or 5034 to 6101 of SEQ ID NO: 13.
- fragments can include sequences that encode a leader sequence, for example, an immunoglobulin leader sequence, such as the IgE leader sequence.
- fragments are free of coding sequences that encode a leader
- Fragments of nucleic acids with nucleotide sequences having identity to fragments of SEQ ID NO: l, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO: 11, SEQ ID NO: 18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:23, 2549 to 3199 of SEQ ID NO: 13, and 5034 to 6101 of SEQ ID NO: 13 can be provided.
- fragments that have 99% or greater identity to the fragments of IL-23 (i.e., p 19 subunit and/or p40 subunit) nucleic acid sequences herein.
- fragments include sequences that encode a leader sequence, for example, an immunoglobulin leader sequence such as the IgE leader sequence.
- fragments are free of coding sequences that encode a leader sequence.
- SEQ ID NO:2 SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO:
- Fragments of proteins with amino acid sequences having identity to fragments of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 19, and SEQ ID NO:21 can be provided.
- the vaccine can comprise an antigen or fragment or variant thereof and an adjuvant as discussed above.
- the antigen can be anything that induces an immune response in a subject. Purified antigens are not usually strongly immunogenic on their own and are therefore combined with the adjuvant as described above.
- the immune response induced by the antigen can be boosted or increased when combined with the adjuvant.
- Such an immune response can be a humoral immune response and/or a cellular immune response.
- the combination of the adjuvant and the antigen can boost or increase a cellular immune response in the subject.
- the combination of the adjuvant and the antigen can boost or increase a humoral immune response in the subject.
- the antigen can be contained in a protein, a nucleic acid, or a fragment thereof, or a variant thereof, or a combination thereof from any number of organisms, for example, a virus, a parasite, a bacterium, a fungus, or a mammal.
- the antigen can be associated with an autoimmune disease, allergy, or asthma.
- the antigen can be associated with cancer, herpes, influenza, hepatitis B, hepatitis C, human papilloma virus (HPV), or human immunodeficiency virus (HIV).
- the antigen of the vaccine can be selected from a group consisting of a human papilloma virus (HPV) antigen, an HIV antigen, an influenza antigen, a Plasmodium falciparum antigen and a fragment thereof.
- HPV antigen can be selected from the group consisting of HPV 16 E6 antigen, an HPV 16 E7 antigen and a combination thereof.
- the HIV antigen can be selected from the group consisting of Env A, Env B, Env C, Env D, B Nef-Rev , Gag, and any combination thereof.
- the influenza antigen can be selected from the group consisting of HI HA, H2 HA, H3 HA, H5 HA, BHA antigen and any combination thereof.
- the Plasmodium falciparum antigen may include a circumsporozoite (CS) antigen.
- CS circumsporozoite
- Some antigens can induce a strong immune response. Other antigens can induce a weak immune response. The antigen can elicit a greater immune response when combined with the adjuvant as described above.
- the antigen can be a viral antigen, or fragment thereof, or variant thereof.
- the viral antigen can be from a virus from one of the following families: Adenoviridae,
- Herpesviridae Orthomyxoviridae, Papovaviridae, Paramyxoviridae, Parvoviridae,
- the consensus hepatitis antigen may comprise a signal peptide such as an immunoglobulin signal peptide such as an IgE or IgG signal peptide, and in some embodiments, may comprise an HA tag.
- the immunogens can be designed to elicit stronger and broader cellular immune responses than corresponding codon optimized immunogens.
- the hepatitis antigen can be an antigen from HAV.
- the hepatitis antigen can be a HAV capsid protein, a HAV non-structural protein, a fragment thereof, a variant thereof, or a combination thereof.
- the hepatitis antigen can be an antigen from HCV.
- the hepatitis antigen can be a HCV nucleocapsid protein (i.e., core protein), a HCV envelope protein (e.g., El and E2), a HCV non-structural protein (e.g., NS1, NS2, NS3, NS4a, NS4b, NS5a, and NS5b), a fragment thereof, a variant thereof, or a combination thereof.
- the hepatitis antigen can be an antigen from HEV.
- the hepatitis antigen can be a HEV capsid protein, fragment thereof, or variant thereof.
- the hepatitis antigen can be a HBV genotype A consensus core DNA sequence construct, an IgE leader sequence linked to a consensus sequence for HBV genotype A core protein, or a HBV genotype A consensus core protein sequence.
- the hepatitis antigen can be a HBV genotype D consensus core DNA sequence construct, an IgE leader sequence linked to a consensus sequence for
- the hepatitis antigen can be a HBV genotype E consensus core DNA sequence construct, an IgE leader sequence linked to a consensus sequence for
- the hepatitis antigen can be a HBV genotype F consensus core DNA sequence construct, an IgE leader sequence linked to a consensus sequence for
- the hepatitis antigen can be a HBV genotype B consensus surface DNA sequence construct, an IgE leader sequence linked to a consensus sequence for HBV genotype B surface protein, or a HBV genotype B consensus surface protein sequence.
- the hepatitis antigen can be a HBV genotype C consensus surface DNA sequence construct, an IgE leader sequence linked to a consensus sequence for HBV genotype C surface protein, or a HBV genotype C consensus surface protein sequence.
- the hepatitis antigen can be a HBV genotype E consensus surface DNA sequence construct, an IgE leader sequence linked to a consensus sequence for HBV genotype E surface protein, or a HBV genotype E consensus surface protein sequence.
- the hepatitis antigen can be a HBV genotype F consensus surface DNA sequence construct, an IgE leader sequence linked to a consensus sequence for HBV genotype F surface protein, or a HBV genotype F consensus surface protein sequence.
- the hepatitis antigen can be a HBV genotype G consensus surface DNA sequence construct, an IgE leader sequence linked to a consensus sequence for HBV genotype G surface protein, or a HBV genotype G consensus surface protein sequence.
- the hepatitis antigen can be a HBV genotype H consensus surface DNA sequence construct, an IgE leader sequence linked to a consensus sequence for HBV genotype H surface protein, or a HBV genotype H consensus surface protein sequence.
- IL-23 can be associated or combined with a human papilloma virus (HPV) antigen, or fragment thereof, or variant thereof.
- HPV antigen can be from HPV types 16, 18, 31, 33, 35, 45, 52, and 58, which cause cervical cancer, rectal cancer, and/or other cancers.
- HPV antigen can be from HPV types 6 and 11, which cause genital warts, and are known to be causes of head and neck cancer.
- the HPV antigens can be the HPV E6 or E7 domains from each HPV type.
- the HPV 16 antigen can include the HPV 16 E6 antigen, the HPV 16 E7 antigen, fragments, variants, or combinations thereof.
- the HPV antigen can be HPV 6 E6 and/or E7, HPV 11 E6 and/or E7, HPV 18 E6 and/or E7, HPV 31 E6 and/or E7, HPV 33 E6 and/or E7, HPV 52 E6 and/or E7, or HPV 58 E6 and/or E7, fragments, variants, or combinations thereof.
- IL-23 can also be associated or combined with an RSV antigen or fragment thereof, or variant thereof.
- the RSV antigen can be a human RSV fusion protein (also referred to herein as "RSV F", "RSV F protein” and "F protein”), or fragment or variant thereof.
- the human RSV fusion protein can be conserved between RSV subtypes A and B.
- the RSV antigen can be a RSV F protein, or fragment or variant thereof, from the RSV Long strain (GenBank AAX23994.1).
- the RSV antigen can be a RSV F protein from the RSV A2 strain (GenBank AAB59858.1), or a fragment or variant thereof.
- the RSV antigen can be RSV G protein from: the RSV subtype B isolate H5601, the RSV subtype B isolate H1068, the RSV subtype B isolate H5598, the RSV subtype B isolate
- the RSV antigen can be RSV NS 1 protein, or fragment or variant thereof, from the RSV Long strain (GenBank
- the RSV antigen can also be human RSV Matrix protein2-l ("M2-1") protein, or fragment or variant thereof.
- M2-1 human RSV Matrix protein2-l
- the RSV antigen can be RSV M2- 1 protein, or fragment or variant thereof, from the RSV Long strain (GenBank AAX23995.1).
- the RSV antigen can further be human RSV Matrix protein 2-2 ("M2-2") protein, or fragment or variant thereof.
- the RSV antigen can be RSV M2-2 protein, or fragment or variant thereof, from the RSV Long strain (GenBank AAX23997.1).
- the RSV antigen human can be RSV Polymerase L (“L”) protein, or fragment or variant thereof.
- the RSV antigen can be RSV L protein, or fragment or variant thereof, from the RSV Long strain (GenBank AAX23996.1).
- NS 1 protein from the RSV Long strain the RSV NS2 protein from the RSV Long strain, the RSV N protein from the RSV Long strain, the RSV P protein from the RSV Long strain, the RSV M protein from the RSV Long strain, the RSV SH protein from the RSV Long strain, the RSV M2-1 protein from the RSV Long strain, for the RSV M2-2 protein from the RSV Long strain, the RSV L protein from the RSV Long strain, the RSV G protein from the RSV subtype B isolate H5601, the RSV G protein from the RSV subtype B isolate H1068, for the RSV G protein from the RSV subtype B isolate H5598, the RSV G protein from the RSV subtype B isolate HI 123, or fragment thereof, or variant thereof.
- IL-23 can be associated or combined with an influenza antigen or fragment thereof, or variant thereof.
- the influenza antigens are those capable of eliciting an immune response in a mammal against one or more influenza serotypes.
- the antigen can comprise the full length translation product HAO, subunit HA1, subunit HA2, a variant thereof, a fragment thereof or a combination thereof.
- the influenza hemagglutinin antigen can be a consensus sequence derived from multiple strains of influenza A serotype HI, a consensus sequence derived from multiple strains of influenza A serotype H2, a hybrid sequence containing portions of two different consensus sequences derived from different sets of multiple strains of influenza A serotype HI or a consensus sequence derived from multiple strains of influenza B.
- the influenza hemagglutinin antigen can be from influenza B.
- the influenza antigen can also contain at least one antigenic epitope that can be effective against particular influenza immunogens against which an immune response can be induced.
- the antigen may provide an entire repertoire of immunogenic sites and epitopes present in an intact influenza virus.
- the antigen may be a consensus hemagglutinin antigen sequence that can be derived from hemagglutinin antigen sequences from a plurality of influenza A virus strains of one serotype such as a plurality of influenza A virus strains of serotype HI or of serotype H2.
- the antigen may be a hybrid consensus hemagglutinin antigen sequence that can be derived from combining two different consensus hemagglutinin antigen sequences or portions thereof.
- Each of two different consensus hemagglutinin antigen sequences may be derived from a different set of a plurality of influenza A virus strains of one serotype such as a plurality of influenza A virus strains of serotype HI .
- the antigen may be a consensus hemagglutinin antigen sequence that can be derived from hemagglutinin antigen sequences from a plurality of influenza B virus strains.
- influenza antigen can be HI HA, H2 HA, H3 HA, H5
- influenza antigen can be a consensus hemagglutinin antigen comprising a consensus HI amino acid sequence or a consensus H2 amino acid sequence.
- the consensus hemagglutinin antigen may be a synthetic hybrid consensus HI sequence comprising portions of two different consensus HI sequences, which are each derived from a different set of sequences from the other.
- An example of a consensus HA antigen that is a synthetic hybrid consensus HI protein is a protein comprising the U2 amino acid sequence.
- the consensus hemagglutinin antigen may be a consensus
- hemagglutinin protein derived from hemagglutinin sequences from influenza B strains, such as a protein comprising the consensus BHA amino acid sequence.
- the consensus hemagglutinin antigen may further comprise one or more additional amino acid sequence elements.
- the consensus hemagglutinin antigen may further comprise on its N-terminus, an IgE or IgG leader amino acid sequence.
- the consensus hemagglutinin antigen may further comprise an immunogenic tag, which is a unique immunogenic epitope that can be detected by readily available antibodies.
- An example of such an immunogenic tag is the 9 amino acid influenza HA Tag, which may be linked on the consensus hemagglutinin C-terminus.
- consensus hemagglutinin antigen may further comprise on its N-terminus, an IgE or IgG leader amino acid sequence and on its C-terminus, an HA tag.
- the consensus hemagglutinin antigen may be a consensus hemagglutinin protein that consists of consensus influenza amino acid sequences or fragments and variants thereof.
- the consensus hemagglutinin antigen may be a consensus hemagglutinin protein that comprises non-influenza protein sequences and influenza protein sequences or fragments and variants thereof.
- Examples of a consensus HI protein include those that may consist of the consensus HI amino acid sequence or those that further comprise additional elements such as an IgE leader sequence, or an HA Tag or both an IgE leader sequence and an HA Tag.
- hybrid consensus influenza B hemagglutinin proteins include those that may consist of the consensus BHA amino acid sequence or it may comprise an IgE leader sequence, or a an HA Tag, or both an IgE leader sequence and an HA Tag.
- the consensus hemagglutinin protein can be encoded by a consensus
- the consensus hemagglutinin nucleic acid refers to a nucleic acid sequence that encodes a consensus protein sequence and the coding sequences used may differ from those used to encode the particular amino acid sequences in the plurality of different hemagglutinin sequences from which the consensus hemagglutinin protein sequence is derived.
- the consensus nucleic acid sequence may be codon optimized and/or RNA optimized.
- HIV Human Immunodeficiency Virus
- the HIV antigen can be a subtype C consensus envelope DNA sequence construct, an IgE leader sequence linked to a consensus sequence for subtype C envelope protein, or a subtype C consensus envelope protein sequence.
- the HIV antigen can be a subtype D consensus envelope DNA sequence construct, an IgE leader sequence linked to a consensus sequence for Subtype D envelope protein, or a subtype D consensus envelope protein sequence.
- the HIV antigen can be a subtype B Nef-Rev consensus envelope DNA sequence construct, an IgE leader sequence linked to a consensus sequence for Subtype B Nef-Rev protein, or a Subtype B Nef-Rev consensus protein sequence
- the HIV antigen can be a Gag consensus DNA sequence of subtype A, B, C and D DNA sequence construct, an IgE leader sequence linked to a consensus sequence for Gag consensus subtype A, B, C and D protein, or a consensus Gag subtype A, B, C and D protein sequence.
- the HIV antigen can be a MPol DNA sequence or a MPol protein sequence.
- the HIV antigen can be nucleic acid or amino acid sequences of Env A, Env B, Env C, Env D, B Nef-Rev, Gag, or any combination thereof.
- the antigen can be a parasite antigen or fragment or variant thereof.
- the parasite can be a protozoa, helminth, or ectoparasite.
- the helminth i.e., worm
- the helminth can be a flatworm (e.g., flukes and tapeworms), a thorny -headed worm, or a round worm (e.g., pinworms).
- the ectoparasite can be lice, fleas, ticks, and mites.
- the parasite can be any parasite causing the following diseases: Acanthamoeba keratitis, Amoebiasis, Ascariasis, Babesiosis, Balantidiasis, Baylisascariasis, Chagas disease, Clonorchiasis, Cochliomyia, Cryptosporidiosis, Diphyllobothriasis, Dracunculiasis,
- Echinococcosis Echinococcosis, Elephantiasis, Enterobiasis, Fascioliasis, Fasciolopsiasis, Filariasis, Giardiasis, Gnathostomiasis, Hymenolepiasis, Isosporiasis, Katayama fever, Leishmaniasis, Lyme disease, Malaria, Metagonimiasis, Myiasis, Onchocerciasis, Pediculosis, Scabies, Schistosomiasis, Sleeping sickness, Strongyloidiasis, Taeniasis, Toxocariasis,
- the parasite can be Acanthamoeba, Anisakis, Ascaris lumbricoides, Botfly, Balantidium coli, Bedbug, Cestoda (tapeworm), Chiggers, Cochliomyia hominivorax, Entamoeba histolytica, Fasciola hepatica, Giardia lamblia, Hookworm, Leishmania, Linguatula serrata, Liver fluke, Loa loa, Paragonimus - lung fluke, Pinworm, Plasmodium falciparum, Schistosoma, Strongyloides stercoralis, Mite, Tapeworm, Toxoplasma gondii, Trypanosoma, Whipworm, or Wuchereria bancrofti.
- IL-23 can be associated or combined with a malaria antigen (i.e., PF antigen or PF immunogen), or fragment thereof, or variant thereof.
- the antigen can be from a parasite causing malaria.
- the malaria causing parasite can be Plasmodium falciparum.
- the malaria antigen can be a consensus sequence of TRAP, which is also referred to as SSP2, designed from a compilation of all full-length Plasmodium falciparum TRAP/SSP2 sequences in the GenBank database (28 sequences total).
- Consensus TRAP immunogens i.e., ConTRAP immunogen
- embodiments may comprise an HA Tag.
- the malaria antigen can be Amal, which is a highly conserved Plasmodium antigen.
- the malaria antigen can also be a consensus sequence of Amal (i.e., ConAmal immunogen) comprising in some instances, a signal peptide such as an immunoglobulin signal peptide such as an IgE or IgG signal peptide and in some
- embodiments may comprise an HA Tag.
- the malaria antigen can be a fusion protein comprising a combination of two or more of the PF proteins set forth herein.
- fusion proteins may comprise two or more of Consensus CS immunogen, ConLSAl immunogen, ConTRAP immunogen, ConCelTOS immunogen and ConAmal immunogen linked directly adjacent to each other or linked with a spacer or one more amino acids in between.
- the fusion protein comprises two PF immunogens. In some embodiments the fusion protein comprises three PF immunogens. In some embodiments, the fusion protein comprises four PF immunogens. In some embodiments the fusion protein comprises five PF immunogens.
- Fusion proteins with two Consensus PF immunogens may comprise: CS and LSAl; CS and TRAP; CS and CelTOS; CS and Amal; LSAl and TRAP; LSAl and CelTOS; LSAl and Amal; TRAP and CelTOS; TRAP and Amal; or CelTOS and Amal .
- Fusion proteins with three Consensus PF immunogens may comprise: CS, LSAl and TRAP; CS, LSAl and CelTOS; CS, LSAl and Amal ; LSAl, TRAP and CelTOS; LSAl, TRAP and Amal; or TRAP, CelTOS and Amal .
- the fusion proteins comprise a signal peptide linked to the
- the fusion proteins comprise multiple signal peptides linked to the N-terminus of each Consensus PF immunogen.
- a spacer may be included between PF immunogens of a fusion protein.
- the spacer between PF immunogens of a fusion protein may be a proteolyic cleavage site.
- the spacer may be a proteolyic cleavage site recognized by a protease found in cells to which the vaccine is intended to be administered and/or taken up.
- the antigen can be bacterial antigen or fragment or variant thereof.
- the bacterium can be from any one of the following phyla: Acidobacteria, Actinobacteria, Aquificae, Bacteroidetes, Caldiserica, Chlamydiae, Chlorobi, Chloroflexi, Chrysiogenetes,
- the bacterium can be a gram positive bacterium or a gram negative bacterium.
- the bacterium can be an aerobic bacterium or an anerobic bacterium.
- the bacterium can be an autotrophic bacterium or a heterotrophic bacterium.
- the bacterium can be a mesophile, a neutrophile, an extremophile, an acidophile, an alkaliphile, a thermophile, psychrophile, halophile, or an osmophile.
- IL-23 can be associated or combined with a Mycobacterium tuberculosis antigen (i.e., TB antigen or TB immunogen), or fragment thereof, or variant thereof.
- the TB antigen can be from the Ag85 family of TB antigens, for example, Ag85A and Ag85B.
- the TB antigen can be from the Esx family of TB antigens, for example, EsxA, EsxB, EsxC, EsxD, EsxE, EsxF, EsxH, EsxO, EsxQ, EsxR, EsxS, EsxT, EsxU, EsxV, and EsxW.
- the TB antigen can be heterologous nucleic acid molecules such as plasmids, which encode one or more of the Mycobacterium tuberculosis immunogens from the Ag85 family and the Esx family.
- the immunogens can be full-length or immunogenic fragments of full-length proteins.
- the immunogens can comprise consensus sequences and/or modifications for improved expression.
- Consensus immunogens may comprise a signal peptide such as an immunoglobulin signal peptide such as an IgE or IgG signal peptide and in some embodiments, may comprise an HA tag.
- the vectors may have expression signals such as a strong promoter, a strong termination codon, adjustment of the distance between the promoter and the cloned gene, and the insertion of a transcription termination sequence and a PTIS (portable translation initiation sequence).
- expression signals such as a strong promoter, a strong termination codon, adjustment of the distance between the promoter and the cloned gene, and the insertion of a transcription termination sequence and a PTIS (portable translation initiation sequence).
- the vector can be pVAX, pcDNA3.0, or provax, or any other expression vector capable of expressing heterologous DNA encoding the antigen, or the adjuvant and enabling a cell to translate the sequence to an antigen that is recognized by the immune system, or the adjuvant.
- a linear nucleic acid vaccine or linear expression cassette (“LEC”), that is capable of being efficiently delivered to a subject via electroporation and expressing one or more desired antigens, and/or one or more desired adjuvants.
- the LEC may be any linear DNA devoid of any phosphate backbone.
- the DNA may encode one or more antigens, and/or one or more adjuvants.
- the LEC may contain a promoter, an intron, a stop codon, and/or a polyadenylation signal.
- the expression of the antigen, or the adjuvant may be controlled by the promoter.
- the LEC may not contain any antibiotic resistance genes and/or a phosphate backbone.
- the LEC may not contain other nucleic acid sequences unrelated to the desired antigen gene expression, or the desired adjuvant expression.
- the pl9 subunit of IL-23, the p40 subunit of IL-23, and/or the antigen can be arranged in a plasmid together or separately. By way of example only, some arrangements are shown schematically in FIGS.1A and IB.
- the LEC may be derived from any plasmid capable of being linearized.
- the plasmid may be capable of expressing the antigen, and/or the adjuvant.
- the plasmid may be capable of expressing the adjuvant IL-23, for example, as a dual promoter plasmid having the pl9 subunit under the control of a first promoter and the p40 subunit under the control of a second promoter.
- the first and second promoters may or may not be the same promoters.
- the plasmid may be WLV009-mIL-23 Opt (SEQ ID NO: 13) as shown in FIG. 2.
- the plasmid can be pNP (Puerto Rico/34) or pM2 (New Caledonia/99).
- the plasmid may be WLV009, pVAX, pcDNA3.0, or provax, or any other expression vector capable of expressing DNA encoding the antigen, or encoding the adjuvant, and enabling a cell to translate the sequence to an antigen that is recognized by the immune system, or the adjuvant.
- the vector may have a promoter.
- a promoter may be any promoter that is capable of driving gene expression and regulating expression of the isolated nucleic acid. Such a promoter is a cis-acting sequence element required for transcription via a DNA dependent RNA polymerase, which transcribes the antigen sequence, or the adjuvant sequence described herein. Selection of the promoter used to direct expression of a heterologous nucleic acid depends on the particular application. The promoter may be positioned about the same distance from the transcription start in the vector as it is from the transcription start site in its natural setting. However, variation in this distance may be accommodated without loss of promoter function.
- the promoter may be operably linked to the nucleic acid sequence encoding the antigen and signals required for efficient polyadenylation of the transcript, ribosome binding sites, and translation termination.
- the promoter may be operably linked to the nucleic acid sequence encoding the adjuvant and signals required for efficient polyadenylation of the transcript, ribosome binding sites, and translation termination.
- the promoter may be a CMV promoter, SV40 early promoter, SV40 later promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or another promoter shown effective for expression in eukaryotic cells.
- the vector may include an enhancer and an intron with functional splice donor and acceptor sites.
- the vector may contain a transcription termination region downstream of the structural gene to provide for efficient termination.
- the termination region may be obtained from the same gene as the promoter sequence or may be obtained from different genes. d. Excipients and other components of the Vaccine
- the vaccine may further comprise a pharmaceutically acceptable excipient.
- the pharmaceutically acceptable excipient can be functional molecules such as vehicles, adjuvants other than IL-23, carriers, or diluents.
- the pharmaceutically acceptable excipient can be a transfection facilitating agent, which can include surface active agents, such as immune-stimulating complexes (ISCOMS), Freunds incomplete adjuvant, LPS analog including monophosphoryl lipid A, muramyl peptides, quinone analogs, vesicles such as squalene and squalene, hyaluronic acid, lipids, liposomes, calcium ions, viral proteins, polyanions, polycations, or nanoparticles, or other known transfection facilitating agents.
- ISCOMS immune-stimulating complexes
- LPS analog including monophosphoryl lipid A, muramyl peptides, quinone analogs, vesicles such as squalene and squalene, h
- the transfection facilitating agent can be a polyanion, polycation, including poly- L-glutamate (LGS), or lipid.
- the transfection facilitating agent can be poly-L-glutamate, and the poly-L-glutamate can be present in the vaccine at a concentration of less than 6 mg/ml.
- the transfection facilitating agent can also include surface active agents such as immune- stimulating complexes (ISCOMS), Freunds incomplete adjuvant, LPS analog including monophosphoryl lipid A, muramyl peptides, quinone analogs and vesicles such as squalene and squalene.
- ISCOMS immune- stimulating complexes
- LPS analog including monophosphoryl lipid A
- muramyl peptides muramyl peptides
- quinone analogs and vesicles such as squalene and squalene.
- Hyaluronic acid can also be used or administered in conjunction with the genetic construct.
- the DNA plasmid vaccines may also include a transfection facilitating agent such as lipids, liposomes, including lecithin liposomes or other liposomes known in the art, as a DNA-liposome mixture (see for example W09324640), calcium ions, viral proteins, polyanions, polycations, or nanoparticles, or other known transfection facilitating agents.
- the concentration of the transfection agent in the vaccine is less than 4 mg/ml, less than 2 mg/ml, less than 1 mg/ml, less than 0.750 mg/ml, less than 0.500 mg/ml, less than 0.250 mg/ml, less than 0.100 mg/ml, less than 0.050 mg/ml, or less than 0.010 mg/ml.
- the adjuvant can be IL-12, IL-15, IL-28, CTACK, TECK, platelet derived growth factor (PDGF), TNFa, TNFp, GM-CSF, epidermal growth factor (EGF), IL- 1, IL-2, IL-4, IL-5, IL-6, IL-10, IL-12, IL-18, or a combination thereof.
- PDGF platelet derived growth factor
- TNFa TNFp
- GM-CSF epidermal growth factor
- EGF epidermal growth factor
- IL- 1, IL-2, IL-4, IL-5, IL-6, IL-10, IL-12, IL-18, or a combination thereof IL-12, IL-15, IL-28, CTACK, TECK, platelet derived growth factor (PDGF), TNFa, TNFp, GM-CSF, epidermal growth factor (EGF), IL- 1, IL-2, IL-4, IL-5, IL-6, IL-10,
- the vaccine may further comprise a genetic vaccine facilitator agent as described in U.S. Serial No. 021,579 filed April 1, 1994, which is fully incorporated by reference.
- Vaccine can further comprise stabilizers including gelatin and albumin.
- stabilizers can allow the formulation to be stable at room or ambient temperature for extended periods of time, including LGS or polycations or polyanions.
- the present invention is also directed to methods of increasing an immune response in a subject by different routes of administration of the vaccine. Increasing the immune response can be used to treat and/or prevent disease in the subject.
- the method can include administering the herein disclosed vaccines to the subject.
- the subject administered the vaccine can have an increased or boosted immune response as compared to a subject administered the antigen alone.
- the immune response in the subject administered the vaccine can be increased by about 18% to about 650%.
- the immune response in the subject administered the vaccine may be increased by about 45% to about 260%.
- the immune response in the subject administered the vaccine may be increased by about 93% to about 130%.
- the administered vaccine can increase or boost the immune response in the subject by at least about 1.5-fold, at least about 2-fold, at least about 2.5-fold, at least about 3 -fold, at least about 4-fold, at least about 5 -fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, or at least about 10-fold.
- the vaccine can be formulated in accordance with standard techniques well known to those skilled in the pharmaceutical art. Such compositions can be administered in dosages and by techniques well known to those skilled in the medical arts taking into consideration such factors as the age, sex, weight, and condition of the particular subject, and the route of administration.
- the subject can be a mammal, such as a human, a horse, a cow, a pig, a sheep, a cat, a dog, a rat, or a mouse.
- the vaccine can be administered prophylactically or therapeutically.
- the vaccines can be administered in an amount sufficient to induce an immune response.
- the vaccines are administered to a subject in need thereof in an amount sufficient to elicit a therapeutic effect.
- An amount adequate to accomplish this is defined as "therapeutically effective dose.” Amounts effective for this use will depend on, e.g., the particular composition of the vaccine regimen administered, the manner of administration, the stage and severity of the disease, the general state of health of the patient, and the judgment of the prescribing physician.
- the vaccine can be administered by methods well known in the art as described in Donnelly et al. (Ann. Rev. Immunol. 15:617-648 (1997)); Feigner et al. (U.S. Pat. No.
- the DNA of the vaccine can be complexed to particles or beads that can be administered to an individual, for example, using a vaccine gun.
- a pharmaceutically acceptable carrier including a physiologically acceptable compound, depends, for example, on the route of administration of the expression vector.
- the vaccines can be delivered via a variety of routes. Typical delivery routes include parenteral administration, e.g., intradermal, intramuscular or subcutaneous delivery. Other routes include oral administration, intranasal, and intravaginal routes.
- parenteral administration e.g., intradermal, intramuscular or subcutaneous delivery.
- Other routes include oral administration, intranasal, and intravaginal routes.
- the vaccine can be delivered to the interstitial spaces of tissues of an individual (Feigner et al, U.S. Pat. Nos. 5,580,859 and 5,703,055, the contents of all of which are incorporated herein by reference in their entirety).
- the vaccine can also be administered to muscle, or can be administered via intradermal or subcutaneous injections, or transdermally, such as by iontophoresis. Epidermal administration of the vaccine can also be employed.
- Epidermal administration can involve mechanically or chemically irritating the outermost layer of epidermis to stimulate an immune response to the irritant (Carson et al, U.S. Pat. No. 5,679,647, the contents of which are incorporated herein by reference in its entirety).
- the vaccine can be a liquid preparation such as a suspension, syrup or elixir.
- the vaccine can also be a preparation for parenteral, subcutaneous, intradermal, intramuscular or intravenous administration (e.g., injectable administration), such as a sterile suspension or emulsion.
- the vaccine can be incorporated into liposomes, microspheres or other polymer matrices (Feigner et al, U.S. Pat. No. 5,703,055; Gregoriadis, Liposome Technology, Vols. Ito III (2nd ed. 1993), the contents of which are incorporated herein by reference in their entirety).
- Liposomes can consist of phospholipids or other lipids, and can be nontoxic, physiologically acceptable and metabolizable carriers that are relatively simple to make and administer.
- the MID may inject the vaccine into tissue without the use of a needle.
- the MID may inject the vaccine as a small stream or jet with such force that the vaccine pierces the surface of the tissue and enters the underlying tissue and/or muscle.
- the force behind the small stream or jet may be provided by expansion of a compressed gas, such as carbon dioxide through a micro-orifice within a fraction of a second. Examples of minimally invasive electroporation devices, and methods of using them, are described in published U.S. Patent Application No. 20080234655; U.S. Patent No. 6,520,950; U.S. Patent No. 7, 171,264; U.S. Patent No. 6,208,893; U.S. Patent NO. 6,009,347; U.S. Patent No. 6, 120,493; U.S. Patent No. 7,245,963; U.S. Patent No. 7,328,064; and U.S. Patent No. 6,763,264, the contents of each of which are herein incorporated by reference.
- the MID may comprise an injector that creates a high-speed jet of liquid that painlessly pierces the tissue.
- injectors are commercially available.
- needle- free injectors examples include those described in U.S. Patent Nos. 3,805,783; 4,447,223; 5,505,697; and 4,342,310, the contents of each of which are herein incorporated by reference.
- Needle-free injectors are well suited to deliver vaccines to all types of tissues, particularly to skin and mucosa.
- a needle-free injector may be used to propel a liquid that contains the vaccine to the surface and into the subject's skin or mucosa.
- Representative examples of the various types of tissues that can be treated using the invention methods include pancreas, larynx, nasopharynx, hypopharynx, oropharynx, lip, throat, lung, heart, kidney, muscle, breast, colon, prostate, thymus, testis, skin, mucosal tissue, ovary, blood vessels, or any combination thereof.
- Electrodes for Mediated Delivery of Drugs and Genes is an array of needles wherein a plurality of pairs of needles may be pulsed during the therapeutic treatment.
- needles were disposed in a circular array, but have connectors and switching apparatus enabling a pulsing between opposing pairs of needle electrodes.
- a pair of needle electrodes for delivering recombinant expression vectors to cells may be used.
- Such a device and system is described in U.S. Patent No. 6,763,264, the contents of which are herein incorporated by reference.
- a single needle device may be used that allows injection of the DNA and electroporation with a single needle resembling a normal injection needle and applies pulses of lower voltage than those delivered by presently used devices, thus reducing the electrical sensation experienced by the patient.
- the MID may consist of a pulse generator and a two or more-needle vaccine injectors that deliver the vaccine and electroporation pulses in a single step.
- the pulse generator may allow for flexible programming of pulse and injection parameters via a flash card operated personal computer, as well as comprehensive recording and storage of electroporation and patient data.
- the pulse generator may deliver a variety of volt pulses during short periods of time. For example, the pulse generator may deliver three 15 volt pulses of 100 ms in duration.
- An example of such a MID is the Elgen 1000 system by Inovio Biomedical Corporation, which is described in U.S. Patent No. 7,328,064, the contents of which are herein incorporated by reference.
- the MID may be a CELLECTRA (Inovio Pharmaceuticals, Blue Bell PA) device and system, which is a modular electrode system, that facilitates the introduction of a macromolecule, such as a DNA, into cells of a selected tissue in a body or plant.
- the modular electrode system may comprise a plurality of needle electrodes; a hypodermic needle; an electrical connector that provides a conductive link from a programmable constant-current pulse controller to the plurality of needle electrodes; and a power source.
- An operator can grasp the plurality of needle electrodes that are mounted on a support structure and firmly insert them into the selected tissue in a body or plant.
- the macromolecules are then delivered via the hypodermic needle into the selected tissue.
- the programmable constant-current pulse controller is activated and constant-current electrical pulse is applied to the plurality of needle electrodes.
- the applied constant-current electrical pulse facilitates the introduction of the macromolecule into the cell between the plurality of electrodes. Cell death due to overheating of cells is minimized by limiting the power dissipation in the tissue by virtue of constant- current pulses.
- the Cellectra device and system is described in U.S. Patent No. 7,245,963, the contents of which are herein incorporated by reference.
- the MID may be an Elgen 1000 system (Inovio Pharmaceuticals).
- the Elgen 1000 system may comprise device that provides a hollow needle; and fluid delivery means, wherein the apparatus is adapted to actuate the fluid delivery means in use so as to concurrently (for example automatically) inject fluid, the described vaccine herein, into body tissue during insertion of the needle into the said body tissue.
- the advantage is the ability to inject the fluid gradually while the needle is being inserted leads to a more even distribution of the fluid through the body tissue. It is also believed that the pain experienced during injection is reduced due to the distribution of the volume of fluid being injected over a larger area.
- the automatic injection of fluid facilitates automatic monitoring and registration of an actual dose of fluid injected.
- This data can be stored by a control unit for documentation purposes if desired.
- the rate of injection could be either linear or non-linear and that the injection may be carried out after the needles have been inserted through the skin of the subject to be treated and while they are inserted further into the body tissue.
- Suitable tissues into which fluid may be injected by the apparatus of the present invention include tumor tissue, skin or liver tissue but may be muscle tissue.
- the apparatus further comprises needle insertion means for guiding insertion of the needle into the body tissue.
- the rate of fluid injection is controlled by the rate of needle insertion. This has the advantage that both the needle insertion and injection of fluid can be controlled such that the rate of insertion can be matched to the rate of injection as desired. It also makes the apparatus easier for a user to operate. If desired, means for automatically inserting the needle into body tissue could be provided.
- a user could choose when to commence injection of fluid. Ideally however, injection is commenced when the tip of the needle has reached muscle tissue and the apparatus may include means for sensing when the needle has been inserted to a sufficient depth for injection of the fluid to commence. This means that injection of fluid can be prompted to commence automatically when the needle has reached a desired depth (which will normally be the depth at which muscle tissue begins).
- the depth at which muscle tissue begins could, for example, be taken to be a preset needle insertion depth such as a value of 4 mm which would be deemed sufficient for the needle to get through the skin layer.
- the sensing means may comprise an ultrasound probe.
- the sensing means may comprise a means for sensing a change in impedance or resistance.
- the means may not as such record the depth of the needle in the body tissue but will rather be adapted to sense a change in impedance or resistance as the needle moves from a different type of body tissue into muscle. Either of these alternatives provides a relatively accurate and simple to operate means of sensing that injection may commence.
- the depth of insertion of the needle can further be recorded if desired and could be used to control injection of fluid such that the volume of fluid to be injected is determined as the depth of needle insertion is being recorded.
- piston driving means may be actuated by the base being moved in the axial direction relative to the housing.
- alternative means for fluid delivery could be provided.
- a closed container which can be squeezed for fluid delivery at a controlled or non-controlled rate could be provided in the place of a syringe and piston system.
- the apparatus described above could be used for any type of injection. It is however envisaged to be particularly useful in the field of electroporation and so it may further comprises means for applying a voltage to the needle. This allows the needle to be used not only for injection but also as an electrode during electroporation. This is particularly advantageous as it means that the electric field is applied to the same area as the injected fluid.
- electroporation There has traditionally been a problem with electroporation in that it is very difficult to accurately align an electrode with previously injected fluid and so user's have tended to inject a larger volume of fluid than is required over a larger area and to apply an electric field over a higher area to attempt to guarantee an overlap between the injected substance and the electric field.
- both the volume of fluid injected and the size of electric field applied may be reduced while achieving a good fit between the electric field and the fluid.
- the present invention has multiple aspects, illustrated by the following non- limiting examples.
- mice were immunized by the
- mice intramuscular route using electroporation.
- An Interferon Gamma ELISpot assay was used to examine the cellular immune response in the immunized groups of mice.
- the presence of IL-23 predominately increased the cellular immune response to the HPV 16 E7 antigen (i.e., pool 2) as compared to the antigen alone. Particularly, IL-23 increased the cellular immune response by about 2-fold. Pool 2 includes the full sequence of the E7 antigen, and pool 1 includes the full sequence of the E6 antigen.
- mice were used as a model system to determine whether IL-23 could function as an adjuvant when the vaccine was administered via an intradermal route.
- the vaccine included a circumsporozoite (CS) antigen from the parasite Plasmodium falciparum and IL- 23.
- the CS antigen and IL-23 were encoded by separate plasmids.
- the CS antigen includes a consensus CS immunogen having the 1239 nucleotide DNA sequence shown below: atgatgcggaagctggctatcctgagcgtgtccagcttcctgttcgtggaggccctgttccaagagtaccagtgctacggcagcagca gcaacacaagagtgctgaacgagctgaactacgacaacgccggcaccaacctgtacaacgagctggaaatgaactactacggcaa gcaggaaactggtacagcctgaagaagaacagccggtcctgggcgagaacgacgacggcaacaacaacggcgacaacggcgacaacggcgacagcagcagagagggcaaggacgaggaggggcctgggcgg
- mice were immunized with the plasmid WLV009-mIL-23 Opt (FIG. 2 and described above in Example 1) and a plasmid encoding the CS antigen as described above.
- a second group of mice were immunized only with the plasmid encoding the CS antigen.
- Mice were immunized via an intradermal route using electroporation.
- An Interferon Gamma ELISpot assay was used to examine the cellular immune response in the immunized groups of mice.
- the presence of IL-23 increased the cellular immune response by greater than 2-fold to the CS antigen as compared to antigen alone.
- IL-23 increased the cellular immune response by about 3-fold. Accordingly, these data indicated that IL-23 is able to function as an adjuvant in skin tissue because IL-23 augmented the cellular immune response to the CS antigen. These data also indicated that IL-23 is able to function as an adjuvant with a parasite antigen.
- IL-23 augmented the cellular immune response in muscle and skin tissues irrespective of the identity or source of the antigen.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Zoology (AREA)
- Virology (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Engineering & Computer Science (AREA)
- Epidemiology (AREA)
- Biochemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Biomedical Technology (AREA)
- Mycology (AREA)
- Biophysics (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Gastroenterology & Hepatology (AREA)
- Toxicology (AREA)
- Dermatology (AREA)
- Neurology (AREA)
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2016501829A JP2016514672A (ja) | 2013-03-15 | 2014-03-13 | 抗原およびアジュバントとしてのインターロイキン−23を有するワクチン |
| US14/775,087 US9669091B2 (en) | 2013-03-15 | 2014-03-13 | Vaccines having an antigen and interleukin-23 as an adjuvant |
| KR1020157028132A KR20150128900A (ko) | 2013-03-15 | 2014-03-13 | 항원 및 어쥬번트로서 인터류킨-23을 갖는 백신 |
| CA2898237A CA2898237A1 (en) | 2013-03-15 | 2014-03-13 | Vaccines having an antigen and interleukin-23 as an adjuvant |
| AU2014235120A AU2014235120B2 (en) | 2013-03-15 | 2014-03-13 | Vaccines having an antigen and interleukin-23 as an adjuvant |
| EP14767446.9A EP2968500A4 (en) | 2013-03-15 | 2014-03-13 | VACCINES WITH ONE ANTIGEN AND INTERLEUKIN-23 AS ADJUVANS |
| CN201480013830.6A CN105209063A (zh) | 2013-03-15 | 2014-03-13 | 具有抗原和作为佐剂的白细胞介素-23的疫苗 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201361788942P | 2013-03-15 | 2013-03-15 | |
| US61/788,942 | 2013-03-15 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2014151279A1 true WO2014151279A1 (en) | 2014-09-25 |
Family
ID=51580923
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2014/025348 Ceased WO2014151279A1 (en) | 2013-03-15 | 2014-03-13 | Vaccines having an antigen and interleukin-23 as an adjuvant |
Country Status (8)
| Country | Link |
|---|---|
| US (1) | US9669091B2 (https=) |
| EP (1) | EP2968500A4 (https=) |
| JP (1) | JP2016514672A (https=) |
| KR (1) | KR20150128900A (https=) |
| CN (1) | CN105209063A (https=) |
| AU (1) | AU2014235120B2 (https=) |
| CA (1) | CA2898237A1 (https=) |
| WO (1) | WO2014151279A1 (https=) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3747459A4 (en) * | 2018-02-02 | 2021-12-01 | SL Vaxigen, Inc. | NEW IMMUNOADJUVANT VACCINE |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DK3054972T3 (da) * | 2013-10-07 | 2019-06-11 | Univ Pennsylvania | Vacciner med interleukin-33 som et adjuvans |
| CN108383913A (zh) * | 2018-02-12 | 2018-08-10 | 四川大学 | 重组猪il-23增强pcv2疫苗免疫佐剂的制备及应用 |
| KR102285977B1 (ko) * | 2019-03-15 | 2021-08-05 | 대한민국 | 오일 에멀젼과 병용 투여 가능한 면역증강용 보조물질 및 이를 포함하는 구제역 백신 조성물 |
| TW202134430A (zh) | 2019-12-03 | 2021-09-16 | 美商紐沃進公司 | 腫瘤細胞疫苗 |
| TW202146435A (zh) * | 2020-03-04 | 2021-12-16 | 美商昂科賽醫藥公司 | 含有病原性抗原及免疫刺激物之組合物 |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003084467A2 (en) * | 2002-04-01 | 2003-10-16 | Euro-Celtique S.A. | Epitope constructs comprising antigen presenting cell targeting mechanisms |
| WO2005108425A1 (en) * | 2004-05-10 | 2005-11-17 | Cytos Biotechnology Ag | Il-23 p19 antigen array and uses thereof |
| US20070048261A1 (en) * | 2003-12-16 | 2007-03-01 | Glaxosmithkline Biologicals S.A. | Vaccine comprising il-12 or il-23 for treatment of autoimmune diseases |
| US20080260765A1 (en) * | 2007-03-15 | 2008-10-23 | Johns Hopkins University | HPV DNA Vaccines and Methods of Use Thereof |
| WO2013090296A1 (en) * | 2011-12-12 | 2013-06-20 | The Trustees Of The University Of Pennsylvania | Compositions, comprising improved il-12 genetic constructs and vaccines, immunotherapeutics and methods of using the same |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| IL113817A (en) * | 1994-06-30 | 2001-03-19 | Merck & Co Inc | Polynucleotide vaccne for papillomavirus |
| BRPI0615400A2 (pt) * | 2005-08-31 | 2011-05-17 | Genvec Inc | vacinas para malária baseadas em vetor adenoviral |
| US7736642B2 (en) * | 2006-02-02 | 2010-06-15 | Globeimmune, Inc. | Yeast-based vaccine for inducing an immune response |
| WO2012009760A1 (en) * | 2010-07-20 | 2012-01-26 | Cephalon Australia Pty Ltd | Anti-il-23 heterodimer specific antibodies |
| WO2012138377A2 (en) * | 2010-10-01 | 2012-10-11 | Trustees Of The University Of Pennsylvania | The use of listeria vaccine vectors to reverse vaccine unresponsiveness in parasitically infected individuals |
| US8802076B2 (en) | 2010-10-04 | 2014-08-12 | Duke University | Compositions and methods for modulating an immune response |
| CN102876684B (zh) * | 2012-09-17 | 2014-10-08 | 青岛康立泰药业有限公司 | 人白细胞介素-12的编码基因、真核宿主细胞和表达方法 |
-
2014
- 2014-03-13 KR KR1020157028132A patent/KR20150128900A/ko not_active Ceased
- 2014-03-13 AU AU2014235120A patent/AU2014235120B2/en not_active Ceased
- 2014-03-13 US US14/775,087 patent/US9669091B2/en active Active
- 2014-03-13 EP EP14767446.9A patent/EP2968500A4/en not_active Withdrawn
- 2014-03-13 CA CA2898237A patent/CA2898237A1/en not_active Abandoned
- 2014-03-13 JP JP2016501829A patent/JP2016514672A/ja active Pending
- 2014-03-13 WO PCT/US2014/025348 patent/WO2014151279A1/en not_active Ceased
- 2014-03-13 CN CN201480013830.6A patent/CN105209063A/zh active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003084467A2 (en) * | 2002-04-01 | 2003-10-16 | Euro-Celtique S.A. | Epitope constructs comprising antigen presenting cell targeting mechanisms |
| US20070048261A1 (en) * | 2003-12-16 | 2007-03-01 | Glaxosmithkline Biologicals S.A. | Vaccine comprising il-12 or il-23 for treatment of autoimmune diseases |
| WO2005108425A1 (en) * | 2004-05-10 | 2005-11-17 | Cytos Biotechnology Ag | Il-23 p19 antigen array and uses thereof |
| US20080260765A1 (en) * | 2007-03-15 | 2008-10-23 | Johns Hopkins University | HPV DNA Vaccines and Methods of Use Thereof |
| WO2013090296A1 (en) * | 2011-12-12 | 2013-06-20 | The Trustees Of The University Of Pennsylvania | Compositions, comprising improved il-12 genetic constructs and vaccines, immunotherapeutics and methods of using the same |
Non-Patent Citations (3)
| Title |
|---|
| GOTHELF ET AL.: "What you always needed to know about electroporation based DNA vaccines", HUM VACCINE IMMUNOTHER, vol. 8, 30 October 2012 (2012-10-30), pages 1694 - 1702, XP055228061 * |
| MATSUI ET AL.: "Adjuvant activities of novel cytokines, interleukin-23 ( IL -23) and IL -27, for induction of hepatitis C virus-specific cytotoxic T lymphocytes in HLA-A*0201 transgenic mice", J VIROL., vol. 78, 1 September 2004 (2004-09-01), pages 9093 - 9104, XP055228063 * |
| See also references of EP2968500A4 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3747459A4 (en) * | 2018-02-02 | 2021-12-01 | SL Vaxigen, Inc. | NEW IMMUNOADJUVANT VACCINE |
| US11844834B2 (en) | 2018-02-02 | 2023-12-19 | Sl Vaxigen, Inc. | Vaccine adjuvant |
Also Published As
| Publication number | Publication date |
|---|---|
| JP2016514672A (ja) | 2016-05-23 |
| CN105209063A (zh) | 2015-12-30 |
| CA2898237A1 (en) | 2014-09-25 |
| AU2014235120B2 (en) | 2017-01-05 |
| EP2968500A1 (en) | 2016-01-20 |
| EP2968500A4 (en) | 2016-06-29 |
| KR20150128900A (ko) | 2015-11-18 |
| US20160030557A1 (en) | 2016-02-04 |
| US9669091B2 (en) | 2017-06-06 |
| AU2014235120A1 (en) | 2015-08-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12280108B2 (en) | Vaccines having an antigen and interleukin-21 as an adjuvant | |
| AU2014235120B2 (en) | Vaccines having an antigen and interleukin-23 as an adjuvant | |
| AU2019210577A1 (en) | Vaccines with CD40 ligand as an adjuvant | |
| US20170182154A1 (en) | Vaccines with interleukin-17 as an adjuvant | |
| US20220211845A1 (en) | Dna encoded il-36 gamma as an adjuvant |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14767446 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2898237 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2014235120 Country of ref document: AU Date of ref document: 20140313 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14775087 Country of ref document: US |
|
| ENP | Entry into the national phase |
Ref document number: 2016501829 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 20157028132 Country of ref document: KR Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2014767446 Country of ref document: EP |