WO2014138379A1 - The telomerator-a tool for chromosome engineering - Google Patents

The telomerator-a tool for chromosome engineering Download PDF

Info

Publication number
WO2014138379A1
WO2014138379A1 PCT/US2014/021158 US2014021158W WO2014138379A1 WO 2014138379 A1 WO2014138379 A1 WO 2014138379A1 US 2014021158 W US2014021158 W US 2014021158W WO 2014138379 A1 WO2014138379 A1 WO 2014138379A1
Authority
WO
WIPO (PCT)
Prior art keywords
telomerator
cassette
host cell
nucleic acid
selectable marker
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2014/021158
Other languages
French (fr)
Inventor
Jef D. Boeke
Leslie Mitchell
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Johns Hopkins University
Original Assignee
Johns Hopkins University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Johns Hopkins University filed Critical Johns Hopkins University
Priority to US14/772,832 priority Critical patent/US10047366B2/en
Publication of WO2014138379A1 publication Critical patent/WO2014138379A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/65Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome
    • C12N15/902Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/905Stable introduction of foreign DNA into chromosome using homologous recombination in yeast
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/80Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites

Definitions

  • THE TELOMERATOR A TOOL FOR CHROMOSOME ENGINEERING
  • the present invention relates to the field of chromosome engineering. More specifically, the present invention provides methods and compositions useful for inducibly linearizing circular DNA molecules in vivo in yeast.
  • Chromosome engineering is the study of genetic modifications that affect large segments of chromosomes. Top down approaches start with pre-existing chromosomes and modify them in vivo by introducing, for instance, large deletions, inversions, or duplications. Bottom up approaches, on the other hand, attempt to design and build chromosomes de novo. In either case, we need a strong understanding not only of chromosomal features that confer mitotic stability, including centromeres, telomeres, and origins of replication, but also the effect of the spatial relationships of these elements with one another and with other chromosomal features like genes.
  • the Saccharomyces cerevisiae genome is an excellent platform to develop tools for chromosome engineering given the ease of genetic manipulation and similarity to higher eukaryotes.
  • the S. cerevisiae genome is composed of 12Mb of DNA inherited via 16 linear chromosomes ranging in size from 270kb to over 1Mb (1).
  • Two important cis elements are required to maintain chromosome stability through mitosis and meiosis: compact point centromeres ( ⁇ 125bp) ensure faithful segregation of sister chromatids (2), and conserved telomere sequences protect the ends of each chromosome and guarantee the maintenance of chromosome length during replication (3, 4).
  • budding yeast tolerates a high degree of chromosomal modifications without affecting viability, for instance: (a) the largest yeast chromosome (IV) can be subdivided into 11 separate mini-chromosomes (5); (b) more than 500kb, including 247 nonessential genes, can be deleted in a single haploid strain (6); (c) any of the 16 chromosomes can be individually destabilized in a diploid cell to generate a chromosomal complement of 2n-l (7); (d) a designer, synthetic chromosome arm, synlXR, was shown to power growth of budding yeast in the absence of the native chromosome sequence (8).
  • the present invention is based, at least in part, on the development of compositions and methods to inducibly convert circular DNA molecules in yeast into stably maintained linear chromosomes.
  • the Telomerator we call this genetic system "The Telomerator.”
  • the cassette encodes a selectable marker gene sequence interrupted by an intron that harbors a homing endonuclease recognition site such as I-Scel.
  • the recognition site is flanked by telomere seed sequences (TeSS), short stretches of minimal yeast telomere sequences.
  • a telomerator cassette comprises a nucleic acid encoding a selectable marker, wherein the nucleic acid encoding a selectable marker comprises an intron comprising an endonuclease recognition site flanked by telomere seed sequences.
  • the intron is the ACT 1 intron.
  • a telomerator cassette can also be referred to as a cassette, an expression cassette, a nucleic acid construct, a construct or simply, a composition.
  • a telomerator cassette comprises a nucleic acid encoding a selectable marker, wherein the nucleic acid encoding a selectable marker comprises an endonuclease recognition site flanked by telomere seed sequences.
  • the site and flanking sequences are inserted in-frame into the nucleic acid sequence encoding the selectable marker to allow expression.
  • the endonuclease recognition site flanked by telomere seed sequences comprises SEQ ID NO:4.
  • a telomerator cassette comprises a nucleic acid encoding a selectable marker, wherein the nucleic acid encoding the selectable marker comprises an endonuclease recognition site flanked by telomere seed sequences such that the selectable marker retains its function.
  • a telomerator cassette comprises a nucleic acid encoding a selectable marker, wherein the nucleic acid encoding a selectable marker comprises the original marker sequence operably linked as a protein fusion with an endonuclease recognition site flanked by telomere seed sequences.
  • the marker is an auxotrophic marker.
  • auxotrophic markers can include, but are not limited to, LEU2, URA3, TRPl, MET 15, LYSl, and HIS3.
  • the auxotrophic marker is the URA3 gene.
  • the marker is a drug selection marker and may include, but is not limited to, nourseothrecin (NAT), geneticin, and hygromycin
  • the selectable marker is both selectable and
  • a counterselectable marker e.g., CYH2 (counterselectable on cycloheximide), can be fused to any other selectable marker by joining the two open reading frames in such a way that both moieties are functional.
  • the endonuclease recognition site is specific for I-Scel.
  • the I-Scel endonuclease recognition site comprises SEQ ID NO:2.
  • the endonuclease may comprise restriction endonucleases, Zinc finger nucleases, TALENs or other meganucleases.
  • the telomere seed sequences comprise minimal telomere seed sequences.
  • the telomere seed sequences for yeast comprise [(TG ( i_3)) i6 ...(C ( i_ 3 ) A)i 6 ].
  • the telomere seed sequences comprise SEQ ID NO: 1 and SEQ ID NO:3.
  • a circular chromosome comprises a telomerator cassette described herein.
  • a eukaryotic host cell comprises a circular chromosome of the present invention.
  • the eukaryote is yeast.
  • the yeast is S. cerevisiae.
  • the yeast is Hansenula polymorpha, Pichia pastoris or Schizosaccharomyces pombe.
  • the eukaryotic host cell comprises a vector encoding the endonuclease under the control of an inducible promoter.
  • the inducible promoter is the GAL1 promoter.
  • Other promoters can include, but are not limited to, pMET15, pCUP2, other pGAL sequences, and TetON/TetOFF systems.
  • a telomerator cassette of the present invention comprises a nucleic acid that encodes the auxotrophic marker URA3, wherein the nucleic acid comprises an intron that comprises the I-Scel endonuclease recognition site flanked by telomere seed sequences.
  • the telomere seed sequences comprise SEQ ID NO: l and SEQ ID NO:3.
  • the I-Scel endonuclease recognition site comprises SEQ ID NO:2.
  • a circular chromosome can comprise a telomerator cassette described herein.
  • a yeast host cell comprises a circular chromosome described herein.
  • the yeast host cell may comprise a vector encoding the I-Scel endonuclease under the control of an inducible promoter. More specifically, the inducible promoter can be the GAL1 promoter.
  • a yeast host cell comprises a circular chromosome comprising a telomerator cassette encoding a selectable marker, wherein the nucleic acid encoding the selectable marker comprises an intron that comprises an endonuclease recognition site flanked by telomere seed sequences; and a vector encoding the endonuclease under the control of an inducible promoter.
  • the selectable marker is an auxotrophic marker.
  • the auxotrophic marker is the URA3 gene.
  • the endonuclease recognition site is specific for I-Scel. More specifically, the I-Scel endonuclease recognition site comprises SEQ ID NO:2.
  • the telomere seed sequences can comprise SEQ ID NO: l and SEQ ID NO:3.
  • a method for engineering a circular chromosome capable of being inducibly linearized comprises the step of integrating a telomerator cassette into a circular chromosome, wherein the telomerator cassette comprises a nucleic acid encoding a selectable marker, wherein the nucleic acid encoding a selectable marker comprises an intron comprising an endonuclease recognition site flanked by telomere seed sequences.
  • the integrating step is accomplished by transforming a telomerator cassette into a host cell comprising the circular chromosome.
  • the host cell comprises a vector encoding the endonuclease under the control of an inducible promoter.
  • FIG. 1 Telomerator Design and Function.
  • the telomerator encodes a selectable URA3 gene sequence interrupted by an intron (ACT1 intron) that harbors a homing endonuclease recognition site (I-Scel). The recognition site is flanked by telomere seed sequences (TeSS).
  • the telomerator cassette is encoded on a circular DNA molecule yielding cells that grow on medium lacking uracil (Ura ) but are sensitive to the uracil
  • FIG. 2 The telomerator complements yeast cell growth on medium lacking uracil. Plasmids encoding either a native URA3 gene (left), a URA3 gene interrupted by the intron of ACT1 (middle), or a URA3 gene interrupted by a telomerator sequence encoded within the ACT1 intron (right), were transformed into a yeast strain (BY4741) incapable of growing on medium lacking uracil (SC-Ura). Growth of the resulting transformed colonies on SC-Ura was indistinguishable indicating normal expression of the URA3 gene product from the telomerator-encoding construct.
  • FIG. 3 The telomerator drives in vivo linearization of a synthetic yeast chromosome arm, synlXR BAC.
  • synlXR BAC is a ⁇ 100kb circular chromosome arm that can power a yeast cell.
  • the telomerator cassette was introduced by homologous recombination at two gene-free regions oisynlXR BAC as indicated
  • FIG. 4 Circular permutation of a synthetic eukaryotic chromosome, synlXR BAC.
  • telomerator cassette was integrated downstream of each indicated gene, and growth of strains, pre- (circular) and post- linearization (linear), was assessed at 30°C (top) or 37°C (bottom) on rich medium. Shown here are 10-fold serial dilutions after two days growth. Permuted strains not pictured here did not exhibit growth defects.
  • the circular form oisynlXR BAC is not detectable on pulsed field gel.
  • O circular;
  • linear.
  • FIG. 5 Deletion of S1R2 rescues growth defects oisynlXR BAC circular permutations.
  • the SIR2 gene was deleted in the each of the 54 unique telomerator-containing synlXR BAC strains. Following transformation of the pGALl-I-Scel construct and growth in galactose, linear permutations were isolated on Foa medium. Shown here are 10-fold serial dilutions after two days growth on rich medium (YPD) at the indicated temperatures. Only the permuted strains corresponding to those pictured in 4b are shown.
  • YPD rich medium
  • FIG. 6 PCR confirmation of integration and circular/linear status. All permutations were tested, pre- and post-linearization (circular and linear, respectively), by PCR using two primer sets.
  • integration was confirmed using a gene-specific primer in combination with a primer that annealed within the telomerator (green arrows). These primers confirmed the presence of this region in either the linear or circular conformation oisynlXR in all strains.
  • a primer pair designed to anneal to the ACT1 intron red arrows was used. This primer pair amplifies a product from the endogenous ACT1 intron at its native locus on chromosome six, as well as from an intact telomerator cassette. Following growth in galactose, absence of this band is consistent with linearization.
  • FIG. 7 Position effect of genes expected to impact cell fitness.
  • Left panel Fitness defects in linearized strains (as in FIG. 3b).
  • Right panel Orientation and approximate location on linearized synlXR of essential ORFs and ORFs required for fast growth.
  • Chromosome engineering is an emerging focus in the fields of systems biology, genetics, synthetic biology, and the functional analysis of genomes.
  • the 'telomerator' a new synthetic biology device designed to inducibly linearize circular DNA molecules in vivo in Saccharomyces cerevisiae.
  • synlXR BAC linear variants of a synthetic yeast chromosome originally built as a circular molecule
  • synlXR BAC By circularly permuting synlXR BAC using the telomerator, we generated an array of 53 different linearized chromosome structures, many of which confer novel phenotypic properties. This tool offers a new way to study the effect of gene placement on chromosomes (i.e.
  • telomere proximity the essentiality of 3 ' non-coding regions of genes, and the plasticity of gene order and chromosome structure on cell fitness.
  • the telomerator will be an important tool to generate artificial, linear chromosomes in yeast and the concept could be extended to other eukaryotes including mammals and human cells.
  • nucleic acid or “polynucleotide” refers to a polymeric form of nucleotides of any length, either ribonucleotides and/or deoxyribonucleotides. These terms include a single-, double- or triple-stranded DNA, genomic DNA, cDNA, RNA, DNA-RNA hybrid, or a polymer comprising purine and pyrimidine bases, or other natural, chemically,
  • the backbone of the nucleic acid can comprise sugars and phosphate groups (as may typically be found in RNA or DNA), or modified or substituted sugar or phosphate groups.
  • the backbone of the nucleic acid can comprise a polymer of synthetic subunits such as phosphoramidates and thus can be an oligodeoxynucleoside phosphoramidate (P-NH 2 ) or a mixed phosphoramidate- phosphodiester oligomer.
  • a double-stranded nucleic acid can be obtained from the single stranded nucleic acid product of chemical synthesis either by synthesizing the complementary strand and annealing the strands under appropriate conditions, or by synthesizing the complementary strand de novo using a DNA polymerase with an appropriate primer.
  • nucleic acids a gene or gene fragment, exons, introns, mRNA, tRNA, rRNA, ribozymes, cDNA, recombinant nucleic acids, branched nucleic acids, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers.
  • a nucleic acid may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs, uracyl, other sugars and linking groups such as fluororibose and thioate, and nucleotide branches.
  • the sequence of nucleotides may be interrupted by non-nucleotide components.
  • a nucleic acid may be further modified after polymerization, such as by conjugation with a labeling component. Other types of modifications included in this definition are caps, substitution of one or more of the naturally occurring nucleotides with an analog, and introduction of means for attaching the nucleic acid to proteins, metal ions, labeling components, other nucleic acids, or a solid support.
  • operably linked means that nucleic acid sequences or proteins are operably linked when placed into a functional relationship with another nucleic acid sequence or protein.
  • a promoter sequence is operably linked to a coding sequence if the promoter promotes transcription of the coding sequence.
  • a repressor protein and a nucleic acid sequence are operably linked if the repressor protein binds to the nucleic acid sequence.
  • a protein may be operably linked to a first and a second nucleic acid sequence if the protein binds to the first nucleic acid sequence and so influences transcription of the second, separate nucleic acid sequence.
  • operably linked means that the DNA sequences being linked are contiguous, although they need not be, and that a gene and a regulatory sequence or sequences (e.g., a promoter) are connected in such a way as to permit gene expression when the appropriate molecules (e.g., transcriptional activator proteins— transcription factors— or proteins which include transcriptional activator domains) are bound to the regulatory sequence or sequences.
  • a gene and a regulatory sequence or sequences e.g., a promoter
  • Plasmid refers to an extrachromosomal circular DNA capable of autonomous replication in a given cell.
  • the plasmid is designed for amplification and expression in bacteria. Plasmids can be engineered by standard molecular biology techniques. See Sambrook et al, Laboratory Manual, Cold Spring Harbor
  • expression vector is used interchangeably herein with the term “plasmid” and refers to a recombinant DNA molecule containing a desired coding sequence and appropriate nucleic acid sequences necessary for expression of the operably linked coding sequence (e.g. an insert sequence that codes for a product) in a particular host cell.
  • Nucleic acid sequences necessary for expression in prokaryotes usually include a promoter, an operator (optional), and a ribosome binding site, often along with other sequences.
  • promoter refers to the DNA region, usually upstream of the coding sequence of a gene or operon, which binds RNA polymerase and directs the enzyme to the correct transcriptional start site.
  • endonucleases refers to any wild-type or variant enzyme capable of catalyzing the hydrolysis (cleavage) of bonds between nucleic acids within a DNA or RNA molecule, preferably a DNA molecule. Endonucleases do not cleave the DNA or RNA molecule irrespective of its sequence, but recognize and cleave the DNA or RNA molecule at specific polynucleotide sequences, further referred to as "target sequences" or "target sites”. Endonucleases can for example be a homing endonuclease (Paques et al, Curr Gen Ther.
  • ZFN Zinc-Finger nuclease
  • a chemical or peptidic cleaver is conjugated either to a polymer of nucleic acids or to another DNA recognizing a specific target sequence, thereby targeting the cleavage activity to a specific sequence.
  • Chemical endonucleases also encompass synthetic nucleases like conjugates of orthophenanthroline, a DNA cleaving molecule, and triplex-forming oligonucleotides (TFOs), known to bind specific DNA sequences (Kalish and Glazer Ann NY Acad Sci 2005 1058: 151-61 ). Such chemical endonucleases are considered to fall within the scope of the term "endonuclease” according to the present invention. Also within the scope of the present invention is intended any fusion between molecules able to bind DNA specific sequences and agent/reagent/chemical able to cleave DNA or interfere with cellular proteins implicated in the double strand break (DSB) repair (Majumdar et al, J. Bioi.
  • a fusion can be constituted by a specific DNA-sequence binding domain linked to a chemical inhibitor known to inhibit re-ligation activity of a topoisomerase after DSB cleavage.
  • Endonucleases can comprise a homing endonuclease, also known under the name of meganuclease.
  • the term "meganuclease" refers to an endonuclease having a double-stranded DNA target sequence of about 12 to about 45 base pairs (bp).
  • homing endonucleases are well-known to the art (see e.g. Stoddard, Quarterly Reviews of Biophysics, 2006, 38:49-95). Homing endonucleases recognize a DNA target sequence and generate a single- or double-strand break. Homing endonucleases are highly specific, recognizing DNA target sites ranging from 12 to 45 base pairs (bp) in length, usually ranging from about 14 to about 40 bp in length.
  • the homing endonuclease according to the invention may for example correspond to a LAGLIDADG endonuclease, to a HNH endonuclease, or to a GIY-YIG endonuclease.
  • a meganuclease is either a dimeric enzyme, wherein each domain is on a monomer or a monomeric enzyme comprising the two domains on a single polypeptide.
  • Endonucleases according to the invention can also be derived from TALENs, a new class of chimeric nucleases using a Fokl catalytic domain and a DNA binding domain derived from Transcription Activator Like Effector (TALE), a family of proteins used in the infection process by plant pathogens of the Xanthomonas genus (Boch, Scholze et al. 2009; Moscou and Bogdanove 2009; Christian, Cermak et al, 201 0; Li, Huang et al, 201 1) (Boch, Scholze et al, 2009; Moscou and Bogdanove 2009; Christian, Cermak et al, 201 0; Li, Huang et al, 2010).
  • TALE Transcription Activator Like Effector
  • TALEN Fokl-based TALE-nuclease
  • the functional layout of a Fokl-based TALE-nuclease is essentially that of a ZFN, with the Zinc-finger DNA binding domain being replaced by the TALE domain.
  • DNA cleavage by a TALEN requires two DNA recognition regions flanking an unspecific central region.
  • Endonucleases encompassed in the present invention can also be derived from TALENs.
  • An endonuclease according to the present invention can be derived from a TALE- nuclease (TALEN), i. e. a fusion between a DNA-binding domain derived from a Transcription Activator Like Effector (TALE) and one or two catalytic domains.
  • TALE Transcription Activator Like Effector
  • CRISPR/Cas systems may be used. See Mali P, Yang L, Esvelt KM, Aach J, Guell M, Dicarlo JE, Norville JE, Church GM: RNA-guided human genome engineering via Cas9. Science 2013; Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, Zhang F: Multiplex genome engineering using CRISPR/Cas systems. Science 2013; Cho SW, Kim S, Kim JM, Kim JS: Targeted genome engineering in human cells with the Cas9 RNA-guided endonuclease.
  • selectable marker refers to a phenotypic trait conferred on transformed cells that protects them from a selective agent in their environment, i.e., the growth media.
  • selectable markers include, but are not limited to, antibiotic resistance markers (e.g., genes encoding resistance to kanamycin, ampicillin, chloramphenicol, gentamycin, or tetracycline), metabolic markers (e.g., amino acid synthesis genes or transfer RNA genes) and auxotrophic markers.
  • vector refers to a nucleic acid construct designed for transduction/transfection of one or more cell types.
  • Vectors may be, for example, "cloning vectors” which are designed for isolation, propagation and replication of inserted nucleotides, "expression vectors” which are designed for expression of a nucleotide sequence in a host cell.
  • replication means duplication of a vector.
  • Any yeast cell can be used in the methods of the present invention.
  • a yeast species within the genus of Saccharomyces particularly, a yeast species within the genus of Saccharomyces , particularly
  • Saccharomyces cerevisiae are used.
  • suitable yeast species include, but are not limited to, Hansenula polymorpha, Pichia pastoris, and Schizosaccharomyces pombe.
  • yeast strains or derivative strains are known in the art. The application and optional modification of such strains for purposes of the present invention should be apparent to a skilled artisan apprised of the present disclosure.
  • telomerator a genetic tool that can inducibly linearize circular DNA molecules in vivo.
  • BAC bacterial artificial chromosome
  • Our results support that telomerator-induced linearization generates linear chromosomes with functional telomeres on which heterochromatin is fully established.
  • telomeres have very little impact on mitotic stability (16, 23).
  • X and Y' elements located in subtelomeric regions of native S. cerevisiae chromosomes have little or no impact on mitotic stability (23).
  • the telomerator represents a new and convenient way to linearize circular DNA molecules in vivo in 5 * . cerevisiae and can be applied to the construction of artificial chromosomes. Here we demonstrate its utility by circularly permuting a pre-existing circular synthetic chromosome in yeast - synlXR.
  • telomere seed sequences that correspond to native yeast telomeres
  • ease with which a telomerator construct can be PCR amplified and thus integrated at multiple unique loci (iii) the method gives virtually 100% correct clones with no requirement for cumbersome screening approaches; and (iv) the inducible control over timing of linearization in vivo.
  • telomeres and centromeres displayed surprisingly little variation in behavior, suggesting that the relative placement of telomeres and centromeres in 5 * . cerevisiae is quite flexible.
  • linearization at either YIL001 W or YIR001C produces telocentric versions oisynlXR with only ⁇ lkb separating the centromere from a telomere; that these permutations exhibit no apparent growth defect is consistent with previous work suggesting telocentric chromosomes in budding yeast are mitotically stable (16, 23).
  • the telomerator provides a flexible new strategy to aid in the construction and expression of supernumerary chromosomes encoding non- native pathways that give a multitude of new functions to the cell. In principle, this technology can be extended to other eukaryotic organisms, especially those with point/small centromeres like budding yeast. Applying the telomerator to chromosome engineering in mammalian cells will be more challenging as 'regional' mammalian centromeres can extend for hundreds of kilobases and include repetitive sequences. Artificially generated human minichromosomes, existing as either linear or circular constructs, have been described and they may serve as a starting point for mammalian artificial chromosome engineering (24-30).
  • the recognition sequence of the enzyme must be sufficiently rare within the sequence of the host genome (i.e., no or few existing sites) to work without causing "collateral damage" in the rest of the genome.
  • the I-Scel site is not present in yeast nuclear genome (31).
  • selectable/counterselectable markers could also be employed.
  • TeSS-I-Scel-TeSS sequence is "in- frame" with the selectable marker sequence (i.e., a multiple of 3) such that the resulting protein translation would not be truncated.
  • the TeSS-I-Scel-Tess sequence is inserted into the selectable marker in a position that would not disrupt function of the resulting protein product.
  • TeSSs Shorter TeSSs have been described in the literature (Yamagishi 2008 Appl Microbiol Biotechnol 79:699-706), and could be employed in this so-called Telomerator-fusion protein model in order to increase the stability of the highly repetitive TeSS sequences.
  • yeast species This work should be easily expandable to other yeast species. This is relevant in the academic setting, where fungal species other than S. cerevisiae are becoming increasingly commonplace (i.e., Ashbya gossypii, Candida glabrata, Pichia pastoris etc.). Furthermore, many yeast species are used industrially, exploiting unique properties beneficial to the process of interest (e.g., P. pastoris, high-level secreted protein production; A. gossypii, riboflavin production). Similarly, the approach could almost certainly be expanded to other eukaryotic microorganisms such as algae, and potentially to various tissue culture cells.
  • TeSS-I-Scel sequence was introduced by one- step isothermal assembly(32) into the unique Xhol site encoded centrally within the ACT1 intron that had been previously transplanted into URA3(12). Specifically, the TeSS-I-Scel- TeSS sequence
  • URA3-intronACTl-TeSS-I-Sce-I-TeSS-intronACTl-URA3 cassette was verified by functional complementation assay as described in the text.
  • Pulsed Field Gel Electrophoresis Full length yeast chromosomes were prepared in agarose plugs as previously described (34). Chromosomes were separated by clamped homogeneous electric field (CHEF) gel electrophoresis using the CHEF-DR III Pulsed Field Electrophoresis Systems (Biorad) with the following settings: 6V/cm, switch time 60-120 seconds over 24 hours, 14°C, 0.5X TBE, 1% gel prepared with low melting point agarose (Lonza, 50100). Gels were stained with 5ug/ml ethidium bromide in water post- electrophoresis and then imaged.
  • CHEF homogeneous electric field
  • sir2AkanMX locus was amplified from the deletion mutant collection strain (35) using primers ⁇ 500bp flanking the gene deletion and subsequently transformed into the array of permutable strains by selection on YP supplemented with 200 ⁇ g/mL geneticin. SIR2 gene deletion was confirmed functionally by confirming the loss of mating proficiency.
  • Example 1 Telomerator Design and Function/Application.
  • the design of the telomerator includes several different elements (FIG. 1A).
  • the telomerator encodes an 18 base pair recognition sequence for the I-Scel homing endonuclease(9, 10). This site is flanked by a pair of convergent telomere seed sequences (TeSS) that encode ⁇ 40bp of conserved yeast telomere repeats [(TG( 1 - 3)) 1 6 ... (C(i_3)A)i 6 ] previously shown to serve as a minimal telomeric repeat(ii) (FIG. IB).
  • TeSS convergent telomere seed sequences
  • TeSS-I-Scel-TeSS sequence is encoded within an intron that interrupts the URA3 S. cerevisiae auxotrophic selectable marker coding sequence.
  • transplantation of the ACT1 gene intron into the middle of the URA3 coding sequence did not disrupt complementation on medium lacking uracil, indicating the mRNA was expressed and the non-native intron correctly spliced prior to translation of the URA3 gene product (12).
  • the overall design of the telomerator is as follows: 5'-L « ⁇ 3exo «7-intron ⁇ Cr;-TeSS-I-SceI-TeSS-introiL4Cr;-L « ⁇ 3exo «2-3 '.
  • I-Scel homing endonuclease which recognizes and cleaves the 18bp I-Scel recognition site, can linearize a circular DNA molecule encoding the telomerator.
  • I-Scel expression can be placed under control of the inducible GAL1 promoter and thus linearization driven specifically by growth in medium containing galactose. Under standard growth conditions in glucose medium, the telomerator cassette should remain intact with cells expressing a functional Ura3 protein, complementing growth of a ura3A0 strain on medium lacking uracil.
  • the linearization reaction can be selected on 5-fluoroorotic acid (Foa) medium, which counters elects against URA3 + cells (13); a circular telomerator-containing molecule will grow on medium lacking uracil and die on FOA, but a cell harboring a linearized molecule, in which the URA3 gene component of the telomerator is literally split in two, should display the opposite growth phenotype (Ura ⁇ , Foa R [uracil requiring and resistant to Foa]) (FIG. 1A).
  • Foa 5-fluoroorotic acid
  • telomerator cassette in pRS413, a centromere- based yeast shuttle vector encoding the HIS3 selectable marker (14).
  • the telomerator- containing construct was transformed into BY4741, a yeast strain with a complete URA3 deletion (ura3A0) (15), and plated on medium lacking uracil.
  • TeSS-I-Scel-TeSS sequence Growth of cells transformed with any of the three constructs on medium lacking uracil was indistinguishable (FIG. 2). Thus, the presence of the TeSS-I- Scel-TeSS sequence within the ACT1 intron interrupting the URA3 gene does not interfere with growth on medium lacking uracil.
  • Example 3 The Telomerator Can Inducibly Linearize Circular DNA Molecules In
  • telome length has important consequences for mitotic stability as linear chromosomes shorter than 90 kb exhibit markedly decreased stability (16). Therefore, we tested the capacity of the telomerator to linearize circular DNA molecules in vivo using synlXR, a synthetic yeast chromosome arm corresponding to the right arm of chromosome nine previously constructed as a bacterial artificial chromosome (BAC) (8, 17) approximately lOOkb long.
  • BAC bacterial artificial chromosome
  • SynlXR encodes all 52 genes from the right arm of chromosome 9 (YIR001C- YIR044C), 2 genes from the left arm (YIL001 W, YIL002C), the native chromosome 9 centromere (CEN9), a yeast selectable marker (LEU2), plus ⁇ 10kb of BAC vector sequence including the chloramphenicol resistance gene (FIG. 3A).
  • synlXR which encodes seven essential genes, was previously shown to be mitotically stable in vivo and power yeast cell growth at wild type levels in the absence of the wild type chromosome arm IXR(8).
  • telomerator cassette Two 'gene-free' regions oisynlXR BAC were chosen as initial integration sites for the telomerator cassette, which was then introduced by homologous recombination to generate two new strains for linearization. Additionally, the URA3exonl-intronACTl-URA3exon2 cassette (12), lacking the TeSS-I-Scel-TeSS sequence, was integrated at the same two positions to generate equivalent, but non-linearizeable control strains. All four strains were transformed with a plasmid expressing pGALl-I-Scel, grown in galactose medium for 24 hours, and finally -200 cells were plated on YPD, permissive yeast medium containing dextrose.
  • telomere-promixal gene positioning that could lead to subtelomeric silencing.
  • linearization could disrupt either 5' or 3' regulatory elements that drive their transcription.
  • synlXR BAC encodes a 34 base pair site-specific recombination site (loxPsym) at this position downstream of every non-essential gene on the BAC with no effect on cell fitness (FIG. 3A).
  • telomerator cassette integration at each of the 47 non-essential genes we "overwrote" the loxPsym site, and for the 7 essential genes that had no pre-exiting loxPsym site we inserted the cassette cleanly 3 base pairs downstream of the stop codon (FIG. 4A). Integration at the correct locus was confirmed for all 54 permutable strains by PCR using a gene-specific primer in combination with a primer that annealed within the telomerator (FIG. 6). We found that at all 54 loci integration of the telomerator caused no noticeable change in fitness (FIG. 4B and data not shown).
  • the promoter region of the telomerator-encoded URA3 contains a terminator sequence that would polyadenylate incoming transcripts; thus integration of the telomerator 3' to any gene, while disrupting native 3 ' end forming sequences, provides a built-in, non-native terminator sequence for the resulting transcript.
  • the pGAL-I-Scel construct was transformed into the 54 strains, which were grown in galactose medium for 24 hours to induce linearization. Foa resistant cells were selected, enabling isolation of the permuted array of linearized s ft/ZR-containing strains.
  • synlXR BACs were linearized, full- length chromosomes from six permuted strains, pre- and post-linearization were chosen and separated by pulse-field gel electrophoresis. Only telomerator-integrated strains subjected to growth in galactose exhibited a band on the gel corresponding to the linearized form of synlXR (FIG. 4C). Of the 54 sites into which the telomerator had been integrated, 53 could be linearized and give rise to viable FoaR colonies. At just one position, YIR013C, linearization of synlXR was lethal (FIG. 4B).
  • YIR013C encodes a non-essential, GATA family zinc finger motif containing protein with no annotated function. While not lethal, many other permuted chromosomes resulted in modest growth defects at 30°C (FIG. 4B). At 37°C, almost half of all permuted strains grew very slowly. Together, the data indicate that telomerator-induced linearization provides a new way to generate novel phenotypes.
  • Example 5 Telomeric Silencing Mediates Fitness Defects of Linearized synlXR Permutations.
  • telomeric silencing could underlie the fitness defects observed in many of the linear permutations ⁇ synlXR (FIG. 3B).
  • Telomeric silencing, or the transcriptional repression of genes in proximity to telomeres is an epigenetic phenomenon relying on the establishment of heterochromatin that spreads from the ends of chromosomes inwards. Linearization-dependent re-location of essential genes into sub-telomeric regions and the subsequent reduction in expression could have a major impact on impact cell fitness and/or survival.
  • mapping the position of the seven essential genes onto the array of linearized permutations of synlXR suggests that fitness defects tend to occur in strains in which one or more essential genes are re-located to within lOkb of a telomere (FIG. 7). Consequently, they might be subject to silencing, a process mediated in part by the lysine deacetylase enzyme Sir2 (18), which deacetylates histone H4 (19).
  • Sir2 lysine deacetylase enzyme
  • telomerator clearly provides a new means to probe epigenetic regulation and chromatin architecture as we show that proper gene expression can depend on the chromosomal location/environment in which a gene is positioned.
  • Example 6 Another Telomerator Sequence.
  • Another approach to introduce the Telomerator sequence into a circular DNA molecule for linearization is to include the TeSS- I-Scel-TeSS sequence as part of the protein coding sequence of the selectable marker.
  • the TeSS-I-Scel-TeSS sequence is "in-frame" with the selectable marker sequence (i.e., a multiple of 3) such that the resulting protein translation would not be truncated.
  • the TeSS-I-Scel-Tess sequence is inserted into the selectable marker in a position that would not disrupt function of the resulting protein product.
  • SEQ ID NO:9 shows the TeSS-IScel-TeSS sequence encoded within the native URA3 coding sequence:
  • SEQ ID NO:9 A construct encoding SEQ ID NO:9 was built and transformed into yeast. Plasmids were recovered from colonies that grew on SC-Ura plates and sequenced. Clone 1 has the following sequence:
  • Clone 3 has the following sequence: atgTGTGTGGTGTGGGTGTGTGTGGGTGTGTGGGTGTGTGGGTAGGGATAACAG GGTAATCACCCACCACACACACCCACACACACCACACACCCACCCAtcgaaaggaacgtgctactcatcctagtcctgttgctgccaagctatttaatatcatgcacgaaaagcaacaaacttgtgtgcttcattgg atgttcgtaccaccaaggaattactggagttagttgaagcattaggtcccaaaatttgtttactaaaaacacatgtggatatcttgactgatttt tccatggagggcacagttaagccgctaaaggcattatccgccaagtttttaaggcattatccgccaagtttaaggcattatccgcca
  • Clone 4 has the following sequence:
  • TeSS repeats are unstable in the absence of selection (i.e., growth on SC-Ura), likely due to slippage during DNA replication.
  • Clone 3 matches exactly the designed sequence, suggesting this design can indeed complement growth.
  • Two out of four clones have a truncated CA repeat, which likely increases the stability.
  • Other embodiments of the telomerator can incorporate this design to generate a more stable construct.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Mycology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to the field of chromosome engineering. More specifically, the present invention provides methods and compositions useful for inducibly linearizing circular DNA molecules in vivo in yeast. In one embodiment, a comprises a nucleic acid encoding a selectable marker, wherein the nucleic acid encoding a selectable marker comprises an intron comprising an endonuclease recognition site flanked by telomere seed sequences.

Description

THE TELOMERATOR— A TOOL FOR CHROMOSOME ENGINEERING
CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 61/773,206, filed March 6, 2013, which is incorporated herein by reference in its entirety.
STATEMENT OF GOVERNMENTAL INTEREST
This invention was made with government support under grant number
MCB 1026068, awarded by the National Science Foundation. The government has certain rights in the invention.
FIELD OF THE INVENTION
The present invention relates to the field of chromosome engineering. More specifically, the present invention provides methods and compositions useful for inducibly linearizing circular DNA molecules in vivo in yeast.
TNCORPORATION-BY-REFERENCE OF MATERIAL SUBMITTED
ELECTRONICALLY
This application contains a sequence listing. It has been submitted electronically via EFS-Web as an ASCII text file entitled "P12280-02_Sequence_Listing.txt." The sequence listing is 8,462 bytes in size, and was created on March 6, 2014. It is hereby incorporated by reference in its entirety.
BACKGROUND OF THE INVENTION
Chromosome engineering is the study of genetic modifications that affect large segments of chromosomes. Top down approaches start with pre-existing chromosomes and modify them in vivo by introducing, for instance, large deletions, inversions, or duplications. Bottom up approaches, on the other hand, attempt to design and build chromosomes de novo. In either case, we need a strong understanding not only of chromosomal features that confer mitotic stability, including centromeres, telomeres, and origins of replication, but also the effect of the spatial relationships of these elements with one another and with other chromosomal features like genes.
The Saccharomyces cerevisiae genome is an excellent platform to develop tools for chromosome engineering given the ease of genetic manipulation and similarity to higher eukaryotes. The S. cerevisiae genome is composed of 12Mb of DNA inherited via 16 linear chromosomes ranging in size from 270kb to over 1Mb (1). Two important cis elements are required to maintain chromosome stability through mitosis and meiosis: compact point centromeres (~125bp) ensure faithful segregation of sister chromatids (2), and conserved telomere sequences protect the ends of each chromosome and guarantee the maintenance of chromosome length during replication (3, 4). With these elements intact, many lines of evidence indicate budding yeast tolerates a high degree of chromosomal modifications without affecting viability, for instance: (a) the largest yeast chromosome (IV) can be subdivided into 11 separate mini-chromosomes (5); (b) more than 500kb, including 247 nonessential genes, can be deleted in a single haploid strain (6); (c) any of the 16 chromosomes can be individually destabilized in a diploid cell to generate a chromosomal complement of 2n-l (7); (d) a designer, synthetic chromosome arm, synlXR, was shown to power growth of budding yeast in the absence of the native chromosome sequence (8).
SUMMARY OF THE INVENTION
The present invention is based, at least in part, on the development of compositions and methods to inducibly convert circular DNA molecules in yeast into stably maintained linear chromosomes. We call this genetic system "The Telomerator." In brief, we can introduce a "telomerator cassette" by homologous recombination into any circular DNA intended to be linearized, in principle, at any position. The cassette encodes a selectable marker gene sequence interrupted by an intron that harbors a homing endonuclease recognition site such as I-Scel. The recognition site is flanked by telomere seed sequences (TeSS), short stretches of minimal yeast telomere sequences. When the endonuclease is inducibly expressed, circular DNA is efficiently linearized and subsequently stably maintained due to the presence of the terminal TeSSs.
Accordingly, in one aspect, the present invention provides a telomerator cassette. In one embodiment, a telomerator cassette comprises a nucleic acid encoding a selectable marker, wherein the nucleic acid encoding a selectable marker comprises an intron comprising an endonuclease recognition site flanked by telomere seed sequences. In a specific embodiment, the intron is the ACT 1 intron. A telomerator cassette can also be referred to as a cassette, an expression cassette, a nucleic acid construct, a construct or simply, a composition.
In another embodiment, a telomerator cassette comprises a nucleic acid encoding a selectable marker, wherein the nucleic acid encoding a selectable marker comprises an endonuclease recognition site flanked by telomere seed sequences. The site and flanking sequences are inserted in-frame into the nucleic acid sequence encoding the selectable marker to allow expression. In a specific embodiment, the endonuclease recognition site flanked by telomere seed sequences comprises SEQ ID NO:4. In another embodiment, a telomerator cassette comprises a nucleic acid encoding a selectable marker, wherein the nucleic acid encoding the selectable marker comprises an endonuclease recognition site flanked by telomere seed sequences such that the selectable marker retains its function. In a further embodiment, a telomerator cassette comprises a nucleic acid encoding a selectable marker, wherein the nucleic acid encoding a selectable marker comprises the original marker sequence operably linked as a protein fusion with an endonuclease recognition site flanked by telomere seed sequences.
In one embodiment, the marker is an auxotrophic marker. Auxotrophic markers can include, but are not limited to, LEU2, URA3, TRPl, MET 15, LYSl, and HIS3. In a specific embodiment, the auxotrophic marker is the URA3 gene. In another embodiment, the marker is a drug selection marker and may include, but is not limited to, nourseothrecin (NAT), geneticin, and hygromycin
In particular embodiments, the selectable marker is both selectable and
counterselectable. Examples in yeast include URA3, LYS2 and TRPl, counterselectable using 5-fluoro-orotic acid, alpha-amino-adipate, and 5-fluoro-anthranilic acid, respectively. In other embodiments, a counterselectable marker, e.g., CYH2 (counterselectable on cycloheximide), can be fused to any other selectable marker by joining the two open reading frames in such a way that both moieties are functional.
In another embodiment, the endonuclease recognition site is specific for I-Scel. In a more specific embodiment, the I-Scel endonuclease recognition site comprises SEQ ID NO:2. In other embodiments, the endonuclease may comprise restriction endonucleases, Zinc finger nucleases, TALENs or other meganucleases.
In certain embodiments, the telomere seed sequences comprise minimal telomere seed sequences. In general, the telomere seed sequences for yeast comprise [(TG(i_3)) i6 ...(C(i_ 3)A)i6]. In a specific embodiment, the telomere seed sequences comprise SEQ ID NO: 1 and SEQ ID NO:3.
In particular embodiments, a circular chromosome comprises a telomerator cassette described herein. In other embodiments, a eukaryotic host cell comprises a circular chromosome of the present invention. In a specific embodiment, the eukaryote is yeast. In a more specific embodiment, the yeast is S. cerevisiae. In other embodiments, the yeast is Hansenula polymorpha, Pichia pastoris or Schizosaccharomyces pombe.
In specific embodiments, the eukaryotic host cell comprises a vector encoding the endonuclease under the control of an inducible promoter. In a particular embodiment, the inducible promoter is the GAL1 promoter. Other promoters can include, but are not limited to, pMET15, pCUP2, other pGAL sequences, and TetON/TetOFF systems. In a specific embodiment, a telomerator cassette of the present invention comprises a nucleic acid that encodes the auxotrophic marker URA3, wherein the nucleic acid comprises an intron that comprises the I-Scel endonuclease recognition site flanked by telomere seed sequences. In a more specific embodiment, the telomere seed sequences comprise SEQ ID NO: l and SEQ ID NO:3. In another embodiment, the I-Scel endonuclease recognition site comprises SEQ ID NO:2. A circular chromosome can comprise a telomerator cassette described herein. In another embodiment, a yeast host cell comprises a circular chromosome described herein. The yeast host cell may comprise a vector encoding the I-Scel endonuclease under the control of an inducible promoter. More specifically, the inducible promoter can be the GAL1 promoter.
In one embodiment, a yeast host cell comprises a circular chromosome comprising a telomerator cassette encoding a selectable marker, wherein the nucleic acid encoding the selectable marker comprises an intron that comprises an endonuclease recognition site flanked by telomere seed sequences; and a vector encoding the endonuclease under the control of an inducible promoter. In a specific embodiment, the selectable marker is an auxotrophic marker. In a more specific embodiment, the auxotrophic marker is the URA3 gene. In the yeast host the endonuclease recognition site is specific for I-Scel. More specifically, the I-Scel endonuclease recognition site comprises SEQ ID NO:2. Moreover, the telomere seed sequences can comprise SEQ ID NO: l and SEQ ID NO:3.
In another aspect, the present invention provides methods for chromosome engineering. In one embodiment, a method for engineering a circular chromosome capable of being inducibly linearized comprises the step of integrating a telomerator cassette into a circular chromosome, wherein the telomerator cassette comprises a nucleic acid encoding a selectable marker, wherein the nucleic acid encoding a selectable marker comprises an intron comprising an endonuclease recognition site flanked by telomere seed sequences. In a specific embodiment, the integrating step is accomplished by transforming a telomerator cassette into a host cell comprising the circular chromosome. In another embodiment, the host cell comprises a vector encoding the endonuclease under the control of an inducible promoter.
BRIEF DESCRIPTION OF THE FIGURES
FIG. 1 : Telomerator Design and Function. (A) The telomerator encodes a selectable URA3 gene sequence interrupted by an intron (ACT1 intron) that harbors a homing endonuclease recognition site (I-Scel). The recognition site is flanked by telomere seed sequences (TeSS). The telomerator cassette is encoded on a circular DNA molecule yielding cells that grow on medium lacking uracil (Ura ) but are sensitive to the uracil
counters election drug Foa, assuming the circular DNA molecule encodes at least one essential genetic part. Expression of I-Scel, under the control of the GAL1 promoter ipGALl), is induced by growth in galactose medium. Cells harboring newly linearized molecules should no longer grow on plates lacking uracil (Ura ) and moreover should be resistant to Foa (FoaR). (B) Sequence of the TeSS-I-Scel-TeSS region of the telomerator.
FIG. 2: The telomerator complements yeast cell growth on medium lacking uracil. Plasmids encoding either a native URA3 gene (left), a URA3 gene interrupted by the intron of ACT1 (middle), or a URA3 gene interrupted by a telomerator sequence encoded within the ACT1 intron (right), were transformed into a yeast strain (BY4741) incapable of growing on medium lacking uracil (SC-Ura). Growth of the resulting transformed colonies on SC-Ura was indistinguishable indicating normal expression of the URA3 gene product from the telomerator-encoding construct.
FIG. 3 : The telomerator drives in vivo linearization of a synthetic yeast chromosome arm, synlXR BAC. (A) synlXR BAC is a ~100kb circular chromosome arm that can power a yeast cell. In independent integration experiments, the telomerator cassette was introduced by homologous recombination at two gene-free regions oisynlXR BAC as indicated
(Integration Site 1, ~40kb; Integration Site 2, ~80kb). (B) Following 24 hours of growth in galactose-containing medium to induce expression of I-Scel, single cells from Integration Site 1 (left) and Integration Site 2 (right) were plated on YPD medium, and then replica plated onto synthetic complete medium supplemented with 5'-fluoroorotic acid (Foa), and synthetic complete medium lacking uracil or leucine (SC-Ura and SC-Leu, respectively). Only in cell populations encoding an intact I-Scel recognition sequence as part of the telomerator cassette (+ I-Scel, top row) did linearization occur, as assayed by growth on Foa and non-growth on SC-Ura.
FIG. 4: Circular permutation of a synthetic eukaryotic chromosome, synlXR BAC.
(A) Strategy to integrate the telomerator cassette downstream of 54 genes on synlXR BAC.
(B) Characterization of permuted strains. The telomerator cassette was integrated downstream of each indicated gene, and growth of strains, pre- (circular) and post- linearization (linear), was assessed at 30°C (top) or 37°C (bottom) on rich medium. Shown here are 10-fold serial dilutions after two days growth. Permuted strains not pictured here did not exhibit growth defects. (C) Pulsed field gel showing appearance of linear synlXR after galactose induction in six representative strains (the telomerator was integrated downstream oi YIR039C, YIR040C, YIR041 W, YIR042C, YIR043C, YIR044C), as compared to a wild type strains encoding a native chromosome 7 (BY4741), or the parental strain used for telomerator integrations (synlXR BAC). The circular form oisynlXR BAC is not detectable on pulsed field gel. O = circular; | = linear.
FIG. 5: Deletion of S1R2 rescues growth defects oisynlXR BAC circular permutations. The SIR2 gene was deleted in the each of the 54 unique telomerator-containing synlXR BAC strains. Following transformation of the pGALl-I-Scel construct and growth in galactose, linear permutations were isolated on Foa medium. Shown here are 10-fold serial dilutions after two days growth on rich medium (YPD) at the indicated temperatures. Only the permuted strains corresponding to those pictured in 4b are shown.
FIG. 6: PCR confirmation of integration and circular/linear status. All permutations were tested, pre- and post-linearization (circular and linear, respectively), by PCR using two primer sets. First, integration was confirmed using a gene-specific primer in combination with a primer that annealed within the telomerator (green arrows). These primers confirmed the presence of this region in either the linear or circular conformation oisynlXR in all strains. Secondly, a primer pair designed to anneal to the ACT1 intron (red arrows) was used. This primer pair amplifies a product from the endogenous ACT1 intron at its native locus on chromosome six, as well as from an intact telomerator cassette. Following growth in galactose, absence of this band is consistent with linearization.
FIG. 7: Position effect of genes expected to impact cell fitness. Left panel: Fitness defects in linearized strains (as in FIG. 3b). Right panel: Orientation and approximate location on linearized synlXR of essential ORFs and ORFs required for fast growth.
DETAILED DESCRIPTION OF THE INVENTION
It is understood that the present invention is not limited to the particular methods and components, etc., described herein, as these may vary. It is also to be understood that the terminology used herein is used for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention. It must be noted that as used herein and in the appended claims, the singular forms "a," "an," and "the" include the plural reference unless the context clearly dictates otherwise. Thus, for example, a reference to a "protein" is a reference to one or more proteins, and includes equivalents thereof known to those skilled in the art and so forth.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Specific methods, devices, and materials are described, although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention.
All publications cited herein are hereby incorporated by reference including all journal articles, books, manuals, published patent applications, and issued patents. In addition, the meaning of certain terms and phrases employed in the specification, examples, and appended claims are provided. The definitions are not meant to be limiting in nature and serve to provide a clearer understanding of certain aspects of the present invention.
Chromosome engineering is an emerging focus in the fields of systems biology, genetics, synthetic biology, and the functional analysis of genomes. Here we describe the 'telomerator', a new synthetic biology device designed to inducibly linearize circular DNA molecules in vivo in Saccharomyces cerevisiae. To demonstrate the functionality and utility of the telomerator, we generate linear variants of a synthetic yeast chromosome originally built as a circular molecule, synlXR BAC. By circularly permuting synlXR BAC using the telomerator, we generated an array of 53 different linearized chromosome structures, many of which confer novel phenotypic properties. This tool offers a new way to study the effect of gene placement on chromosomes (i.e. telomere proximity), the essentiality of 3 ' non-coding regions of genes, and the plasticity of gene order and chromosome structure on cell fitness. The telomerator will be an important tool to generate artificial, linear chromosomes in yeast and the concept could be extended to other eukaryotes including mammals and human cells.
The term "nucleic acid" or "polynucleotide" refers to a polymeric form of nucleotides of any length, either ribonucleotides and/or deoxyribonucleotides. These terms include a single-, double- or triple-stranded DNA, genomic DNA, cDNA, RNA, DNA-RNA hybrid, or a polymer comprising purine and pyrimidine bases, or other natural, chemically,
biochemically modified, non-natural or derivatized nucleotide bases. The backbone of the nucleic acid can comprise sugars and phosphate groups (as may typically be found in RNA or DNA), or modified or substituted sugar or phosphate groups. Alternatively, the backbone of the nucleic acid can comprise a polymer of synthetic subunits such as phosphoramidates and thus can be an oligodeoxynucleoside phosphoramidate (P-NH2) or a mixed phosphoramidate- phosphodiester oligomer. In addition, a double-stranded nucleic acid can be obtained from the single stranded nucleic acid product of chemical synthesis either by synthesizing the complementary strand and annealing the strands under appropriate conditions, or by synthesizing the complementary strand de novo using a DNA polymerase with an appropriate primer. The following are non-limiting examples of nucleic acids: a gene or gene fragment, exons, introns, mRNA, tRNA, rRNA, ribozymes, cDNA, recombinant nucleic acids, branched nucleic acids, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. A nucleic acid may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs, uracyl, other sugars and linking groups such as fluororibose and thioate, and nucleotide branches. The sequence of nucleotides may be interrupted by non-nucleotide components. A nucleic acid may be further modified after polymerization, such as by conjugation with a labeling component. Other types of modifications included in this definition are caps, substitution of one or more of the naturally occurring nucleotides with an analog, and introduction of means for attaching the nucleic acid to proteins, metal ions, labeling components, other nucleic acids, or a solid support.
As used herein, the term "operably linked" means that nucleic acid sequences or proteins are operably linked when placed into a functional relationship with another nucleic acid sequence or protein. For example, a promoter sequence is operably linked to a coding sequence if the promoter promotes transcription of the coding sequence. As a further example, a repressor protein and a nucleic acid sequence are operably linked if the repressor protein binds to the nucleic acid sequence. Additionally, a protein may be operably linked to a first and a second nucleic acid sequence if the protein binds to the first nucleic acid sequence and so influences transcription of the second, separate nucleic acid sequence.
Generally, "operably linked" means that the DNA sequences being linked are contiguous, although they need not be, and that a gene and a regulatory sequence or sequences (e.g., a promoter) are connected in such a way as to permit gene expression when the appropriate molecules (e.g., transcriptional activator proteins— transcription factors— or proteins which include transcriptional activator domains) are bound to the regulatory sequence or sequences.
The term "plasmid" refers to an extrachromosomal circular DNA capable of autonomous replication in a given cell. In certain embodiments, the plasmid is designed for amplification and expression in bacteria. Plasmids can be engineered by standard molecular biology techniques. See Sambrook et al, Laboratory Manual, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor (1989), N.Y. The term "expression vector" is used interchangeably herein with the term "plasmid" and refers to a recombinant DNA molecule containing a desired coding sequence and appropriate nucleic acid sequences necessary for expression of the operably linked coding sequence (e.g. an insert sequence that codes for a product) in a particular host cell. Nucleic acid sequences necessary for expression in prokaryotes usually include a promoter, an operator (optional), and a ribosome binding site, often along with other sequences.
The term "promoter" refers to the DNA region, usually upstream of the coding sequence of a gene or operon, which binds RNA polymerase and directs the enzyme to the correct transcriptional start site.
The terms "endonuclease" refers to any wild-type or variant enzyme capable of catalyzing the hydrolysis (cleavage) of bonds between nucleic acids within a DNA or RNA molecule, preferably a DNA molecule. Endonucleases do not cleave the DNA or RNA molecule irrespective of its sequence, but recognize and cleave the DNA or RNA molecule at specific polynucleotide sequences, further referred to as "target sequences" or "target sites". Endonucleases can for example be a homing endonuclease (Paques et al, Curr Gen Ther. 2007 7:49-66), a chimeric Zinc-Finger nuclease (ZFN) resulting from the fusion of engineered zinc-finger domains with the catalytic domain of a restriction enzyme such as Fokl (Porteus et al, Nat Biotechnol. 2005 23 :967-973) or a chemical endonuclease
(Arimondo et al, Mol Cell Bioi. 2006 26:324-333; Simon et al, NAR 2008 36:3531-3538; Eisenschmidt et al, NAR 2005 33 :7039-7047; Cannata et al, PNAS 2008 105:9576-9581). In chemical endonucleases, a chemical or peptidic cleaver is conjugated either to a polymer of nucleic acids or to another DNA recognizing a specific target sequence, thereby targeting the cleavage activity to a specific sequence. Chemical endonucleases also encompass synthetic nucleases like conjugates of orthophenanthroline, a DNA cleaving molecule, and triplex-forming oligonucleotides (TFOs), known to bind specific DNA sequences (Kalish and Glazer Ann NY Acad Sci 2005 1058: 151-61 ). Such chemical endonucleases are considered to fall within the scope of the term "endonuclease" according to the present invention. Also within the scope of the present invention is intended any fusion between molecules able to bind DNA specific sequences and agent/reagent/chemical able to cleave DNA or interfere with cellular proteins implicated in the double strand break (DSB) repair (Majumdar et al, J. Bioi. Chern 2008 283, 17: 11244-1 1252; Liu et al. NAR 2009 37:6378-6388); as a non- limiting example such a fusion can be constituted by a specific DNA-sequence binding domain linked to a chemical inhibitor known to inhibit re-ligation activity of a topoisomerase after DSB cleavage. Endonucleases can comprise a homing endonuclease, also known under the name of meganuclease. The term "meganuclease" refers to an endonuclease having a double-stranded DNA target sequence of about 12 to about 45 base pairs (bp). Such homing endonucleases are well-known to the art (see e.g. Stoddard, Quarterly Reviews of Biophysics, 2006, 38:49-95). Homing endonucleases recognize a DNA target sequence and generate a single- or double-strand break. Homing endonucleases are highly specific, recognizing DNA target sites ranging from 12 to 45 base pairs (bp) in length, usually ranging from about 14 to about 40 bp in length. The homing endonuclease according to the invention may for example correspond to a LAGLIDADG endonuclease, to a HNH endonuclease, or to a GIY-YIG endonuclease. In certain embodiments, a meganuclease is either a dimeric enzyme, wherein each domain is on a monomer or a monomeric enzyme comprising the two domains on a single polypeptide.
Endonucleases according to the invention can also be derived from TALENs, a new class of chimeric nucleases using a Fokl catalytic domain and a DNA binding domain derived from Transcription Activator Like Effector (TALE), a family of proteins used in the infection process by plant pathogens of the Xanthomonas genus (Boch, Scholze et al. 2009; Moscou and Bogdanove 2009; Christian, Cermak et al, 201 0; Li, Huang et al, 201 1) (Boch, Scholze et al, 2009; Moscou and Bogdanove 2009; Christian, Cermak et al, 201 0; Li, Huang et al, 2010). The functional layout of a Fokl-based TALE-nuclease (TALEN) is essentially that of a ZFN, with the Zinc-finger DNA binding domain being replaced by the TALE domain. As such, DNA cleavage by a TALEN requires two DNA recognition regions flanking an unspecific central region. Endonucleases encompassed in the present invention can also be derived from TALENs. An endonuclease according to the present invention can be derived from a TALE- nuclease (TALEN), i. e. a fusion between a DNA-binding domain derived from a Transcription Activator Like Effector (TALE) and one or two catalytic domains. In other embodiments, CRISPR/Cas systems may be used. See Mali P, Yang L, Esvelt KM, Aach J, Guell M, Dicarlo JE, Norville JE, Church GM: RNA-guided human genome engineering via Cas9. Science 2013; Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, Zhang F: Multiplex genome engineering using CRISPR/Cas systems. Science 2013; Cho SW, Kim S, Kim JM, Kim JS: Targeted genome engineering in human cells with the Cas9 RNA-guided endonuclease. Nat Biotechnol 2013; Hwang WY, Fu Y, Reyon D, Maeder ML, Tsai SQ, Sander JD, Peterson RT, Yeh JR, Joung JK:Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol 2013; and Jiang W, Bikard D, Cox D, Zhang F, Marraffini LA: RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Nat Biotechnol 2013.
As used herein, a "selectable marker" refers to a phenotypic trait conferred on transformed cells that protects them from a selective agent in their environment, i.e., the growth media. Examples of selectable markers include, but are not limited to, antibiotic resistance markers (e.g., genes encoding resistance to kanamycin, ampicillin, chloramphenicol, gentamycin, or tetracycline), metabolic markers (e.g., amino acid synthesis genes or transfer RNA genes) and auxotrophic markers.
As used herein, the term "vector" refers to a nucleic acid construct designed for transduction/transfection of one or more cell types. Vectors may be, for example, "cloning vectors" which are designed for isolation, propagation and replication of inserted nucleotides, "expression vectors" which are designed for expression of a nucleotide sequence in a host cell. The term "replication" means duplication of a vector.
Any yeast cell can be used in the methods of the present invention. In particular embodiments, a yeast species within the genus of Saccharomyces , particularly
Saccharomyces cerevisiae, are used. Other examples of suitable yeast species include, but are not limited to, Hansenula polymorpha, Pichia pastoris, and Schizosaccharomyces pombe. Indeed, numerous yeast strains or derivative strains are known in the art. The application and optional modification of such strains for purposes of the present invention should be apparent to a skilled artisan apprised of the present disclosure.
Our goal was to systematically perturb order and orientation of genetic elements on linear chromosomes in S. cerevisiae. To achieve this, we have developed the telomerator, a genetic tool that can inducibly linearize circular DNA molecules in vivo. We use the telomerator to circularly permute the synlXR synthetic chromosome, which is encoded as a bacterial artificial chromosome (BAC, herein refered to synlXR BAC). Our results support that telomerator-induced linearization generates linear chromosomes with functional telomeres on which heterochromatin is fully established.
At least two previous methods have been used to construct artificial linear chromosomes in yeast. First, non-native chromosomes were generated by in vitro ligation of synthetic telomere sequences onto linear DNA followed by transformation and selection in yeast (20, 21). This approach overcomes the complicating factor that linear DNA molecules cannot be replicated in E. coli and can therefore be difficult to construct. Secondly, a circular derivative of chromosome three (22) was linearized by integrating into it synthetic telomere sequences; over time these sequences resolved in vivo to generate a linear molecule (23). Together these studies shed light on important features about the mitotic stability of chromosomes. First, the overall length of linear DNA molecules is a major contributing factor to mitotic stability (16, 20, 21, 23). Second, the spatial relationship between the centromere and telomeres has very little impact on mitotic stability (16, 23). Finally, X and Y' elements located in subtelomeric regions of native S. cerevisiae chromosomes have little or no impact on mitotic stability (23). The telomerator represents a new and convenient way to linearize circular DNA molecules in vivo in 5*. cerevisiae and can be applied to the construction of artificial chromosomes. Here we demonstrate its utility by circularly permuting a pre-existing circular synthetic chromosome in yeast - synlXR. In terms of chromosome engineering, the telomerator presents four major advantages over the approaches described above: (i) the use of telomere seed sequences that correspond to native yeast telomeres; (ii) the ease with which a telomerator construct can be PCR amplified and thus integrated at multiple unique loci; (iii) the method gives virtually 100% correct clones with no requirement for cumbersome screening approaches; and (iv) the inducible control over timing of linearization in vivo.
Linear Permutations of synlXR. In our work, we linearized circular chromosomes to generate minimal telomere sequences. Based on the 5 R2-dependent phenotypes observed, we conclude that heterochromatin is forming on the linearized chromosomes. In native chromosomes, subtelomeric sequences can buffer these effects, as can insulators. Future telomerator designs could incorporate such elements.
With the exception of effects on gene expression, the panel of permuted chromosomes displays surprisingly little variation in behavior, suggesting that the relative placement of telomeres and centromeres in 5*. cerevisiae is quite flexible. For instance, linearization at either YIL001 W or YIR001C produces telocentric versions oisynlXR with only ~lkb separating the centromere from a telomere; that these permutations exhibit no apparent growth defect is consistent with previous work suggesting telocentric chromosomes in budding yeast are mitotically stable (16, 23).
Other Applications for Telomerator. The telomerator provides a flexible new strategy to aid in the construction and expression of supernumerary chromosomes encoding non- native pathways that give a multitude of new functions to the cell. In principle, this technology can be extended to other eukaryotic organisms, especially those with point/small centromeres like budding yeast. Applying the telomerator to chromosome engineering in mammalian cells will be more challenging as 'regional' mammalian centromeres can extend for hundreds of kilobases and include repetitive sequences. Artificially generated human minichromosomes, existing as either linear or circular constructs, have been described and they may serve as a starting point for mammalian artificial chromosome engineering (24-30). We ultimately envision such artificial chromosomes as valuable platforms for gene targeting that will allow delivery of large DNAs to recipient cells and provide a means by which to investigate the incorporation of complex segments of DNA encoding networks and pathways. Prospects for Telomerators in Other Systems/Organisms. The linearization function of the telomerator can obviously be achieved with a wide variety of restriction endonucleases, Zinc finger nucleases, TALENs or meganucleases besides I-Scel. One important
consideration is that the recognition sequence of the enzyme must be sufficiently rare within the sequence of the host genome (i.e., no or few existing sites) to work without causing "collateral damage" in the rest of the genome. In this regard the I-Scel site is not present in yeast nuclear genome (31). A wide variety of selectable/counterselectable markers could also be employed.
Another approach to introduce the Telomerator sequence into a circular DNA molecule for linearization is to include the TeSS-I-Scel-TeSS sequence as part of the protein coding sequence of the selectable marker. In such embodiments, the TeSS-I-Scel-TeSS sequence is "in- frame" with the selectable marker sequence (i.e., a multiple of 3) such that the resulting protein translation would not be truncated. The TeSS-I-Scel-Tess sequence is inserted into the selectable marker in a position that would not disrupt function of the resulting protein product. Shorter TeSSs have been described in the literature (Yamagishi 2008 Appl Microbiol Biotechnol 79:699-706), and could be employed in this so-called Telomerator-fusion protein model in order to increase the stability of the highly repetitive TeSS sequences.
This work should be easily expandable to other yeast species. This is relevant in the academic setting, where fungal species other than S. cerevisiae are becoming increasingly commonplace (i.e., Ashbya gossypii, Candida glabrata, Pichia pastoris etc.). Furthermore, many yeast species are used industrially, exploiting unique properties beneficial to the process of interest (e.g., P. pastoris, high-level secreted protein production; A. gossypii, riboflavin production). Similarly, the approach could almost certainly be expanded to other eukaryotic microorganisms such as algae, and potentially to various tissue culture cells.
Without further elaboration, it is believed that one skilled in the art, using the preceding description, can utilize the present invention to the fullest extent. The following examples are illustrative only, and not limiting of the remainder of the disclosure in any way whatsoever.
EXAMPLES
The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how the compounds, compositions, articles, devices, and/or methods described and claimed herein are made and evaluated, and are intended to be purely illustrative and are not intended to limit the scope of what the inventors regard as their invention. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.) but some errors and deviations should be accounted for herein. Unless indicated otherwise, parts are parts by weight, temperature is in degrees Celsius or is at ambient temperature, and pressure is at or near atmospheric. There are numerous variations and combinations of reaction conditions, e.g., component
concentrations, desired solvents, solvent mixtures, temperatures, pressures and other reaction ranges and conditions that can be used to optimize the product purity and yield obtained from the described process. Only reasonable and routine experimentation will be required to optimize such process conditions.
Materials and Methods
Construction of the Telomerator . The TeSS-I-Scel sequence was introduced by one- step isothermal assembly(32) into the unique Xhol site encoded centrally within the ACT1 intron that had been previously transplanted into URA3(12). Specifically, the TeSS-I-Scel- TeSS sequence
(5 'TGTGTGGTGTGTGGGTGTGTGTGGGTGTGTGGGTGTGTGGGTAGGGATAACAG GGTAATCACCCACCACACACACCCACACACACCACACACCCACCCA3 ' ) (SEQ ID NO:4) flanked by 40bp corresponding to sequence on either side of the Xhol site was ordered from IDT as an Ultramer. This sequence was exponentially amplified using external primers (F 5'ATCCCATTTAACTGTAAGAAGAATTGC3' (SEQ ID NO:5); R
5 ' GGAGAGTGAAAAATAGTAAAAAAAGGT3 ' (SEQ ID NO:6)). Expression of the
URA3-intronACTl-TeSS-I-Sce-I-TeSS-intronACTl-URA3 cassette was verified by functional complementation assay as described in the text.
Integration of Telomerator into synlXR BAC. Primers were designed to bind upstream of the URA3 promoter (5 ' CCCGGGGGATCCGGTGATTG3 ' ) (SEQ ID NO:7) and downstream of the URA3 terminator (5 ' CCAAAGCTGGAGCTCCACCG3 ' ) (SEQ ID NO: 8) on the telomerator construct. 50bp corresponding to either side of each unique integration site was then appended to these two primers. Standard PCR conditions were used to amplify the telomerator, which was then transformed into a synlXR BAC containing strain (yJS587 (8)). Integration was confirmed with a location specific primer in combination with a primer internal to the URA3 promoter sequence (FIG. 6).
Linearization of synlXR. The pGALl-I-Scel sequence was subcloned from a preexisting plasmid (33) into the yeast shuttle vector pRS413 (14) at the Sail recognition site. This construct was transformed into strains to be linearized and selected on medium lacking histidine (SC-His). Linearization was induced in liquid culture in synthetic medium lacking histidine with 2% galactose for 24 hours. Strains were then transferred onto synthetic complete solid medium supplemented with Foa and extra uracil. Each strain was subjected to single round of colony purification on YPD medium and single isolates that had lost the pGAL-I-Sce-I construct, confirmed by replica-plating on SC-His, were selected for further analysis. Circular versus linear status of synlXR was tested by PCR using the primers originally designed to amplify the TeSS-I-Sce-I-TeSS ultramer (described above and FIG. 6).
Pulsed Field Gel Electrophoresis. Full length yeast chromosomes were prepared in agarose plugs as previously described (34). Chromosomes were separated by clamped homogeneous electric field (CHEF) gel electrophoresis using the CHEF-DR III Pulsed Field Electrophoresis Systems (Biorad) with the following settings: 6V/cm, switch time 60-120 seconds over 24 hours, 14°C, 0.5X TBE, 1% gel prepared with low melting point agarose (Lonza, 50100). Gels were stained with 5ug/ml ethidium bromide in water post- electrophoresis and then imaged.
SIR2 Gene Deletion. The sir2AkanMX locus was amplified from the deletion mutant collection strain (35) using primers ~500bp flanking the gene deletion and subsequently transformed into the array of permutable strains by selection on YP supplemented with 200μg/mL geneticin. SIR2 gene deletion was confirmed functionally by confirming the loss of mating proficiency.
Results
Example 1 : Telomerator Design and Function/Application. The design of the telomerator includes several different elements (FIG. 1A). Centrally, the telomerator encodes an 18 base pair recognition sequence for the I-Scel homing endonuclease(9, 10). This site is flanked by a pair of convergent telomere seed sequences (TeSS) that encode ~40bp of conserved yeast telomere repeats [(TG(1 -3)) 16 ... (C(i_3)A)i6] previously shown to serve as a minimal telomeric repeat(ii) (FIG. IB). The entire TeSS-I-Scel-TeSS sequence is encoded within an intron that interrupts the URA3 S. cerevisiae auxotrophic selectable marker coding sequence. Previous work showed that transplantation of the ACT1 gene intron into the middle of the URA3 coding sequence did not disrupt complementation on medium lacking uracil, indicating the mRNA was expressed and the non-native intron correctly spliced prior to translation of the URA3 gene product (12). Thus, the overall design of the telomerator is as follows: 5'-L«^3exo«7-intron^Cr;-TeSS-I-SceI-TeSS-introiL4Cr;-L«^3exo«2-3 '.
Expression of the I-Scel homing endonuclease, which recognizes and cleaves the 18bp I-Scel recognition site, can linearize a circular DNA molecule encoding the telomerator. To facilitate inducible linearization, I-Scel expression can be placed under control of the inducible GAL1 promoter and thus linearization driven specifically by growth in medium containing galactose. Under standard growth conditions in glucose medium, the telomerator cassette should remain intact with cells expressing a functional Ura3 protein, complementing growth of a ura3A0 strain on medium lacking uracil. Following growth in galactose, the linearization reaction can be selected on 5-fluoroorotic acid (Foa) medium, which counters elects against URA3+ cells (13); a circular telomerator-containing molecule will grow on medium lacking uracil and die on FOA, but a cell harboring a linearized molecule, in which the URA3 gene component of the telomerator is literally split in two, should display the opposite growth phenotype (Ura~, FoaR [uracil requiring and resistant to Foa]) (FIG. 1A).
Example 2: Telomerator Constructs Complement Growth on Medium Lacking Uracil.
While expression of the URA3 gene interrupted by the ACT1 intron was previously shown to complement growth oi ura3 mutants on medium lacking uracil (12), the effect on
complementation of further encoding the TeSS-I-Scel-TeSS sequence within the intron was unknown. To test this, we constructed the telomerator cassette in pRS413, a centromere- based yeast shuttle vector encoding the HIS3 selectable marker (14). The telomerator- containing construct was transformed into BY4741, a yeast strain with a complete URA3 deletion (ura3A0) (15), and plated on medium lacking uracil. Growth of the resulting transformants was compared to cells transformed with pRS416, another centromere-based yeast shuttle vector encoding a wild type URA3 gene, or a plasmid encoding the URA3exonl- intronACTl-URA3exon2 cassette (12), identical to the telomerator plasmid but lacking the
TeSS-I-Scel-TeSS sequence. Growth of cells transformed with any of the three constructs on medium lacking uracil was indistinguishable (FIG. 2). Thus, the presence of the TeSS-I- Scel-TeSS sequence within the ACT1 intron interrupting the URA3 gene does not interfere with growth on medium lacking uracil.
Example 3 : The Telomerator Can Inducibly Linearize Circular DNA Molecules In
Vivo. Chromosome length has important consequences for mitotic stability as linear chromosomes shorter than 90 kb exhibit markedly decreased stability (16). Therefore, we tested the capacity of the telomerator to linearize circular DNA molecules in vivo using synlXR, a synthetic yeast chromosome arm corresponding to the right arm of chromosome nine previously constructed as a bacterial artificial chromosome (BAC) (8, 17) approximately lOOkb long. SynlXR encodes all 52 genes from the right arm of chromosome 9 (YIR001C- YIR044C), 2 genes from the left arm (YIL001 W, YIL002C), the native chromosome 9 centromere (CEN9), a yeast selectable marker (LEU2), plus ~10kb of BAC vector sequence including the chloramphenicol resistance gene (FIG. 3A). synlXR, which encodes seven essential genes, was previously shown to be mitotically stable in vivo and power yeast cell growth at wild type levels in the absence of the wild type chromosome arm IXR(8). Two 'gene-free' regions oisynlXR BAC were chosen as initial integration sites for the telomerator cassette, which was then introduced by homologous recombination to generate two new strains for linearization. Additionally, the URA3exonl-intronACTl-URA3exon2 cassette (12), lacking the TeSS-I-Scel-TeSS sequence, was integrated at the same two positions to generate equivalent, but non-linearizeable control strains. All four strains were transformed with a plasmid expressing pGALl-I-Scel, grown in galactose medium for 24 hours, and finally -200 cells were plated on YPD, permissive yeast medium containing dextrose. These plates were replica printed onto medium containing Foa and uracil, or on medium lacking uracil (SC-Ura) or leucine (SC-Leu) (FIG. 3B). At either integration site 1 or 2, in cells expressing the functional telomerator cassette (+ I-Scel), -50% of cells became resistant to growth on Foa and correspondingly lost ability to grow on SC-Ura, consistent with successful linearization (FIG. 3B, top row). The remaining half of cells that were sensitive to Foa was able to grow on SC-Ura, suggesting the synlXR BAC had not been linearized. When comparing cells harboring circular or linear synlXR molecules, there were no apparent changes to colony size or shape, suggesting the linearized construct was mitotically stable. Importantly, in cells lacking the I-Scel recognition site (- I-Scel), the FoaR phenotype was not observed, demonstrating that linearization depends on this sequence (FIG. 3B, bottom row). Taken together, this work suggests that the telomerator efficient linearizes circular DNA molecules in vivo upon induction.
Example 4 Circular Permutation of a Synthetic Eukaryotic Chromosome. The telomerator enables fine control over the location at which a circular DNA molecule is linearized and thus represents a tool to probe the function of gene order, orientation, and chromosomal structure in vivo. For instance, if integrated between two genes, telomerator- driven linearization will yield novel telomere-promixal gene positioning that could lead to subtelomeric silencing. Furthermore, depending on the orientation of each gene with respect to the telomerator cassette, linearization could disrupt either 5' or 3' regulatory elements that drive their transcription. To test these ideas, we integrated the telomerator cassette three base pairs downstream of all 54 chromosome IX genes on synlXR BAC, generating an array of 54 permutable strains. We chose this position as it was previously shown to tolerate the insertion of synthetic sequences (8); indeed synlXR BAC encodes a 34 base pair site-specific recombination site (loxPsym) at this position downstream of every non-essential gene on the BAC with no effect on cell fitness (FIG. 3A). For the telomerator cassette integration, at each of the 47 non-essential genes we "overwrote" the loxPsym site, and for the 7 essential genes that had no pre-exiting loxPsym site we inserted the cassette cleanly 3 base pairs downstream of the stop codon (FIG. 4A). Integration at the correct locus was confirmed for all 54 permutable strains by PCR using a gene-specific primer in combination with a primer that annealed within the telomerator (FIG. 6). We found that at all 54 loci integration of the telomerator caused no noticeable change in fitness (FIG. 4B and data not shown). Notably, the promoter region of the telomerator-encoded URA3 contains a terminator sequence that would polyadenylate incoming transcripts; thus integration of the telomerator 3' to any gene, while disrupting native 3 ' end forming sequences, provides a built-in, non-native terminator sequence for the resulting transcript. Next, the pGAL-I-Scel construct was transformed into the 54 strains, which were grown in galactose medium for 24 hours to induce linearization. Foa resistant cells were selected, enabling isolation of the permuted array of linearized s ft/ZR-containing strains. To investigate whether the synlXR BACs were linearized, full- length chromosomes from six permuted strains, pre- and post-linearization were chosen and separated by pulse-field gel electrophoresis. Only telomerator-integrated strains subjected to growth in galactose exhibited a band on the gel corresponding to the linearized form of synlXR (FIG. 4C). Of the 54 sites into which the telomerator had been integrated, 53 could be linearized and give rise to viable FoaR colonies. At just one position, YIR013C, linearization of synlXR was lethal (FIG. 4B). YIR013C encodes a non-essential, GATA family zinc finger motif containing protein with no annotated function. While not lethal, many other permuted chromosomes resulted in modest growth defects at 30°C (FIG. 4B). At 37°C, almost half of all permuted strains grew very slowly. Together, the data indicate that telomerator-induced linearization provides a new way to generate novel phenotypes.
Example 5: Telomeric Silencing Mediates Fitness Defects of Linearized synlXR Permutations. We hypothesized that telomeric silencing could underlie the fitness defects observed in many of the linear permutations οΐ synlXR (FIG. 3B). Telomeric silencing, or the transcriptional repression of genes in proximity to telomeres, is an epigenetic phenomenon relying on the establishment of heterochromatin that spreads from the ends of chromosomes inwards. Linearization-dependent re-location of essential genes into sub-telomeric regions and the subsequent reduction in expression could have a major impact on impact cell fitness and/or survival. Indeed, mapping the position of the seven essential genes onto the array of linearized permutations of synlXR suggests that fitness defects tend to occur in strains in which one or more essential genes are re-located to within lOkb of a telomere (FIG. 7). Consequently, they might be subject to silencing, a process mediated in part by the lysine deacetylase enzyme Sir2 (18), which deacetylates histone H4 (19). To test our hypothesis, we deleted SIR2 in each of the 54 linearizable synlXR strains. Following transformation of the pGALl-I-Scel construct and growth in galactose, cells harboring linearized synlXR molecules were selected on medium containing Foa. We discovered that disruption of telomeric silencing by SIR2 deletion rescued nearly all growth defects associated linear permutations oisynlXR (FIG. 5). Notably, this included the location at which we previously could not detect linearization, YIR013C (FIG. 3B). Importantly, these results are consistent with the conclusion that the telomerator-encoded 40bp telomere seed sequences indeed generate functional telomeres complete with the appropriate establishment of
heterochromatin. Moreover, the telomerator clearly provides a new means to probe epigenetic regulation and chromatin architecture as we show that proper gene expression can depend on the chromosomal location/environment in which a gene is positioned.
Example 6: Another Telomerator Sequence. Another approach to introduce the Telomerator sequence into a circular DNA molecule for linearization is to include the TeSS- I-Scel-TeSS sequence as part of the protein coding sequence of the selectable marker. In such embodiments, the TeSS-I-Scel-TeSS sequence is "in-frame" with the selectable marker sequence (i.e., a multiple of 3) such that the resulting protein translation would not be truncated. The TeSS-I-Scel-Tess sequence is inserted into the selectable marker in a position that would not disrupt function of the resulting protein product.
SEQ ID NO:9 shows the TeSS-IScel-TeSS sequence encoded within the native URA3 coding sequence:
atgTGTGTGGTGTGTGGGTGTGTGTGGGTGTGTGGGTGTGTGGGTAGGGATAACAG GGTAATCACCCACCACACACACCCACACACACCACACACCCACCCAtcgaaagctacata taaggaacgtgctgctactcatcctagtcctgttgctgccaagctatttaatatcatgcacgaaaagcaaacaaacttgtgtgcttcattgg atgttcgtaccaccaaggaattactggagttagttgaagcattaggtcccaaaatttgtttactaaaaacacatgtggatatcttgactgattt ttccatggagggcacagttaagccgctaaaggcattatccgccaagtacaattttttactcttcgaagacagaaaatttgctgacattggta atacagtcaaattgcagtactctgcgggtgtatacagaatagcagaatgggcagacattacgaatgcacacggtgtggtgggcccagg tattgttagcggtttgaagcaggcggcagaagaagtaacaaaggaacctagaggccttttgatgttagcagaattgtcatgcaagggct ccctatctactggagaatatactaagggtactgttgacattgcgaagagcgacaaagattttgttatcggctttattgctcaaagagacatg ggtggaagagatgaaggttacgattggttgattatgacacccggtgtgggtttagatgacaagggagaTgcattgggtcaacagtata gaaccgtggatgatgtggtGtctacaggatctgacattattattgttggaagaggactatttgcaaagggaagggatgctaaggtagag ggtgaacgttacagaaaagcaggctgggaagcatatttgagaagatgcggccagcaaaactaa (SEQ ID NO: 9) The TeSS-IScel-TeSS sequence, which is 99 bp and thus should be in-frame, is inserted just past the start codon (ATG) of URA3. The lower case letters are native URA3 coding sequence and the upper case letters correspond to the TeSS-IScel-TeSS
A construct encoding SEQ ID NO:9 was built and transformed into yeast. Plasmids were recovered from colonies that grew on SC-Ura plates and sequenced. Clone 1 has the following sequence:
atgTGTGTGGTGTGTGGGTGTGTGTGGGTGTGTGGGTGTGTGTGGGTGTGTGGGTG TGTGGGTAGGGATAACAGGGTAATCACCCACCACACACACCCACACACACCACA CACCCACCCAtcgaaagctacatataaggaacgtgctgctactcatcctagtcctgttgctgccaagctatttaatatcatgcac gaaaagcaaacaaacttgtgtgcttcattggatgttcgtaccaccaaggaattactggagttagttgaagcattaggtcccaaaatttgttt actaaaaacacatgtggatatcttgactgatttttccatggagggcacagttaagccgctaaaggcattatccgccaagtacaattttttact cttcgaagacagaaaatttgctgacattggtaatacagtcaaattgcagtactctgcgggtgtatacagaatagcagaatgngcagacat tacgaatgcacacggtgtggtgggcccaggtattgttagcggtttgaagcaggcggcagaagaagtaacaaaggaacctagaggcc ttttgatgttagcagaattgtcatgcaagggctccctatctactggagaatatactaagggtactgttgacattgcgaagagcgacaaaga ttttgttatcggctttattgctcaaagagacatgggtggaagagatgaaggttacgattggttgattatgacacccggtgtgggtttagatg acaagggagacgcattgggtcaacagtatagaaccgtggatgatgtggtctctacaggatctgacattattattgttggaagaggactat ttgcaaagggaagggatgctaaggtagagggtgaacgttacagaaaagcaggctgggaagcatatttgagaagatgcggccagcaa aactaa (SEQ ID NO: 10) Clone 2 has the following sequence:
atgTGTGTGGTGTGTGGGTGTGTGTGGGTGTGTGGGTGTGTGGGTAGGGATAACAG GGTAATCACCCACCCAtcgaaagctacatataaggaacgtgctgctactcatcctagtcctgttgctgccaagctatttaat atcatgcacgaaaagcaaacaaacttgtgtgcttcattggatgttcgtaccaccaaggaattactggagttagttgaagcattaggtccca aaatttgtttactaaaaacacatgtggatatcttgactgatttttccatggagggcacagttaagccgctaaaggcattatccgccaagtac aattttttactcttcgaagacagaaaatttgctgacattggtaatacagtcaaattgcagtactctgcgggtgtatacagaatagcagaatg ggcagacattacgaatgcacacggtgtggtgggcccaggtattgttagcggtttgaagcaggcggcagaagaagtaacaaaggaac ctagaggccttttgatgttagcagaattgtcatgcaagggctccctatctactggagaatatactaagggtactgttgacattgcgaagag cgacaaagattttgttatcggctttattgctcaaagagacatgggtggaagagatgaaggttacgattggttgattatgacacccggtgtg ggtttagatgacaagggagacgcattgggtcaacagtatagaaccgtggatgatgtggtctctacaggatctgacattattattgttggaa gaggactatttgcaaagggaagggatgctaaggtagagggtgaacgttacagaaaagcaggctgggaagcatatttgagaagatgc ggccagcaaaactaa (SEQ ID NO: 11)
Clone 3 has the following sequence: atgTGTGTGGTGTGTGGGTGTGTGTGGGTGTGTGGGTGTGTGGGTAGGGATAACAG GGTAATCACCCACCACACACACCCACACACACCACACACCCACCCAtcgaaagctacata taaggaacgtgctgctactcatcctagtcctgttgctgccaagctatttaatatcatgcacgaaaagcaaacaaacttgtgtgcttcattgg atgttcgtaccaccaaggaattactggagttagttgaagcattaggtcccaaaatttgtttactaaaaacacatgtggatatcttgactgattt ttccatggagggcacagttaagccgctaaaggcattatccgccaagtacaattttttactcttcgaagacagaaaatttgctgacattggta atacagtcaaattgcagtactctgcgggtgtatacagaatagcagaatgggcagacattacgaatgcacacggtgtggtgggcccagg tattgttagcggtttgaagcangcggcagaagaagtaacaaaggaacctagaggccttttgatgttagcagaattgtcatgcaagggct ccctatctactggagaatatactaagggtactgttgacattgcgaagagcgacaaagattttgttatcggctttattgctcaaagagacatg ggtggaagagatgaaggttacgattggttgattatgacacccggtgtgggtttagatgacaagggagacgcattgggtcaacagtata gaaccgtggatgatgtggtctctacaggatctgacattattattgttggaagaggactatttgcaaagggaagggatgctaaggtagag ggtgaacgttacagaaaagcaggctgggaagcatatttgagaagatgcggccagcaaaactaa (SEQ ID NO: 12)
Clone 4 has the following sequence:
atgTGTGTGGTGTGTGGGTGTGTGTGGGTGTGTGGGTGTGTGGGTAGGGATAACAG GGTAATCACCCACCCAtcgaaagctacatataaggaacgtgctgctactcatcctagtcctgttgctgccaagctatttaat atcatgcacgaaaagcaaacaaacttgtgtgcttcattggatgttcgtaccaccaaggaattactggagttagttgaagcattaggtccca aaatttgtttactaaaaacacatgtggatatcttgactgatttttccatggagggcacagttaagccgctaaaggcattatccgccaagtac aattttttactcttcgaagacagaaaatttgctgacattggtaatacagtcaaattgcagtactctgcgggtgtatacagaatagcagaatg ggcagacattacgaatgcacacggtgtggtgggcccaggtattgttagcggtttgaagcaggcggcagaagaagtaacaaaggaac ctagaggccttttgatgttagcagaattgtcatgcaagggctccctatctactggngaatatactaagggtactgttgacattgcgaagag cgacaaagattttgttatcggctttattgctcaaagagacatgggtggaagagatgaaggttacgattggttgattatgacacccggtgtg ggtttagatgacaagggagacgcattgggtcaacagtatagaaccgtggatgatgtggtctctacaggatctgacattattattgttggaa gaggactatttgcaaagggaagggatgctaaggtagagggtgaacgttacagaaaagcaggctgggaagcatatttgagaagatgc ggccagcaaaactaa (SEQ ID NO: 13)
The TeSS repeats are unstable in the absence of selection (i.e., growth on SC-Ura), likely due to slippage during DNA replication. Clone 3 matches exactly the designed sequence, suggesting this design can indeed complement growth. Two out of four clones have a truncated CA repeat, which likely increases the stability. Other embodiments of the telomerator can incorporate this design to generate a more stable construct.
REFERENCES
1. A. Goffeau et al, Science 214, 546 (Oct 25, 1996).
2. L. Clarke, J. Carbon, Nature 287, 504 (Oct 9, 1980).
3. J. Shampay, J. W. Szostak, E. H. Blackburn, Nature 310, 154 (Jul 12-18,
1984). 4. R. W. Walmsley, C. S. Chan, B. K. Tye, T. D. Petes, Nature 310, 157 (Jul 12- 18, 1984).
5. Y. Ueda et al, JBiosci Bioeng 113, 675 (Jun, 2012).
6. K. Murakami et αί, ΑρρΙ Microbiol Biotechnol 75, 589 (Jun, 2007).
7. R. J. Reid et al, Genetics 180, 1799 (Dec, 2008).
8. J. S. Dymond et al, Nature 477, 471 (Sep 22, 2011).
9. A. Plessis, A. Perrin, J. E. Haber, B. Dujon, Genetics 130, 451 (Mar, 1992).
10. L. Colleaux, L. D'Auriol, F. Galibert, B. Dujon, Proc Natl Acad Sci USA S5, 6022 (Aug, 1988).
11. A. P. Davis, L. S. Symington, Mol Cell Biol 24, 2344 (Mar, 2004).
12. X. Yu, A. Gabriel, Mol Cell 4, 873 (Nov, 1999).
13. J. D. Boeke, J. Trueheart, G. Natsoulis, G. R. Fink, Methods Enzymol 154, 164
(1987).
14. R. S. Sikorski, P. Hieter, Genetics 122, 19 (May, 1989).
15. C. B. Brachmann et al, Yeast 14, 115 (Jan 30, 1998).
16. R. T. Surosky, C. S. Newlon, B. K. Tye, Proc Natl Acad Sci U S A 83, 414 (Jan, 1986).
17. W. J. Blake et al, Nucleic Acids Res 38, 2594 (May, 2010).
18. O. M. Aparicio, B. L. Billington, D. E. Gottschling, Cell 66, 1279 (Sep 20, 1991).
19. S. Imai, C. M. Armstrong, M. Kaeberlein, L. Guarente, Nature 403, 795 (Feb 17, 2000).
20. G. M. Dani, V. A. Zakian, Proc Natl Acad Sci USA S0, 3406 (Jun, 1983).
21. A. W. Murray, J. W. Szostak, Nature 305, 189 (Sep 15-21, 1983).
22. J. E. Haber, P. C. Thorburn, D. Rogers, Genetics 106, 185 (Feb, 1984).
23. A. W. Murray, J. W. Szostak, Mol Cell Biol 6, 3166 (Sep, 1986).
24. Y. Kazuki et al , Gene Ther 18, 384 (Apr, 2011 ).
25. R. Saffery et al, Proc Natl Acad Sci USA 98, 5705 (May 8, 2001).
26. J. J. Harrington, G. Van Bokkelen, R. W. Mays, K. Gustashaw, H. F. Willard, Nat Genet 15, 345 (Apr, 1997).
27. T. A. Ebersole et al, Hum Mol Genet 9, 1623 (Jul 1, 2000).
28. M. Ikeno et al, Nat Biotechnol 16, 431 (May, 1998).
29. D. Moralli, P. Vagnarelli, M. Bensi, L. De Carli, E. Raimondi, Cytogenet Cell Genet 94, 113 (2001). 30. Y. Iida et al, DNA Res 17, 293 (Oct, 2010).
31. A. J. Noel, W. Wende, A. Pingoud, J Biol Chem 279, 6794 (Feb 20, 2004).
32. D. G. Gibson et al., Nat Methods 6, 343 (May, 2009).
33. M. Lisby, U. H. Mortensen, R. Rothstein, Nat Cell Biol 5, 572 (Jun, 2003). 34. D. C. Schwartz, C. R. Cantor, Cell 37, 67 (May, 1984).
35. E. A. Winzeler et al., Science 285, 901 (Aug 6, 1999).

Claims

We claim:
1. A telomerator cassette comprising a nucleic acid encoding a selectable marker, wherein the nucleic acid encoding a selectable marker comprises an intron comprising an endonuclease recognition site flanked by telomere seed sequences.
2. The telomerator cassette of claim 1, wherein the intron is the ACT1 intron.
3. The telomerator cassette of claim 1, wherein the selectable marker is an auxotrophic marker.
4. The telomerator cassette of claim 3, wherein the auxotrophic marker is the URA3 gene.
5. The telomerator cassette of claim 1, wherein the endonuclease recognition site is specific for I-Scel.
6. The telomerator cassette of claim 1, wherein the I-Scel endonuclease recognition site comprises SEQ ID NO:2.
7. The telomerator cassette of claim 1, wherein the telomere seed sequences comprise SEQ ID NO: 1 and SEQ ID O:3.
8. A circular chromosome comprising the telomerator cassette of claim 1.
9. A eukaryotic host cell comprising the circular chromosome of claim 8.
10. The eukaryotic host cell of claim 9, wherein the eukaryote is yeast.
11. The eukaryotic host cell of claim 10, wherein the yeast is S. cerevisiae.
12. The eukaryotic host cell of claim 9, wherein the host cell comprises a vector encoding the endonuclease under the control of an inducible promoter.
13. A telomerator cassette comprising a nucleic acid that encodes the auxotrophic marker URA3, wherein the nucleic acid comprises an intron that comprises the I-Scel endonuclease recognition site flanked by telomere seed sequences.
14. The telomerator cassette of claim 13, wherein the telomere seed sequences comprise SEQ ID O: l and SEQ ID O:3.
15. The telomerator cassette of claim 13, wherein the I-Scel endonuclease recognition site comprises SEQ ID NO:2.
16. A circular chromosome comprising the telomerator cassette of claim 13.
17. A yeast host cell comprising the circular chromosome of claim 16.
18. The yeast host cell of claim 17, wherein the yeast host cell comprises a vector encoding the I-Scel endonuclease under the control of an inducible promoter.
19. The yeast host cell of claim 18, wherein the inducible promoter is the GAL1 promoter.
20. A yeast host cell comprising:
a. a circular chromosome comprising a telomerator cassette encoding a selectable marker, wherein the nucleic acid encoding the selectable marker comprises an intron that comprises an endonuclease recognition site flanked by telomere seed sequences; and
b. a vector encoding the endonuclease under the control of an inducible promoter.
21. The yeast host cell of claim 20, wherein the selectable marker is an auxotrophic marker.
22. The yeast host cell of claim 21, wherein the auxotrophic marker is the URA3 gene.
23. The yeast host cell of claim 20, wherein the endonuclease recognition site is specific for I-Scel.
24. The yeast host cell of claim 20, wherein the I-Scel endonuclease recognition site comprises SEQ ID NO:2.
25. The yeast host cell of claim 20, wherein the telomere seed sequences comprise SEQ ID O: l and SEQ ID O:3.
26. A method for engineering a circular chromosome capable of being inducibly linearized comprising the step of integrating a telomerator cassette into a circular chromosome, wherein the telomerator cassette comprises a nucleic acid encoding a selectable marker, wherein the nucleic acid encoding a selectable marker comprises an intron comprising an endonuclease recognition site flanked by telomere seed sequences.
27. The method of claim 26, wherein the integrating step is accomplished by transforming a telomerator cassette into a host cell comprising the circular chromosome.
28. The method of claim 27, wherein the host cell comprises a vector encoding the endonuclease under the control of an inducible promoter.
29. A telomerator cassette comprising a nucleic acid encoding a selectable marker, wherein the nucleic acid encoding a selectable marker comprises an endonuclease recognition site flanked by telomere seed sequences.
30. A telomerator cassette comprising a nucleic acid encoding a selectable marker, wherein the nucleic acid encoding the selectable marker comprises an endonuclease recognition site flanked by telomere seed sequences such that the selectable marker retains its function.
31. A telomerator cassette comprising a nucleic acid encoding a selectable marker, wherein the nucleic acid encoding a selectable marker comprises the original marker sequence operably linked as a protein fusion with an endonuclease recognition site flanked by telomere seed sequences.
32. The telomerator cassette of any one of claims 29-31 , wherein the selectable marker is an auxotrophic marker.
33. The telomerator cassette of claim 32, wherein the auxotrophic marker is the URA3 gene.
34. The telomerator cassette of any one of claims 29-31 , wherein the endonuclease recognition site is specific for I-Scel.
35. The telomerator cassette of claim 34, wherein the I-Scel endonuclease recognition site comprises SEQ ID NO:2.
36. The telomerator cassette of claim 29, wherein the telomere seed sequences comprise SEQ ID NO: 1 and SEQ ID NO:3.
37. A circular chromosome comprising the telomerator cassette of any one of claims 29-36. eukaryotic host cell comprising the circular chromosome of claim 37.
PCT/US2014/021158 2013-03-06 2014-03-06 The telomerator-a tool for chromosome engineering Ceased WO2014138379A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US14/772,832 US10047366B2 (en) 2013-03-06 2014-03-06 Telomerator-a tool for chromosome engineering

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201361773206P 2013-03-06 2013-03-06
US61/773,206 2013-03-06

Publications (1)

Publication Number Publication Date
WO2014138379A1 true WO2014138379A1 (en) 2014-09-12

Family

ID=51491947

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2014/021158 Ceased WO2014138379A1 (en) 2013-03-06 2014-03-06 The telomerator-a tool for chromosome engineering

Country Status (2)

Country Link
US (1) US10047366B2 (en)
WO (1) WO2014138379A1 (en)

Cited By (32)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016149612A3 (en) * 2015-03-19 2016-10-27 The Johns Hopkins University Assay for telomere length regulators
US9526784B2 (en) 2013-09-06 2016-12-27 President And Fellows Of Harvard College Delivery system for functional nucleases
US9840699B2 (en) 2013-12-12 2017-12-12 President And Fellows Of Harvard College Methods for nucleic acid editing
US10077453B2 (en) 2014-07-30 2018-09-18 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US10227581B2 (en) 2013-08-22 2019-03-12 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US12157760B2 (en) 2018-05-23 2024-12-03 The Broad Institute, Inc. Base editors and uses thereof
US12281338B2 (en) 2018-10-29 2025-04-22 The Broad Institute, Inc. Nucleobase editors comprising GeoCas9 and uses thereof
US12351837B2 (en) 2019-01-23 2025-07-08 The Broad Institute, Inc. Supernegatively charged proteins and uses thereof
US12390514B2 (en) 2017-03-09 2025-08-19 President And Fellows Of Harvard College Cancer vaccine
US12406749B2 (en) 2017-12-15 2025-09-02 The Broad Institute, Inc. Systems and methods for predicting repair outcomes in genetic engineering
US12435330B2 (en) 2019-10-10 2025-10-07 The Broad Institute, Inc. Methods and compositions for prime editing RNA
US12473543B2 (en) 2019-04-17 2025-11-18 The Broad Institute, Inc. Adenine base editors with reduced off-target effects
US12522807B2 (en) 2018-07-09 2026-01-13 The Broad Institute, Inc. RNA programmable epigenetic RNA modifiers and uses thereof

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP7690257B2 (en) 2019-06-24 2025-06-10 トヨタ自動車株式会社 Transformation-assisting plasmid, method for producing a transformant using the same, and transformation method

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000006715A1 (en) * 1998-07-27 2000-02-10 Genotypes Inc. Automatic eukaryotic artificial chromosome vector
US20080160616A1 (en) * 1992-05-05 2008-07-03 Institut Pasteur Nucleotide sequence encoding the enzyme I-SceI and the uses thereof

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US1329559A (en) 1916-02-21 1920-02-03 Tesla Nikola Valvular conduit
US6777589B1 (en) * 1990-01-22 2004-08-17 Dekalb Genetics Corporation Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof
US5474896A (en) 1992-05-05 1995-12-12 Institut Pasteur Nucleotide sequence encoding the enzyme I-SceI and the uses thereof
US6183969B1 (en) 1999-04-15 2001-02-06 Rutgers, The State University Of New Jersey Intron-based assay for detecting and characterizing chromosomal rearrangement
JP5041273B2 (en) 2005-06-28 2012-10-03 株式会社Sumco Container packaging equipment

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080160616A1 (en) * 1992-05-05 2008-07-03 Institut Pasteur Nucleotide sequence encoding the enzyme I-SceI and the uses thereof
WO2000006715A1 (en) * 1998-07-27 2000-02-10 Genotypes Inc. Automatic eukaryotic artificial chromosome vector

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DOUVILLE, NICHOLAS ET AL.: "DNA linearization through confinement in nanofluidic channels", ANALYTICAL AND BIOANALYTICAL CHEMISTRY, vol. 391, 2008, pages 2395 - 2409, XP019621372 *
NOSEK, JOZEF ET AL.: "On the origin of telomeres: a glimpse at the pre-telomerase world", BIOESSAYS, vol. 28, 2006, pages 182 - 190 *
WOODS, JON P. ET AL.: "Autonomous replication of foreign DNA in Histoplosma capsulatum; role of native telomeric sequences", JOURNAL OF BACTERIOLOGY, vol. 175, no. 3, February 1993 (1993-02-01), pages 636 - 641 *

Cited By (70)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12006520B2 (en) 2011-07-22 2024-06-11 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US11920181B2 (en) 2013-08-09 2024-03-05 President And Fellows Of Harvard College Nuclease profiling system
US10954548B2 (en) 2013-08-09 2021-03-23 President And Fellows Of Harvard College Nuclease profiling system
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US10227581B2 (en) 2013-08-22 2019-03-12 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US12473573B2 (en) 2013-09-06 2025-11-18 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US9999671B2 (en) 2013-09-06 2018-06-19 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US9526784B2 (en) 2013-09-06 2016-12-27 President And Fellows Of Harvard College Delivery system for functional nucleases
US9737604B2 (en) 2013-09-06 2017-08-22 President And Fellows Of Harvard College Use of cationic lipids to deliver CAS9
US11299755B2 (en) 2013-09-06 2022-04-12 President And Fellows Of Harvard College Switchable CAS9 nucleases and uses thereof
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10682410B2 (en) 2013-09-06 2020-06-16 President And Fellows Of Harvard College Delivery system for functional nucleases
US12559737B2 (en) 2013-09-06 2026-02-24 President And Fellows Of Harvard College Cas9 variants and uses thereof
US12584118B2 (en) 2013-09-06 2026-03-24 President And Fellows Of Harvard College Cas9 variants and uses thereof
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US10912833B2 (en) 2013-09-06 2021-02-09 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US11124782B2 (en) 2013-12-12 2021-09-21 President And Fellows Of Harvard College Cas variants for gene editing
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US9840699B2 (en) 2013-12-12 2017-12-12 President And Fellows Of Harvard College Methods for nucleic acid editing
US11053481B2 (en) 2013-12-12 2021-07-06 President And Fellows Of Harvard College Fusions of Cas9 domains and nucleic acid-editing domains
US12215365B2 (en) 2013-12-12 2025-02-04 President And Fellows Of Harvard College Cas variants for gene editing
US11578343B2 (en) 2014-07-30 2023-02-14 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US12398406B2 (en) 2014-07-30 2025-08-26 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10077453B2 (en) 2014-07-30 2018-09-18 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US11156599B2 (en) 2015-03-19 2021-10-26 The Johns Hopkins University Assay for telomere length regulators
WO2016149612A3 (en) * 2015-03-19 2016-10-27 The Johns Hopkins University Assay for telomere length regulators
US11214780B2 (en) 2015-10-23 2022-01-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US12344869B2 (en) 2015-10-23 2025-07-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US12043852B2 (en) 2015-10-23 2024-07-23 President And Fellows Of Harvard College Evolved Cas9 proteins for gene editing
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US10947530B2 (en) 2016-08-03 2021-03-16 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11999947B2 (en) 2016-08-03 2024-06-04 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11702651B2 (en) 2016-08-03 2023-07-18 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US12084663B2 (en) 2016-08-24 2024-09-10 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US11820969B2 (en) 2016-12-23 2023-11-21 President And Fellows Of Harvard College Editing of CCR2 receptor gene to protect against HIV infection
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US12390514B2 (en) 2017-03-09 2025-08-19 President And Fellows Of Harvard College Cancer vaccine
US12516308B2 (en) 2017-03-09 2026-01-06 President And Fellows Of Harvard College Suppression of pain by gene editing
US12435331B2 (en) 2017-03-10 2025-10-07 President And Fellows Of Harvard College Cytosine to guanine base editor
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US12359218B2 (en) 2017-07-28 2025-07-15 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11932884B2 (en) 2017-08-30 2024-03-19 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US12406749B2 (en) 2017-12-15 2025-09-02 The Broad Institute, Inc. Systems and methods for predicting repair outcomes in genetic engineering
US12157760B2 (en) 2018-05-23 2024-12-03 The Broad Institute, Inc. Base editors and uses thereof
US12522807B2 (en) 2018-07-09 2026-01-13 The Broad Institute, Inc. RNA programmable epigenetic RNA modifiers and uses thereof
US12281338B2 (en) 2018-10-29 2025-04-22 The Broad Institute, Inc. Nucleobase editors comprising GeoCas9 and uses thereof
US12351837B2 (en) 2019-01-23 2025-07-08 The Broad Institute, Inc. Supernegatively charged proteins and uses thereof
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12281303B2 (en) 2019-03-19 2025-04-22 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12509680B2 (en) 2019-03-19 2025-12-30 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11643652B2 (en) 2019-03-19 2023-05-09 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12570972B2 (en) 2019-03-19 2026-03-10 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11795452B2 (en) 2019-03-19 2023-10-24 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12473543B2 (en) 2019-04-17 2025-11-18 The Broad Institute, Inc. Adenine base editors with reduced off-target effects
US12435330B2 (en) 2019-10-10 2025-10-07 The Broad Institute, Inc. Methods and compositions for prime editing RNA
US12031126B2 (en) 2020-05-08 2024-07-09 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence

Also Published As

Publication number Publication date
US10047366B2 (en) 2018-08-14
US20160017344A1 (en) 2016-01-21

Similar Documents

Publication Publication Date Title
US10047366B2 (en) Telomerator-a tool for chromosome engineering
AU2022100158A4 (en) Improved methods for modification of target nucleic acids
JP6737974B1 (en) Nuclease-mediated DNA assembly
AU2020223370B2 (en) Enzymes with RuvC domains
US11248216B2 (en) Methods and compositions for genomic editing
Numamoto et al. Efficient genome editing by CRISPR/Cas9 with a tRNA-sgRNA fusion in the methylotrophic yeast Ogataea polymorpha
US20220033791A1 (en) Enzymes with ruvc domains
EP3708671B1 (en) Methods and compositions for modifying a targeted locus
CN110747187B (en) Cas12a protein for identifying TTTV and TTV double-PAM sites, plant genome directed editing vector and method
US20220298494A1 (en) Enzymes with ruvc domains
WO2015138855A1 (en) Vectors and methods for fungal genome engineering by crispr-cas9
JP2005500841A (en) System for in vivo site-directed mutagenesis using oligonucleotides
US20240182927A1 (en) Methods for genomic integration for kluyveromyces host cells
US20240110167A1 (en) Enzymes with ruvc domains
CN111088275A (en) Cloning method of DNA large fragment
US20220220460A1 (en) Enzymes with ruvc domains
JP2024509047A (en) CRISPR-related transposon system and its usage
EP2548957A1 (en) Method for producing kluyveromyces marxianus transformant
US7022501B1 (en) Ligation of double-stranded DNAs
CN118109498A (en) Optimized plasmid system for CRISPR-Cas9 genome editing
EP4043574A1 (en) Synergistic promoter activation by combining cpe and cre modifications
CN107287226A (en) A kind of DNA constructions and the external joining methods of DNA based on Cpf1
Pérez The Colors of CRISPR-Cas Type V: Broadening the Genome Editing Toolkit for Saccharomyces Cerevisiae
WO2025206382A1 (en) Nucleic acid cleavage enzyme, nucleic acid, vector, nucleic acid modification kit, method for modifying nucleic acid, method for producing variant, method for expressing gene, eukaryotic cell, vector or dna fragment, kit, and method for producing genetically engineered eukaryotic cell
Strother et al. Targeted Insertion of the mPing Transposable Element

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14759943

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 14772832

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 14759943

Country of ref document: EP

Kind code of ref document: A1