CN107287226A - A kind of DNA constructions and the external joining methods of DNA based on Cpf1 - Google Patents
A kind of DNA constructions and the external joining methods of DNA based on Cpf1 Download PDFInfo
- Publication number
- CN107287226A CN107287226A CN201610199930.3A CN201610199930A CN107287226A CN 107287226 A CN107287226 A CN 107287226A CN 201610199930 A CN201610199930 A CN 201610199930A CN 107287226 A CN107287226 A CN 107287226A
- Authority
- CN
- China
- Prior art keywords
- enzyme
- nucleic acid
- sequence
- acid sequence
- cleavage site
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 238000000034 method Methods 0.000 title claims abstract description 42
- 238000010276 construction Methods 0.000 title claims abstract description 15
- 238000003776 cleavage reaction Methods 0.000 claims abstract description 78
- 230000007017 scission Effects 0.000 claims abstract description 78
- 125000003729 nucleotide group Chemical group 0.000 claims abstract description 13
- 102000004190 Enzymes Human genes 0.000 claims description 92
- 108090000790 Enzymes Proteins 0.000 claims description 92
- 108091028043 Nucleic acid sequence Proteins 0.000 claims description 65
- 150000007523 nucleic acids Chemical group 0.000 claims description 60
- 239000013598 vector Substances 0.000 claims description 52
- 238000001976 enzyme digestion Methods 0.000 claims description 47
- 108020004414 DNA Proteins 0.000 claims description 40
- 108090000623 proteins and genes Proteins 0.000 claims description 33
- 101000860092 Francisella tularensis subsp. novicida (strain U112) CRISPR-associated endonuclease Cas12a Proteins 0.000 claims description 25
- 108091033409 CRISPR Proteins 0.000 claims description 11
- 231100000241 scar Toxicity 0.000 claims description 11
- 238000000338 in vitro Methods 0.000 claims description 9
- 238000010354 CRISPR gene editing Methods 0.000 claims description 8
- 238000011144 upstream manufacturing Methods 0.000 claims description 6
- 230000015572 biosynthetic process Effects 0.000 claims description 5
- 230000003115 biocidal effect Effects 0.000 claims description 4
- 238000006243 chemical reaction Methods 0.000 claims description 4
- 108091008053 gene clusters Proteins 0.000 claims description 4
- 239000003242 anti bacterial agent Substances 0.000 claims description 3
- 239000013604 expression vector Substances 0.000 claims description 3
- 238000010353 genetic engineering Methods 0.000 claims description 3
- 229910052791 calcium Inorganic materials 0.000 claims description 2
- 239000003153 chemical reaction reagent Substances 0.000 claims description 2
- 230000002068 genetic effect Effects 0.000 claims description 2
- 238000013518 transcription Methods 0.000 claims description 2
- 230000035897 transcription Effects 0.000 claims description 2
- 238000012546 transfer Methods 0.000 claims description 2
- 230000002255 enzymatic effect Effects 0.000 claims 1
- 108091008146 restriction endonucleases Proteins 0.000 abstract description 5
- 230000009466 transformation Effects 0.000 abstract description 5
- 239000002773 nucleotide Substances 0.000 abstract 3
- 239000011449 brick Substances 0.000 description 29
- 210000004027 cell Anatomy 0.000 description 22
- 241000588724 Escherichia coli Species 0.000 description 13
- 239000003550 marker Substances 0.000 description 13
- 239000013612 plasmid Substances 0.000 description 12
- 230000000295 complement effect Effects 0.000 description 10
- 239000012634 fragment Substances 0.000 description 10
- 108010042407 Endonucleases Proteins 0.000 description 8
- 102000004533 Endonucleases Human genes 0.000 description 8
- 102000004169 proteins and genes Human genes 0.000 description 7
- 102100035102 E3 ubiquitin-protein ligase MYCBP2 Human genes 0.000 description 6
- 108010020764 Transposases Proteins 0.000 description 5
- 238000005516 engineering process Methods 0.000 description 5
- 102000012410 DNA Ligases Human genes 0.000 description 4
- 108010061982 DNA Ligases Proteins 0.000 description 4
- 102000008579 Transposases Human genes 0.000 description 4
- -1 Cpf1 Proteins 0.000 description 3
- 102000053602 DNA Human genes 0.000 description 3
- 108700007698 Genetic Terminator Regions Proteins 0.000 description 3
- 108091034057 RNA (poly(A)) Proteins 0.000 description 3
- 102100026260 Titin Human genes 0.000 description 3
- 239000011575 calcium Substances 0.000 description 3
- 238000013461 design Methods 0.000 description 3
- 239000003623 enhancer Substances 0.000 description 3
- 210000003527 eukaryotic cell Anatomy 0.000 description 3
- 108020001507 fusion proteins Proteins 0.000 description 3
- 102000037865 fusion proteins Human genes 0.000 description 3
- 239000000499 gel Substances 0.000 description 3
- 238000010363 gene targeting Methods 0.000 description 3
- 239000001963 growth medium Substances 0.000 description 3
- 239000007788 liquid Substances 0.000 description 3
- 239000002609 medium Substances 0.000 description 3
- 238000011084 recovery Methods 0.000 description 3
- 239000007787 solid Substances 0.000 description 3
- 241000589158 Agrobacterium Species 0.000 description 2
- 241000894006 Bacteria Species 0.000 description 2
- 108020004511 Recombinant DNA Proteins 0.000 description 2
- 108700008625 Reporter Genes Proteins 0.000 description 2
- 240000004808 Saccharomyces cerevisiae Species 0.000 description 2
- 235000014680 Saccharomyces cerevisiae Nutrition 0.000 description 2
- FAPWRFPIFSIZLT-UHFFFAOYSA-M Sodium chloride Chemical compound [Na+].[Cl-] FAPWRFPIFSIZLT-UHFFFAOYSA-M 0.000 description 2
- 241000187747 Streptomyces Species 0.000 description 2
- 238000000246 agarose gel electrophoresis Methods 0.000 description 2
- 210000004102 animal cell Anatomy 0.000 description 2
- 229940041514 candida albicans extract Drugs 0.000 description 2
- 125000004122 cyclic group Chemical group 0.000 description 2
- 238000004520 electroporation Methods 0.000 description 2
- 239000000463 material Substances 0.000 description 2
- 230000001404 mediated effect Effects 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 210000001236 prokaryotic cell Anatomy 0.000 description 2
- 210000003370 receptor cell Anatomy 0.000 description 2
- 230000010076 replication Effects 0.000 description 2
- 238000012163 sequencing technique Methods 0.000 description 2
- 238000003786 synthesis reaction Methods 0.000 description 2
- 230000008685 targeting Effects 0.000 description 2
- 238000012360 testing method Methods 0.000 description 2
- 239000012137 tryptone Substances 0.000 description 2
- 239000012138 yeast extract Substances 0.000 description 2
- 108091032973 (ribonucleotides)n+m Proteins 0.000 description 1
- 229920001817 Agar Polymers 0.000 description 1
- 108091079001 CRISPR RNA Proteins 0.000 description 1
- 108091026890 Coding region Proteins 0.000 description 1
- 108020004705 Codon Proteins 0.000 description 1
- 108010076804 DNA Restriction Enzymes Proteins 0.000 description 1
- 230000006820 DNA synthesis Effects 0.000 description 1
- 206010059866 Drug resistance Diseases 0.000 description 1
- 241001302160 Escherichia coli str. K-12 substr. DH10B Species 0.000 description 1
- 241000206602 Eukaryota Species 0.000 description 1
- 241000589602 Francisella tularensis Species 0.000 description 1
- 241000588088 Francisella tularensis subsp. novicida U112 Species 0.000 description 1
- BCCRXDTUTZHDEU-VKHMYHEASA-N Gly-Ser Chemical compound NCC(=O)N[C@@H](CO)C(O)=O BCCRXDTUTZHDEU-VKHMYHEASA-N 0.000 description 1
- 241000238631 Hexapoda Species 0.000 description 1
- 108091005461 Nucleic proteins Chemical group 0.000 description 1
- 229910019142 PO4 Inorganic materials 0.000 description 1
- 108700019535 Phosphoprotein Phosphatases Proteins 0.000 description 1
- 102000045595 Phosphoprotein Phosphatases Human genes 0.000 description 1
- OAICVXFJPJFONN-UHFFFAOYSA-N Phosphorus Chemical compound [P] OAICVXFJPJFONN-UHFFFAOYSA-N 0.000 description 1
- 102000001253 Protein Kinase Human genes 0.000 description 1
- 101710137500 T7 RNA polymerase Proteins 0.000 description 1
- 239000008272 agar Substances 0.000 description 1
- 150000001413 amino acids Chemical group 0.000 description 1
- 238000013459 approach Methods 0.000 description 1
- 230000001580 bacterial effect Effects 0.000 description 1
- 239000001506 calcium phosphate Substances 0.000 description 1
- 229910000389 calcium phosphate Inorganic materials 0.000 description 1
- 235000011010 calcium phosphates Nutrition 0.000 description 1
- 244000309466 calf Species 0.000 description 1
- 238000012512 characterization method Methods 0.000 description 1
- 210000000349 chromosome Anatomy 0.000 description 1
- 238000010367 cloning Methods 0.000 description 1
- 238000000975 co-precipitation Methods 0.000 description 1
- 239000003086 colorant Substances 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 230000003247 decreasing effect Effects 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 230000007812 deficiency Effects 0.000 description 1
- 230000001419 dependent effect Effects 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 230000018109 developmental process Effects 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 230000029087 digestion Effects 0.000 description 1
- 239000003814 drug Substances 0.000 description 1
- 229940079593 drug Drugs 0.000 description 1
- 238000005538 encapsulation Methods 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 229940118764 francisella tularensis Drugs 0.000 description 1
- 238000012239 gene modification Methods 0.000 description 1
- 230000005017 genetic modification Effects 0.000 description 1
- 235000013617 genetically modified food Nutrition 0.000 description 1
- 230000012010 growth Effects 0.000 description 1
- 210000000987 immune system Anatomy 0.000 description 1
- 230000006872 improvement Effects 0.000 description 1
- 238000001727 in vivo Methods 0.000 description 1
- 239000002502 liposome Substances 0.000 description 1
- 238000009630 liquid culture Methods 0.000 description 1
- 210000001161 mammalian embryo Anatomy 0.000 description 1
- 238000010297 mechanical methods and process Methods 0.000 description 1
- 238000000520 microinjection Methods 0.000 description 1
- 238000010369 molecular cloning Methods 0.000 description 1
- 230000035772 mutation Effects 0.000 description 1
- 102000039446 nucleic acids Human genes 0.000 description 1
- 108020004707 nucleic acids Proteins 0.000 description 1
- NBIIXXVUZAFLBC-UHFFFAOYSA-K phosphate Chemical compound [O-]P([O-])([O-])=O NBIIXXVUZAFLBC-UHFFFAOYSA-K 0.000 description 1
- 239000010452 phosphate Substances 0.000 description 1
- 239000011574 phosphorus Substances 0.000 description 1
- 229910052698 phosphorus Inorganic materials 0.000 description 1
- 239000013600 plasmid vector Substances 0.000 description 1
- 108091033319 polynucleotide Proteins 0.000 description 1
- 102000040430 polynucleotide Human genes 0.000 description 1
- 239000002157 polynucleotide Substances 0.000 description 1
- 230000008569 process Effects 0.000 description 1
- 108090000765 processed proteins & peptides Proteins 0.000 description 1
- 108060006633 protein kinase Proteins 0.000 description 1
- 238000010188 recombinant method Methods 0.000 description 1
- 230000003252 repetitive effect Effects 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 238000012552 review Methods 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 239000013605 shuttle vector Substances 0.000 description 1
- 238000002791 soaking Methods 0.000 description 1
- 239000011780 sodium chloride Substances 0.000 description 1
- 238000003151 transfection method Methods 0.000 description 1
- 230000001131 transforming effect Effects 0.000 description 1
- QORWJWZARLRLPR-UHFFFAOYSA-H tricalcium bis(phosphate) Chemical compound [Ca+2].[Ca+2].[Ca+2].[O-]P([O-])([O-])=O.[O-]P([O-])([O-])=O QORWJWZARLRLPR-UHFFFAOYSA-H 0.000 description 1
- 241001515965 unidentified phage Species 0.000 description 1
- 230000009614 wildtype growth Effects 0.000 description 1
- 210000005253 yeast cell Anatomy 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/76—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Actinomyces; for Streptomyces
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/30—Vector systems comprising sequences for excision in presence of a recombinase, e.g. loxP or FRT
Landscapes
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Mycology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a kind of DNA constructions, the DNA constructions include prefix and suffix, and the DNA constructions contain in structure Ta C Tb, formula, and Ta is prefix, the nucleotide sequence containing cleavage sites；C is nucleotide sequence to be spliced；Tb is suffix, the nucleotide sequence containing the cleavage sites different from prefix；Wherein, the restriction enzyme site (T2 and T3) that the prefix and suffix are included produces same tailer sequence after cleavage.Present invention also offers the external joining methods of a kind of DNA of the application of above-mentioned DNA constructions and use the DNA constructions.DNA can be engineered, standardized using the construction and method of the present invention, modular transformation or assembling.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a construct for genetic modification and a DNA in-vitro splicing method.
Background
Over 40 years ago, humans began to possess the ability to splice DNA of genetic material of life in vitro due to the discovery of restriction enzymes and DNA ligases (Zimmerman et al 1967; Lobban & Kaiser 1973; Cohen et al 1973). In recent decades, many DNA splicing techniques have been developed to make splicing of DNA easier and to make the spliced length larger. Although the price of chemically synthesized DNA is decreasing, chemical synthesis is currently not a complete alternative to the splicing technique of DNA, since only 200bp-2,000bp length can be synthesized (Kosuri & Church 2014). The DNA splicing technology can be mainly summarized into 3 basic principles: endonuclease-mediated splicing, site-specific recombinant splicing, and long-overlapping sequence-based splicing (Casini et al 2015).
In addition to making splicing of DNA easier and larger due to the advent of synthetic biology, another goal of DNA splicing is to establish a scientific, standardized splicing standard (Kelwick et al 2014; Ellis et al 2011). On the one hand, one direction of research in synthetic biology is to assemble individual biological elements into a system, in which standard, reliable engineering approaches are required to splice instead of specific repetitive, cumbersome splices. On the other hand, the synthetic biology needs to test and redesign components of different levels such as genes, loops, paths, networks and the like, and a standard splicing method can conveniently realize the sharing of all scientists. In the future, any layperson, even school students, may design cells that assemble specific characteristics.
At present, there are some standard splicing methods established and Arturo Casini et al have summarized in a review (Casini et al 2015). Wherein, the biobrick (BioBricks)TM) Is one of the earliest splicing methods (Shettyet al 2008), and on this basis, an International genetic engineering machine Competition (iGEM) is established, which currently has a library of more than 20,000 elements. On the basis of BioBrick, BamHI and BglII isocaudarner is used instead of BglBrick standard, so that the spliced scar is more reasonable and has more advantages in the assembly of fusion protein (Anderson et al 2010). With the development of splicing technology, seamless splicing is also applied to the establishment of standards. Such as type IIS restriction enzyme-based splicing, inter-fragment long overlap-based splicing techniques In-Fusion and Gibson assembly, etc. (Zhu et al 2007; Gibson et al 2009).
While many standards for assembly have been established, there are deficiencies and room for improvement in these assembly techniques. For example, splicing techniques based on type II restriction enzyme and type IIS endonuclease must require that the spliced elements do not contain these sites, otherwise these sites must be removed first by PCR methods or de novo synthesis, increasing the workload and cost. The ibrick method utilizes an assembly method based on homing endonuclease to recognize and cut a long specific sequence (>18bp), and avoids restriction of restriction endonuclease, but has the disadvantage of leaving a long scar (21bp) after splicing (Liu et al 2014). The method such as Gibson assembly based on the long overlapping region between the fragments can well carry out seamless splicing, and can realize the one-time splicing of large fragments and multiple fragments, but the method is not suitable for iterative splicing because the fragments are obtained by PCR, the PCR method may introduce unnecessary mutation, and one-time PCR has great limitation on the length (for example, the length of the current PCR product is generally less than 20 Kb).
In 2015, Zhang et al found that the crRNA-mediated endonuclease, Cpf1, was able to cleave double-stranded DNA and produce sticky ends (Zetsche et al 2015). Based on the characteristics of the enzyme, the inventor invents a C-Brick standard assembly method through design and construction, is simple and easy to use, and solves the defects of the splicing method. Therefore, the C-Brick standard assembly has a huge application prospect.
Disclosure of Invention
The invention aims to provide a DNA construct and application thereof.
Another object of the present invention is to provide a method for splicing DNAs in vitro.
In a first aspect of the invention, there is provided a DNA construct comprising an enzyme cleavage site and comprising a nucleic acid sequence of the structure shown in formula I:
Ta-C-Tb I
in the formula, Ta is a prefix sequence; c is a nucleic acid sequence to be spliced; tb is a suffix sequence;
the prefix sequence contains a second enzyme cutting site, the suffix sequence contains a third enzyme cutting site, the second enzyme cutting site is different from the third enzyme cutting site, and the second enzyme cutting site and the third enzyme cutting site generate a same tail sequence after enzyme cutting.
In another preferred embodiment, the enzyme cleavage site needs to be located (recognized) and cleaved in the presence of crRNA.
In another preferred embodiment, the enzyme cleavage site is capable of being recognized and cleaved by a CRISPR-associated enzyme.
In another preferred embodiment, the enzyme cleavage site is capable of being recognized and cleaved by an enzyme selected from the group consisting of: CRISPR-associated enzymes such as Cpf1, Cas9, C2C1, C2C2, C2C3 and the like.
In another preferred example, the Cpf1 enzyme is FnCpf1 (i.e., Cpf1 from Francisella tularensis). FnCpf1, capable of cleaving the cleavage site of Cpf1 under the direction of a specific crRNA.
In another preferred example, in formula I, the Tb further includes a fourth enzyme cleavage site (T4), which is different from the second enzyme cleavage site and the third enzyme cleavage site.
In another preferred embodiment, the fourth enzyme cleavage site needs to be located and cleaved in the presence of crRNA.
In another preferred example, in formula I, the Ta further comprises a first enzyme cleavage site (T1), the first enzyme cleavage site being different from the fourth enzyme cleavage site, the second enzyme cleavage site, and the third enzyme cleavage site.
In another preferred embodiment, the first enzyme cleavage site needs to be located and cleaved in the presence of crRNA.
In another preferred embodiment, the second enzyme cleavage site and the third enzyme cleavage site are capable of being cleaved by the same enzyme in the presence of different crrnas; preferably, it is capable of being cleaved by an enzyme selected from the group consisting of: CRISPR-associated enzymes such as Cpf1, Cas9, C2C1, C2C2, C2C3 and the like.
In another preferred example, the first enzyme cleavage site, the second enzyme cleavage site, the third enzyme cleavage site and the fourth enzyme cleavage site are capable of being cleaved by the same enzyme in the presence of different crrnas; preferably, it is capable of being cleaved by an enzyme selected from the group consisting of: CRISPR-associated enzymes such as Cpf1, Cas9, C2C1, C2C2, C2C3 and the like.
In another preferred embodiment, the nucleic acid sequence to be spliced comprises a CDS sequence, a coding gene sequence, an antibiotic biosynthesis gene cluster, an element responsible for conjugative transfer, or a DNA sequence with a specific function.
In another preferred embodiment, the nucleic acid sequence to be spliced has a length of more than or equal to 1bp, preferably more than or equal to 500bp, more preferably more than or equal to 1kb, such as 1.5kb, 2kb, 2.5kb, 3kb, 3.5kb, 4kb, 5kb, 10kb, 15kb, 20kb, 25kb, 30kb, 35kb, 40kb, 45kb, 50kb, 100 kb.
In another preferred embodiment, said C does not contain said cleavage site.
In another preferred embodiment, the crRNA sequence locating the cleavage site of the first enzyme is:
5’-GGGAAUUUCUACUGUUGUAGAUUUAUCGCAACUUUCUACUGAAUUC-3’。
in another preferred embodiment, the crRNA sequence locating the cleavage site of the second enzyme is:
5’-GGGAAUUUCUACUGUUGUAGAUCUCUAGAAAGAGGAGAAAGGAUCC-3’。
in another preferred embodiment, the crRNA sequence locating the cleavage site of the third enzyme is:
5’-GGGAAUUUCUACUGUUGUAGAUUCGAGCUAGAGACUAGUGGAUCC-3’。
in another preferred embodiment, the crRNA sequence locating the fourth enzyme cleavage site is:
5’-GGGAAUUUCUACUGUUGUAGAUAGCUAGCUGCAGUUUCUCCUUGAA-3’。
in another preferred embodiment, the second enzyme cleavage site comprises a nucleic acid sequence selected from the group consisting of:
(a)5’-TTTACTCTAGAAAGAGGAGAAAGGATCC-3’(T2)
(b) a nucleic acid sequence which is formed by substituting, deleting or adding one or more nucleotide residues to the nucleic acid sequence in (a) and can be recognized by FnCpf1 and corresponding crRNA.
In another preferred embodiment, the third enzyme cleavage site comprises a nucleic acid sequence selected from the group consisting of:
(a)5’-GGATCCACTAGTCTCTAGCTCGAGAAA-3’(T3)
(b) a nucleic acid sequence which is formed by substituting, deleting or adding one or more nucleotide residues to the nucleic acid sequence in (a) and can be recognized by FnCpf1 and corresponding crRNA.
In another preferred embodiment, said fourth enzyme cleavage site comprises a nucleic acid sequence selected from the group consisting of:
(a)5’-TTCAAGGAGAAACTGCAGCTAGCTTAAA-3’(T4)，
(b) a nucleic acid sequence which is formed by substituting, deleting or adding one or more nucleotide residues to the nucleic acid sequence in (a) and can be recognized by FnCpf1 and corresponding crRNA.
In another preferred embodiment, the first enzyme cleavage site comprises a nucleic acid sequence selected from the group consisting of:
(a)5’-TTTGTTATCGCAACTTTCTACTGAATTC-3’(T1)，
(b) a nucleic acid sequence which is formed by substituting, deleting or adding one or more nucleotide residues to the nucleic acid sequence in (a) and can be recognized by FnCpf1 and corresponding crRNA.
In another preferred embodiment, Ta comprises a nucleic acid sequence selected from the group consisting of:
(a)5’-TTTGTTATCGCAACTTTCTACTGAATTCAAGCTTTACTCTAGAAAGAGGAGAAAGGATCC-3’；
(b) a nucleic acid sequence which is formed by substituting, deleting or adding one or more nucleotide residues to the nucleic acid sequence in (a) and can be recognized by FnCpf1 and corresponding crRNA.
In another preferred embodiment, Tb comprises a nucleic acid sequence selected from the group consisting of:
(a)5’-GGATCCACTAGTCTCTAGCTCGAGAAATTCAAGGAGAAACTGCAGCTAGCTTAAA-3’。
(b) a nucleic acid sequence which is formed by substituting, deleting or adding one or more nucleotide residues to the nucleic acid sequence in (a) and can be recognized by FnCpf1 and corresponding crRNA.
In another preferred embodiment, the construct further comprises an element selected from the group consisting of upstream and downstream of the nucleic acid sequence of formula I:
selectable marker genes, replication elements, promoters, terminators, poly (A) elements, transport elements, gene targeting elements, selectable marker genes, enhancers, and transposase encoding genes.
In another preferred embodiment, the selectable marker gene is selected from the group consisting of resistance markers.
In a second aspect of the invention, there is provided a vector comprising a construct according to the first aspect of the invention.
In a third aspect of the invention, there is provided a host cell having a construct according to the first aspect of the invention integrated at one or more sites in its genome or comprising a vector according to the second aspect of the invention.
In a fourth aspect of the present invention, there is provided a kit comprising reagents selected from one or more of the following groups:
(a) the construct of claim 1;
(b) the vector of claim 5;
(c) the cell of claim 6;
(d) an enzyme or an expression vector thereof that cleaves an enzyme cleavage site of the construct of claim 1; and
(e) a crRNA transcript or crRNA transcription template that maps to an enzyme cleavage site of the construct described in claim 1.
In a fifth aspect of the invention, there is provided use of a construct according to the first aspect of the invention, a vector according to the second aspect of the invention, a cell according to the third aspect of the invention or a kit according to the fourth aspect of the invention for genetic engineering of a genome of a cell and/or for construction of a genetic circuit.
The sixth aspect of the present invention provides a method for in vitro splicing of DNA, comprising the steps of:
(1) providing a first vector comprising a first construct comprising a first nucleic acid sequence having the structure of formula Ia,
Ta-Ca-Tb Ia
wherein Ta and Tb are as defined in the first aspect of the invention and Ca is the first nucleic acid sequence to be spliced;
(2) carrying out enzyme digestion on a third enzyme digestion site of the first vector to form a linearized first enzyme digestion product;
(3) providing a second construct comprising a second nucleic acid sequence having the structure of formula Ib,
Ta-Cb-Tb Ib
wherein Ta and Tb are defined as above, and Cb is a second nucleic acid sequence to be spliced;
carrying out enzyme digestion on a second enzyme digestion site and a third enzyme digestion site of the second construction to form a second enzyme digestion product subjected to enzyme digestion;
(4) and (3) performing a ligation reaction on the second enzyme digestion product and the first enzyme digestion product to form a vector containing a splicing sequence shown in a formula II:
Ta-Ca-Scar-Cb-Tb II
wherein Ta, Tb, Ca, and Cb are as defined above, and Scar is a splice linker sequence formed during splicing.
In another preferred embodiment, the length of the Scar is 0-50.
In another preferred embodiment, the length of the Scar is a multiple of 3.
In another preferred example, the length of the Scar is 6 bp.
In another preferred embodiment, said second construct is integrated or ligated into the second cleavage site of the first vector.
In another preferred example, in step (2) of the method, the third enzyme cutting site and the fourth enzyme cutting site of the first vector are cut by enzyme, so as to form a linearized first enzyme cutting product; and is
In the step (3), performing enzyme digestion on a second enzyme digestion site and a fourth enzyme digestion site of the second construction to form an enzyme-digested second enzyme digestion product; then, the ligation reaction of step (4) is performed.
In another preferred embodiment, the method further comprises optionally repeating the following steps one or more times:
(5) and carrying out enzyme digestion on the vector obtained in the previous step at a second enzyme digestion site and a third enzyme digestion site to obtain a linearized enzyme digestion product, and carrying out a connection reaction on the enzyme digestion product and the enzyme digestion product subjected to enzyme digestion at the first enzyme digestion site and the third enzyme digestion site to form a connection product containing a multistage splicing sequence.
In another preferred embodiment, said Ca and Cb do not contain said first cleavage site and said second cleavage site.
In another preferred embodiment, the enzyme is Cpf1, preferably FnCpf 1.
In another preferred embodiment, the nucleic acid sequence to be spliced comprises a CDS sequence, a coding gene sequence and an antibiotic biosynthesis gene cluster.
In another preferred embodiment, the nucleic acid sequence to be spliced has a length of more than or equal to 1bp, preferably more than or equal to 500bp, more preferably more than or equal to 1kb, such as 1.5kb, 2kb, 2.5kb, 3kb, 3.5kb, 4kb, 5kb, 10kb, 15kb, 20kb, 25kb, 30kb, 35kb, 40kb, 45kb, 50kb, 100 kb.
In another preferred embodiment, said construct further comprises an element selected from the group consisting of upstream and downstream of the nucleic acid sequence of formula Ia or Ib:
selectable marker genes, replication elements, promoters, terminators, poly (A) elements, transport elements, gene targeting elements, selectable marker genes, enhancers, and transposase encoding genes.
In another preferred embodiment, the selectable marker gene is selected from the group consisting of: auxotrophic markers, resistance markers, reporter gene markers, and the like.
It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.
Drawings
FIG. 1 shows a schematic representation of C-Brick standard splicing and cleavage by the Cpf1 endonuclease. Based on the characteristic that a specific crRNA guides Cpf1 to cut a DNA double strand and form a 5' protruding sticky end, a C-Brick standard splicing method is designed.
FIG. 2 shows the results of sequencing the interface sequences (i.e., prefix and suffix sequences) and their cleavage sites using the vector plasmid of C-Brick of the present invention. Where the prefix contains the T1 and T2 sequences and the suffix contains the T3 and T4 sequences. The major cleavage sites were at 18 bases (non-complementary strand) and 23 bases (complementary strand) from PAM.
FIG. 3 shows a scheme for splicing one expression cassette using the C-Brick system of the present invention.
FIG. 4 shows the results of splicing three color expression-related genes using the C-Brick system of the present invention. FIG. 4a shows the cultivation of E.coli containing different plasmids constructed in liquid medium, in which 1,2,3 are E.coli expressing eforRed, amilGFP and cjBlue, respectively, and 4,5,6 are E.coli expressing eforRed + amilGFP, eforRed + cjBlue and amilGFP + cjBlue, respectively; FIG. 4b shows the results of 1 day culture at 37 ℃ using E.coli strain of 4a as a drawing on a solid medium.
Detailed Description
The present inventors have extensively and intensively studied and studied the cleavage property of Cpf1 enzyme to develop a technical scheme for in vitro DNA splicing. The C-Brick standard vector is adopted as a splicing vector to carry out engineering, standardization and modular modification or assembly on DNA. Experimental results show that the technical scheme is adopted to successfully splice and construct the eforRed, cjBlue and amilGFP protein expression cassettes. On the basis, the applicant develops a new generation of bio-brick assembly standard and completes the invention.
Specifically, the invention provides a DNA construct comprising a prefix and a suffix (each being a DNA sequence capable of being cleaved by a CRISPR-associated enzyme) and comprising the structure Ta-C-Tb, wherein Ta is the prefix and comprises a nucleic acid sequence comprising an enzyme cleavage site; c is a nucleic acid sequence to be spliced; tb is a suffix comprising a nucleic acid sequence of an enzyme cleavage site different from the prefix; wherein the prefix and suffix comprise enzyme cutting sites (T2 and T3) which are cut by enzyme to generate a common tail sequence. The invention also provides application of the DNA construction and a DNA in vitro splicing method using the DNA construction. DNA can be engineered, standardized, modular engineered or assembled using the constructs and methods of the invention.
Term(s) for
The term "biobrick (BioBricks)TM) "refers to a standardized Assembly Standard for DNA proposed by Tom Knight et al in 2003 (Idempower Vector Design for Standard Assembly of BioBricks. DSpace2003http:// hdl. handle. net/1721.1/21168.).
The term "crRNA" refers to CRISPR RNA, a short RNA that directs Cpf1 to a target DNA sequence.
The term "CRISPR" refers to clustered, regularly interspaced short palindromic repeats (clustered regular interspersed short palindromic repeats) that are the immune system of many prokaryotes.
The term "Cpf 1" refers to a crRNA-dependent endonuclease, which is a type V (type V) enzyme in the classification of CRISPR systems.
The term "FnCpf 1" refers to Cpf1 from Francisella novicida U112, which requires the PAM sequence of TTN to cleave double-stranded DNA under the guidance of a particular crRNA, predominantly forming 5' -overhanging sticky ends, at 18 th base (non-complementary strand) and 23 th base (complementary strand) from PAM.
In a preferred embodiment of the invention, the coding polynucleotide sequence of FnCpf1 is as follows:
>FnCpf1(SEQ ID NO.1)
ATGAGCATCTATCAGGAGTTCGTGAATAAGTACAGCCTGTCCAAGACCCTGCGGTTTGAGCTGATCCCCCAGGGCAAGACACTGGAGAACATCAAGGCCAGGGGCCTGATCCTGGACGATGAGAAGCGCGCCAAGGACTATAAGAAGGCCAAGCAGATCATCGATAAGTACCACCAGTTCTTTATCGAGGAGATCCTGAGCAGCGTGTGCATCTCTGAGGATCTGCTGCAGAATTACAGCGACGTGTATTTCAAGCTGAAGAAGTCTGACGATGACAACCTGCAGAAGGACTTCAAGAGCGCCAAGGACACCATCAAGAAGCAGATCAGCGAGTATATCAAGGACTCCGAGAAGTTTAAGAATCTGTTCAACCAGAATCTGATCGATGCCAAGAAGGGCCAGGAGTCCGACCTGATCCTGTGGCTGAAGCAGTCTAAGGACAATGGCATCGAGCTGTTCAAGGCCAACTCTGATATCACCGATATCGACGAGGCCCTGGAGATCATCAAGAGCTTTAAGGGCTGGACCACATACTTTAAGGGCTTCCACGAGAACAGGAAGAACGTGTACAGCAGCAACGACATCCCTACAAGCATCATCTACCGCATCGTGGATGACAATCTGCCAAAGTTCCTGGAGAACAAGGCCAAGTATGAGTCCCTGAAGGACAAGGCCCCCGAGGCCATCAATTACGAGCAGATCAAGAAGGATCTGGCCGAGGAGCTGACCTTCGATATCGACTATAAGACATCCGAGGTGAACCAGCGGGTGTTTTCTCTGGACGAGGTGTTTGAGATCGCCAATTTCAACAATTACCTGAACCAGTCCGGCATCACCAAGTTCAATACAATCATCGGCGGCAAGTTTGTGAACGGCGAGAATACCAAGAGAAAGGGCATCAACGAGTACATCAATCTGTATAGCCAGCAGATCAACGACAAGACCCTGAAGAAGTACAAGATGAGCGTGCTGTTCAAGCAGATCCTGTCCGATACAGAGTCTAAGAGCTTTGTGATCGATAAGCTGGAGGATGACTCTGACGTGGTGACCACAATGCAGAGCTTTTATGAGCAGATCGCCGCCTTCAAGACCGTGGAGGAGAAGTCTATCAAGGAGACACTGAGCCTGCTGTTCGATGACCTGAAGGCCCAGAAGCTGGACCTGTCTAAGATCTACTTCAAGAACGATAAGTCCCTGACCGACCTGTCTCAGCAGGTGTTTGATGACTATAGCGTGATCGGCACCGCCGTGCTGGAGTACATCACACAGCAGATCGCCCCAAAGAACCTGGATAATCCCTCTAAGAAGGAGCAGGAGCTGATCGCCAAGAAGACCGAGAAGGCCAAGTATCTGAGCCTGGAGACAATCAAGCTGGCCCTGGAGGAGTTCAATAAGCACCGGGATATCGACAAGCAGTGCAGATTTGAGGAGATCCTGGCCAACTTCGCCGCCATCCCCATGATCTTTGATGAGATCGCCCAGAACAAGGACAATCTGGCCCAGATCTCCATCAAGTACCAGAACCAGGGCAAGAAGGACCTGCTGCAGGCCTCTGCCGAGGATGACGTGAAGGCCATCAAGGATCTGCTGGACCAGACCAACAATCTGCTGCACAAGCTGAAGATCTTCCACATCTCCCAGTCTGAGGATAAGGCCAATATCCTGGATAAGGACGAGCACTTTTATCTGGTGTTCGAGGAGTGTTACTTCGAGCTGGCCAACATCGTGCCCCTGTACAACAAGATCAGAAATTATATCACACAGAAGCCTTACTCCGACGAGAAGTTTAAGCTGAACTTCGAGAACAGCACCCTGGCCAACGGCTGGGATAAGAATAAGGAGCCTGACAACACAGCCATCCTGTTCATCAAGGATGACAAGTACTATCTGGGCGTGATGAATAAGAAGAACAATAAGATCTTCGATGACAAGGCCATCAAGGAGAACAAGGGCGAGGGCTACAAGAAGATCGTGTATAAGCTGCTGCCCGGCGCCAATAAGATGCTGCCTAAGGTGTTCTTTTCCGCCAAGTCTATCAAGTTCTACAACCCATCCGAGGACATCCTGCGGATCAGAAATCACTCCACCCACACAAAGAACGGCTCTCCCCAGAAGGGCTATGAGAAGTTTGAGTTCAATATCGAGGATTGCCGGAAGTTTATCGACTTCTACAAGCAGAGCATCTCCAAGCACCCTGAGTGGAAGGATTTTGGCTTCAGGTTTAGCGACACCCAGCGGTACAACTCCATCGACGAGTTCTACAGAGAGGTGGAGAATCAGGGCTATAAGCTGACATTTGAGAACATCTCTGAGAGCTACATCGACAGCGTGGTGAATCAGGGCAAGCTGTACCTGTTCCAGATCTATAACAAGGACTTCAGCGCCTATTCCAAGGGCCGGCCAAACCTGCACACCCTGTACTGGAAGGCCCTGTTCGATGAGAGAAATCTGCAGGACGTGGTGTATAAGCTGAACGGCGAGGCCGAGCTGTTTTACAGGAAGCAGTCCATCCCTAAGAAGATCACACACCCAGCCAAGGAGGCCATCGCCAACAAGAATAAGGACAATCCTAAGAAGGAGAGCGTGTTCGAGTACGATCTGATCAAGGACAAGCGGTTCACCGAGGATAAGTTCTTTTTCCACTGTCCAATCACAATCAACTTCAAGTCCTCTGGCGCCAACAAGTTTAATGACGAGATCAATCTGCTGCTGAAGGAGAAGGCCAACGATGTGCACATCCTGAGCATCGACCGGGGCGAGAGACACCTGGCCTACTATACCCTGGTGGATGGCAAGGGCAATATCATCAAGCAGGATACCTTCAACATCATCGGCAATGACAGGATGAAGACAAACTACCACGATAAGCTGGCCGCCATCGAGAAGGATAGGGACTCCGCCCGCAAGGACTGGAAGAAGATCAACAATATCAAGGAGATGAAGGAGGGCTATCTGTCTCAGGTGGTGCACGAGATCGCCAAGCTGGTCATCGAGTACAATGCCATCGTGGTGTTCGAGGATCTGAACTTCGGCTTTAAGAGGGGCCGCTTTAAGGTGGAGAAGCAGGTGTATCAGAAGCTGGAGAAGATGCTGATCGAGAAGCTGAATTACCTGGTGTTTAAGGATAACGAGTTCGACAAGACCGGAGGCGTGCTGAGGGCATACCAGCTGACCGCCCCCTTTGAGACATTCAAGAAGATGGGCAAGCAGACAGGCATCATCTACTATGTGCCAGCCGGCTTCACCTCCAAGATCTGCCCCGTGACAGGCTTTGTGAACCAGCTGTACCCTAAGTATGAGTCCGTGTCTAAGAGCCAGGAGTTTTTCAGCAAGTTCGATAAGATCTGTTATAATCTGGACAAGGGCTACTTCGAGTTTTCCTTCGATTATAAGAACTTTGGCGACAAGGCCGCCAAGGGCAAGTGGACCATCGCCTCTTTCGGCAGCCGGCTGATCAACTTTAGAAATTCCGATAAGAACCACAATTGGGACACCCGGGAGGTGTACCCAACAAAGGAGCTGGAGAAGCTGCTGAAGGACTACAGCATCGAGTATGGCCACGGCGAGTGCATCAAGGCCGCCATCTGTGGCGAGAGCGATAAGAAGTTTTTCGCCAAGCTGACCTCCGTGCTGAATACAATCCTGCAGATGCGGAACAGCAAGACCGGCACAGAGCTGGACTACCTGATCTCCCCCGTGGCCGATGTGAACGGCAACTTCTTCGACAGCAGACAGGCCCCCAAGAATATGCCTCAGGATGCCGACGCCAACGGCGCCTATCACATCGGCCTGAAGGGCCTGATGCTGCTGGGCAGGATCAAGAACAATCAGGAGGGCAAGAAGCTGAACCTGGTCATCAAGAACGAGGAGTACTTTGAGTTCGTGCAGAACCGCAACAAT
the term "PAM" refers to the pro-spacer-adjacencies motif (protospacer-adjacent motif) necessary for cleavage of Cpf1, and the PAM of FnCpf1 is the TTN sequence.
In the present invention, C-Brick refers to a DNA standardized assembly technique using Cpf1 for iterative splicing between biological elements (part). In the C-Brick standard vector, each biological element carries a prefix sequence at its 5 'end and a suffix sequence at its 3' end. The prefix suffix sequence is cleaved enzymatically to leave complementary sticky ends.
The term "nucleic acid sequence to be spliced" in the present invention refers to any nucleic acid sequence of interest, including, but not limited to, CDS sequences, resistance gene coding sequences, antibiotic biosynthesis gene clusters, promoter sequences, terminator sequences, replicon sequences.
The terms "part" and "biological element" have the same meaning and refer to a DNA sequence with a prefix added to the 5 'end and a suffix added to the 3' end of the sequence according to the C-Brick standard, respectively.
The term "scar" means that two biological elements are spliced by C-Brick standards, leaving a short sequence. If splicing is performed at the T2, T3 site, a 6 base sequence is formed between the two elements: 5 '-GGATCC-3'.
The C-Brick working principle according to the invention
As shown in FIG. 1, FnCpf1 is used as an example to illustrate the C-Brick operation of the present invention. In FIG. 1, the elements to be spliced are constructed into a C-Brick standard vector (such as a promoter sequence, a protein coding sequence and a terminator sequence), and then spliced by digestion and ligation with FnCpf1 and the corresponding crRNA (such as to obtain a functional expression cassette).
As shown in fig. 2, panel a shows the interface sequence and Cpf1 target sequences T1, T2, T3 and T4 in the C-Brick standard vector, the red line indicates the cleavage site of the 4 Cpf1 targeting sequences of the interface sequence; FIG. b shows a schematic representation of the C-Brick standard vector; the c diagram shows that after 4 Cpf1 targeting sequences are cleaved with FnCpf1 and the corresponding crRNA, the cleavage sites are sequenced, with the major cleavage sites at position 18 on the non-complementary strand and position 23 on the complementary strand.
In a preferred embodiment of the invention, with reference to FIG. 3, a DNA construct according to the invention comprises four cleavage sites T1 (first cleavage site), T2 (second cleavage site), T3 (third cleavage site), T4 (fourth cleavage site), T1, T2 being located upstream (prefix sequence) and T3, T4 being located downstream (suffix sequence) of the nucleic acid sequences to be spliced. The specific splicing process is described as follows:
cutting enzyme sites T3 and T4 of the vector A (containing an element A to be spliced, such as an RBS promoter vector) to form a linearized enzyme product A;
cleaving the T1 and T3 cleavage sites of vector B (containing the element B to be spliced, e.g., a protein-coding sequence vector) to form a cleaved product B (protein-coding sequence);
carrying out enzyme digestion on T1 and T2 enzyme digestion sites of a vector C (containing an element C to be spliced, such as a terminator vector) to form a linearized enzyme digestion product C;
connecting the enzyme digestion product B with the enzyme digestion product C, splicing the enzyme digestion product B (containing the element B to be spliced) into a carrier C, wherein the element B to be spliced is positioned at the upstream of the element C to be spliced, and obtaining a spliced carrier D;
carrying out enzyme digestion on the T2 and T4 enzyme digestion sites of the splicing vector D to form an enzyme digestion product D (containing an element B to be spliced and an element C to be spliced) after enzyme digestion;
and connecting the enzyme digestion product A with the enzyme digestion product D, splicing the enzyme digestion product D (containing the element B to be spliced and the element C to be spliced) into the carrier A, wherein the element A to be spliced is positioned at the upstream of the element B to be spliced, and thus obtaining the spliced element A-the element B to be spliced-the element C to be spliced.
In a preferred embodiment of the invention, the cleavage site is the FnCpf1 cleavage site, which cleaves double-stranded DNA under the guidance of specific crRNA, forming a 5' overhanging sticky-end.
In a preferred embodiment of the invention, C-Brick according to the invention comprises a DNA standardized assembly technique using Cpf1 for iterative splicing between biological elements (part). In the C-Brick standard vector, each biological element carries a prefix sequence (e.g., comprising T1, T2) at the 5 'end and a suffix sequence (e.g., comprising T3, T4) at the 3' end. The T2 and T3 cleaved through Cpf1 leaving complementary sticky ends.
In another preferred embodiment, the crRNA sequences of the corresponding cleavage sites are as follows:
T1-crRNA sequence 5'-GGGAAUUUCUACUGUUGUAGAUUUAUCGCAACUUUCUACUGAAUUC-3' (SEQ ID NO. 5);
T2-crRNA sequence 5'-GGGAAUUUCUACUGUUGUAGAUCUCUAGAAAGAGGAGAAAGGAUCC-3' (SEQ ID NO. 6);
T3-crRNA sequence 5'-GGGAAUUUCUACUGUUGUAGAUUCGAGCUAGAGACUAGUGGAUCC-3' (SEQ ID NO. 7);
T4-crRNA sequence 5'-GGGAAUUUCUACUGUUGUAGAUAGCUAGCUGCAGUUUCUCCUUGAA-3' (SEQ ID NO. 8).
In another preferred embodiment, the prefix sequence comprises a nucleic acid sequence selected from the group consisting of:
(a) 5'-TTTGTTATCGCAACTTTCTACTGAATTCAAGCTTTACTCTAGAAAGAGGAGAAAGGATCC-3' (SEQ ID NO. 9); wherein,
t1 sequence 5'-TTTGTTATCGCAACTTTCTACTGAATTC-3' (SEQ ID NO. 10);
t2 sequence 5'-TTTACTCTAGAAAGAGGAGAAAGGATCC-3' (SEQ ID NO. 11);
(b) a nucleic acid sequence which is formed by substituting, deleting or adding one or more nucleotide residues to the nucleic acid sequence in the step (a) and can be recognized by FnCpf1 and corresponding crRNA;
the suffix sequence comprises a nucleic acid sequence selected from the group consisting of:
(a) 5'-GGATCCACTAGTCTCTAGCTCGAGAAATTCAAGGAGAAACTGCAGCTAGCTTAAA-3' (SEQ ID NO. 12); wherein,
t3 sequence 5'-GGATCCACTAGTCTCTAGCTCGAGAAA-3' (SEQ ID NO. 13);
t4 sequence 5'-TTCAAGGAGAAACTGCAGCTAGCTTAAA-3' (SEQ ID NO. 14);
the T3 and T4 sequences are complementary strands of crRNA.
(b) A nucleic acid sequence which is formed by substituting, deleting or adding one or more nucleotide residues to the nucleic acid sequence in (a) and can be recognized by FnCpf1 and corresponding crRNA.
Each biological element was constructed into a standard C-Brick vector, forming a plasmid for storage. The new component is obtained by cutting part1 with FnCpf1, crRNA-T3 and crRNA-T4, cutting part2 with FnCpf1, crRNA-T2 and crRNA-T3, recovering by agarose gel electrophoresis, mixing and connecting the part2 fragment and the part1 vector according to a certain molar ratio, and transforming Escherichia coli (or other suitable hosts). Then, a 6bp scar will be generated between the two elements, and the sequence does not contain the in-frame stop codon, so the method is suitable for the expression of the fusion protein. In order to prevent self-ligation of the vector during splicing, the vector is subjected to agarose gel electrophoresis after enzyme digestion, and is recovered by using a DNA gel recovery kit, and then CIP (cyclic endogenous phosphate) is used for removing phosphorus, and the DNA gel recovery kit is used for recovery again.
As used herein, "exogenous" or "heterologous" refers to the relationship between two or more nucleic acid or protein sequences of different origin. For example, a promoter is foreign to a gene of interest if the combination of the promoter and the sequence of the gene of interest is not normally found in nature. A particular sequence is "foreign" to the cell or organism into which it is inserted.
DNA constructs
The invention provides a DNA construct, which comprises a nucleic acid sequence with a structure shown in a formula I:
Ta-C-Tb I
wherein Ta is a nucleic acid sequence comprising a second enzyme cleavage site (T2); c is a nucleic acid sequence to be spliced; tb is a nucleic acid sequence containing a third enzyme cleavage site (T3);
wherein the second enzyme cleavage site and the third enzyme cleavage site generate a common tail sequence after enzyme cleavage.
In another preferred embodiment, said construct further comprises an element or a combination thereof selected from the group consisting of: promoters, terminators, poly (A) elements, transport elements, gene targeting elements, selectable marker genes, enhancers, resistance genes, transposase encoding genes.
A variety of selectable marker genes are applicable to the present invention, including but not limited to: auxotrophic markers, resistance markers, reporter gene markers. The use of a selectable marker serves to screen for recombinant cells (recombinants) so that recipient cells can be significantly distinguished from non-transformed cells. The auxotrophic marker is a marker gene that is introduced so as to complement a mutant gene of a recipient cell, thereby allowing the recipient cell to exhibit wild-type growth. The resistance marker refers to transferring resistance genes into receptor cells, and the transferred genes enable the receptor cells to show drug resistance at a certain drug concentration. As a preferred mode of the invention, a resistance marker is used to achieve convenient screening of recombinant cells.
Vectors, host cells
The invention also provides a vector comprising a DNA construct of the invention. Preferably, the carrier is selected from: bacterial plasmids, bacteriophages, yeast plasmids, or animal cell vectors, shuttle vectors; the vector is a transposon vector. Methods for preparing recombinant vectors are well known to those of ordinary skill in the art. Any plasmid and vector may be used as long as it can replicate and is stable in the host.
One of ordinary skill in the art can use well-known methods to construct expression vectors containing the promoter and/or gene sequences of interest described herein. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like.
The invention also provides a host cell comprising said construct or vector, or said host cell having said construct or vector chromosomally integrated therein. In another preferred embodiment, the host cell further comprises a vector comprising a gene encoding a transposase or having a transposase gene integrated into its chromosome.
Preferably, the host cell is Escherichia coli, Streptomyces or eukaryotic cell.
In another preferred embodiment, the prokaryotic cell includes (but is not limited to): escherichia coli and the like.
In another preferred embodiment, the eukaryotic cell includes (but is not limited to): saccharomyces cerevisiae, and the like.
The constructs or vectors of the invention may be used to transform appropriate host cells. The host cell may be a prokaryotic cell, such as E.coli, Streptomyces, Agrobacterium: or lower eukaryotic cells, such as yeast cells; or a higher animal cell, such as an insect cell. It will be clear to one of ordinary skill in the art how to select an appropriate vector and host cell. Transformation of a host cell with recombinant DNA can be carried out using conventional techniques well known to those skilled in the art. When the host is a prokaryote (e.g., Escherichia coli), CaCl may be used2The treatment can also be carried out by electroporation. When the host is a eukaryote, the following DNA transfection methods may be used: calcium phosphate coprecipitation, conventional mechanical methods (e.g., microinjection, electroporation, liposome encapsulation, etc.). The transformed plant may be transformed by methods such as Agrobacterium transformation or biolistic transformation, for example, leaf disc method, immature embryo transformation, flower bud soaking method, etc.
The main advantages of the invention are:
(1) since CIRPSR-related enzymes, such as the Cpf1 endonuclease, recognize much longer sequences than conventional endonucleases, up to around 24 base pairs, and require a PAM sequence (TTN), the recognition sites of which are very rare in the native DNA sequence. Therefore, when the C-Brick standardized element is constructed, the removal of the enzyme cutting sites in the DNA is basically not needed, so that the technology can accommodate larger biological elements without modifying the original sequence, can directly utilize the natural sequence with better representation, greatly reduces the workload of the standardized biological elements, and increases the universality of the cyclic assembly strategy in the assembly technology;
(2) the long recognition sequence also provides a single cleavage site for cloning and splicing of long fragments, so that the capacity of a single biological element can be greatly increased. Therefore, the technology has significant advantages in the standardization, assembly and characterization of long-fragment DNA sequences.
(3) C-Brick splicing leaves a short scar, such as a six base scar GGATCC, translated into the amino acid sequence glycine-serine, which is typically a linker peptide sequence useful in fusion proteins.
The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, molecular cloning is generally performed according to conventional conditions such as Sambrook et al: the conditions described in the laboratory Manual (New York: Cold Spring Harbor laboratory Press,1989), or according to the manufacturer's recommendations. Unless otherwise indicated, percentages and parts are by weight. The experimental materials referred to in the present invention are commercially available without specific reference.
Material
1. Escherichia coli DH10B strain was purchased from Takara; DNA restriction enzyme, T4DNA ligase, T4Polynucleotide Kinase, calf endogenous phosphatase, etc. from New England Biolabs; t7RNA polymerase was purchased from Thermo;SV Gel and PCR Clean-Up System was purchased from Promega; the pSB1A2 plasmid was purchased from iGEM; the Cpf1 sequence was synthesized by tsry corporation, tokyo; cjBlue (BBa _ K592011), eforRed (BBa _ K592012), amilGFP (BBa _ K592010) sequences were synthesized by Shanghai Tulo harbor Biotech limited; the culture medium (e.g., Tryptone,yeast Extract, etc., if not specifically noted) were purchased from OXOID, Inc.
2. The formula of the culture medium is as follows: in the case of preparing liquid LB (1% Tryptone, 0.5% Yeast extract, 1% NaCl) as a solid LB, it is only necessary to add 1% agar to the liquid LB.
Example 1 splicing of three color proteins Eford, cjBlue and amilGFP
1. Using pSB1A2 as a template, PCR introduced prefix and suffix sequences such that the cleavage site of BioBrick was replaced.
2. cjBlue (BBa _ K592011), eforRed (BBa _ K592012), amilGFP (BBa _ K592010) are used as template PCR fragments and inserted into a standard C-Brick vector. The terminator sequence (BBa _ B0015) and the promoter sequence containing the RBS were introduced into a standard C-Brick vector by PCR.
>eforRed(BBa_K592012)(SEQ ID NO.2)
ATGTCAGTGATTAAGCAGGTAATGAAGACCAAGTTGCACCTTGAGGGCACTGTCAATGGCCATGATTTTACGATCGAGGGTAAAGGTGAAGGCAAGCCGTACGAAGGGTTACAGCACATGAAAATGACAGTCACCAAAGGCGCGCCTCTGCCGTTTTCCGTTCATATTCTTACACCTAGCCACATGTATGGAAGCAAACCGTTTAATAAGTATCCAGCGGATATCCCAGACTACCACAAACAGTCTTTTCCCGAAGGTATGTCTTGGGAGCGGTCGATGATTTTTGAAGATGGTGGCGTATGCACCGCCAGTAATCACTCCAGCATAAACTTGCAAGAGAACTGTTTCATCTATGATGTTAAATTTCATGGTGTGAACCTGCCTCCGGATGGGCCCGTAATGCAAAAAACCATTGCTGGATGGGAGCCGAGCGTGGAAACACTGTACGTGCGTGACGGGATGTTAAAAAGTGACACTGCAATGGTTTTTAAACTGAAAGGAGGCGGTCATCATCGTGTTGATTTCAAAACGACGTATAAAGCCAAAAAACCTGTCAAGCTGCCAGAATTTCATTTCGTTGAACATCGCCTGGAACTGACCAAACACGATAAAGATTTCACAACTTGGGACCAGCAGGAGGCAGCCGAAGGCCATTTCTCACCGCTGCCGAAGGCTCTCCCATAA
>amilGFP(BBa_K592010)(SEQ ID NO.3)
ATGTCTTATTCAAAGCATGGCATCGTACAAGAAATGAAGACGAAATACCATATGGAAGGCAGTGTCAATGGCCATGAATTTACGATCGAAGGTGTAGGAACTGGGTACCCTTACGAAGGGAAACAGATGTCCGAATTAGTGATCATCAAGCCTGCGGGAAAACCCCTTCCATTCTCCTTTGACATACTGTCATCAGTCTTTCAATATGGAAACCGTTGCTTCACAAAGTACCCGGCAGACATGCCTGACTATTTCAAGCAAGCATTCCCAGATGGAATGTCATATGAAAGGTCATTTCTATTTGAGGATGGAGCAGTTGCTACAGCCAGCTGGAACATTCGTCTCGAAGGAAATTGCTTCATCCACAAATCCATCTTTCATGGCGTAAACTTTCCCGCTGATGGACCCGTAATGAAAAAGAAGACAATTGACTGGGATAAGTCCTTCGAAAAAATGACTGTGTCTAAAGAGGTGCTAAGAGGTGACGTGACTATGTTTCTTATGCTCGAAGGAGGTGGTTCTCACAGATGCCAATTTCACTCCACTTACAAAACAGAGAAGCCGGTCACACTGCCCCCGAATCATGTCGTAGAACATCAAATTGTGAGGACCGACCTTGGCCAAAGTGCAAAAGGCTTTACAGTCAAGCTGGAAGCACATGCCGCGGCTCATGTTAACCCTTTGAAGGTTAAATAA
>cjBlue(BBa_K592011)(SEQ ID NO.4)
ATGGCTTCCAAAATAAGCGACAACGTACGTATCAAACTGTATATGGAGGGCACGGTTAATAATCACCACTTCATGTGTGAAGCGGAGGGTGAGGGCAAGCCATACGAAGGAACGCAGATGGAAAACATTAAAGTGACCAAAGGAGGCCCGCTGCCGTTCTCTTTTGATATCCTGACGCCGAACTGCCAATATGGTTCTGTAGCCATAACCAAGTACACGTCGGGGATTCCGGACTATTTTAAACAGTCATTCCCTGAAGGTTTTACCTGGGAAAGAACCACCATTTATGAAGATGGGGCTTATCTGACAACTCAGCAGGAAACCAAACTTGATGGAAATTGCTTAGTCTACAATATTAAAATCCTCGGCTGCAATTTTCCCCCCAATGGTCCTGTTATGCAGAAAAAAACGCAAGGCTGGGAACCATGTTGCGAGATGCGCTATACACGTGATGGTGTCTTGTGCGGTCAGACATTAATGGCACTGAAATGTGCCGATGGGAACCATCTGACTTGTCATCTGCGGACTACTTACCGATCCAAAAAGGCAGCGAAGGCGTTGCAAATGCCACCTTTCCATTTTTCAGACCATCGTCCGGAAATTGTGAAGGTTAGCGAGAACGGCACACTGTTTGAGCAGCACGAAAGTAGTGTGGCACGCTATTGTCAGACATGCCCGAGCAAACTTGGTCATAATTAA
3. The plasmid containing cjBlue (BBa _ K592011), eforRed (BBa _ K592012) and amilGFP (BBa _ K592010) was cut with FnCpf1 and crRNA-T1 and crRNA-T3 respectively, and the terminator plasmid was cut with FnCpf1 and crRNA-T1 and crRNA-T2, and each fragment was recovered and ligated with a terminator vector mixed T4DNA ligase.
4. The promoter plasmid containing RBS on C-Brick was cut with FnCpf1 and crRNA-T3, crRNA-T4, and the structural genes containing the terminators in 3 were cut with FnCpf1 and crRNA-T2, crRNA-T4, and then ligated with the promoter plasmid vector mixed with T4DNA ligase, respectively.
5. In a similar manner, the 3 cassettes that have been ligated can be spliced again in pairs to form 3 additional colors.
6. The plasmids obtained by sequencing and splicing were analyzed for the accuracy at the interface, as shown in table 1. The most common T2-T3 incision connection and T4-T4 incision connection have the accuracy rate of more than 90 percent.
TABLE 1. accuracy of C-Brick splicing of different sites
| Connection mode | T1-T1 | T2-T3 | T4-T4 |
| Number of correct clones/number of tests | 10/12 | 44/47 | 38/42 |
| Rate of accuracy | 83.3％ | 93.6％ | 90.5％ |
FIG. 4 shows the results of splicing of chromoproteins using the C-Brick system of the present invention. Wherein panel a shows the growth of 6 E.coli containing different C-Brick assembled plasmids in liquid culture medium, producing visible color. Wherein, the Escherichia coli with the numbers of 1,2 and 3 respectively express eforRed, amilGFP and cjBlue proteins, and the Escherichia coli with the numbers of 4,5 and 6 respectively express 2 different proteins, namely eforRed + amilGFP eforRed + cjBlue and amilGFP + cjBlue; the b picture shows the use of 6 kinds of Escherichia coli on the solid medium drawing.
All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.
Anderson,J.C.et al.,2010.BglBricks:A flexible standard for biologicalpart assembly.Journal of biological engineering,4(1),p.1.
Casini,A.et al.,2015.Bricks and blueprints:methods and standards forDNA assembly.Nature Reviews Molecular Cell Biology,16(9),pp.568–576.Availableat:http://www.nature.com/doifinder/10.1038/nrm4014.
Cohen,S.N.et al.,1973.Construction of biologically functionalbacterial plasmids in vitro.Proceedings of the National Academy of Sciencesof the United States of America,70(11),pp.3240–3244.
Ellis,T.,Adie,T.&Baldwin,G.S.,2011.DNA assembly for syntheticbiology:from parts to pathways and beyond.Integrative biology:quantitativebiosciences from nano to macro,3(2),pp.109–118.
Gibson,D.G.et al.,2009.Enzymatic assembly of DNA molecules up toseveral hundred kilobases.Nature methods,6(5),pp.343–345.
Kelwick,R.et al.,2014.Developments in the Tools and Methodologies ofSynthetic Biology.Frontiers in Bioengineering and Biotechnology,2(November),pp.1–23.
Kosuri,S.&Church,G.M.,2014.Large-scale de novo DNA synthesis:technologies and applications.Nature Methods,11(5),pp.499–507.Available at:http://www.nature.com/doifinder/10.1038/nmeth.2918.
Liu,J.-K.et al.,2014.iBrick:A New Standard for Iterative Assembly ofBiological Parts with Homing Endonucleases.PLoS ONE，9(10),p.e110852.Availableat:http://dx.plos.org/10.1371/journal.pone.0110852.
Lobban,P.E.&Kaiser,A.D.,1973.Enzymatic end-to-end joining of DNAmolecules.Journal of Molecular Biology,78(3),pp.453–471.Available at:http://www.sciencedirect.com/science/article/pii/0022283673904683.
Shetty,R.P.,Endy,D.&Knight,T.F.,2008.Engineering BioBrick vectorsfrom BioBrick parts.Journal of biological engineering,2(1),p.5.Available at:http://www.jbioleng.org/content/2/1/5.
Zetsche,B.et al.,2015.Cpf1 Is a Single RNA-Guided Endonuclease of aClass 2 CRISPR-Cas System.Cell,pp.1–13.Available at:http://linkinghub.elsevier.com/retrieve/pii/S0092867415012003.
Zhu,B.et al.,2007.In-Fusion assembly:Seamless engineering ofmultidomain fusion proteins,modular vectors,and mutations.BioTechniques,43(3),pp.354–359.
Zimmerman,S.B.et al.,1967.Enzymatic joining of DNA strands:a novelreaction of diphosphopyridine nucleotide.Proceedings of the National Academyof Sciences of the United States of America,57(6),pp.1841–1848。
Claims (10)
1. A DNA construct comprising an enzyme cleavage site, wherein said DNA construct comprises a nucleic acid sequence having the structure of formula I:
Ta-C-Tb I
in the formula, Ta is a prefix sequence; c is a nucleic acid sequence to be spliced; tb is a suffix sequence;
the prefix sequence contains a second enzyme cutting site, the suffix sequence contains a third enzyme cutting site, the second enzyme cutting site is different from the third enzyme cutting site, and the second enzyme cutting site and the third enzyme cutting site generate a same tail sequence after enzyme cutting.
2. The construct of claim 1, wherein the enzymatic cleavage site needs to be located (recognized) and cleaved in the presence of crRNA;
preferably, the enzyme cleavage site is capable of being recognized and cleaved by a CRISPR-associated enzyme.
3. The construct of claim 1, wherein the Tb further comprises a fourth enzyme cleavage site (T4) downstream of the third enzyme cleavage site and which is different from the second and third enzyme cleavage sites; and/or
In the formula I, the Ta further includes a first enzyme cleavage site (T1), the first enzyme cleavage site being located upstream of the second enzyme cleavage site and being different from the fourth enzyme cleavage site, the second enzyme cleavage site, and the third enzyme cleavage site.
4. The construct of claim 1, wherein Ta comprises a nucleic acid sequence selected from the group consisting of:
(a)5’-TTTGTTATCGCAACTTTCTACTGAATTCAAGCTTTACTCTAGAAAGAGGAGAAAGGATCC-3’；
(b) a nucleic acid sequence which is formed by substituting, deleting or adding one or more nucleotide residues to the nucleic acid sequence in the step (a) and can be recognized by FnCpf1 and corresponding crRNA; and/or
Tb comprises a nucleic acid sequence selected from the group consisting of:
(a)5’-GGATCCACTAGTCTCTAGCTCGAGAAATTCAAGGAGAAACTGCAGCTAGCTTAAA-3’；
(b) a nucleic acid sequence which is formed by substituting, deleting or adding one or more nucleotide residues to the nucleic acid sequence in (a) and can be recognized by FnCpf1 and corresponding crRNA.
5. A vector comprising the construct of claim 1.
6. A host cell having the construct of claim 1 integrated at one or more sites in the genome of said host cell or having the vector of claim 5 incorporated therein.
7. A kit comprising reagents selected from one or more of the group consisting of:
(a) the construct of claim 1;
(b) the vector of claim 5;
(c) the cell of claim 6;
(d) an enzyme or an expression vector thereof that cleaves an enzyme cleavage site of the construct of claim 1; and
(e) a crRNA transcript or crRNA transcription template that maps to an enzyme cleavage site of the construct described in claim 1.
8. Use of the construct of claim 1, the vector of claim 5, the cell of claim 6 or the kit of claim 7 for genetic engineering of the genome of a cell and/or for construction of a genetic circuit.
9. A method for splicing DNA in vitro comprises the following steps:
(1) providing a first vector comprising a first construct comprising a first nucleic acid sequence having the structure of formula Ia,
Ta-Ca-Tb Ia
wherein Ta and Tb are as defined in the first aspect of the invention and Ca is the first nucleic acid sequence to be spliced;
(2) carrying out enzyme digestion on a third enzyme digestion site of the first vector to form a linearized first enzyme digestion product;
(3) providing a second construct comprising a second nucleic acid sequence having the structure of formula Ib,
Ta-Cb-Tb Ib
wherein Ta and Tb are defined as above, and Cb is a second nucleic acid sequence to be spliced;
carrying out enzyme digestion on a second enzyme digestion site and a third enzyme digestion site of the second construction to form a second enzyme digestion product subjected to enzyme digestion;
(4) and (3) performing a ligation reaction on the second enzyme digestion product and the first enzyme digestion product to form a vector containing the splicing sequence shown in the formula I I:
Ta-Ca-Scar-Cb-Tb II
wherein Ta, Tb, Ca, and Cb are as defined above, and Scar is a splice linker sequence formed during splicing.
10. The method of claim 9, wherein the nucleic acid sequence to be spliced comprises a CDS sequence, a coding gene sequence, an antibiotic biosynthesis gene cluster, an element responsible for conjugative transfer, or a DNA sequence with a specific function.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610199930.3A CN107287226B (en) | 2016-03-31 | 2016-03-31 | Cpf 1-based DNA construct and DNA in-vitro splicing method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610199930.3A CN107287226B (en) | 2016-03-31 | 2016-03-31 | Cpf 1-based DNA construct and DNA in-vitro splicing method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107287226A true CN107287226A (en) | 2017-10-24 |
| CN107287226B CN107287226B (en) | 2021-08-27 |
Family
ID=60086766
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610199930.3A Active CN107287226B (en) | 2016-03-31 | 2016-03-31 | Cpf 1-based DNA construct and DNA in-vitro splicing method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107287226B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109593763A (en) * | 2018-04-27 | 2019-04-09 | 四川大学华西医院 | The external DNA that a kind of FnCpf1 is mediated edits kit |
| CN112852849A (en) * | 2019-12-31 | 2021-05-28 | 湖北伯远合成生物科技有限公司 | System and method for seamless assembly of large-fragment DNA |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105331604A (en) * | 2014-05-29 | 2016-02-17 | 中国科学院上海生命科学研究院 | DNA construct and DNA extracorporeal splicing method |
-
2016
- 2016-03-31 CN CN201610199930.3A patent/CN107287226B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105331604A (en) * | 2014-05-29 | 2016-02-17 | 中国科学院上海生命科学研究院 | DNA construct and DNA extracorporeal splicing method |
Non-Patent Citations (2)
| Title |
|---|
| BERND ZETSCHE ET AL: "Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System", 《CELL》 * |
| J CHRISTOPHER ANDERSON ET AL: "BglBricks: A flexible standard for biological part assembly", 《JOURNAL OF BIOLOGICAL ENGINEERING》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109593763A (en) * | 2018-04-27 | 2019-04-09 | 四川大学华西医院 | The external DNA that a kind of FnCpf1 is mediated edits kit |
| CN109593763B (en) * | 2018-04-27 | 2021-10-29 | 四川大学华西医院 | FnCpf 1-mediated in-vitro DNA editing kit |
| CN112852849A (en) * | 2019-12-31 | 2021-05-28 | 湖北伯远合成生物科技有限公司 | System and method for seamless assembly of large-fragment DNA |
| CN112852849B (en) * | 2019-12-31 | 2023-03-14 | 湖北伯远合成生物科技有限公司 | System and method for seamless assembly of large-fragment DNA |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107287226B (en) | 2021-08-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Rajkumar et al. | Biological parts for Kluyveromyces marxianus synthetic biology | |
| EP3604524B1 (en) | New technique for genomic large fragment direct cloning and dna multi-molecular assembly | |
| US10612043B2 (en) | Methods of in vivo engineering of large sequences using multiple CRISPR/cas selections of recombineering events | |
| CN105132451B (en) | A kind of single transcriptional units directed modification skeleton carrier of CRISPR/Cas9 and its application | |
| CN102124112B (en) | Homologous recombination-based DNA cloning methods and compositions | |
| US7785871B2 (en) | DNA cloning vector plasmids and methods for their use | |
| CN109136248B (en) | Multi-target editing vector and construction method and application thereof | |
| US20040126883A1 (en) | Method for producing a multi-gene recombinant vector construct and the application | |
| EP4180460A1 (en) | System and method for editing nucleic acid | |
| CN107287226B (en) | Cpf 1-based DNA construct and DNA in-vitro splicing method | |
| CN113957089B (en) | Vector system for screening regulatory sequences and application thereof | |
| CN100465278C (en) | Method of constructing T carrier | |
| JP2018504916A (en) | Method for producing a DNA vector from a molecular component containing a sequence of interest | |
| CN116355938A (en) | Gene editing carrier system based on micro RNA guide nuclease TnpB, construction method and application thereof | |
| CN111386343A (en) | Methods for Kluyveromyces host cell genomic integration | |
| US20220380750A1 (en) | Method for the production of raav and method for the in vitro generation of genetically engineered, linear, single-stranded nucleic acid fragments containing itr sequences flanking a gene of interest | |
| JP2021151200A (en) | Methods for producing linked dna and vector combinations for use therein | |
| CN108220314B (en) | New method for rapid connection transformation of DNA fragment and vector and application thereof | |
| CN100494384C (en) | T vector and its construction method | |
| García-Pedrajas et al. | DelsGate: a robust and rapid method for gene deletion | |
| KR100538990B1 (en) | Plasmid having a function of T-vector and expression vector, and expression of the target gene using the same | |
| CN115747242B (en) | Kit for eliminating plasmids, plasmid combination and gene editing, preparation method and application | |
| WO2023070043A1 (en) | Compositions and methods for targeted editing and evolution of repetitive genetic elements | |
| CN115896149A (en) | Zymomonas mobilis gene editing plasmid, kit, method and application | |
| CN118086353A (en) | E.coli-saccharomycete shuttle plasmid vector, recombinant plasmid and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20200511 Address after: 200032 building 4, No. 300 Fenglin Road, Xuhui District, Shanghai Applicant after: Center for excellence and innovation in molecular plant science, Chinese Academy of Sciences Address before: 200031 Yueyang Road, Shanghai, No. 319, No. Applicant before: SHANGHAI INSTITUTES FOR BIOLOGICAL SCIENCES, CHINESE ACADEMY OF SCIENCES |
|
| TA01 | Transfer of patent application right | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |