WO2014099744A1 - Rna-guided human genome engineering - Google Patents

Rna-guided human genome engineering Download PDF

Info

Publication number
WO2014099744A1
WO2014099744A1 PCT/US2013/075317 US2013075317W WO2014099744A1 WO 2014099744 A1 WO2014099744 A1 WO 2014099744A1 US 2013075317 W US2013075317 W US 2013075317W WO 2014099744 A1 WO2014099744 A1 WO 2014099744A1
Authority
WO
WIPO (PCT)
Prior art keywords
rna
cell
enzyme
genomic dna
cas9
Prior art date
Application number
PCT/US2013/075317
Other languages
French (fr)
Inventor
George M. Church
Prashant MALI
Luhan Yang
Original Assignee
President And Fellows Of Harvard College
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=50979072&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2014099744(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to BR112015014425-0A priority Critical patent/BR112015014425B1/en
Priority to IL308158A priority patent/IL308158A/en
Priority to DK13863815.0T priority patent/DK2931891T3/en
Priority to EP23197923.8A priority patent/EP4282970A3/en
Priority to CA2895155A priority patent/CA2895155C/en
Priority to MX2015007743A priority patent/MX2015007743A/en
Priority to NZ709429A priority patent/NZ709429B2/en
Priority to KR1020157018831A priority patent/KR20150095861A/en
Priority to AU2013363194A priority patent/AU2013363194B2/en
Priority to ES13863815T priority patent/ES2741951T3/en
Priority to EP13863815.0A priority patent/EP2931891B1/en
Priority to SG11201504621RA priority patent/SG11201504621RA/en
Priority to CN201380073208.XA priority patent/CN105121641A/en
Priority to US14/653,144 priority patent/US9970024B2/en
Priority to JP2015549528A priority patent/JP6700788B2/en
Priority to EP19173061.3A priority patent/EP3553174A1/en
Priority to RU2015129018A priority patent/RU2699523C2/en
Application filed by President And Fellows Of Harvard College filed Critical President And Fellows Of Harvard College
Priority to KR1020227034121A priority patent/KR20220139433A/en
Publication of WO2014099744A1 publication Critical patent/WO2014099744A1/en
Priority to US14/319,255 priority patent/US9260723B2/en
Priority to US14/319,100 priority patent/US9023649B2/en
Priority to US14/319,171 priority patent/US10717990B2/en
Priority to US14/318,933 priority patent/US20140342456A1/en
Priority to US14/681,510 priority patent/US20170044569A9/en
Priority to US14/701,912 priority patent/US20150232833A1/en
Priority to IL239326A priority patent/IL239326A0/en
Priority to ZA2015/04739A priority patent/ZA201504739B/en
Priority to US14/790,147 priority patent/US10273501B2/en
Priority to HK15112584.0A priority patent/HK1212376A1/en
Priority to US15/042,515 priority patent/US10435708B2/en
Priority to US15/042,573 priority patent/US11236359B2/en
Priority to US16/397,423 priority patent/US11359211B2/en
Priority to US16/397,213 priority patent/US11365429B2/en
Priority to US16/439,840 priority patent/US11535863B2/en
Priority to AU2019216665A priority patent/AU2019216665B2/en
Priority to US16/884,327 priority patent/US20200308599A1/en
Priority to US17/186,139 priority patent/US20210222193A1/en
Priority to AU2021204024A priority patent/AU2021204024B2/en
Priority to AU2021204023A priority patent/AU2021204023B2/en
Priority to US17/672,744 priority patent/US11512325B2/en
Priority to US18/296,579 priority patent/US12018272B2/en
Priority to AU2024201441A priority patent/AU2024201441A1/en
Priority to US18/619,354 priority patent/US20240279677A1/en
Priority to US18/663,233 priority patent/US20240294939A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases RNAses, DNAses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/01Preparation of mutants without inserting foreign genetic material therein; Screening processes therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102Mutagenizing nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102Mutagenizing nucleic acids
    • C12N15/1024In vivo mutagenesis using high mutation rate "mutator" host strains by inserting genetic material, e.g. encoding an error prone polymerase, disrupting a gene for mismatch repair
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome
    • C12N15/902Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/10Cells modified by introduction of foreign genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/80Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2810/00Vectors comprising a targeting moiety
    • C12N2810/50Vectors comprising as targeting moiety peptide derived from defined protein
    • C12N2810/55Vectors comprising as targeting moiety peptide derived from defined protein from bacteria
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y301/00Hydrolases acting on ester bonds (3.1)

Definitions

  • a eukaryotic cell is transfected with a two component system including RNA complementary to genomic DNA and an enzyme that interacts with the RNA.
  • the RNA and the enzyme are expressed by the cell.
  • the RNA of the RNA/enzyme complex then binds to complementary genomic DNA.
  • the enzyme then performs a function, such as cleavage of the genomic DNA.
  • the RNA includes between about 10 nucleotides to about 250 nucleotides.
  • the RNA includes between about 20 nucleotides to about 100 nucleotides.
  • the enzyme may perform any desired function in a site specific manner for which the enzyme has been engineered.
  • the eukaryotic cell is a yeast cell, plant cell or mammalian cell.
  • the enzyme cleaves genomic sequences targeted by RNA sequences (see references (4-6)), thereby creating a genomically altered eukaryotic cell.
  • the present disclosure provides a method of genetically altering a human cell by including a nucleic acid encoding an RNA complementary to genomic DNA into the genome of the cell and a nucleic acid encoding an enzyme that performs a desired function on genomic DNA into the genome of the cell.
  • the RNA and the enzyme are expressed,
  • the RNA hybridizes with complementary genomic DNA.
  • the enzyme is activated to perform a desired function, such as cleavage, in a site specific manner when the RNA is hybridized to the complementary genomic DNA.
  • the RNA and the enzyme are components of a bacterial Type II CRISPR system.
  • a method of altering a eukaryotic cell including transfecting the eukaryotic cell with a nucleic acid encoding RNA complementary to genomic DNA of the eukaryotic cell, transfecting the eukaryotic cell with a nucleic acid encoding an enzyme that interacts with the RNA and cleaves the genomic DNA in a site specific manner, wherein the cell expresses the RNA and the enzyme, the RNA binds to complementary genomic DNA and the enzyme cleaves the genomic DNA in a site specific manner.
  • the enzyme is Cas9 or modified Cas9 or a homolog of Cas9.
  • the eukaryotic cell is a yeast cell, a plant cell or a mammalian cell.
  • the RNA includes between about 10 to about 250 nucleotides.
  • the RNA includes between about 20 to about 100 nucleotides.
  • a method of altering a human cell including transfecting the human cell with a nucleic acid encoding RNA complementary to genomic DNA of the eukaryotic cell, transfecting the human cell with a nucleic acid encoding an enzyme that interacts with the RNA and cleaves the genomic DNA in a site specific manner, wherein the human cell expresses the RNA and the enzyme, the RNA binds to complementary genomic DNA and the enzyme cleaves the genomic DNA in a site specific manner.
  • the enzyme is Cas9 or modified Cas9 or a homolog of Cas9.
  • the RNA includes between about 10 to about 250 nucleotides.
  • the RNA includes between about 20 to about 100 nucleotides.
  • a method of altering a eukaryotic cell at a plurality of genomic DNA sites including transfecting the eukaryotic cell with a plurality of nucleic acids encoding RNAs complementary to different sites on genomic DNA of the eukaryotic cell, transfecting the eukaryotic cell with a nucleic acid encoding an enzyme that interacts with the RNA and cleaves the genomic DNA in a site specific manner, wherein the cell expresses the RNAs and the enzyme, the RNAs bind to complementary genomic DNA and the enzyme cleaves the genomic DNA in a site specific manner.
  • the enzyme is Cas9.
  • the eukaryotic cell is a yeast cell, a plant cell or a mammalian cell.
  • the RNA includes between about 10 to about 250 nucleotides.
  • the RNA includes between about 20 to about 100 nucleotides.
  • a human codon-optimized version of the Cas9 protein bearing a C-terminus SV40 nuclear localization signal is synthetized and cloned into a mammalian expression system (Fig. 1A and Fig. 3 A).
  • Figure 1 is directed to genome editing in human cells using an engineered type II CRISPR system.
  • RNA-guided gene targeting in human cells involves co-expression of the Cas9 protein bearing a C-terminus SV40 nuclear localization signal with one or more guide RNAs (gRNAs) expressed from the human U6 polymerase III promoter.
  • gRNAs guide RNAs
  • Cas9 unwinds the DNA duplex and cleaves both strands upon recognition of a target sequence by the gRNA, but only if the correct protospacer-adjacent motif (PAM) is present at the 3' end.
  • Any genomic sequence of the form GN 2 oGG can in principle be targeted.
  • a genomically integrated GFP coding sequence is disrupted by the insertion of a stop codon and a 68bp genomic fragment from the AAVS l locus.
  • Restoration of the GFP sequence by homologous recombination (HR) with an appropriate donor sequence results in GFP + cells that can be quantitated by FACS.
  • Tl and T2 gRNAs target sequences within the AAVS l fragment.
  • Binding sites for the two halves of the TAL effector nuclease heterodimer are underlined.
  • crRNA-tracrRNA fusion transcripts are expressed, hereafter referred to as guide RNAs (gRNAs), from the human U6 polymerase III promoter.
  • gRNAs are directly transcribed by the cell. This aspect advantageously avoids reconstituting the RNA processing machinery employed by bacterial CRISPR systems (Fig. 1A and Fig. 3B) (see references (4, 7-9)).
  • a method is provided for altering genomic DNA using a U6 transcription initiating with G and a PAM (protospacer-adjacent motif) sequence -NGG following the 20 bp crRNA target.
  • the target genomic site is in the form of GN 2 oGG (See Fig. 3C).
  • a GFP reporter assay (Fig. IB) in 293T cells was developed similar to one previously described (see reference (10)) to test the functionality of the genome engineering methods described herein.
  • a stable cell line was established bearing a genomically integrated GFP coding sequence disrupted by the insertion of a stop codon and a 68bp genomic fragment from the AAVS l locus that renders the expressed protein fragment non-fluorescent.
  • Homologous recombination (HR) using an appropriate repair donor can restore the normal GFP sequence, which allows one to quantify the resulting GFP + cells by flow activated cell sorting (FACS).
  • FACS flow activated cell sorting
  • a method is provided of homologous recombination (HR).
  • RNA-mediated editing process was notably rapid, with the first detectable GFP + cells appearing -20 hours post transfection compared to -40 hours for the AAVS l TALENs.
  • a native locus was modified.
  • gRNAs were used to target the AAVS l locus located in the PPP1R12C gene on chromosome 19, which is ubiquitously expressed across most tissues (Fig. 2A) in 293Ts, K562s, and PGP1 human iPS cells (see reference (12)) and analyzed the results by next-generation sequencing of the targeted locus.
  • Figure 2 is directed to RNA-guided genome editing of the native AAVS l locus in multiple cell types.
  • Tl (red) and T2 (green) gRNAs target sequences in an intron of the PPP1R12C gene within the chromosome 19 AAVS l locus.
  • PCR assay three days post transfection demonstrates that only cells expressing the donor, Cas9 and T2 gRNA exhibit successful HR events.
  • successful HR was confirmed by Sanger sequencing of the PCR amplicon showing that the expected DNA bases at both the genome-donor and donor-insert boundaries are present.
  • Figure 2F successfully targeted clones of 293T cells were selected with puromycin for 2 weeks. Microscope images of two representative GFP+ clones is shown (scale bar is 100 microns).
  • HR is used to integrate either a dsDNA donor construct (see reference (13)) or an oligo donor into the native AAVS l locus (Fig. 2C, Fig. 12).
  • HR-mediated integration was confirmed using both approaches by PCR (Fig. 2D, Fig. 12) and Sanger sequencing (Fig. 2E).
  • 293T or iPS clones were readily derived from the pool of modified cells using puromycin selection over two weeks (Fig. 2F, Fig. 12).
  • an RNA-guided genome editing system which can readily be adapted to modify other genomic sites by simply modifying the sequence of the gRNA expression vector to match a compatible sequence in the locus of interest.
  • 190,000 specifically gRNA-targetable sequences targeting about 40.5% exons of genes in the human genome were generated. These target sequences were incorporated into a 200bp format compatible with multiplex synthesis on DNA arrays (see reference (14)) (Fig. 13).
  • a ready genome -wide reference of potential target sites in the human genome and a methodology for multiplex gRNA synthesis is provided.
  • methods are provided for multiplexing genomic alterations in a cell by using one or more or a plurality of RNA/enzyme systems described herein to alter the genome of a cell at a plurality of locations.
  • target sites perfectly match the PAM sequence NGG and the 8- 12 base "seed sequence" at the 3 ' end of the gRNA.
  • perfect match is not required of the remaining 8- 12 bases.
  • Cas9 will function with single mismatches at the 5' end.
  • the target locus 's underlying chromatin structure and epigenetic state may affect efficiency of Cas9 function.
  • Cas9 homologs having higher specificity are included as useful enzymes.
  • CRISPR-targetable sequences include those having different PAM requirements (see reference (9)), or directed evolution.
  • inactivating one of the Cas9 nuclease domains increases the ratio of HR to NHEJ and may reduce toxicity (Fig. 3 A, Fig. 5) (4, 5), while inactivating both domains may enable Cas9 to function as a retargetable DNA binding protein.
  • Embodiments of the present disclosure have broad utility in synthetic biology (see references (21, 22)), the direct and multiplexed perturbation of gene networks (see references (13, 23)), and targeted ex vivo (see references (24-26)) and in vivo gene therapy (see reference (27)).
  • a "re-engineerable organism” is provided as a model system for biological discovery and in vivo screening.
  • a "re-engineerable mouse” bearing an inducible Cas9 transgene is provided, and localized delivery (using adeno- associated viruses, for example) of libraries of gRNAs targeting multiple genes or regulatory elements allow one to screen for mutations that result in the onset of tumors in the target tissue type.
  • Use of Cas9 homologs or nuclease-null variants bearing effector domains (such as activators) allow one to multiplex activate or repress genes in vivo.
  • DNA-arrays enables multiplex synthesis of defined gRNA libraries (refer Fig. 13); and (b) gRNAs being small in size (refer Fig. 3b) are packaged and delivered using a multitude of non- viral or viral delivery methods.
  • the lower toxicities observed with "nickases” for genome engineering applications is achieved by inactivating one of the Cas9 nuclease domains, either the nicking of the DNA strand base-paired with the RNA or nicking its complement. Inactivating both domains allows Cas9 to function as a retargetable DNA binding protein.
  • the Cas9 retargetable DNA binding protein is attached
  • nuclease domains such as Fokl to enable 'highly specific' genome editing contingent upon dimerization of adjacent gRNA-Cas9 complexes
  • the transcriptional activation and repression components can employ CRISPR systems naturally or synthetically orthogonal, such that the gRNAs only bind to the activator or repressor class of Cas. This allows a large set of gRNAs to tune multiple targets.
  • the use of gRNAs provide the ability to multiplex than mRNAs in part due to the smaller size - 100 vs. 2000 nucleotide lengths respectively. This is particularly valuable when nucleic acid delivery is size limited, as in viral packaging. This enables multiple instances of cleavage, nicking, activation, or repression - or combinations thereof.
  • the ability to easily target multiple regulatory targets allows the coarse-or- fine-tuning or regulatory networks without being constrained to the natural regulatory circuits downstream of specific regulatory factors (e.g. the 4 mRNAs used in reprogramming fibroblasts into IPSCs). Examples of multiplexing applications include:
  • Multiplex cis-regulatory element (CRE signals for transcription, splicing, translation, RNA and protein folding, degradation, etc.) mutations in a single cell (or a collection of cells) can be used for efficiently studying the complex sets of regulatory interaction that can occur in normal development or pathological, synthetic or pharmaceutical scenarios.
  • the CREs are (or can be made) somewhat orthogonal (i.e. low cross talk) so that many can be tested in one setting— e.g. in an expensive animal embryo time series.
  • One exemplary application is with RNA fluorescent in situ sequencing (FISSeq).
  • CRE mutations and/or epigenetic activation or repression of CREs can be used to alter or reprogram iPSCs or ESCs or other stem cells or non-stem cells to any cell type or combination of cell types for use in organs-on-chips or other cell and organ cultures for purposes of testing pharmaceuticals (small molecules, proteins, RNAs, cells, animal, plant or microbial cells, aerosols and other delivery methods), transplantation strategies, personalization strategies, etc.
  • Repetitive elements or endogenous viral elements can be targeted with engineered Cas + gRNA systems in microbes, plants, animals, or human cells to reduce deleterious transposition or to aid in sequencing or other analytic genomic/transcriptomic/proteomic/diagnostic tools (in which nearly identical copies can be problematic).
  • embodiments of the present disclosure utilize short RNA to identify foreign nucleic acids for activity by a nuclease in a eukaryotic cell.
  • a eukaryotic cell is altered to include within its genome nucleic acids encoding one or more short RNA and one or more nucleases which are activated by the binding of a short RNA to a target DNA sequence.
  • exemplary short RNA / enzyme systems may be identified within bacteria or archaea, such as (CRISPR)/CRISPR- associated (Cas) systems that use short RNA to direct degradation of foreign nucleic acids.
  • CRISPR (“clustered regularly interspaced short palindromic repeats") defense involves acquisition and integration of new targeting "spacers” from invading virus or plasmid DNA into the CRISPR locus, expression and processing of short guiding CRISPR RNAs (crRNAs) consisting of spacer- repeat units, and cleavage of nucleic acids (most commonly DNA) complementary to the spacer.
  • spacers new targeting "spacers” from invading virus or plasmid DNA into the CRISPR locus
  • crRNAs short guiding CRISPR RNAs
  • nucleic acids most commonly DNA
  • Type II Three classes of CRISPR systems are generally known and are referred to as Type I, Type II or Type III).
  • a particular useful enzyme according to the present disclosure to cleave dsDNA is the single effector enzyme, Cas9, common to Type II. (See reference (7)).
  • the Type II effector system consists of a long pre-crRNA transcribed from the spacer-containing CRISPR locus, the multifunctional Cas9 protein, and a tracrRNA important for gRNA processing.
  • the tracrRNAs hybridize to the repeat regions separating the spacers of the pre-crRNA, initiating dsRNA cleavage by endogenous RNase III, which is followed by a second cleavage event within each spacer by Cas9, producing mature crRNAs that remain associated with the tracrRNA and Cas9.
  • eukaryotic cells of the present disclosure are engineered to avoid use of RNase III and the crRNA processing in general. See reference (2).
  • the enzyme of the present disclosure such as Cas9 unwinds the DNA duplex and searches for sequences matching the crRNA to cleave.
  • Target recognition occurs upon detection of complementarity between a "protospacer” sequence in the target DNA and the remaining spacer sequence in the crRNA.
  • Cas9 cuts the DNA only if a correct protospacer-adjacent motif (PAM) is also present at the 3' end.
  • PAM protospacer-adjacent motif
  • different protospacer-adjacent motif can be utilized.
  • the S. pyogenes system requires an NGG sequence, where N can be any nucleotide.
  • S. thermophilus Type II systems require NGGNG (see reference (3)) and NNAGAAW (see reference (4)), respectively, while different S. mutans systems tolerate NGG or NAAR (see reference (5)).
  • DSB formation also occurs towards the 3 ' end of the protospacer. If one of the two nuclease domains is inactivated, Cas9 will function as a nickase in vitro (see reference (2)) and in human cells (see Figure 5).
  • the specificity of gRNA-directed Cas9 cleavage is used as a mechanism for genome engineering in a eukaryotic cell.
  • hybridization of the gRNA need not be 100 percent in order for the enzyme to recognize the gRNA/DNA hybrid and affect cleavage.
  • Some off-target activity could occur.
  • the S. pyogenes system tolerates mismatches in the first 6 bases out of the 20bp mature spacer sequence in vitro.
  • greater stringency may be beneficial in vivo when potential off-target sites matching (last 14 bp) NGG exist within the human reference genome for the gRNAs.
  • the effect of mismatches and enzyme activity in general are described in references (9), (2), (10), and (4).
  • specificity may be improved.
  • AT-rich target sequences may have fewer off- target sites. Carefully choosing target sites to avoid pseudo-sites with at least 14bp matching sequences elsewhere in the genome may improve specificity.
  • the use of a Cas9 variant requiring a longer PAM sequence may reduce the frequency of off-target sites.
  • Directed evolution may improve Cas9 specificity to a level sufficient to completely preclude off-target activity, ideally requiring a perfect 20bp gRNA match with a minimal PAM. Accordingly, modification to the Cas9 protein is a representative embodiment of the present disclosure. As such, novel methods permitting many rounds of evolution in a short timeframe (see reference (11) and envisioned. CRISPR systems useful in the present disclosure are described in references (12, 13).
  • the Cas9 gene sequence was human codon optimized and assembled by hierarchical fusion PCR assembly of 9 500bp gBlocks ordered from IDT.
  • Fig. 3A for the engineered type II CRISPR system for human cells shows the expression format and full sequence of the cas9 gene insert.
  • the RuvC-like and HNH motifs, and the C-terminus SV40 NLS are respectively highlighted by blue, brown and orange colors.
  • Cas9_D 10A was similarly constructed. The resulting full-length products were cloned into the pcDNA3.3-TOPO vector (Invitrogen).
  • Fig. 3B shows the U6 promoter based expression scheme for the guide RNAs and predicted RNA transcript secondary structure. The use of the U6 promoter constrains the 1 st position in the RNA transcript to be a 'G' and thus all genomic sites of the form GN 2 oGG can be targeted using this approach.
  • Fig. 3C shows the 7 gRNAs used.
  • the vectors for the HR reporter assay involving a broken GFP were constructed by fusion PCR assembly of the GFP sequence bearing the stop codon and 68bp AAVS l fragment (or mutants thereof; see Fig. 6), or 58bp fragments from the DNMT3a and DNMT3b genomic loci (see Fig. 8) assembled into the EGIP lentivector from Addgene (plasmid #26777). These lentivectors were then used to establish the GFP reporter stable lines.
  • TALENs used in this study were constructed using the protocols described in (14). All DNA reagents developed in this study are available at Addgene.
  • HEK 293T cells were cultured in Dulbecco's modified Eagle's medium (DMEM, Invitrogen) high glucose supplemented with 10% fetal bovine serum (FBS, Invitrogen), penicillin/streptomycin (pen/strep, Invitrogen), and non-essential amino acids (NEAA, Invitrogen). All cells were maintained at 37°C and 5% CO 2 in a humidified incubator.
  • DMEM Dulbecco's modified Eagle's medium
  • FBS fetal bovine serum
  • pen/streptomycin penicillin/streptomycin
  • NEAA non-essential amino acids
  • PGP1 iPS cells were cultured in Rho kinase (ROCK) inhibitor (Calbiochem) 2h before nucleofection.
  • ROCK Rho kinase
  • Cells were harvest using TrypLE Express (Invitrogen) and 2* 10 6 cells were resuspended in P3 reagent (Lonza) with ⁇ g Cas9 plasmid, ⁇ g gRNA and/or ⁇ g DNA donor plasmid, and nucleofected according to manufacturer's instruction (Lonza).
  • Cells were subsequently plated on an mTeSRl -coated plate in mTeSRl medium supplemented with ROCK inhibitor for the first 24h.
  • the targeting efficiency was assessed as follows. Cells were harvested 3 days after nucleofection and the genomic DNA of ⁇ 1 X 10 6 cells was extracted using prepGEM (ZyGEM). PCR was conducted to amplify the targeting region with genomic DNA derived from the cells and amplicons were deep sequenced by MiSeq Personal Sequencer (Illumina) with coverage >200,000 reads. The sequencing data was analyzed to estimate NHEJ efficiencies.
  • the reference AAVS 1 sequence analyzed is:
  • the PCR primers for amplifying the targeting regions in the human genome are:
  • a set of gRNA gene sequences that maximally target specific locations in human exons but minimally target other locations in the genome were determined as follows. According to one aspect, maximally efficient targeting by a gRNA is achieved by 23nt sequences, the 5 '-most 20nt of which exactly complement a desired location, while the three 3 '-most bases must be of the form NGG. Additionally, the 5 '-most nt must be a G to establish a pol-III transcription start site.
  • mispairing of the six 5'-most nt of a 20bp gRNA against its genomic target does not abrogate Cas9-mediated cleavage so long as the last 14nt pairs properly, but mispairing of the eight 5 '-most nt along with pairing of the last 12 nt does, while the case of the seven 5-most nt mispairs and 13 3' pairs was not tested.
  • one condition was that the case of the seven 5 '-most mispairs is, like the case of six, permissive of cleavage, so that pairing of the 3 '-most 13nt is sufficient for cleavage.
  • Coding exon locations in this BED file comprised a set of 346089 mappings of RefSeq mRNA accessions to the hgl9 genome. However, some RefSeq mRNA accessions mapped to multiple genomic locations (probable gene duplications), and many accessions mapped to subsets of the same set of exon locations (multiple isoforms of the same genes).
  • RefSeq mRNA mappings were clustered so that any two RefSeq accessions (including the gene duplicates distinguished in (ii)) that overlap a merged exon region are counted as a single gene cluster, the 189864 exonic specific CRISPR sites target 17104 out of 18872 gene clusters (-90.6% of all gene clusters) at a multiplicity of ⁇ 1 1.1 per targeted gene cluster.
  • the database can be refined by correlating performance with factors, such as base composition and secondary structure of both gRNAs and genomic targets (20, 21), and the epigenetic state of these targets in human cell lines for which this information is available (22).
  • factors such as base composition and secondary structure of both gRNAs and genomic targets (20, 21), and the epigenetic state of these targets in human cell lines for which this information is available (22).
  • the target sequences were incorporated into a 200bp format that is compatible for multiplex synthesis on DNA arrays (23, 24).
  • the method allows for targeted retrieval of a specific or pools of gRNA sequences from the DNA array based oligonucleotide pool and its rapid cloning into a common expression vector (Fig. 13 A). Specifically, a 12k oligonucleotide pool from CustomArray Inc. was synthesized. Furthermore, gRNAs of choice from this library (Fig. 13B) were successfully retrieved. We observed an error rate of -4 mutations per 1 OOObp of synthesized DNA.
  • RNA-guided genome editing requires both Cas9 and guide RNA for successful targeting
  • Each of the lines was then targeted by one of the following 4 reagents: a GFP-ZFN pair that can target all cell types since its targeted sequence was in the flanking GFP fragments and hence present in along cell lines; a AAVS 1 TALEN that could potentially target only the wt-AAVS 1 fragment since the mutations in the other two lines should render the left TALEN unable to bind their sites; the Tl gRNA which can also potentially target only the wt-AAVS 1 fragment, since its target site is also disrupted in the two mutant lines; and finally the T2 gRNA which should be able to target all 3 cell lines since, unlike the Tl gRNA, its target site is unaltered among the 3 lines.
  • RNA-guided genome editing is target sequence specific, and demonstrates similar targeting efficiencies as ZFNs or TALENs Similar to the GFP reporter assay described in Fig. IB, two 293T stable lines each bearing a distinct GFP reporter construct were developed. These are distinguished by the sequence of the fragment insert (as indicated in Figure 8). One line harbored a 58bp fragment from the DNMT3a gene while the other line bore a homologous 58bp fragment from the DNMT3b gene. The sequence differences are highlighted in red.
  • PGP1 Human iPS cells
  • DPBs double-strand breaks
  • Panel 1 Deletion rate detected at targeting region. Red dash lines: boundary of Tl RNA targeting site; green dash lines: boundary of T2 RNA targeting site. The deletion incidence at each nucleotide position was plotted in black lines and the deletion rate as the percentage of reads carrying deletions was calculated.
  • Panel 2 Insertion rate detected at targeting region. Red dash lines: boundary of Tl RNA targeting site; green dash lines: boundary of T2 RNA targeting site.
  • K562 cells were nucleated with constructs indicated in the left panel of Figure 10. 4 days after nucleofection, NHEJ rate was measured by assessing genomic deletion and insertion rate at DSBs by deep sequencing.
  • Panel 1 Deletion rate detected at targeting region. Red dash lines: boundary of Tl RNA targeting site; green dash lines: boundary of T2 RNA targeting site. The deletion incidence at each nucleotide position was plotted in black lines and the deletion rate as the percentage of reads carrying deletions was calculated.
  • Panel 2 Insertion rate detected at targeting region. Red dash lines: boundary of Tl RNA targeting site; green dash lines: boundary of T2 RNA targeting site.
  • 293T cells were transfected with constructs indicated in the left panel of Figure 11. 4 days after nucleofection, NHEJ rate was measured by assessing genomic deletion and insertion rate at DSBs by deep sequencing.
  • Panel 1 Deletion rate detected at targeting region. Red dash lines: boundary of Tl RNA targeting site; green dash lines: boundary of T2 RNA targeting site. The deletion incidence at each nucleotide position was plotted in black lines and the deletion rate as the percentage of reads carrying deletions was calculated.
  • Panel 2 Insertion rate detected at targeting region. Red dash lines: boundary of Tl RNA targeting site; green dash lines: boundary of T2 RNA targeting site.
  • the incidence of insertion at the genomic location where the first insertion junction was detected was plotted in black lines and the insertion rate as the percentage of reads carrying insertions was calculated.
  • Panel 3 Deletion size distribution. The frequencies of different size deletions among the whole NHEJ population was plotted.
  • Panel 4 insertion size distribution. The frequencies of different sizes insertions among the whole NHEJ population was plotted. 293T targeting by both gRNAs is efficient (10-24%) and sequence specific (as shown by the shift in position of the NHEJ deletion distributions).
  • PCR screen (with reference to Figure 2C) confirmed that 21/24 randomly picked 293T clones were successfully targeted.
  • FIG 12B similar PCR screen confirmed 3/7 randomly picked PGPl-iPS clones were also successfully targeted.
  • short 90mer oligos could also effect robust targeting at the endogenous AAVS 1 locus (shown here for K562 cells).
  • a resource of about 190k bioinformatically computed unique gRNA sites targeting -40.5% of all exons of genes in the human genome was generated.
  • the gRNA target sites were incorporated into a 200bp format that is compatible for multiplex synthesis on DNA arrays.
  • the design allows for (i) targeted retrieval of a specific or pools of gRNA targets from the DNA array oligonucleotide pool (through 3 sequential rounds of nested PCR as indicated in the figure schematic); and (ii) rapid cloning into a common expression vector which upon linearization using an Aflll site serves as a recipient for Gibson assembly mediated incorporation of the gRNA insert fragment.
  • the method was used to accomplish targeted retrieval of 10 unique gRNAs from a 12k oligonucleotide pool synthesized by CustomArray Inc.
  • the CRISPR-Cas system has an adaptive immune defense system in bacteria and functions to 'cleave' invading nucleic acids.
  • the CRISPR-CAS system is engineered to function in human cells, and to 'cleave' genomic DNA. This is achieved by a short guide RNA directing a Cas9 protein (which has nuclease function) to a target sequence complementary to the spacer in the guide RNA.
  • the ability to 'cleave' DNA enables a host of applications related to genome editing, and also targeted genome regulation.
  • the Cas9 protein was mutated to make it nuclease-null by introducing mutations that are predicted to abrogate coupling to Mg2+ (known to be important for the nuclease functions of the RuvC-like and HNH-like domains): specifically, combinations of D10A, D839A, H840A and N863A mutations were introduced.
  • the thus generated Cas9 nuclease-null protein (as confirmed by its ability to not cut DNA by sequencing analysis) and hereafter referred to as Cas9R-H-, was then coupled to a transcriptional activation domain, here VP64, enabling the CRISPR-cas system to function as a RNA guided transcription factor (see Figure 14).
  • the Cas9R-H-+VP64 fusion enables RNA- guided transcriptional activation at the two reporters shown. Specifically, both FACS analysis and immunofluorescence imaging demonstrates that the protein enables gRNA sequence specific targeting of the corresponding reporters, and furthermore, the resulting transcription activation as assayed by expression of a dTomato fluorescent protein was at levels similar to those induced by a convention TALE-VP64 fusion protein.
  • Flexibility of the gRNA scaffold sequence to designer sequence insertions was determined by systematically assaying for a range of the random sequence insertions on the 5', middle and 3' portions of the gRNA: specifically, lbp, 5bp, lObp, 20bp, and 40bp inserts were made in the gRNA sequence at the 5', middle, and 3' ends of the gRNA (the exact positions of the insertion are highlighted in 'red' in Figure 15). This gRNA was then tested for functionality by its ability to induce HR in a GFP reporter assay (as described herein). It is evident that gRNAs are flexible to sequence insertions on the 5' and 3' ends (as measured by retained HR inducing activity).
  • aspects of the present disclosure are directed to tagging of small-molecule responsive RNA aptamers that may trigger onset of gRNA activity, or gRNA visualization. Additionally, aspects of the present disclosure are directed to tethering of ssDNA donors to gRNAs via hybridization, thus enabling coupling of genomic target cutting and immediate physical localization of repair template which can promote homologous recombination rates over error- prone non-homologous end-joining.
  • the following references identified in the Examples section by number are hereby incorporated by reference in their entireties for all purposes.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Mycology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

A method of altering a eukaryotic cell is provided including transfecting the eukaryotic cell with a nucleic acid encoding RNA complementary to genomic DNA of the eukaryotic cell, transfecting the eukaryotic cell with a nucleic acid encoding an enzyme that interacts with the RNA and cleaves the genomic DNA in a site specific manner, wherein the cell expresses the RNA and the enzyme, the RNA binds to complementary genomic DNA and the enzyme cleaves the genomic DNA in a site specific manner.

Description

RNA-GUIDED HUMAN GENOME ENGINEERING
RELATED APPLICATION DATA
This application claims priority to U.S. Provisional Application No. 61/779, 169, filed on March 13, 2013 and U.S. Provisional Application No. 61/738,355, filed on December 17, 2012 each of which is hereby incorporated herein by reference in their entirety for all purposes.
STATEMENT OF GOVERNMENT INTERESTS
This invention was made with government support under P50 HG005550 awarded by National Institutes of Health. The government has certain rights in the invention.
BACKGROUND
Bacterial and archaeal CRISPR systems rely on crRNAs in complex with Cas proteins to direct degradation of complementary sequences present within invading viral and plasmid DNA (7- 3). A recent in vitro reconstitution of the S. pyogenes type II CRISPR system demonstrated that crRNA fused to a normally trans-encoded tracrRNA is sufficient to direct Cas9 protein to sequence-specifically cleave target DNA sequences matching the crRNA (4).
SUMMARY
The present disclosure references documents numerically which are listed at the end of the present disclosure. The document corresponding to the number is incorporated by reference into the specification as a supporting reference corresponding to the number as if fully cited.
According to one aspect of the present disclosure, a eukaryotic cell is transfected with a two component system including RNA complementary to genomic DNA and an enzyme that interacts with the RNA. The RNA and the enzyme are expressed by the cell. The RNA of the RNA/enzyme complex then binds to complementary genomic DNA. The enzyme then performs a function, such as cleavage of the genomic DNA. The RNA includes between about 10 nucleotides to about 250 nucleotides. The RNA includes between about 20 nucleotides to about 100 nucleotides. According to certain aspects, the enzyme may perform any desired function in a site specific manner for which the enzyme has been engineered. According to one aspect, the eukaryotic cell is a yeast cell, plant cell or mammalian cell. According to one aspect, the enzyme cleaves genomic sequences targeted by RNA sequences (see references (4-6)), thereby creating a genomically altered eukaryotic cell.
According to one aspect, the present disclosure provides a method of genetically altering a human cell by including a nucleic acid encoding an RNA complementary to genomic DNA into the genome of the cell and a nucleic acid encoding an enzyme that performs a desired function on genomic DNA into the genome of the cell. According to one aspect, the RNA and the enzyme are expressed, According to one aspect, the RNA hybridizes with complementary genomic DNA. According to one aspect, the enzyme is activated to perform a desired function, such as cleavage, in a site specific manner when the RNA is hybridized to the complementary genomic DNA. According to one aspect, the RNA and the enzyme are components of a bacterial Type II CRISPR system.
According to one aspect, a method of altering a eukaryotic cell is providing including transfecting the eukaryotic cell with a nucleic acid encoding RNA complementary to genomic DNA of the eukaryotic cell, transfecting the eukaryotic cell with a nucleic acid encoding an enzyme that interacts with the RNA and cleaves the genomic DNA in a site specific manner, wherein the cell expresses the RNA and the enzyme, the RNA binds to complementary genomic DNA and the enzyme cleaves the genomic DNA in a site specific manner. According to one aspect, the enzyme is Cas9 or modified Cas9 or a homolog of Cas9. According to one aspect, the eukaryotic cell is a yeast cell, a plant cell or a mammalian cell. According to one aspect, the RNA includes between about 10 to about 250 nucleotides. According to one aspect, the RNA includes between about 20 to about 100 nucleotides.
According to one aspect, a method of altering a human cell is provided including transfecting the human cell with a nucleic acid encoding RNA complementary to genomic DNA of the eukaryotic cell, transfecting the human cell with a nucleic acid encoding an enzyme that interacts with the RNA and cleaves the genomic DNA in a site specific manner, wherein the human cell expresses the RNA and the enzyme, the RNA binds to complementary genomic DNA and the enzyme cleaves the genomic DNA in a site specific manner. According to one aspect, the enzyme is Cas9 or modified Cas9 or a homolog of Cas9. According to one aspect, the RNA includes between about 10 to about 250 nucleotides. According to one aspect, the RNA includes between about 20 to about 100 nucleotides.
According to one aspect, a method of altering a eukaryotic cell at a plurality of genomic DNA sites is provided including transfecting the eukaryotic cell with a plurality of nucleic acids encoding RNAs complementary to different sites on genomic DNA of the eukaryotic cell, transfecting the eukaryotic cell with a nucleic acid encoding an enzyme that interacts with the RNA and cleaves the genomic DNA in a site specific manner, wherein the cell expresses the RNAs and the enzyme, the RNAs bind to complementary genomic DNA and the enzyme cleaves the genomic DNA in a site specific manner. According to one aspect, the enzyme is Cas9. According to one aspect, the eukaryotic cell is a yeast cell, a plant cell or a mammalian cell. According to one aspect, the RNA includes between about 10 to about 250 nucleotides. According to one aspect, the RNA includes between about 20 to about 100 nucleotides. DETAILED DESCRIPTION
According to one aspect, a human codon-optimized version of the Cas9 protein bearing a C-terminus SV40 nuclear localization signal is synthetized and cloned into a mammalian expression system (Fig. 1A and Fig. 3 A). Accordingly, Figure 1 is directed to genome editing in human cells using an engineered type II CRISPR system. As shown in Figure 1A, RNA-guided gene targeting in human cells involves co-expression of the Cas9 protein bearing a C-terminus SV40 nuclear localization signal with one or more guide RNAs (gRNAs) expressed from the human U6 polymerase III promoter. Cas9 unwinds the DNA duplex and cleaves both strands upon recognition of a target sequence by the gRNA, but only if the correct protospacer-adjacent motif (PAM) is present at the 3' end. Any genomic sequence of the form GN2oGG can in principle be targeted. As shown in Figure IB, a genomically integrated GFP coding sequence is disrupted by the insertion of a stop codon and a 68bp genomic fragment from the AAVS l locus. Restoration of the GFP sequence by homologous recombination (HR) with an appropriate donor sequence results in GFP+ cells that can be quantitated by FACS. Tl and T2 gRNAs target sequences within the AAVS l fragment. Binding sites for the two halves of the TAL effector nuclease heterodimer (TALEN) are underlined. As shown in Figure 1 C, bar graph depict HR efficiencies induced by Tl , T2, and TALEN-mediated nuclease activity at the target locus, as measured by FACS. Representative FACS plots and microscopy images of the targeted cells are depicted below (scale bar is 100 microns). Data is mean +/- SEM (N=3).
According to one aspect, to direct Cas9 to cleave sequences of interest, crRNA-tracrRNA fusion transcripts are expressed, hereafter referred to as guide RNAs (gRNAs), from the human U6 polymerase III promoter. According to one aspect, gRNAs are directly transcribed by the cell. This aspect advantageously avoids reconstituting the RNA processing machinery employed by bacterial CRISPR systems (Fig. 1A and Fig. 3B) (see references (4, 7-9)). According to one aspect, a method is provided for altering genomic DNA using a U6 transcription initiating with G and a PAM (protospacer-adjacent motif) sequence -NGG following the 20 bp crRNA target. According to this aspect, the target genomic site is in the form of GN2oGG (See Fig. 3C).
According to one aspect, a GFP reporter assay (Fig. IB) in 293T cells was developed similar to one previously described (see reference (10)) to test the functionality of the genome engineering methods described herein. According to one aspect, a stable cell line was established bearing a genomically integrated GFP coding sequence disrupted by the insertion of a stop codon and a 68bp genomic fragment from the AAVS l locus that renders the expressed protein fragment non-fluorescent. Homologous recombination (HR) using an appropriate repair donor can restore the normal GFP sequence, which allows one to quantify the resulting GFP+ cells by flow activated cell sorting (FACS). According to one aspect, a method is provided of homologous recombination (HR). Two gRNAs are constructed, Tl and T2, that target the intervening AAVS 1 fragment (Fig. lb). Their activity to that of a previously described TAL effector nuclease heterodimer (TALEN) targeting the same region (see reference (11)) was compared. Successful HR events were observed using all three targeting reagents, with gene correction rates using the Tl and T2 gRNAs approaching 3% and 8% respectively (Fig. 1C). This RNA-mediated editing process was notably rapid, with the first detectable GFP+ cells appearing -20 hours post transfection compared to -40 hours for the AAVS l TALENs. HR was observed only upon simultaneous introduction of the repair donor, Cas9 protein, and gRNA, confirming that all components are required for genome editing (Fig. 4). While no apparent toxicity associated with Cas9/crRNA expression was noted, work with ZFNs and TALENs has shown that nicking only one strand further reduces toxicity. Accordingly, a Cas9D 1 OA mutant was tested that is known to function as a nickase in vitro, which yielded similar HR but lower non-homologous end joining (NHEJ) rates (Fig. 5) (see references (4, 5)). Consistent with (4) where a related Cas9 protein is shown to cut both strands 6 bp upstream of the PAM, NHEJ data confirmed that most deletions or insertions occurred at the 3 ' end of the target sequence (Fig. 5B). Also confirmed was that mutating the target genomic site prevents the gRNA from effecting HR at that locus, demonstrating that CRISPR-mediated genome editing is sequence specific (Fig. 6). It was showed that two gRNAs targeting sites in the GFP gene, and also three additional gRNAs targeting fragments from homologous regions of the DNA methyl transferase 3 a (DNMT3a) and DNMT3b genes could sequence specifically induce significant HR in the engineered reporter cell lines (Fig. 7, 8). Together these results confirm that RNA- guided genome targeting in human cells induces robust HR across multiple target sites.
According to certain aspects, a native locus was modified. gRNAs were used to target the AAVS l locus located in the PPP1R12C gene on chromosome 19, which is ubiquitously expressed across most tissues (Fig. 2A) in 293Ts, K562s, and PGP1 human iPS cells (see reference (12)) and analyzed the results by next-generation sequencing of the targeted locus. Accordingly, Figure 2 is directed to RNA-guided genome editing of the native AAVS l locus in multiple cell types. As shown in Figure 2A, Tl (red) and T2 (green) gRNAs target sequences in an intron of the PPP1R12C gene within the chromosome 19 AAVS l locus. As shown in Figure 2B, total count and location of deletions caused by NHEJ in 293Ts, K562s, and PGP1 iPS cells following expression of Cas9 and either Tl or T2 gRNAs as quantified by next-generation sequencing is provided. Red and green dash lines demarcate the boundaries of the Tl and T2 gRNA targeting sites. NHEJ frequencies for Tl and T2 gRNAs were 10% and 25% in 293T, 13% and 38% in K562, and 2% and 4% in PGP 1 iPS cells, respectively. As shown in Figure 2C, DNA donor architecture for HR at the AAVS l locus, and the locations of sequencing primers (arrows) for detecting successful targeted events, are depicted. As shown in Figure 2D, PCR assay three days post transfection demonstrates that only cells expressing the donor, Cas9 and T2 gRNA exhibit successful HR events. As shown in Figure 2E, successful HR was confirmed by Sanger sequencing of the PCR amplicon showing that the expected DNA bases at both the genome-donor and donor-insert boundaries are present. As shown in Figure 2F, successfully targeted clones of 293T cells were selected with puromycin for 2 weeks. Microscope images of two representative GFP+ clones is shown (scale bar is 100 microns).
Consistent with results for the GFP reporter assay, high numbers of NHEJ events were observed at the endogenous locus for all three cell types. The two gRNAs Tl and T2 achieved NHEJ rates of 10 and 25% in 293Ts, 13 and 38% in K562s, and 2 and 4% in PGP l-iPS cells, respectively (Fig. 2B). No overt toxicity was observed from the Cas9 and crRNA expression required to induce NHEJ in any of these cell types (Fig. 9). As expected, NHEJ-mediated deletions for Tl and T2 were centered around the target site positions, further validating the sequence specificity of this targeting process (Fig. 9, 10, 1 1). Simultaneous introduction of both Tl and T2 gRNAs resulted in high efficiency deletion of the intervening 19bp fragment (Fig. 10), demonstrating that multiplexed editing of genomic loci is feasible using this approach.
According to one aspect, HR is used to integrate either a dsDNA donor construct (see reference (13)) or an oligo donor into the native AAVS l locus (Fig. 2C, Fig. 12). HR-mediated integration was confirmed using both approaches by PCR (Fig. 2D, Fig. 12) and Sanger sequencing (Fig. 2E). 293T or iPS clones were readily derived from the pool of modified cells using puromycin selection over two weeks (Fig. 2F, Fig. 12). These results demonstrate that Cas9 is capable of efficiently integrating foreign DNA at endogenous loci in human cells. Accordingly, one aspect of the present disclosure includes a method of integrating foreign DNA into the genome of a cell using homologous recombination and Cas9.
According to one aspect, an RNA-guided genome editing system is provided which can readily be adapted to modify other genomic sites by simply modifying the sequence of the gRNA expression vector to match a compatible sequence in the locus of interest. According to this aspect, 190,000 specifically gRNA-targetable sequences targeting about 40.5% exons of genes in the human genome were generated. These target sequences were incorporated into a 200bp format compatible with multiplex synthesis on DNA arrays (see reference (14)) (Fig. 13). According to this aspect, a ready genome -wide reference of potential target sites in the human genome and a methodology for multiplex gRNA synthesis is provided.
According to one aspect, methods are provided for multiplexing genomic alterations in a cell by using one or more or a plurality of RNA/enzyme systems described herein to alter the genome of a cell at a plurality of locations. According to one aspect, target sites perfectly match the PAM sequence NGG and the 8- 12 base "seed sequence" at the 3 ' end of the gRNA. According to certain aspects, perfect match is not required of the remaining 8- 12 bases. According to certain aspects, Cas9 will function with single mismatches at the 5' end. According to certain aspects, the target locus 's underlying chromatin structure and epigenetic state may affect efficiency of Cas9 function. According to certain aspects, Cas9 homologs having higher specificity are included as useful enzymes. One of skill in the art will be able to identify or engineer suitable Cas9 homologs. According to one aspect, CRISPR-targetable sequences include those having different PAM requirements (see reference (9)), or directed evolution. According to one aspect, inactivating one of the Cas9 nuclease domains increases the ratio of HR to NHEJ and may reduce toxicity (Fig. 3 A, Fig. 5) (4, 5), while inactivating both domains may enable Cas9 to function as a retargetable DNA binding protein. Embodiments of the present disclosure have broad utility in synthetic biology (see references (21, 22)), the direct and multiplexed perturbation of gene networks (see references (13, 23)), and targeted ex vivo (see references (24-26)) and in vivo gene therapy (see reference (27)).
According to certain aspects, a "re-engineerable organism" is provided as a model system for biological discovery and in vivo screening. According to one aspect, a "re-engineerable mouse" bearing an inducible Cas9 transgene is provided, and localized delivery (using adeno- associated viruses, for example) of libraries of gRNAs targeting multiple genes or regulatory elements allow one to screen for mutations that result in the onset of tumors in the target tissue type. Use of Cas9 homologs or nuclease-null variants bearing effector domains (such as activators) allow one to multiplex activate or repress genes in vivo. According to this aspect, one could screen for factors that enable phenotypes such as: tissue -regeneration, trans-differentiation etc. According to certain aspects, (a) use of DNA-arrays enables multiplex synthesis of defined gRNA libraries (refer Fig. 13); and (b) gRNAs being small in size (refer Fig. 3b) are packaged and delivered using a multitude of non- viral or viral delivery methods.
According to one aspect, the lower toxicities observed with "nickases" for genome engineering applications is achieved by inactivating one of the Cas9 nuclease domains, either the nicking of the DNA strand base-paired with the RNA or nicking its complement. Inactivating both domains allows Cas9 to function as a retargetable DNA binding protein. According to one aspect, the Cas9 retargetable DNA binding protein is attached
(a) to transcriptional activation or repression domains for modulating target gene expression, including but not limited to chromatin remodeling, histone modification, silencing, insulation, direct interactions with the transcriptional machinery;
(b) to nuclease domains such as Fokl to enable 'highly specific' genome editing contingent upon dimerization of adjacent gRNA-Cas9 complexes;
(c) to fluorescent proteins for visualizing genomic loci and chromosome dynamics; or
(d) to other fluorescent molecules such as protein or nucleic acid bound organic fluorophores, quantum dots, molecular beacons and echo probes or molecular beacon replacements; (e) to multivalent ligand-binding protein domains that enable programmable manipulation of genome -wide 3D architecture.
According to one aspect, the transcriptional activation and repression components can employ CRISPR systems naturally or synthetically orthogonal, such that the gRNAs only bind to the activator or repressor class of Cas. This allows a large set of gRNAs to tune multiple targets.
According to certain aspects, the use of gRNAs provide the ability to multiplex than mRNAs in part due to the smaller size - 100 vs. 2000 nucleotide lengths respectively. This is particularly valuable when nucleic acid delivery is size limited, as in viral packaging. This enables multiple instances of cleavage, nicking, activation, or repression - or combinations thereof. The ability to easily target multiple regulatory targets allows the coarse-or- fine-tuning or regulatory networks without being constrained to the natural regulatory circuits downstream of specific regulatory factors (e.g. the 4 mRNAs used in reprogramming fibroblasts into IPSCs). Examples of multiplexing applications include:
1. Establishing (major and minor) histocompatibility alleles, haplotypes, and genotypes for human (or animal) tissue/organ transplantation. This aspect results e.g. in HLA homozygous cell lines or humanized animal breeds - or - a set of gRNAs capable of superimposing such HLA alleles onto an otherwise desirable cell lines or breeds.
2. Multiplex cis-regulatory element (CRE = signals for transcription, splicing, translation, RNA and protein folding, degradation, etc.) mutations in a single cell (or a collection of cells) can be used for efficiently studying the complex sets of regulatory interaction that can occur in normal development or pathological, synthetic or pharmaceutical scenarios. According to one aspect, the CREs are (or can be made) somewhat orthogonal (i.e. low cross talk) so that many can be tested in one setting— e.g. in an expensive animal embryo time series. One exemplary application is with RNA fluorescent in situ sequencing (FISSeq).
3. Multiplex combinations of CRE mutations and/or epigenetic activation or repression of CREs can be used to alter or reprogram iPSCs or ESCs or other stem cells or non-stem cells to any cell type or combination of cell types for use in organs-on-chips or other cell and organ cultures for purposes of testing pharmaceuticals (small molecules, proteins, RNAs, cells, animal, plant or microbial cells, aerosols and other delivery methods), transplantation strategies, personalization strategies, etc.
4. Making multiplex mutant human cells for use in diagnostic testing (and/or DNA sequencing) for medical genetics. To the extent that the chromosomal location and context of a human genome allele (or epigenetic mark) can influence the accuracy of a clinical genetic diagnosis, it is important to have alleles present in the correct location in a reference genome - rather than in an ectopic (aka transgenic) location or in a separate piece of synthetic DNA. One embodiment is a series of independent cell lines one per each diagnostic human SNP, or structural variant. Alternatively, one embodiment includes multiplex sets of alleles in the same cell. In some cases multiplex changes in one gene (or multiple genes) will be desirable under the assumption of independent testing. In other cases, particular haplotype combinations of alleles allows testing of sequencing (genotyping) methods which accurately establish haplotype phase (i.e. whether one or both copies of a gene are affected in an individual person or somatic cell type.
5. Repetitive elements or endogenous viral elements can be targeted with engineered Cas + gRNA systems in microbes, plants, animals, or human cells to reduce deleterious transposition or to aid in sequencing or other analytic genomic/transcriptomic/proteomic/diagnostic tools (in which nearly identical copies can be problematic).
The following references identified by number in the foregoing section are hereby incorporated by reference in their entireties.
1. B. Wiedenheft, S. H. Sternberg, J. A. Doudna, Nature 482, 331 (Feb 16, 2012).
2. D. Bhaya, M. Davison, R. Barrangou, Annual review of genetics 45, 273 (201 1).
3. M. P. Terns, R. M. Terns, Current opinion in microbiology 14, 321 (Jun, 201 1).
4. M. Jinek et al, Science 337, 816 (Aug 17, 2012).
5. G. Gasiunas, R. Barrangou, P. Horvath, V. Siksnys, Proceedings of the National Academy of Sciences of the United States of America 109, E2579 (Sep 25, 2012).
6. R. Sapranauskas et al, Nucleic acids research 39, 9275 (Nov, 201 1).
7. T. R. Brummelkamp, R. Bernards, R. Agami, Science 296, 550 (Apr 19, 2002).
8. M. Miyagishi, K. Taira, Nature biotechnology 20, 497 (May, 2002).
9. E. Deltcheva et al, Nature 471, 602 (Mar 31, 201 1).
10. J. Zou, P. Mali, X. Huang, S. N. Dowey, L. Cheng, Blood 1 18, 4599 (Oct 27, 201 1).
1 1. N. E. Sanjana et al, Nature protocols 7, 171 (Jan, 2012).
12. J. H. Lee et al, PLoS Genet 5, el 000718 (Nov, 2009).
13. D. Hockemeyer et al, Nature biotechnology 27, 851 (Sep, 2009).
14. S. Kosuri et al, Nature biotechnology 28, 1295 (Dec, 2010).
15. V. Pattanayak, C. L. Ramirez, J. K. Joung, D. R. Liu, Nature methods 8, 765 (Sep, 2011).
16. N. M. King, O. Cohen-Haguenauer, Molecular therapy : the journal of the American Society of Gene Therapy 16, 432 (Mar, 2008).
17. Y. G. Kim, J. Cha, S. Chandrasegaran, Proceedings of the National Academy of Sciences of the United States of America 93, 1 156 (Feb 6, 1996).
18. E. J. Rebar, C. O. Pabo, Science 263, 671 (Feb 4, 1994).
19. J. Boch et al , Science 326, 1509 (Dec 1 1 , 2009).
20. M. J. Moscou, A. J. Bogdanove, Science 326, 1501 (Dec 1 1, 2009).
21. A. S. Khalil, J. J. Collins, Nature reviews. Genetics 1 1 , 367 (May, 2010).
22. P. E. Purnick, R. Weiss, Nature reviews. Molecular cell biology 10, 410 (Jun, 2009). 23. J. Zou et al, Cell stem cell 5, 97 (Jul 2, 2009).
24. N. Holt et al, Nature biotechnology 28, 839 (Aug, 2010).
25. F. D. Umov et al, Nature 435, 646 (Jun 2, 2005).
26. A. Lombardo et al, Nature biotechnology 25, 1298 (Nov, 2007).
27. H. Li et al, Nature 475, 217 (Jul 14, 201 1).
The following examples are set forth as being representative of the present disclosure. These examples are not to be construed as limiting the scope of the present disclosure as these and other equivalent embodiments will be apparent in view of the present disclosure, figures and accompanying claims.
EXAMPLE I
The Type II CRISPR-Cas System
According to one aspect, embodiments of the present disclosure utilize short RNA to identify foreign nucleic acids for activity by a nuclease in a eukaryotic cell. According to a certain aspect of the present disclosure, a eukaryotic cell is altered to include within its genome nucleic acids encoding one or more short RNA and one or more nucleases which are activated by the binding of a short RNA to a target DNA sequence. According to certain aspects, exemplary short RNA / enzyme systems may be identified within bacteria or archaea, such as (CRISPR)/CRISPR- associated (Cas) systems that use short RNA to direct degradation of foreign nucleic acids. CRISPR ("clustered regularly interspaced short palindromic repeats") defense involves acquisition and integration of new targeting "spacers" from invading virus or plasmid DNA into the CRISPR locus, expression and processing of short guiding CRISPR RNAs (crRNAs) consisting of spacer- repeat units, and cleavage of nucleic acids (most commonly DNA) complementary to the spacer.
Three classes of CRISPR systems are generally known and are referred to as Type I, Type II or Type III). According to one aspect, a particular useful enzyme according to the present disclosure to cleave dsDNA is the single effector enzyme, Cas9, common to Type II. (See reference (7)). Within bacteria, the Type II effector system consists of a long pre-crRNA transcribed from the spacer-containing CRISPR locus, the multifunctional Cas9 protein, and a tracrRNA important for gRNA processing. The tracrRNAs hybridize to the repeat regions separating the spacers of the pre-crRNA, initiating dsRNA cleavage by endogenous RNase III, which is followed by a second cleavage event within each spacer by Cas9, producing mature crRNAs that remain associated with the tracrRNA and Cas9. According to one aspect, eukaryotic cells of the present disclosure are engineered to avoid use of RNase III and the crRNA processing in general. See reference (2). According to one aspect, the enzyme of the present disclosure, such as Cas9 unwinds the DNA duplex and searches for sequences matching the crRNA to cleave. Target recognition occurs upon detection of complementarity between a "protospacer" sequence in the target DNA and the remaining spacer sequence in the crRNA. Importantly, Cas9 cuts the DNA only if a correct protospacer-adjacent motif (PAM) is also present at the 3' end. According to certain aspects, different protospacer-adjacent motif can be utilized. For example, the S. pyogenes system requires an NGG sequence, where N can be any nucleotide. S. thermophilus Type II systems require NGGNG (see reference (3)) and NNAGAAW (see reference (4)), respectively, while different S. mutans systems tolerate NGG or NAAR (see reference (5)). Bioinformatic analyses have generated extensive databases of CRISPR loci in a variety of bacteria that may serve to identify additional useful PAMs and expand the set of CRISPR-targetable sequences (see references (6, 7)). In S. thermophilus, Cas9 generates a blunt-ended double-stranded break 3bp prior to the 3 ' end of the protospacer (see reference (8)), a process mediated by two catalytic domains in the Cas9 protein: an HNH domain that cleaves the complementary strand of the DNA and a RuvC-like domain that cleaves the non-complementary strand (See Figure 1A and Figure 3). While the S. pyogenes system has not been characterized to the same level of precision, DSB formation also occurs towards the 3 ' end of the protospacer. If one of the two nuclease domains is inactivated, Cas9 will function as a nickase in vitro (see reference (2)) and in human cells (see Figure 5).
According to one aspect, the specificity of gRNA-directed Cas9 cleavage is used as a mechanism for genome engineering in a eukaryotic cell. Accordign to one aspect, hybridization of the gRNA need not be 100 percent in order for the enzyme to recognize the gRNA/DNA hybrid and affect cleavage. Some off-target activity could occur. For example, the S. pyogenes system tolerates mismatches in the first 6 bases out of the 20bp mature spacer sequence in vitro. According to one aspect, greater stringency may be beneficial in vivo when potential off-target sites matching (last 14 bp) NGG exist within the human reference genome for the gRNAs. The effect of mismatches and enzyme activity in general are described in references (9), (2), (10), and (4).
According to certain aspects, specificity may be improved. When interference is sensitive to the melting temperature of the gRNA-DNA hybrid, AT-rich target sequences may have fewer off- target sites. Carefully choosing target sites to avoid pseudo-sites with at least 14bp matching sequences elsewhere in the genome may improve specificity. The use of a Cas9 variant requiring a longer PAM sequence may reduce the frequency of off-target sites. Directed evolution may improve Cas9 specificity to a level sufficient to completely preclude off-target activity, ideally requiring a perfect 20bp gRNA match with a minimal PAM. Accordingly, modification to the Cas9 protein is a representative embodiment of the present disclosure. As such, novel methods permitting many rounds of evolution in a short timeframe (see reference (11) and envisioned. CRISPR systems useful in the present disclosure are described in references (12, 13).
EXAMPLE II
Plasmid construction
The Cas9 gene sequence was human codon optimized and assembled by hierarchical fusion PCR assembly of 9 500bp gBlocks ordered from IDT. Fig. 3A for the engineered type II CRISPR system for human cells shows the expression format and full sequence of the cas9 gene insert. The RuvC-like and HNH motifs, and the C-terminus SV40 NLS are respectively highlighted by blue, brown and orange colors. Cas9_D 10A was similarly constructed. The resulting full-length products were cloned into the pcDNA3.3-TOPO vector (Invitrogen). The target gRNA expression constructs were directly ordered as individual 455bp gBlocks from IDT and either cloned into the pCR-Bluntll-TOPO vector (Invitrogen) or per amplified. Fig. 3B shows the U6 promoter based expression scheme for the guide RNAs and predicted RNA transcript secondary structure. The use of the U6 promoter constrains the 1st position in the RNA transcript to be a 'G' and thus all genomic sites of the form GN2oGG can be targeted using this approach. Fig. 3C shows the 7 gRNAs used.
The vectors for the HR reporter assay involving a broken GFP were constructed by fusion PCR assembly of the GFP sequence bearing the stop codon and 68bp AAVS l fragment (or mutants thereof; see Fig. 6), or 58bp fragments from the DNMT3a and DNMT3b genomic loci (see Fig. 8) assembled into the EGIP lentivector from Addgene (plasmid #26777). These lentivectors were then used to establish the GFP reporter stable lines. TALENs used in this study were constructed using the protocols described in (14). All DNA reagents developed in this study are available at Addgene.
EXAMPLE III
Cell culture PGP 1 iPS cells were maintained on Matrigel (BD Biosciences)-coated plates in mTeSRl
(Stemcell Technologies). Cultures were passaged every 5-7 d with TrypLE Express (Invitrogen). K562 cells were grown and maintained in RPMI (Invitrogen) containing 15% FBS. HEK 293T cells were cultured in Dulbecco's modified Eagle's medium (DMEM, Invitrogen) high glucose supplemented with 10% fetal bovine serum (FBS, Invitrogen), penicillin/streptomycin (pen/strep, Invitrogen), and non-essential amino acids (NEAA, Invitrogen). All cells were maintained at 37°C and 5% CO2 in a humidified incubator.
EXAMPLE IV
Gene targeting of PGP 1 iPS, K562 and 293Ts
PGP1 iPS cells were cultured in Rho kinase (ROCK) inhibitor (Calbiochem) 2h before nucleofection. Cells were harvest using TrypLE Express (Invitrogen) and 2* 106 cells were resuspended in P3 reagent (Lonza) with ^g Cas9 plasmid, ^g gRNA and/or ^g DNA donor plasmid, and nucleofected according to manufacturer's instruction (Lonza). Cells were subsequently plated on an mTeSRl -coated plate in mTeSRl medium supplemented with ROCK inhibitor for the first 24h. For K562s, 2x l06 cells were resuspended in SF reagent (Lonza) with ^g Cas9 plasmid, ^g gRNA and/or ^g DNA donor plasmid, and nucleofected according to manufacturer's instruction (Lonza). For 293Ts, O. l x lO6 cells were transfected with ^g Cas9 plasmid, ^g gRNA and/or ^g DNA donor plasmid using Lipofectamine 2000 as per the manufacturer's protocols. The DNA donors used for endogenous AAVS1 targeting were either a dsDNA donor (Fig. 2C) or a 90mer oligonucleotide. The former has flanking short homology arms and a SA-2A-puromycin-CaGGS-eGFP cassette to enrich for successfully targeted cells.
The targeting efficiency was assessed as follows. Cells were harvested 3 days after nucleofection and the genomic DNA of ~1 X 106 cells was extracted using prepGEM (ZyGEM). PCR was conducted to amplify the targeting region with genomic DNA derived from the cells and amplicons were deep sequenced by MiSeq Personal Sequencer (Illumina) with coverage >200,000 reads. The sequencing data was analyzed to estimate NHEJ efficiencies. The reference AAVS 1 sequence analyzed is:
CACTTCAGGACAGCATGTTTGCTGCCTCCAGGGATCCTGTGTCCCCGAGCTGGGACCA CCTTATATTCCCAGGGCCGGTTAATGTGGCTCTGGTTCTGGGTACTTTTATCTGTCCCC TCCACCCCACAGTGGGGCCACTAGGGACAGGATTGGTGACAGAAAAGCCCCATCCTT AGGCCTCCTCCTTCCTAGTCTCCTGATATTGGGTCTAACCCCCACCTCCTGTTAGGCAG ATTCCTTATCTGGTGACACACCCCCATTTCCTGGA
The PCR primers for amplifying the targeting regions in the human genome are:
AAVS 1 -R CTCGGCATTCCTGCTGAACCGCTCTTCCGATCTacaggaggtgggggttagac AAVS 1-F.1
ACACTCTTTCCCTACACGACGCTCTTCCGATCTCGTGATtatattcccagggccggtta AAVS 1-F.2
ACACTCTTTCCCTACACGACGCTCTTCCGATCTACATCGtatattcccagggccggtta AAVS 1-F.3
ACACTCTTTCCCTACACGACGCTCTTCCGATCTGCCTAAtatattcccagggccggtta AAVS 1-F.4
ACACTCTTTCCCTACACGACGCTCTTCCGATCTTGGTCAtatattcccagggccggtta AAVS 1-F.5
ACACTCTTTCCCTACACGACGCTCTTCCGATCTCACTGTtatattcccagggccggtta AAVS 1-F.6
ACACTCTTTCCCTACACGACGCTCTTCCGATCTATTGGCtatattcccagggccggtta AAVS 1-F.7
ACACTCTTTCCCTACACGACGCTCTTCCGATCTGATCTGtatattcccagggccggtta AAVS 1-F.8
ACACTCTTTCCCTACACGACGCTCTTCCGATCTTCAAGTtatattcccagggccggtta AAVS 1-F.9
ACACTCTTTCCCTACACGACGCTCTTCCGATCTCTGATCtatattcccagggccggtta AAVS 1-F.10
ACACTCTTTCCCTACACGACGCTCTTCCGATCTAAGCTAtatattcccagggccggtta AAVS 1-F. i l
ACACTCTTTCCCTACACGACGCTCTTCCGATCTGTAGCCtatattcccagggccggtta AAVS 1-F.12
ACACTCTTTCCCTACACGACGCTCTTCCGATCTTACAAGtatattcccagggccggtta To analyze the HR events using the DNA donor in Fig. 2C, the primers used were:
HR AAVSl-F CTGCCGTCTCTCTCCTGAGT
HR_Puro-R GTGGGCTTGTACTCGGTCAT EXAMPLE V
Bioinformatics approach for computing human exon CRISPR targets
and methodology for their multiplexed synthesis
A set of gRNA gene sequences that maximally target specific locations in human exons but minimally target other locations in the genome were determined as follows. According to one aspect, maximally efficient targeting by a gRNA is achieved by 23nt sequences, the 5 '-most 20nt of which exactly complement a desired location, while the three 3 '-most bases must be of the form NGG. Additionally, the 5 '-most nt must be a G to establish a pol-III transcription start site. However, according to (2), mispairing of the six 5'-most nt of a 20bp gRNA against its genomic target does not abrogate Cas9-mediated cleavage so long as the last 14nt pairs properly, but mispairing of the eight 5 '-most nt along with pairing of the last 12 nt does, while the case of the seven 5-most nt mispairs and 13 3' pairs was not tested. To be conservative regarding off-target effects, one condition was that the case of the seven 5 '-most mispairs is, like the case of six, permissive of cleavage, so that pairing of the 3 '-most 13nt is sufficient for cleavage. To identify CRISPR target sites within human exons that should be cleavable without off-target cuts, all 23bp sequences of the form 5'-GBBBB BBBBB BBBBB BBBBB NGG-3' (form 1) were examined, where the B's represent the bases at the exon location, for which no sequence of the form 5'- N N BBB BBBBB BBBBB NGG-3' (form 2) existed at any other location in the human genome. Specifically, (i) a BED file of locations of coding regions of all RefSeq genes the GRCh37/hgl9 human genome from the UCSC Genome Browser (15-17) was downloaded. Coding exon locations in this BED file comprised a set of 346089 mappings of RefSeq mRNA accessions to the hgl9 genome. However, some RefSeq mRNA accessions mapped to multiple genomic locations (probable gene duplications), and many accessions mapped to subsets of the same set of exon locations (multiple isoforms of the same genes). To distinguish apparently duplicated gene instances and consolidate multiple references to the same genomic exon instance by multiple RefSeq isoform accessions, (ii) unique numerical suffixes to 705 RefSeq accession numbers that had multiple genomic locations were added, and (iii) the mergeBed function of BEDTools (18) (v2.16.2-zip-87e3926) was used to consolidate overlapping exon locations into merged exon regions. These steps reduced the initial set of 346089 RefSeq exon locations to 192783 distinct genomic regions. The hgl9 sequence for all merged exon regions were downloaded using the UCSC Table Browser, adding 20bp of padding on each end. (iv) Using custom perl code, 1657793 instances of form 1 were identified within this exonic sequence, (v) These sequences were then filtered for the existence of off-target occurrences of form 2: For each merged exon form 1 target, the 3 '-most 13bp specific (B) "core" sequences were extracted and, for each core generated the four 16bp sequences 5'-BBB BBBBB BBBBB NGG-3' (N = A, C, G, and T), and searched the entire hgl9 genome for exact matches to these 6631172 sequences using Bowtie version 0.12.8 (19) using the parameters -1 16 -v 0 -k 2. Any exon target site for which there was more than a single match was rejected. Note that because any specific 13bp core sequence followed by the sequence NGG confers only 15bp of specificity, there should be on average -5.6 matches to an extended core sequence in a random ~3Gb sequence (both strands). Therefore, most of the 1657793 initially identified targets were rejected; however 189864 sequences passed this filter. These comprise the set of CRISPR-targetable exonic locations in the human genome. The 189864 sequences target locations in 78028 merged exonic regions (-40.5% of the total of 192783 merged human exon regions) at a multiplicity of -2.4 sites per targeted exonic region. To assess targeting at a gene level, RefSeq mRNA mappings were clustered so that any two RefSeq accessions (including the gene duplicates distinguished in (ii)) that overlap a merged exon region are counted as a single gene cluster, the 189864 exonic specific CRISPR sites target 17104 out of 18872 gene clusters (-90.6% of all gene clusters) at a multiplicity of ~1 1.1 per targeted gene cluster. (Note that while these gene clusters collapse RefSeq mRNA accessions that represent multiple isoforms of a single transcribed gene into a single entity, they will also collapse overlapping distinct genes as well as genes with antisense transcripts.) At the level of original RefSeq accessions, the 189864 sequences targeted exonic regions in 30563 out of a total of 43726 (-69.9%) mapped RefSeq accessions (including distinguished gene duplicates) at a multiplicity of -6.2 sites per targeted mapped RefSeq accession.
According to one aspect, the database can be refined by correlating performance with factors, such as base composition and secondary structure of both gRNAs and genomic targets (20, 21), and the epigenetic state of these targets in human cell lines for which this information is available (22).
EXAMPLE VI
Multiplex Synthesis The target sequences were incorporated into a 200bp format that is compatible for multiplex synthesis on DNA arrays (23, 24). According to one aspect the method allows for targeted retrieval of a specific or pools of gRNA sequences from the DNA array based oligonucleotide pool and its rapid cloning into a common expression vector (Fig. 13 A). Specifically, a 12k oligonucleotide pool from CustomArray Inc. was synthesized. Furthermore, gRNAs of choice from this library (Fig. 13B) were successfully retrieved. We observed an error rate of -4 mutations per 1 OOObp of synthesized DNA.
EXAMPLE VII
RNA-guided genome editing requires both Cas9 and guide RNA for successful targeting
Using the GFP reporter assay described in Fig. IB, all possible combinations of the repair DNA donor, Cas9 protein, and gRNA were tested for their ability to effect successful HR (in 293Ts). As shown in Figure 4, GFP+ cells were observed only when all the 3 components were present, validating that these CRISPR components are essential for RNA-guided genome editing. Data is mean +/- SEM (N=3).
EXAMPLE VIII
Analysis of gRNA and Cas9 mediated genome editing The CRISPR mediated genome editing process was examined using either (A) a GFP reporter assay as described earlier results of which are shown in Figure 5A, and (B) deep sequencing of the targeted loci (in 293Ts), results of which are shown in Figure 5B. As comparison, a D 1 OA mutant for Cas9 was tested that has been shown in earlier reports to function as a nickase in in vitro assays. As shown in Figure 5, both Cas9 and Cas9D10A can effect successful HR at nearly similar rates. Deep sequencing however confirms that while Cas9 shows robust NHEJ at the targeted loci, the D10A mutant has significantly diminished NHEJ rates (as would be expected from its putative ability to only nick DNA). Also, consistent with the known biochemistry of the Cas9 protein, NHEJ data confirms that most base-pair deletions or insertions occurred near the 3' end of the target sequence: the peak is ~3-4 bases upstream of the PAM site, with a median deletion frequency of -9-1 Obp. Data is mean +/- SEM (N=3).
EXAMPLE IX RNA-guided genome editing is target sequence specific
Similar to the GFP reporter assay described in Fig. IB, 3 293T stable lines each bearing a distinct GFP reporter construct were developed. These are distinguished by the sequence of the AAVS l fragment insert (as indicated in the Figure 6). One line harbored the wild-type fragment while the two other lines were mutated at 6bp (highlighted in red). Each of the lines was then targeted by one of the following 4 reagents: a GFP-ZFN pair that can target all cell types since its targeted sequence was in the flanking GFP fragments and hence present in along cell lines; a AAVS 1 TALEN that could potentially target only the wt-AAVS 1 fragment since the mutations in the other two lines should render the left TALEN unable to bind their sites; the Tl gRNA which can also potentially target only the wt-AAVS 1 fragment, since its target site is also disrupted in the two mutant lines; and finally the T2 gRNA which should be able to target all 3 cell lines since, unlike the Tl gRNA, its target site is unaltered among the 3 lines. ZFN modified all 3 cell types, the AAVSl TALENs and the Tl gRNA only targeted the wt-AAVS 1 cell type, and the T2 gRNA successfully targets all 3 cell types. These results together confirm that the guide RNA mediated editing is target sequence specific. Data is mean +/- SEM (N=3).
EXAMPLE X
Guide RNAs targeted to the GFP sequence enable robust genome editing
In addition to the 2 gRNAs targeting the AAVS 1 insert, two additional gRNAs targeting the flanking GFP sequences of the reporter described in Fig. IB (in 293Ts) were tested. As shown in Figure 7, these gRNAs were also able to effect robust HR at this engineered locus. Data is mean +/- SEM (N=3). EXAMPLE XI
RNA-guided genome editing is target sequence specific, and demonstrates similar targeting efficiencies as ZFNs or TALENs Similar to the GFP reporter assay described in Fig. IB, two 293T stable lines each bearing a distinct GFP reporter construct were developed. These are distinguished by the sequence of the fragment insert (as indicated in Figure 8). One line harbored a 58bp fragment from the DNMT3a gene while the other line bore a homologous 58bp fragment from the DNMT3b gene. The sequence differences are highlighted in red. Each of the lines was then targeted by one of the following 6 reagents: a GFP-ZFN pair that can target all cell types since its targeted sequence was in the flanking GFP fragments and hence present in along cell lines; a pair of TALENs that potentially target either DNMT3a or DNMT3b fragments; a pair of gRNAs that can potentially target only the DNMT3a fragment; and finally a gRNA that should potentially only target the DNMT3b fragment. As indicated in Figure 8, the ZFN modified all 3 cell types, and the TALENs and gRNAs only their respective targets. Furthermore the efficiencies of targeting were comparable across the 6 targeting reagents. These results together confirm that RNA-guided editing is target sequence specific and demonstrates similar targeting efficiencies as ZFNs or TALENs. Data is mean +/- SEM (N=3). EXAMPLE XII
RNA-guided NHEJ in human iPS cells
Human iPS cells (PGP1) were nucleofected with constructs indicated in the left panel of Figure 9. 4 days after nucleofection, NHEJ rate was measured by assessing genomic deletion and insertion rate at double-strand breaks (DSBs) by deep sequencing. Panel 1: Deletion rate detected at targeting region. Red dash lines: boundary of Tl RNA targeting site; green dash lines: boundary of T2 RNA targeting site. The deletion incidence at each nucleotide position was plotted in black lines and the deletion rate as the percentage of reads carrying deletions was calculated. Panel 2: Insertion rate detected at targeting region. Red dash lines: boundary of Tl RNA targeting site; green dash lines: boundary of T2 RNA targeting site. The incidence of insertion at the genomic location where the first insertion junction was detected was plotted in black lines and the insertion rate as the percentage of reads carrying insertions was calculated. Panel 3: Deletion size distribution. The frequencies of different size deletions among the whole NHEJ population was plotted. Panel 4: insertion size distribution. The frequencies of different sizes insertions among the whole NHEJ population was plotted. iPS targeting by both gRNAs is efficient (2-4%), sequence specific (as shown by the shift in position of the NHEJ deletion distributions), and reaffirming the results of Figure 4, the NGS-based analysis also shows that both the Cas9 protein and the gRNA are essential for NHEJ events at the target locus.
EXAMPLE XIII RNA-guided NHEJ in K562 cells
K562 cells were nucleated with constructs indicated in the left panel of Figure 10. 4 days after nucleofection, NHEJ rate was measured by assessing genomic deletion and insertion rate at DSBs by deep sequencing. Panel 1: Deletion rate detected at targeting region. Red dash lines: boundary of Tl RNA targeting site; green dash lines: boundary of T2 RNA targeting site. The deletion incidence at each nucleotide position was plotted in black lines and the deletion rate as the percentage of reads carrying deletions was calculated. Panel 2: Insertion rate detected at targeting region. Red dash lines: boundary of Tl RNA targeting site; green dash lines: boundary of T2 RNA targeting site. The incidence of insertion at the genomic location where the first insertion junction was detected was plotted in black lines and the insertion rate as the percentage of reads carrying insertions was calculated. Panel 3: Deletion size distribution. The frequencies of different size deletions among the whole NHEJ population was plotted. Panel 4: insertion size distribution. The frequencies of different sizes insertions among the whole NHEJ population was plotted. K562 targeting by both gRNAs is efficient (13-38%) and sequence specific (as shown by the shift in position of the NHEJ deletion distributions). Importantly, as evidenced by the peaks in the histogram of observed frequencies of deletion sizes, simultaneous introduction of both Tl and T2 guide RNAs resulted in high efficiency deletion of the intervening 19bp fragment, demonstrating that multiplexed editing of genomic loci is also feasible using this approach. EXAMPLE XIV
RNA-guided NHEJ in 293T cells
293T cells were transfected with constructs indicated in the left panel of Figure 11. 4 days after nucleofection, NHEJ rate was measured by assessing genomic deletion and insertion rate at DSBs by deep sequencing. Panel 1: Deletion rate detected at targeting region. Red dash lines: boundary of Tl RNA targeting site; green dash lines: boundary of T2 RNA targeting site. The deletion incidence at each nucleotide position was plotted in black lines and the deletion rate as the percentage of reads carrying deletions was calculated. Panel 2: Insertion rate detected at targeting region. Red dash lines: boundary of Tl RNA targeting site; green dash lines: boundary of T2 RNA targeting site. The incidence of insertion at the genomic location where the first insertion junction was detected was plotted in black lines and the insertion rate as the percentage of reads carrying insertions was calculated. Panel 3: Deletion size distribution. The frequencies of different size deletions among the whole NHEJ population was plotted. Panel 4: insertion size distribution. The frequencies of different sizes insertions among the whole NHEJ population was plotted. 293T targeting by both gRNAs is efficient (10-24%) and sequence specific (as shown by the shift in position of the NHEJ deletion distributions).
EXAMPLE XV HR at the endogenous AAVS 1 locus using either a dsDNA
donor or a short oligonucleotide donor
As shown in Figure 12A, PCR screen (with reference to Figure 2C) confirmed that 21/24 randomly picked 293T clones were successfully targeted. As shown in Figure 12B, similar PCR screen confirmed 3/7 randomly picked PGPl-iPS clones were also successfully targeted. As shown in Figure 12C, short 90mer oligos could also effect robust targeting at the endogenous AAVS 1 locus (shown here for K562 cells).
EXAMPLE XVI
Methodology for multiplex synthesis, retrieval and
U6 expression vector cloning of guide RNAs targeting genes in the human genome
A resource of about 190k bioinformatically computed unique gRNA sites targeting -40.5% of all exons of genes in the human genome was generated. As shown in Figure 13 A, the gRNA target sites were incorporated into a 200bp format that is compatible for multiplex synthesis on DNA arrays. Specifically, the design allows for (i) targeted retrieval of a specific or pools of gRNA targets from the DNA array oligonucleotide pool (through 3 sequential rounds of nested PCR as indicated in the figure schematic); and (ii) rapid cloning into a common expression vector which upon linearization using an Aflll site serves as a recipient for Gibson assembly mediated incorporation of the gRNA insert fragment. As shown in Figure 13B, the method was used to accomplish targeted retrieval of 10 unique gRNAs from a 12k oligonucleotide pool synthesized by CustomArray Inc.
EXAMPLE XVII CRISPR Mediated RNA-Guided Transcriptional Activation The CRISPR-Cas system has an adaptive immune defense system in bacteria and functions to 'cleave' invading nucleic acids. According to one aspect, the CRISPR-CAS system is engineered to function in human cells, and to 'cleave' genomic DNA. This is achieved by a short guide RNA directing a Cas9 protein (which has nuclease function) to a target sequence complementary to the spacer in the guide RNA. The ability to 'cleave' DNA enables a host of applications related to genome editing, and also targeted genome regulation. Towards this, the Cas9 protein was mutated to make it nuclease-null by introducing mutations that are predicted to abrogate coupling to Mg2+ (known to be important for the nuclease functions of the RuvC-like and HNH-like domains): specifically, combinations of D10A, D839A, H840A and N863A mutations were introduced. The thus generated Cas9 nuclease-null protein (as confirmed by its ability to not cut DNA by sequencing analysis) and hereafter referred to as Cas9R-H-, was then coupled to a transcriptional activation domain, here VP64, enabling the CRISPR-cas system to function as a RNA guided transcription factor (see Figure 14). The Cas9R-H-+VP64 fusion enables RNA- guided transcriptional activation at the two reporters shown. Specifically, both FACS analysis and immunofluorescence imaging demonstrates that the protein enables gRNA sequence specific targeting of the corresponding reporters, and furthermore, the resulting transcription activation as assayed by expression of a dTomato fluorescent protein was at levels similar to those induced by a convention TALE-VP64 fusion protein.
EXAMPLE XVIII
gRNA Sequence Flexibility and Applications Thereof
Flexibility of the gRNA scaffold sequence to designer sequence insertions was determined by systematically assaying for a range of the random sequence insertions on the 5', middle and 3' portions of the gRNA: specifically, lbp, 5bp, lObp, 20bp, and 40bp inserts were made in the gRNA sequence at the 5', middle, and 3' ends of the gRNA (the exact positions of the insertion are highlighted in 'red' in Figure 15). This gRNA was then tested for functionality by its ability to induce HR in a GFP reporter assay (as described herein). It is evident that gRNAs are flexible to sequence insertions on the 5' and 3' ends (as measured by retained HR inducing activity). Accordingly, aspects of the present disclosure are directed to tagging of small-molecule responsive RNA aptamers that may trigger onset of gRNA activity, or gRNA visualization. Additionally, aspects of the present disclosure are directed to tethering of ssDNA donors to gRNAs via hybridization, thus enabling coupling of genomic target cutting and immediate physical localization of repair template which can promote homologous recombination rates over error- prone non-homologous end-joining. The following references identified in the Examples section by number are hereby incorporated by reference in their entireties for all purposes.
References
1. K. S. Makarova et al, Evolution and classification of the CRISPR-Cas systems. Nature reviews. Microbiology 9, 467 (Jun, 2011).
2. M. Jinek et al., A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816 (Aug 17, 2012).
3. P. Horvath, R. Barrangou, CRISPR/Cas, the immune system of bacteria and archaea.
Science 327, 167 (Jan 8, 2010).
4. H. Deveau et al., Phage response to CRISPR-encoded resistance in Streptococcus thermophilus. Journal of bacteriology 190, 1390 (Feb, 2008).
5. J. R. van der Ploeg, Analysis of CRISPR in Streptococcus mutans suggests frequent occurrence of acquired immunity against infection by M102-like bacteriophages.
Microbiology 155, 1966 (Jun, 2009).
6. M. Rho, Y. W. Wu, H. Tang, T. G. Doak, Y. Ye, Diverse CRISPRs evolving in human microbiomes. PLoS genetics 8, el 002441 (2012).
7. D. T. Pride et al, Analysis of streptococcal CRISPRs from human saliva reveals substantial sequence diversity within and between subjects over time. Genome research
21, 126 (Jan, 201 1).
8. G. Gasiunas, R. Barrangou, P. Horvath, V. Siksnys, Cas9-crRNA ribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity in bacteria. Proceedings of the National Academy of Sciences of the United States of America 109, E2579 (Sep 25, 2012).
9. R. Sapranauskas et al, The Streptococcus thermophilus CRISPR/Cas system provides immunity in Escherichia coli. Nucleic acids research 39, 9275 (Nov, 201 1).
10. J. E. Garneau et al, The CRISPR/Cas bacterial immune system cleaves bacteriophage and plasmid DNA. Nature 468, 67 (Nov 4, 2010).
1 1. K. M. Esvelt, J. C. Carlson, D. R. Liu, A system for the continuous directed evolution of biomolecules. Nature 472, 499 (Apr 28, 201 1).
12. R. Barrangou, P. Horvath, CRISPR: new horizons in phage resistance and strain identification. Annual review of food science and technology 3, 143 (2012).
13. B. Wiedenheft, S. H. Sternberg, J. A. Doudna, RNA-guided genetic silencing systems in bacteria and archaea. Nature 482, 331 (Feb 16, 2012).
14. N. E. Sanjana et al, A transcription activator- like effector toolbox for genome engineering.
Nature protocols 7, 171 (Jan, 2012).
15. W. J. Kent et al, The human genome browser at UCSC. Genome Res 12, 996 (Jun, 2002). 16. T. R. Dreszer et ah, The UCSC Genome Browser database: extensions and updates 201 1. Nucleic Acids Res 40, D918 (Jan, 2012).
17. D. Karolchik et ah, The UCSC Table Browser data retrieval tool. Nucleic Acids Res 32, D493 (Jan 1, 2004).
18. A. R. Quinlan, I. M. Hall, BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 26, 841 (Mar 15, 2010).
19. B. Langmead, C. Trapnell, M. Pop, S. L. Salzberg, Ultrafast and memory- efficient alignment of short DNA sequences to the human genome. Genome Biol 10, R25 (2009). 0. R. Lorenz et ah, ViennaRNA Package 2.0. Algorithms for molecular biology : AMB 6, 26 (201 1).
1. D. H. Mathews, J. Sabina, M. Zuker, D. H. Turner, Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. Journal of molecular biology 288, 91 1 (May 21, 1999).
2. R. E. Thurman et ah, The accessible chromatin landscape of the human genome. Nature 489, 75 (Sep 6, 2012).
3. S. Kosuri et ah, Scalable gene synthesis by selective amplification of DNA pools from high-fidelity microchips. Nature biotechnology 28, 1295 (Dec, 2010).
4. Q. Xu, M. R. Schlabach, G. J. Hannon, S. J. Elledge, Design of 240,000 orthogonal 25mer DNA barcode probes. Proceedings of the National Academy of Sciences of the United States of America 106, 2289 (Feb 17, 2009).

Claims

Claims:
1. A method of altering a eukaryotic cell comprising
transfecting the eukaryotic cell with a nucleic acid encoding RNA complementary to genomic DNA of the eukaryotic cell,
transfecting the eukaryotic cell with a nucleic acid encoding an enzyme that interacts with the RNA and cleaves the genomic DNA in a site specific manner,
wherein the cell expresses the RNA and the enzyme, the RNA binds to complementary genomic DNA and the enzyme cleaves the genomic DNA in a site specific manner.
2. The method of claim 1 wherein the enzyme is Cas9.
3. The method of claim 1 wherein the eukaryotic cell is a yeast cell, a plant cell or a mammalian cell.
4. The method of claim 1 wherein the RNA includes between about 10 to about 250 nucleotides.
5. The method of claim 1 wherein the RNA includes between about 20 to about 100 nucleotides.
6. A method of altering a human cell comprising
transfecting the human cell with a nucleic acid encoding RNA complementary to genomic DNA of the eukaryotic cell,
transfecting the human cell with a nucleic acid encoding an enzyme that interacts with the RNA and cleaves the genomic DNA in a site specific manner,
wherein the human cell expresses the RNA and the enzyme, the RNA binds to complementary genomic DNA and the enzyme cleaves the genomic DNA in a site specific manner.
7. The method of claim 6 wherein the enzyme is Cas9.
8. The method of claim 6 wherein the RNA includes between about 10 to about 250 nucleotides.
9. The method of claim 6 wherein the RNA includes between about 20 to about 100 nucleotides.
10. A method of altering a eukaryotic cell at a plurality of genomic DNA sites comprising
transfecting the eukaryotic cell with a plurality of nucleic acids encoding RNAs complementary to different sites on genomic DNA of the eukaryotic cell,
transfecting the eukaryotic cell with a nucleic acid encoding an enzyme that interacts with the RNA and cleaves the genomic DNA in a site specific manner,
wherein the cell expresses the RNAs and the enzyme, the RNAs bind to complementary genomic DNA and the enzyme cleaves the genomic DNA in a site specific manner.
1 1. The method of claim 10 wherein the enzyme is Cas9.
12. The method of claim 10 wherein the eukaryotic cell is a yeast cell, a plant cell or a mammalian cell.
13. The method of claim 10 wherein the RNA includes between about 10 to about 250 nucleotides.
14. The method of claim 10 wherein the RNA includes between about 20 to about 100 nucleotides.
PCT/US2013/075317 2012-12-17 2013-12-16 Rna-guided human genome engineering WO2014099744A1 (en)

Priority Applications (43)

Application Number Priority Date Filing Date Title
KR1020227034121A KR20220139433A (en) 2012-12-17 2013-12-16 Rna-guided human genome engineering
ES13863815T ES2741951T3 (en) 2012-12-17 2013-12-16 Genetic engineering modification of the human genome guided by RNA
DK13863815.0T DK2931891T3 (en) 2012-12-17 2013-12-16 RNA-guided MODIFICATION OF HUMAN GENOMES
EP23197923.8A EP4282970A3 (en) 2012-12-17 2013-12-16 Rna-guided human genome engineering
CA2895155A CA2895155C (en) 2012-12-17 2013-12-16 Rna-guided human genome engineering
MX2015007743A MX2015007743A (en) 2012-12-17 2013-12-16 Rna-guided human genome engineering.
NZ709429A NZ709429B2 (en) 2012-12-17 2013-12-16 Rna-guided human genome engineering
EP13863815.0A EP2931891B1 (en) 2012-12-17 2013-12-16 Rna-guided human genome engineering
AU2013363194A AU2013363194B2 (en) 2012-12-17 2013-12-16 RNA-guided human genome engineering
BR112015014425-0A BR112015014425B1 (en) 2012-12-17 2013-12-16 IN VITRO OR EX VIVO METHOD FOR ALTERING A EUKARYOTIC CELL, RNA-GUIDED GENOME EDITING SYSTEM AND EUKARYOTIC CELL CONTAINING SAID EDITING SYSTEM
KR1020157018831A KR20150095861A (en) 2012-12-17 2013-12-16 Rna-guided human genome engineering
SG11201504621RA SG11201504621RA (en) 2012-12-17 2013-12-16 Rna-guided human genome engineering
CN201380073208.XA CN105121641A (en) 2012-12-17 2013-12-16 RNA-guided human genome engineering
US14/653,144 US9970024B2 (en) 2012-12-17 2013-12-16 RNA-guided human genome engineering
JP2015549528A JP6700788B2 (en) 2012-12-17 2013-12-16 RNA-induced human genome modification
EP19173061.3A EP3553174A1 (en) 2012-12-17 2013-12-16 Rna-guided human genome engineering
RU2015129018A RU2699523C2 (en) 2012-12-17 2013-12-16 Rna-guided engineering of human genome
IL308158A IL308158A (en) 2012-12-17 2013-12-16 Rna-guided human genome engineering
US14/318,933 US20140342456A1 (en) 2012-12-17 2014-06-30 RNA-Guided Human Genome Engineering
US14/319,171 US10717990B2 (en) 2012-12-17 2014-06-30 RNA-guided human genome engineering
US14/319,100 US9023649B2 (en) 2012-12-17 2014-06-30 RNA-guided human genome engineering
US14/319,255 US9260723B2 (en) 2012-12-17 2014-06-30 RNA-guided human genome engineering
US14/681,510 US20170044569A9 (en) 2012-12-17 2015-04-08 RNA-Guided Human Genome Engineering
US14/701,912 US20150232833A1 (en) 2012-12-17 2015-05-01 RNA-Guided Human Genome Engineering
IL239326A IL239326A0 (en) 2012-12-17 2015-06-10 Rna-guided human genome engineering
ZA2015/04739A ZA201504739B (en) 2012-12-17 2015-07-01 Rna-guided human genome engineering
US14/790,147 US10273501B2 (en) 2012-12-17 2015-07-02 RNA-guided human genome engineering
HK15112584.0A HK1212376A1 (en) 2012-12-17 2015-12-22 Rna-guided human genome engineering rna
US15/042,573 US11236359B2 (en) 2012-12-17 2016-02-12 RNA-guided human genome engineering
US15/042,515 US10435708B2 (en) 2012-12-17 2016-02-12 RNA-guided human genome engineering
US16/397,423 US11359211B2 (en) 2012-12-17 2019-04-29 RNA-guided human genome engineering
US16/397,213 US11365429B2 (en) 2012-12-17 2019-04-29 RNA-guided human genome engineering
US16/439,840 US11535863B2 (en) 2012-12-17 2019-06-13 RNA-guided human genome engineering
AU2019216665A AU2019216665B2 (en) 2012-12-17 2019-08-15 RNA-guided human genome engineering
US16/884,327 US20200308599A1 (en) 2012-12-17 2020-05-27 RNA-Guided Human Genome Engineering
US17/186,139 US20210222193A1 (en) 2012-12-17 2021-02-26 RNA-Guided Human Genome Engineering
AU2021204024A AU2021204024B2 (en) 2012-12-17 2021-06-17 RNA-guided human genome engineering
AU2021204023A AU2021204023B2 (en) 2012-12-17 2021-06-17 RNA-guided human genome engineering
US17/672,744 US11512325B2 (en) 2012-12-17 2022-02-16 RNA-guided human genome engineering
US18/296,579 US12018272B2 (en) 2012-12-17 2023-04-06 RNA-guided human genome engineering
AU2024201441A AU2024201441A1 (en) 2012-12-17 2024-03-05 RNA-guided human genome engineering
US18/619,354 US20240279677A1 (en) 2012-12-17 2024-03-28 RNA-Guided Human Genome Engineering
US18/663,233 US20240294939A1 (en) 2012-12-17 2024-05-14 RNA-Guided Human Genome Engineering

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201261738355P 2012-12-17 2012-12-17
US61/738,355 2012-12-17
US201361779169P 2013-03-13 2013-03-13
US61/779,169 2013-03-13

Related Child Applications (6)

Application Number Title Priority Date Filing Date
US14/653,144 A-371-Of-International US9970024B2 (en) 2012-12-17 2013-12-16 RNA-guided human genome engineering
US14/318,933 Continuation US20140342456A1 (en) 2012-12-17 2014-06-30 RNA-Guided Human Genome Engineering
US14/319,100 Continuation US9023649B2 (en) 2012-12-17 2014-06-30 RNA-guided human genome engineering
US14/319,255 Continuation US9260723B2 (en) 2012-12-17 2014-06-30 RNA-guided human genome engineering
US14/319,171 Continuation US10717990B2 (en) 2012-12-17 2014-06-30 RNA-guided human genome engineering
US14/790,147 Continuation US10273501B2 (en) 2012-12-17 2015-07-02 RNA-guided human genome engineering

Publications (1)

Publication Number Publication Date
WO2014099744A1 true WO2014099744A1 (en) 2014-06-26

Family

ID=50979072

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/US2013/075317 WO2014099744A1 (en) 2012-12-17 2013-12-16 Rna-guided human genome engineering
PCT/US2013/075326 WO2014099750A2 (en) 2012-12-17 2013-12-16 Rna-guided human genome engineering

Family Applications After (1)

Application Number Title Priority Date Filing Date
PCT/US2013/075326 WO2014099750A2 (en) 2012-12-17 2013-12-16 Rna-guided human genome engineering

Country Status (17)

Country Link
US (19) US9970024B2 (en)
EP (3) EP3553174A1 (en)
JP (4) JP6700788B2 (en)
KR (2) KR20150095861A (en)
CN (1) CN105121641A (en)
AU (5) AU2013363194B2 (en)
CA (2) CA2895155C (en)
DK (1) DK2931891T3 (en)
ES (1) ES2741951T3 (en)
HK (1) HK1212376A1 (en)
IL (2) IL308158A (en)
MX (3) MX2015007743A (en)
MY (1) MY170059A (en)
RU (2) RU2699523C2 (en)
SG (3) SG11201504621RA (en)
WO (2) WO2014099744A1 (en)
ZA (1) ZA201504739B (en)

Cited By (150)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8865406B2 (en) 2012-12-12 2014-10-21 The Broad Institute Inc. Engineering and optimization of improved systems, methods and enzyme compositions for sequence manipulation
US8871445B2 (en) 2012-12-12 2014-10-28 The Broad Institute Inc. CRISPR-Cas component systems, methods and compositions for sequence manipulation
US8889356B2 (en) 2012-12-12 2014-11-18 The Broad Institute Inc. CRISPR-Cas nickase systems, methods and compositions for sequence manipulation in eukaryotes
US8906616B2 (en) 2012-12-12 2014-12-09 The Broad Institute Inc. Engineering of systems, methods and optimized guide compositions for sequence manipulation
US8945839B2 (en) 2012-12-12 2015-02-03 The Broad Institute Inc. CRISPR-Cas systems and methods for altering expression of gene products
US8993233B2 (en) 2012-12-12 2015-03-31 The Broad Institute Inc. Engineering and optimization of systems, methods and compositions for sequence manipulation with functional domains
EP2784162B1 (en) 2012-12-12 2015-04-08 The Broad Institute, Inc. Engineering of systems, methods and optimized guide compositions for sequence manipulation
US9068179B1 (en) 2013-12-12 2015-06-30 President And Fellows Of Harvard College Methods for correcting presenilin point mutations
EP2800811A4 (en) * 2012-05-25 2015-09-23 Univ California Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription
US9163284B2 (en) 2013-08-09 2015-10-20 President And Fellows Of Harvard College Methods for identifying a target site of a Cas9 nuclease
US9228207B2 (en) 2013-09-06 2016-01-05 President And Fellows Of Harvard College Switchable gRNAs comprising aptamers
US9228208B2 (en) 2013-12-11 2016-01-05 Regeneron Pharmaceuticals, Inc. Methods and compositions for the targeted modification of a genome
US9234213B2 (en) 2013-03-15 2016-01-12 System Biosciences, Llc Compositions and methods directed to CRISPR/Cas genomic engineering systems
WO2016011080A2 (en) 2014-07-14 2016-01-21 The Regents Of The University Of California Crispr/cas transcriptional modulation
US9260752B1 (en) 2013-03-14 2016-02-16 Caribou Biosciences, Inc. Compositions and methods of nucleic acid-targeting nucleic acids
WO2016028843A2 (en) 2014-08-19 2016-02-25 President And Fellows Of Harvard College Rna-guided systems for probing and mapping of nucleic acids
WO2016036754A1 (en) 2014-09-02 2016-03-10 The Regents Of The University Of California Methods and compositions for rna-directed target dna modification
JP2016512048A (en) * 2013-03-15 2016-04-25 リージェンツ オブ ザ ユニバーシティ オブ ミネソタ Plant genome manipulation using the CRISPR / Cas system
JP2016512264A (en) * 2013-03-15 2016-04-25 ザ ジェネラル ホスピタル コーポレイション RNA-induced targeting of genomic and epigenomic regulatory proteins to specific genomic loci
US9322006B2 (en) 2011-07-22 2016-04-26 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US9322037B2 (en) 2013-09-06 2016-04-26 President And Fellows Of Harvard College Cas9-FokI fusion proteins and uses thereof
US9359599B2 (en) 2013-08-22 2016-06-07 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
CN105695485A (en) * 2014-11-27 2016-06-22 中国科学院上海生命科学研究院 Cas9 encoding gene used for mycelial fungus Crispr-Cas system, and application thereof
JP2016521975A (en) * 2013-05-15 2016-07-28 サンガモ バイオサイエンシーズ, インコーポレイテッド Methods and compositions for the treatment of genetic conditions
US9487802B2 (en) 2014-05-30 2016-11-08 The Board Of Trustees Of The Leland Stanford Junior University Compositions and methods to treat latent viral infections
US9512446B1 (en) 2015-08-28 2016-12-06 The General Hospital Corporation Engineered CRISPR-Cas9 nucleases
US9526784B2 (en) 2013-09-06 2016-12-27 President And Fellows Of Harvard College Delivery system for functional nucleases
EP2928496A4 (en) * 2012-12-06 2017-03-01 Sigma-Aldrich Co. LLC Crispr-based genome modification and regulation
WO2017040348A1 (en) 2015-08-28 2017-03-09 The General Hospital Corporation Engineered crispr-cas9 nucleases
EP3003392A4 (en) * 2013-06-04 2017-05-03 President and Fellows of Harvard College Rna-guideded transcriptional regulation
WO2017037304A3 (en) * 2016-07-28 2017-06-01 Dsm Ip Assets B.V. An assembly system for a eukaryotic cell
WO2017165655A1 (en) * 2016-03-23 2017-09-28 Dana-Farber Cancer Institute, Inc. Methods for enhancing the efficiency of gene editing
US20170306306A1 (en) * 2014-10-24 2017-10-26 Life Technologies Corporation Compositions and Methods for Enhancing Homologous Recombination
US9834786B2 (en) 2012-04-25 2017-12-05 Regeneron Pharmaceuticals, Inc. Nuclease-mediated targeting with large targeting vectors
JP2017537645A (en) * 2014-12-19 2017-12-21 アプライズ バイオ, インコーポレイテッド Method for identifying multiple epitopes in a selected subpopulation of cells
US9856497B2 (en) 2016-01-11 2018-01-02 The Board Of Trustee Of The Leland Stanford Junior University Chimeric proteins and methods of regulating gene expression
US9885026B2 (en) 2011-12-30 2018-02-06 Caribou Biosciences, Inc. Modified cascade ribonucleoproteins and uses thereof
US9888673B2 (en) 2014-12-10 2018-02-13 Regents Of The University Of Minnesota Genetically modified cells, tissues, and organs for treating disease
US9926546B2 (en) 2015-08-28 2018-03-27 The General Hospital Corporation Engineered CRISPR-Cas9 nucleases
US9938521B2 (en) 2014-03-10 2018-04-10 Editas Medicine, Inc. CRISPR/CAS-related methods and compositions for treating leber's congenital amaurosis 10 (LCA10)
WO2018071892A1 (en) 2016-10-14 2018-04-19 Joung J Keith Epigenetically regulated site-specific nucleases
US9982279B1 (en) 2017-06-23 2018-05-29 Inscripta, Inc. Nucleic acid-guided nucleases
US9982278B2 (en) 2014-02-11 2018-05-29 The Regents Of The University Of Colorado, A Body Corporate CRISPR enabled multiplexed genome engineering
US10011850B2 (en) 2013-06-21 2018-07-03 The General Hospital Corporation Using RNA-guided FokI Nucleases (RFNs) to increase specificity for RNA-Guided Genome Editing
US10011849B1 (en) 2017-06-23 2018-07-03 Inscripta, Inc. Nucleic acid-guided nucleases
US10017760B2 (en) 2016-06-24 2018-07-10 Inscripta, Inc. Methods for generating barcoded combinatorial libraries
US10077453B2 (en) 2014-07-30 2018-09-18 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
WO2018195545A2 (en) 2017-04-21 2018-10-25 The General Hospital Corporation Variants of cpf1 (cas12a) with altered pam specificity
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10117911B2 (en) 2015-05-29 2018-11-06 Agenovir Corporation Compositions and methods to treat herpes simplex virus infections
WO2018218166A1 (en) 2017-05-25 2018-11-29 The General Hospital Corporation Using split deaminases to limit unwanted off-target base editor deamination
US10166255B2 (en) 2015-07-31 2019-01-01 Regents Of The University Of Minnesota Intracellular genomic transplant and methods of therapy
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US10190137B2 (en) 2013-11-07 2019-01-29 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAS
CN109415756A (en) * 2016-04-28 2019-03-01 延世大学校产学协力团 For the active method of the nuclease of RNA guidance to be assessed in body in a manner of high-throughput
EP3352795A4 (en) * 2015-09-21 2019-03-13 The Regents of The University of California Compositions and methods for target nucleic acid modification
EP3441468A3 (en) * 2013-10-17 2019-04-03 Sangamo Therapeutics, Inc. Delivery methods and compositions for nuclease-mediated genome engineering
US10266851B2 (en) 2016-06-02 2019-04-23 Sigma-Aldrich Co. Llc Using programmable DNA binding proteins to enhance targeted genome modification
EP2931891B1 (en) 2012-12-17 2019-05-15 President and Fellows of Harvard College Rna-guided human genome engineering
US10336807B2 (en) 2016-01-11 2019-07-02 The Board Of Trustees Of The Leland Stanford Junior University Chimeric proteins and methods of immunotherapy
US10337001B2 (en) 2014-12-03 2019-07-02 Agilent Technologies, Inc. Guide RNA with chemical modifications
US10377998B2 (en) 2013-12-12 2019-08-13 The Broad Institute, Inc. CRISPR-CAS systems and methods for altering expression of gene products, structural information and inducible modular CAS enzymes
US10385359B2 (en) 2013-04-16 2019-08-20 Regeneron Pharmaceuticals, Inc. Targeted modification of rat genome
US10428310B2 (en) 2014-10-15 2019-10-01 Regeneron Pharmaceuticals, Inc. Methods and compositions for generating or maintaining pluripotent cells
US10428319B2 (en) 2017-06-09 2019-10-01 Editas Medicine, Inc. Engineered Cas9 nucleases
US10457960B2 (en) 2014-11-21 2019-10-29 Regeneron Pharmaceuticals, Inc. Methods and compositions for targeted genetic modification using paired guide RNAs
US10494621B2 (en) 2015-06-18 2019-12-03 The Broad Institute, Inc. Crispr enzyme mutations reducing off-target effects
US10526589B2 (en) 2013-03-15 2020-01-07 The General Hospital Corporation Multiplex guide RNAs
US10544405B2 (en) 2013-01-16 2020-01-28 Emory University Cas9-nucleic acid complexes and uses related thereto
US10550372B2 (en) 2013-12-12 2020-02-04 The Broad Institute, Inc. Systems, methods and compositions for sequence manipulation with optimized functional CRISPR-Cas systems
US10577630B2 (en) 2013-06-17 2020-03-03 The Broad Institute, Inc. Delivery and use of the CRISPR-Cas systems, vectors and compositions for hepatic targeting and therapy
US10640789B2 (en) 2013-06-04 2020-05-05 President And Fellows Of Harvard College RNA-guided transcriptional regulation
US10696986B2 (en) 2014-12-12 2020-06-30 The Board Institute, Inc. Protected guide RNAS (PGRNAS)
US10711285B2 (en) 2013-06-17 2020-07-14 The Broad Institute, Inc. Optimized CRISPR-Cas double nickase systems, methods and compositions for sequence manipulation
WO2020163396A1 (en) 2019-02-04 2020-08-13 The General Hospital Corporation Adenine dna base editor variants with reduced off-target rna editing
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US10767175B2 (en) 2016-06-08 2020-09-08 Agilent Technologies, Inc. High specificity genome editing using chemically modified guide RNAs
US10781444B2 (en) 2013-06-17 2020-09-22 The Broad Institute, Inc. Functional genomics using CRISPR-Cas systems, compositions, methods, screens and applications thereof
US10851357B2 (en) 2013-12-12 2020-12-01 The Broad Institute, Inc. Compositions and methods of use of CRISPR-Cas systems in nucleotide repeat disorders
US10851380B2 (en) 2012-10-23 2020-12-01 Toolgen Incorporated Methods for cleaving a target DNA using a guide RNA specific for the target DNA and Cas protein-encoding nucleic acid or Cas protein
US10912797B2 (en) 2016-10-18 2021-02-09 Intima Bioscience, Inc. Tumor infiltrating lymphocytes and methods of therapy
US10930367B2 (en) 2012-12-12 2021-02-23 The Broad Institute, Inc. Methods, models, systems, and apparatus for identifying target sequences for Cas enzymes or CRISPR-Cas systems for target sequences and conveying results thereof
US10946108B2 (en) 2013-06-17 2021-03-16 The Broad Institute, Inc. Delivery, use and therapeutic applications of the CRISPR-Cas systems and compositions for targeting disorders and diseases using viral components
US11008588B2 (en) 2013-06-17 2021-05-18 The Broad Institute, Inc. Delivery, engineering and optimization of tandem guide systems, methods and compositions for sequence manipulation
US11021719B2 (en) 2017-07-31 2021-06-01 Regeneron Pharmaceuticals, Inc. Methods and compositions for assessing CRISPER/Cas-mediated disruption or excision and CRISPR/Cas-induced recombination with an exogenous donor nucleic acid in vivo
WO2021105191A1 (en) 2019-11-29 2021-06-03 Basf Se Increasing resistance against fungal infections in plants
US11028388B2 (en) 2014-03-05 2021-06-08 Editas Medicine, Inc. CRISPR/Cas-related methods and compositions for treating Usher syndrome and retinitis pigmentosa
US11041173B2 (en) 2012-12-12 2021-06-22 The Broad Institute, Inc. Delivery, engineering and optimization of systems, methods and compositions for sequence manipulation and therapeutic applications
WO2021122528A1 (en) 2019-12-20 2021-06-24 Basf Se Decreasing toxicity of terpenes and increasing the production potential in micro-organisms
WO2021122687A1 (en) 2019-12-19 2021-06-24 Basf Se Increasing space-time-yield, carbon-conversion-efficiency and carbon substrate flexibility in the production of fine chemicals
US11046952B2 (en) * 2015-03-16 2021-06-29 The Broad Institute, Inc. Encoding of DNA vector identity via iterative hybridization detection of a barcode transcript
US11046954B2 (en) 2015-08-06 2021-06-29 Dana-Farber Cancer Institute, Inc. Targeted protein degradation to attenuate adoptive T-cell therapy associated adverse inflammatory responses
US20210207165A1 (en) * 2013-03-15 2021-07-08 Sigma-Aldrich Co. Llc Crispr-based genome modification and regulation
US11098325B2 (en) 2017-06-30 2021-08-24 Intima Bioscience, Inc. Adeno-associated viral vectors for gene therapy
US11111521B2 (en) 2011-12-22 2021-09-07 President And Fellows Of Harvard College Compositions and methods for analyte detection
US11130999B2 (en) 2017-07-31 2021-09-28 Regeneron Pharmaceuticals, Inc. Cas-ready mouse embryonic stem cells and mice and uses thereof
WO2021202938A1 (en) 2020-04-03 2021-10-07 Creyon Bio, Inc. Oligonucleotide-based machine learning
US11141493B2 (en) 2014-03-10 2021-10-12 Editas Medicine, Inc. Compositions and methods for treating CEP290-associated disease
US11149267B2 (en) 2013-10-28 2021-10-19 The Broad Institute, Inc. Functional genomics using CRISPR-Cas systems, compositions, methods, screens and applications thereof
US11155795B2 (en) 2013-12-12 2021-10-26 The Broad Institute, Inc. CRISPR-Cas systems, crystal structure and uses thereof
US11180793B2 (en) 2015-04-24 2021-11-23 Editas Medicine, Inc. Evaluation of Cas9 molecule/guide RNA molecule complexes
US11236313B2 (en) 2016-04-13 2022-02-01 Editas Medicine, Inc. Cas9 fusion molecules, gene editing systems, and methods of use thereof
US11242525B2 (en) 2014-03-26 2022-02-08 Editas Medicine, Inc. CRISPR/CAS-related methods and compositions for treating sickle cell disease
US11248240B2 (en) * 2015-01-29 2022-02-15 Meiogenix Method for inducing targeted meiotic recombinations
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11299767B2 (en) 2013-03-12 2022-04-12 President And Fellows Of Harvard College Method for generating a three-dimensional nucleic acid containing matrix
US11306309B2 (en) 2015-04-06 2022-04-19 The Board Of Trustees Of The Leland Stanford Junior University Chemically modified guide RNAs for CRISPR/CAS-mediated gene regulation
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11311609B2 (en) 2017-02-08 2022-04-26 Dana-Farber Cancer Institute, Inc. Regulating chimeric antigen receptors
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
EP3998344A1 (en) * 2014-10-09 2022-05-18 Life Technologies Corporation Crispr oligonucleotides and gene editing
US11339437B2 (en) 2014-03-10 2022-05-24 Editas Medicine, Inc. Compositions and methods for treating CEP290-associated disease
US11384360B2 (en) 2012-06-19 2022-07-12 Regents Of The University Of Minnesota Gene targeting in plants using DNA viruses
US11390884B2 (en) 2015-05-11 2022-07-19 Editas Medicine, Inc. Optimized CRISPR/cas9 systems and methods for gene editing in stem cells
US11407985B2 (en) 2013-12-12 2022-08-09 The Broad Institute, Inc. Delivery, use and therapeutic applications of the CRISPR-Cas systems and compositions for genome editing
US11434491B2 (en) 2018-04-19 2022-09-06 The Regents Of The University Of California Compositions and methods for gene editing
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11466271B2 (en) 2017-02-06 2022-10-11 Novartis Ag Compositions and methods for the treatment of hemoglobinopathies
WO2022216857A1 (en) * 2021-04-07 2022-10-13 Century Therapeutics, Inc. Gene transfer vectors and methods of engineering cells
US11499151B2 (en) 2017-04-28 2022-11-15 Editas Medicine, Inc. Methods and systems for analyzing guide RNA molecules
US11512341B1 (en) 2011-01-31 2022-11-29 Roche Sequencing Solutions, Inc. Methods of identifying multiple epitopes in cells
US11512311B2 (en) 2016-03-25 2022-11-29 Editas Medicine, Inc. Systems and methods for treating alpha 1-antitrypsin (A1AT) deficiency
US11535871B2 (en) * 2015-05-14 2022-12-27 University Of Southern California Optimized gene editing utilizing a recombinant endonuclease system
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11542554B2 (en) 2015-11-03 2023-01-03 President And Fellows Of Harvard College Method and apparatus for volumetric imaging
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11560585B2 (en) 2011-01-31 2023-01-24 Roche Sequencing Solutions, Inc. Methods of identifying multiple epitopes in cells
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11566263B2 (en) 2016-08-02 2023-01-31 Editas Medicine, Inc. Compositions and methods for treating CEP290 associated disease
US11578312B2 (en) 2015-06-18 2023-02-14 The Broad Institute Inc. Engineering and optimization of systems, methods, enzymes and guide scaffolds of CAS9 orthologs and variants for sequence manipulation
US11597924B2 (en) 2016-03-25 2023-03-07 Editas Medicine, Inc. Genome editing systems comprising repair-modulating enzyme molecules and methods of their use
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11667911B2 (en) 2015-09-24 2023-06-06 Editas Medicine, Inc. Use of exonucleases to improve CRISPR/CAS-mediated genome editing
US11680268B2 (en) 2014-11-07 2023-06-20 Editas Medicine, Inc. Methods for improving CRISPR/Cas-mediated genome-editing
EP4198124A1 (en) 2021-12-15 2023-06-21 Versitech Limited Engineered cas9-nucleases and method of use thereof
US11713485B2 (en) 2016-04-25 2023-08-01 President And Fellows Of Harvard College Hybridization chain reaction methods for in situ molecular detection
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US11851690B2 (en) 2017-03-14 2023-12-26 Editas Medicine, Inc. Systems and methods for the treatment of hemoglobinopathies
US11866726B2 (en) 2017-07-14 2024-01-09 Editas Medicine, Inc. Systems and methods for targeted integration and genome editing and detection thereof using integrated priming sites
US11884915B2 (en) 2021-09-10 2024-01-30 Agilent Technologies, Inc. Guide RNAs with chemical modification for prime editing
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11911415B2 (en) 2015-06-09 2024-02-27 Editas Medicine, Inc. CRISPR/Cas-related methods and compositions for improving transplantation
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US11920128B2 (en) 2013-09-18 2024-03-05 Kymab Limited Methods, cells and organisms
US11963982B2 (en) 2017-05-10 2024-04-23 Editas Medicine, Inc. CRISPR/RNA-guided nuclease systems and methods
US12031132B2 (en) 2018-03-14 2024-07-09 Editas Medicine, Inc. Systems and methods for the treatment of hemoglobinopathies
US12058986B2 (en) 2017-04-20 2024-08-13 Egenesis, Inc. Method for generating a genetically modified pig with inactivated porcine endogenous retrovirus (PERV) elements
US12070022B2 (en) 2014-04-28 2024-08-27 Recombinetics, Inc. Methods for making genetic edits
US12098425B2 (en) 2021-04-08 2024-09-24 Readcoor, Llc Three-dimensional spatial molecular indexing

Families Citing this family (211)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008027558A2 (en) 2006-08-31 2008-03-06 Codon Devices, Inc. Iterative nucleic acid assembly using activation of vector-encoded traits
US9295965B2 (en) 2010-11-12 2016-03-29 Gen9, Inc. Methods and devices for nucleic acid synthesis
EP2637780B1 (en) 2010-11-12 2022-02-09 Gen9, Inc. Protein arrays and methods of using and making the same
US20130059296A1 (en) 2011-08-26 2013-03-07 Gen9, Inc. Compositions and Methods For High Fidelity Assembly of Nucleic Acids
US9637739B2 (en) * 2012-03-20 2017-05-02 Vilnius University RNA-directed DNA cleavage by the Cas9-crRNA complex
US9150853B2 (en) 2012-03-21 2015-10-06 Gen9, Inc. Methods for screening proteins using DNA encoded chemical libraries as templates for enzyme catalysis
CA2871505C (en) 2012-04-24 2021-10-12 Gen9, Inc. Methods for sorting nucleic acids and multiplexed preparative in vitro cloning
US20150191719A1 (en) 2012-06-25 2015-07-09 Gen9, Inc. Methods for Nucleic Acid Assembly and High Throughput Sequencing
BR112015019950B1 (en) 2013-02-20 2023-02-14 Regeneron Pharmaceuticals, Inc METHOD TO GENERATE MOUSE EMBRYONIC STEM CELL (ES) LINEAGE AND IN VITRO CULTURE
CN115261411A (en) 2013-04-04 2022-11-01 哈佛学院校长同事会 Therapeutic uses of genome editing with CRISPR/Cas systems
US11414695B2 (en) 2013-05-29 2022-08-16 Agilent Technologies, Inc. Nucleic acid enrichment using Cas9
WO2015006498A2 (en) 2013-07-09 2015-01-15 President And Fellows Of Harvard College Therapeutic uses of genome editing with crispr/cas systems
US20150044772A1 (en) * 2013-08-09 2015-02-12 Sage Labs, Inc. Crispr/cas system-based novel fusion protein and its applications in genome editing
BR112016003591A8 (en) 2013-08-22 2018-01-30 Du Pont soybean polymerase iii promoter and methods of use
EA037850B1 (en) 2013-08-29 2021-05-27 Тэмпл Юниверсити Оф Зе Коммонвэлс Систем Оф Хайе Эдьюкейшн Methods and compositions for rna-guided treatment of hiv infection
WO2015066119A1 (en) 2013-10-30 2015-05-07 North Carolina State University Compositions and methods related to a type-ii crispr-cas system in lactobacillus buchneri
US10787684B2 (en) * 2013-11-19 2020-09-29 President And Fellows Of Harvard College Large gene excision and insertion
ES2975317T3 (en) 2013-12-11 2024-07-04 Regeneron Pharma Methods and compositions for the targeted modification of a genome
US10787654B2 (en) 2014-01-24 2020-09-29 North Carolina State University Methods and compositions for sequence guiding Cas9 targeting
US11439712B2 (en) 2014-04-08 2022-09-13 North Carolina State University Methods and compositions for RNA-directed repression of transcription using CRISPR-associated genes
MX2016016133A (en) 2014-06-06 2017-08-04 Regeneron Pharma Methods and compositions for modifying a targeted locus.
DK3354732T3 (en) 2014-06-23 2020-04-06 Regeneron Pharma NUCLEASE MEDIATED DNA COLLECTION
EP3461885B1 (en) 2014-06-26 2021-10-20 Regeneron Pharmaceuticals, Inc. Methods and compositions for targeted genetic modifications and methods of use
WO2016007347A1 (en) 2014-07-11 2016-01-14 E. I. Du Pont De Nemours And Company Compositions and methods for producing plants resistant to glyphosate herbicide
US9970030B2 (en) * 2014-08-27 2018-05-15 Caribou Biosciences, Inc. Methods for increasing CAS9-mediated engineering efficiency
US10450584B2 (en) 2014-08-28 2019-10-22 North Carolina State University Cas9 proteins and guiding features for DNA targeting and genome editing
WO2016040594A1 (en) * 2014-09-10 2016-03-17 The Regents Of The University Of California Reconstruction of ancestral cells by enzymatic recording
EP3191595B1 (en) 2014-09-12 2019-12-25 E. I. du Pont de Nemours and Company Generation of site-specific-integration sites for complex trait loci in corn and soybean, and methods of use
WO2016065341A1 (en) 2014-10-24 2016-04-28 Avectas Limited Delivery across cell plasma membranes
GB201421096D0 (en) 2014-11-27 2015-01-14 Imp Innovations Ltd Genome editing methods
ES2760508T3 (en) 2014-12-19 2020-05-14 Regeneron Pharma Methods and compositions for targeted genetic modification through single-stage multiple transformation
US10196613B2 (en) 2014-12-19 2019-02-05 Regeneron Pharmaceuticals, Inc. Stem cells for modeling type 2 diabetes
EP3245232B1 (en) 2015-01-12 2021-04-21 The Regents of The University of California Heterodimeric cas9 and methods of use thereof
EP3250689B1 (en) 2015-01-28 2020-11-04 The Regents of The University of California Methods and compositions for labeling a single-stranded target nucleic acid
EP3274460A1 (en) 2015-03-27 2018-01-31 E. I. du Pont de Nemours and Company Soybean u6 small nuclear rna gene promoters and their use in constitutive expression of small rna genes in plants
US10968426B2 (en) 2015-05-08 2021-04-06 President And Fellows Of Harvard College Universal donor stem cells and related methods
EP3324999A1 (en) 2015-05-29 2018-05-30 Agenovir Corporation Compositions and methods for cell targeted hpv treatment
CN108026536A (en) 2015-05-29 2018-05-11 北卡罗来纳州立大学 Use the method for CRISPR nucleic acid screening bacterium, archeobacteria, algae and yeast
WO2016196655A1 (en) 2015-06-03 2016-12-08 The Regents Of The University Of California Cas9 variants and methods of use thereof
US20180296537A1 (en) 2015-06-05 2018-10-18 Novartis Ag Methods and compositions for diagnosing, treating, and monitoring treatment of shank3 deficiency associated disorders
EP4299754A3 (en) 2015-06-15 2024-03-20 North Carolina State University Methods and compositions for efficient delivery of nucleic acids and rna-based antimicrobials
US9790490B2 (en) 2015-06-18 2017-10-17 The Broad Institute Inc. CRISPR enzymes and systems
WO2016205749A1 (en) 2015-06-18 2016-12-22 The Broad Institute Inc. Novel crispr enzymes and systems
JP2018519811A (en) 2015-06-29 2018-07-26 アイオーニス ファーマシューティカルズ, インコーポレーテッドIonis Pharmaceuticals,Inc. Modified CRISPR RNA and modified single CRISPR RNA and uses thereof
CN108291218B (en) 2015-07-15 2022-08-19 新泽西鲁特格斯州立大学 Nuclease-independent targeted gene editing platform and application thereof
WO2017040511A1 (en) 2015-08-31 2017-03-09 Agilent Technologies, Inc. Compounds and methods for crispr/cas-based genome editing by homologous recombination
US20180251789A1 (en) * 2015-09-04 2018-09-06 Massachusetts Institute Of Technology Multilayer genetic safety kill circuits based on single cas9 protein and multiple engineered grna in mammalian cells
US11261439B2 (en) 2015-09-18 2022-03-01 President And Fellows Of Harvard College Methods of making guide RNA
EP3356533A1 (en) 2015-09-28 2018-08-08 North Carolina State University Methods and compositions for sequence specific antimicrobials
US10959413B2 (en) * 2015-10-08 2021-03-30 President And Fellows Of Harvard College Multiplexed genome editing
US11111508B2 (en) 2015-10-30 2021-09-07 Brandeis University Modified CAS9 compositions and methods of use
BR112018009515A2 (en) 2015-11-11 2018-11-06 Univ Minnesota biocontainment / biocontrol system and methods
US11905521B2 (en) 2015-11-17 2024-02-20 The Chinese University Of Hong Kong Methods and systems for targeted gene manipulation
AU2016355178B9 (en) 2015-11-19 2019-05-30 Massachusetts Institute Of Technology Lymphocyte antigen CD5-like (CD5L)-interleukin 12B (p40) heterodimers in immunity
WO2017112620A1 (en) 2015-12-22 2017-06-29 North Carolina State University Methods and compositions for delivery of crispr based antimicrobials
CA3009715A1 (en) 2015-12-30 2017-07-06 Avectas Limited Vector-free delivery of gene editing proteins and compositions to cells and tissues
CN105624187A (en) * 2016-02-17 2016-06-01 天津大学 Site-directed mutation method for genomes of saccharomyces cerevisiae
WO2017143071A1 (en) 2016-02-18 2017-08-24 The Regents Of The University Of California Methods and compositions for gene editing in stem cells
WO2017151444A1 (en) 2016-02-29 2017-09-08 Agilent Technologies, Inc. Methods and compositions for blocking off-target nucleic acids from cleavage by crispr proteins
JP2019515654A (en) 2016-03-16 2019-06-13 ザ ジェイ. デヴィッド グラッドストーン インスティテューツ Methods and compositions for treating obesity and / or diabetes, and methods and compositions for identifying candidate treatment agents
WO2017184768A1 (en) 2016-04-19 2017-10-26 The Broad Institute Inc. Novel crispr enzymes and systems
EP3445853A1 (en) 2016-04-19 2019-02-27 The Broad Institute, Inc. Cpf1 complexes with reduced indel activity
JP7324583B2 (en) 2016-05-20 2023-08-10 リジェネロン・ファーマシューティカルズ・インコーポレイテッド Methods for breaking immune tolerance using multiple guide RNAs
WO2017205540A1 (en) * 2016-05-24 2017-11-30 The Translational Genomics Research Institute Molecular tagging methods and sequencing libraries
EP3490562A4 (en) * 2016-07-27 2020-04-22 The Board of Trustees of the Leland Stanford Junior University Immolative cell-penetrating complexes for nucleic acid delivery
AU2017302657A1 (en) 2016-07-29 2019-02-14 Regeneron Pharmaceuticals, Inc. Mice comprising mutations resulting in expression of c-truncated fibrillin-1
EP3509645A4 (en) 2016-09-07 2020-06-17 Sangamo Therapeutics, Inc. Modulation of liver genes
US20190225974A1 (en) 2016-09-23 2019-07-25 BASF Agricultural Solutions Seed US LLC Targeted genome optimization in plants
CA3038960A1 (en) 2016-09-30 2018-04-05 The Regents Of The University Of California Rna-guided nucleic acid modifying enzymes and methods of use thereof
US10669539B2 (en) 2016-10-06 2020-06-02 Pioneer Biolabs, Llc Methods and compositions for generating CRISPR guide RNA libraries
WO2018093797A1 (en) 2016-11-15 2018-05-24 The Schepens Eye Research Institute, Inc. Compositions and methods for the treatment of aberrant angiogenesis
WO2018112278A1 (en) 2016-12-14 2018-06-21 Ligandal, Inc. Methods and compositions for nucleic acid and protein payload delivery
EP3559204B1 (en) 2016-12-22 2022-05-04 Avectas Limited Vector-free intracellular delivery by reversible permeabilisation
CN110520163A (en) 2017-01-05 2019-11-29 新泽西鲁特格斯州立大学 Independently of the target gene editing platform and application thereof of DNA double chain fracture
CN118325899A (en) 2017-01-23 2024-07-12 瑞泽恩制药公司 HSD17B13 variants and uses thereof
US20210115407A1 (en) 2017-04-12 2021-04-22 The Broad Institute, Inc. Respiratory and sweat gland ionocytes
US11913015B2 (en) 2017-04-17 2024-02-27 University Of Maryland, College Park Embryonic cell cultures and methods of using the same
WO2018195486A1 (en) 2017-04-21 2018-10-25 The Broad Institute, Inc. Targeted delivery to beta cells
WO2018204777A2 (en) 2017-05-05 2018-11-08 The Broad Institute, Inc. Methods for identification and modification of lncrna associated with target genotypes and phenotypes
US11834665B2 (en) 2017-05-10 2023-12-05 Regents Of The University Of Minnesota Programmable transcription factors and methods
WO2018226880A1 (en) 2017-06-06 2018-12-13 Zymergen Inc. A htp genomic engineering platform for improving escherichia coli
KR20200026878A (en) 2017-06-06 2020-03-11 지머젠 인코포레이티드 HTP Genome Engineering Platform to Improve Fungal Strains
EP3636754A4 (en) * 2017-06-07 2021-03-17 The University Of Tokyo Gene therapy for granular corneal dystrophy
KR20200018645A (en) 2017-06-15 2020-02-19 더 리전트 오브 더 유니버시티 오브 캘리포니아 Targeted non-viral DNA insertion
CA3065579A1 (en) 2017-07-31 2019-02-07 Regeneron Pharmaceuticals, Inc. Assessment of crispr/cas-induced recombination with an exogenous donor nucleic acid in vivo
MX2020003602A (en) 2017-09-29 2020-09-22 Intellia Therapeutics Inc Polynucleotides, compositions, and methods for genome editing.
MX2020007147A (en) 2017-09-29 2020-08-24 Intellia Therapeutics Inc In vitro method of mrna delivery using lipid nanoparticles.
WO2019067872A1 (en) 2017-09-29 2019-04-04 Intellia Therapeutics, Inc. Compositions and methods for ttr gene editing and treating attr amyloidosis
US20190098879A1 (en) 2017-09-29 2019-04-04 Regeneron Pharmaceuticals, Inc. Non-Human Animals Comprising A Humanized TTR Locus And Methods Of Use
RS65493B1 (en) 2017-09-29 2024-05-31 Intellia Therapeutics Inc Formulations
BR112020008201A2 (en) 2017-10-27 2020-10-06 The Regents Of The University Of California target replacement of endogenous t cell receptors
US11739326B2 (en) 2017-11-14 2023-08-29 Massachusetts Eye And Ear Infirmary RUNX1 inhibition for treatment of proliferative vitreoretinopathy and conditions associated with epithelial to mesenchymal transition
CA3086620A1 (en) 2018-01-12 2019-07-18 Basf Se Gene underlying the number of spikelets per spike qtl in wheat on chromosome 7a
US20190233816A1 (en) 2018-01-26 2019-08-01 Massachusetts Institute Of Technology Structure-guided chemical modification of guide rna and its applications
KR20200124702A (en) 2018-02-23 2020-11-03 파이어니어 하이 부렛드 인터내쇼날 인코포레이팃드 The novel CAS9 ortholog
AU2019239880B2 (en) 2018-03-19 2023-11-30 Regeneron Pharmaceuticals, Inc. Transcription modulation in animals using CRISPR/Cas systems
EP3794130A4 (en) 2018-05-16 2022-07-27 Synthego Corporation Methods and systems for guide rna design and use
EP3802779A1 (en) 2018-06-01 2021-04-14 Avectas Limited Cell engineering platform
CN112513270A (en) 2018-07-13 2021-03-16 加利福尼亚大学董事会 Retrotransposon-based delivery vehicles and methods of use thereof
CA3113190A1 (en) 2018-07-31 2020-02-06 Intellia Therapeutics, Inc. Compositions and methods for hydroxyacid oxidase 1 (hao1) gene editing for treating primary hyperoxaluria type 1 (ph1)
SG11202102068TA (en) 2018-07-31 2021-03-30 Broad Inst Inc Novel crispr enzymes and systems
CN110678553B (en) * 2018-08-21 2023-08-11 中国医学科学院血液病医院(中国医学科学院血液学研究所) Method for genome editing in mammalian stem cells
EP3856901A1 (en) 2018-09-28 2021-08-04 Intellia Therapeutics, Inc. Compositions and methods for lactate dehydrogenase (ldha) gene editing
WO2020072248A1 (en) 2018-10-01 2020-04-09 North Carolina State University Recombinant type i crispr-cas system
EP3867379A1 (en) 2018-10-16 2021-08-25 Intellia Therapeutics, Inc. Compositions and methods for immunotherapy
US11407995B1 (en) 2018-10-26 2022-08-09 Inari Agriculture Technology, Inc. RNA-guided nucleases and DNA binding proteins
KR20210088615A (en) 2018-10-31 2021-07-14 지머젠 인코포레이티드 Multiple deterministic assemblies of DNA libraries
JP2022505440A (en) * 2018-11-01 2022-01-14 キージーン ナムローゼ フェンノートシャップ Dual guide RNA for CRISPR / Cas genome editing in plant cells
US11434477B1 (en) 2018-11-02 2022-09-06 Inari Agriculture Technology, Inc. RNA-guided nucleases and DNA binding proteins
KR20200071198A (en) 2018-12-10 2020-06-19 네오이뮨텍, 인코퍼레이티드 Development of new adoptive T cell immunotherapy by modification of Nrf2 expression
WO2020123887A2 (en) 2018-12-14 2020-06-18 Pioneer Hi-Bred International, Inc. Novel crispr-cas systems for genome editing
CA3120799A1 (en) 2018-12-20 2020-06-25 Regeneron Pharmaceuticals, Inc. Nuclease-mediated repeat expansion
EP3911746A1 (en) 2019-01-14 2021-11-24 Institut National de la Santé et de la Recherche Médicale (INSERM) Methods and kits for generating and selecting a variant of a binding protein with increased binding affinity and/or specificity
US20220145330A1 (en) 2019-02-10 2022-05-12 The J. David Gladstone Institutes, a testamentary trust established under the Will of J. David Glads Modified mitochondrion and methods of use thereof
WO2020181101A1 (en) 2019-03-07 2020-09-10 The Regents Of The University Of California Crispr-cas effector polypeptides and methods of use thereof
US11053515B2 (en) 2019-03-08 2021-07-06 Zymergen Inc. Pooled genome editing in microbes
CN113728106A (en) 2019-03-08 2021-11-30 齐默尔根公司 Iterative genome editing in microorganisms
US11845931B2 (en) 2019-03-18 2023-12-19 Regeneron Pharmaceuticals, Inc. CRISPR/Cas screening platform to identify genetic modifiers of tau seeding or aggregation
KR102683424B1 (en) 2019-03-18 2024-07-10 리제너론 파마슈티칼스 인코포레이티드 CRISPR/Cas dropout screening platform to identify genetic vulnerabilities associated with tau aggregation
WO2020198697A1 (en) 2019-03-28 2020-10-01 Intellia Therapeutics, Inc. Compositions and methods comprising a ttr guide rna and a polynucleotide encoding an rna-guided dna binding agent
EP3946285A1 (en) 2019-03-28 2022-02-09 Intellia Therapeutics, Inc. Compositions and methods for ttr gene editing and treating attr amyloidosis comprising a corticosteroid or use thereof
KR20220004649A (en) 2019-03-28 2022-01-11 인텔리아 테라퓨틱스, 인크. Polynucleotides, compositions and methods for polypeptide expression
CA3133361A1 (en) 2019-04-03 2020-10-08 Regeneron Pharmaceuticals, Inc. Methods and compositions for insertion of antibody coding sequences into a safe harbor locus
IL286917B (en) 2019-04-04 2022-09-01 Regeneron Pharma Methods for scarless introduction of targeted modifications into targeting vectors
KR102661779B1 (en) 2019-04-04 2024-04-30 리제너론 파마슈티칼스 인코포레이티드 Non-human animals containing the humanized coagulation factor 12 locus
CA3137761A1 (en) 2019-06-04 2020-12-10 Regeneron Pharmaceuticals, Inc. Non-human animals comprising a humanized ttr locus with a beta-slip mutation and methods of use
IL288606B1 (en) 2019-06-07 2024-08-01 Regeneron Pharma Non-human animals comprising a humanized albumin locus
CN113906134A (en) 2019-06-14 2022-01-07 瑞泽恩制药公司 Model of TAU proteinopathy
EP4022057A1 (en) 2019-08-27 2022-07-06 Vertex Pharmaceuticals Incorporated Compositions and methods for treatment of disorders associated with repetitive dna
CN114616002A (en) 2019-09-13 2022-06-10 瑞泽恩制药公司 Transcriptional regulation in animals using CRISPR/CAS systems delivered by lipid nanoparticles
CA3151563A1 (en) 2019-09-20 2021-03-25 Feng Zhang Novel type vi crispr enzymes and systems
CA3156277A1 (en) 2019-11-08 2021-05-14 Regeneron Pharmaceuticals, Inc. Crispr and aav strategies for x-linked juvenile retinoschisis therapy
WO2021108363A1 (en) 2019-11-25 2021-06-03 Regeneron Pharmaceuticals, Inc. Crispr/cas-mediated upregulation of humanized ttr allele
US11060141B1 (en) 2019-12-23 2021-07-13 Stilla Technologies Multiplex drop-off digital polymerase chain reaction methods
TW202146030A (en) * 2020-02-07 2021-12-16 美商英特利亞醫療公司 Compositions and methods for kallikrein (klkb1) gene editing
KR20230004456A (en) 2020-03-04 2023-01-06 리제너론 파아마슈티컬스, 인크. Methods and compositions for sensitization of tumor cells to immunotherapy
WO2021191678A1 (en) 2020-03-23 2021-09-30 Avectas Limited Engineering of dendritic cells for generation of vaccines against sars-cov-2
WO2021195079A1 (en) 2020-03-23 2021-09-30 Regeneron Pharmaceuticals, Inc. Non-human animals comprising a humanized ttr locus comprising a v30m mutation and methods of use
CN115427566A (en) 2020-04-08 2022-12-02 阿斯利康(瑞典)有限公司 Compositions and methods for improved site-specific modification
KR20230017783A (en) 2020-04-28 2023-02-06 인텔리아 테라퓨틱스, 인크. In vitro cell delivery methods
WO2022008935A1 (en) 2020-07-10 2022-01-13 Horizon Discovery Limited Method for producing genetically modified cells
WO2022056000A1 (en) 2020-09-09 2022-03-17 Vertex Pharmaceuticals Incorporated Compositions and methods for treatment of duchenne muscular dystrophy
AU2021353004A1 (en) 2020-09-30 2023-04-13 Nobell Foods, Inc. Recombinant milk proteins and food compositions comprising the same
US10894812B1 (en) 2020-09-30 2021-01-19 Alpine Roads, Inc. Recombinant milk proteins
US10947552B1 (en) 2020-09-30 2021-03-16 Alpine Roads, Inc. Recombinant fusion proteins for producing milk proteins in plants
AU2021364781A1 (en) 2020-10-21 2023-06-01 Massachusetts Institute Of Technology Systems, methods, and compositions for site-specific genetic engineering using programmable addition via site-specific targeting elements (paste)
US20230414648A1 (en) 2020-11-06 2023-12-28 Vertex Pharmaceuticals Incorporated Compositions and Methods for Treatment of DM1 with SLUCAS9 and SACAS9
EP4256052A1 (en) 2020-12-02 2023-10-11 Decibel Therapeutics, Inc. Crispr sam biosensor cell lines and methods of use thereof
JP2023552816A (en) 2020-12-11 2023-12-19 インテリア セラピューティクス,インコーポレイテッド Compositions and methods for reducing intracellular MHC class II
CA3205042A1 (en) 2020-12-23 2022-06-30 Intellia Therapeutics, Inc. Compositions and methods for genetically modifying ciita in a cell
WO2022140586A2 (en) 2020-12-23 2022-06-30 Intellia Therapeutics, Inc. Compositions and methods for reducing hla-a in a cell
JP2024501757A (en) 2021-01-05 2024-01-15 ホライズン・ディスカバリー・リミテッド Method for producing genetically modified cells
US20240110144A1 (en) 2021-02-01 2024-04-04 Avectas Limited Delivery platform
CN117042794A (en) 2021-02-08 2023-11-10 因特利亚治疗公司 T cell immunoglobulin and mucin domain 3 (TIM 3) compositions and methods for immunotherapy
CN117042793A (en) 2021-02-08 2023-11-10 因特利亚治疗公司 Lymphocyte activating gene 3 (LAG 3) compositions and methods for immunotherapy
EP4288525A1 (en) 2021-02-08 2023-12-13 Intellia Therapeutics, Inc. Natural killer cell receptor 2b4 compositions and methods for immunotherapy
WO2022182957A1 (en) 2021-02-26 2022-09-01 Vertex Pharmaceuticals Incorporated Compositions and methods for treatment of myotonic dystrophy type 1 with crispr/sacas9
WO2022182959A1 (en) 2021-02-26 2022-09-01 Vertex Pharmaceuticals Incorporated Compositions and methods for treatment of myotonic dystrophy type 1 with crispr/slucas9
EP4320234A2 (en) 2021-04-07 2024-02-14 Astrazeneca AB Compositions and methods for site-specific modification
TW202308596A (en) 2021-04-17 2023-03-01 美商英特利亞醫療公司 Lipid nanoparticle compositions
EP4322920A1 (en) 2021-04-17 2024-02-21 Intellia Therapeutics, Inc. Lipid nanoparticle compositions
US20240300977A1 (en) 2021-04-17 2024-09-12 Intellia Therapeutics, Inc. Inhibitors of dna-dependent protein kinase and compositions and uses thereof
WO2022229851A1 (en) 2021-04-26 2022-11-03 Crispr Therapeutics Ag Compositions and methods for using slucas9 scaffold sequences
WO2022234519A1 (en) 2021-05-05 2022-11-10 Crispr Therapeutics Ag Compositions and methods for using sacas9 scaffold sequences
US20240247285A1 (en) 2021-05-10 2024-07-25 Sqz Biotechnologies Company Methods for delivering genome editing molecules to the nucleus or cytosol of a cell and uses thereof
WO2022251644A1 (en) 2021-05-28 2022-12-01 Lyell Immunopharma, Inc. Nr4a3-deficient immune cells and uses thereof
KR20240027676A (en) 2021-06-02 2024-03-04 라이엘 이뮤노파마, 인크. NR4A3-deficient immune cells and uses thereof
WO2023018637A1 (en) 2021-08-09 2023-02-16 Vertex Pharmaceuticals Incorporated Gene editing of regulatory elements
WO2023028471A1 (en) 2021-08-24 2023-03-02 Intellia Therapeutics, Inc. Programmed cell death protein 1 (pd1) compositions and methods for cell-based therapy
WO2023039444A2 (en) 2021-09-08 2023-03-16 Vertex Pharmaceuticals Incorporated Precise excisions of portions of exon 51 for treatment of duchenne muscular dystrophy
WO2023052508A2 (en) 2021-09-30 2023-04-06 Astrazeneca Ab Use of inhibitors to increase efficiency of crispr/cas insertions
KR20240099259A (en) 2021-10-14 2024-06-28 아스널 바이오사이언시스, 인크. Immune cells with co-expressed SHRNA and logic gate system
KR20240082391A (en) 2021-10-14 2024-06-10 론자 세일즈 아게 Modified producer cells for extracellular vesicle production
WO2023077053A2 (en) 2021-10-28 2023-05-04 Regeneron Pharmaceuticals, Inc. Crispr/cas-related methods and compositions for knocking out c5
AU2022375820A1 (en) 2021-11-01 2024-06-13 Tome Biosciences, Inc. Single construct platform for simultaneous delivery of gene editing machinery and nucleic acid cargo
CN118369110A (en) 2021-11-03 2024-07-19 英特利亚治疗股份有限公司 CD38 compositions and methods for immunotherapy
TW202325848A (en) 2021-11-03 2023-07-01 美商英特利亞醫療公司 Polynucleotides, compositions, and methods for genome editing
EP4426832A1 (en) 2021-11-03 2024-09-11 The J. David Gladstone Institutes, A Testamentary Trust Established under The Will of J. David Gladstone Precise genome editing using retrons
CN118632622A (en) 2021-12-08 2024-09-10 瑞泽恩制药公司 Mutant myofibrillar disease model and use thereof
WO2023122764A1 (en) 2021-12-22 2023-06-29 Tome Biosciences, Inc. Co-delivery of a gene editor construct and a donor template
KR20240128067A (en) 2021-12-29 2024-08-23 브리스톨-마이어스 스큅 컴퍼니 Generation of landing pad cell lines
WO2023141602A2 (en) 2022-01-21 2023-07-27 Renagade Therapeutics Management Inc. Engineered retrons and methods of use
WO2023150181A1 (en) 2022-02-01 2023-08-10 President And Fellows Of Harvard College Methods and compositions for treating cancer
IL314482A (en) 2022-02-02 2024-09-01 Regeneron Pharma Anti-tfr:gaa and anti-cd63:gaa insertions for treatment of pompe disease
WO2023172926A1 (en) 2022-03-08 2023-09-14 Vertex Pharmaceuticals Incorporated Precise excisions of portions of exons for treatment of duchenne muscular dystrophy
TW202345911A (en) 2022-03-08 2023-12-01 美商維泰克斯製藥公司 Precise excisions of portions of exon 44, 50, and 53 for treatment of duchenne muscular dystrophy
WO2023205744A1 (en) 2022-04-20 2023-10-26 Tome Biosciences, Inc. Programmable gene insertion compositions
WO2023212677A2 (en) 2022-04-29 2023-11-02 Regeneron Pharmaceuticals, Inc. Identification of tissue-specific extragenic safe harbors for gene therapy approaches
WO2023220603A1 (en) 2022-05-09 2023-11-16 Regeneron Pharmaceuticals, Inc. Vectors and methods for in vivo antibody production
WO2023225665A1 (en) 2022-05-19 2023-11-23 Lyell Immunopharma, Inc. Polynucleotides targeting nr4a3 and uses thereof
WO2023225670A2 (en) 2022-05-20 2023-11-23 Tome Biosciences, Inc. Ex vivo programmable gene insertion
WO2023235726A2 (en) 2022-05-31 2023-12-07 Regeneron Pharmaceuticals, Inc. Crispr interference therapeutics for c9orf72 repeat expansion disease
WO2023235725A2 (en) 2022-05-31 2023-12-07 Regeneron Pharmaceuticals, Inc. Crispr-based therapeutics for c9orf72 repeat expansion disease
WO2024020352A1 (en) 2022-07-18 2024-01-25 Vertex Pharmaceuticals Incorporated Tandem guide rnas (tg-rnas) and their use in genome editing
WO2024020346A2 (en) 2022-07-18 2024-01-25 Renagade Therapeutics Management Inc. Gene editing components, systems, and methods of use
WO2024020587A2 (en) 2022-07-22 2024-01-25 Tome Biosciences, Inc. Pleiopluripotent stem cell programmable gene insertion
WO2024026474A1 (en) 2022-07-29 2024-02-01 Regeneron Pharmaceuticals, Inc. Compositions and methods for transferrin receptor (tfr)-mediated delivery to the brain and muscle
WO2024031053A1 (en) 2022-08-05 2024-02-08 Regeneron Pharmaceuticals, Inc. Aggregation-resistant variants of tdp-43
WO2024044723A1 (en) 2022-08-25 2024-02-29 Renagade Therapeutics Management Inc. Engineered retrons and methods of use
WO2024064952A1 (en) 2022-09-23 2024-03-28 Lyell Immunopharma, Inc. Methods for culturing nr4a-deficient cells overexpressing c-jun
WO2024064958A1 (en) 2022-09-23 2024-03-28 Lyell Immunopharma, Inc. Methods for culturing nr4a-deficient cells
WO2024073606A1 (en) 2022-09-28 2024-04-04 Regeneron Pharmaceuticals, Inc. Antibody resistant modified receptors to enhance cell-based therapies
WO2024077174A1 (en) 2022-10-05 2024-04-11 Lyell Immunopharma, Inc. Methods for culturing nr4a-deficient cells
US20240182561A1 (en) 2022-11-04 2024-06-06 Regeneron Pharmaceuticals, Inc. Calcium voltage-gated channel auxiliary subunit gamma 1 (cacng1) binding proteins and cacng1-mediated delivery to skeletal muscle
WO2024102434A1 (en) 2022-11-10 2024-05-16 Senda Biosciences, Inc. Rna compositions comprising lipid nanoparticles or lipid reconstructed natural messenger packs
US20240173426A1 (en) 2022-11-14 2024-05-30 Regeneron Pharmaceuticals, Inc. Compositions and methods for fibroblast growth factor receptor 3-mediated delivery to astrocytes
WO2024137766A2 (en) 2022-12-21 2024-06-27 Intellia Therapeutics, Inc. Compositions and methods for proprotein convertase subtilisin kexin 9 (pcsk9) editing
WO2024138194A1 (en) 2022-12-22 2024-06-27 Tome Biosciences, Inc. Platforms, compositions, and methods for in vivo programmable gene insertion
WO2024159071A1 (en) 2023-01-27 2024-08-02 Regeneron Pharmaceuticals, Inc. Modified rhabdovirus glycoproteins and uses thereof
WO2024186890A1 (en) 2023-03-06 2024-09-12 Intellia Therapeutics, Inc. Compositions and methods for hepatitis b virus (hbv) genome editing
WO2024186971A1 (en) 2023-03-07 2024-09-12 Intellia Therapeutics, Inc. Cish compositions and methods for immunotherapy

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100076057A1 (en) * 2008-09-23 2010-03-25 Northwestern University TARGET DNA INTERFERENCE WITH crRNA
WO2013142578A1 (en) * 2012-03-20 2013-09-26 Vilnius University RNA-DIRECTED DNA CLEAVAGE BY THE Cas9-crRNA COMPLEX

Family Cites Families (48)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6039784A (en) 1997-03-12 2000-03-21 Hoeganaes Corporation Iron-based powder compositions containing green strength enhancing lubricants
EP1060261B1 (en) * 1998-03-02 2010-05-05 Massachusetts Institute of Technology Poly zinc finger proteins with improved linkers
US7090976B2 (en) 1999-11-10 2006-08-15 Rigel Pharmaceuticals, Inc. Methods and compositions comprising Renilla GFP
US6203986B1 (en) 1998-10-22 2001-03-20 Robert H. Singer Visualization of RNA in living cells
US6534261B1 (en) 1999-01-12 2003-03-18 Sangamo Biosciences, Inc. Regulation of endogenous gene expression in cells using zinc finger proteins
EP2927318B1 (en) 2003-08-08 2020-05-20 Sangamo Therapeutics, Inc. Methods and compositions for targeted cleavage and recombination
US20050220796A1 (en) 2004-03-31 2005-10-06 Dynan William S Compositions and methods for modulating DNA repair
US20050233994A1 (en) * 2004-04-16 2005-10-20 Ajamete Kaykas Methods and vectors for expressing siRNA
CA2961849C (en) 2005-08-26 2022-08-02 Dupont Nutrition Biosciences Aps Use of crispr associated genes (cas)
MX2009009071A (en) 2007-03-02 2009-09-24 Danisco Cultures with improved phage resistance.
WO2010011961A2 (en) 2008-07-25 2010-01-28 University Of Georgia Research Foundation, Inc. Prokaryotic rnai-like system and methods of use
US9404098B2 (en) 2008-11-06 2016-08-02 University Of Georgia Research Foundation, Inc. Method for cleaving a target RNA using a Cas6 polypeptide
WO2010114168A1 (en) 2009-03-31 2010-10-07 Sumitomo Metal Industries, Ltd. Threaded joint for pipes
US8889394B2 (en) 2009-09-07 2014-11-18 Empire Technology Development Llc Multiple domain proteins
US10087431B2 (en) 2010-03-10 2018-10-02 The Regents Of The University Of California Methods of generating nucleic acid fragments
MX2012013037A (en) 2010-05-10 2013-07-29 Univ California Endoribonuclease compositions and methods of use thereof.
JP6208580B2 (en) 2010-05-17 2017-10-04 サンガモ セラピューティクス, インコーポレイテッド Novel DNA binding protein and use thereof
CA2805442C (en) 2010-07-21 2020-05-12 Sangamo Biosciences, Inc. Methods and compositions for modification of an hla locus
US20140113376A1 (en) * 2011-06-01 2014-04-24 Rotem Sorek Compositions and methods for downregulating prokaryotic genes
GB201122458D0 (en) 2011-12-30 2012-02-08 Univ Wageningen Modified cascade ribonucleoproteins and uses thereof
EP3272356A1 (en) 2012-02-24 2018-01-24 Fred Hutchinson Cancer Research Center Compositions and methods for the treatment of hemoglobinopathies
WO2013130824A1 (en) 2012-02-29 2013-09-06 Sangamo Biosciences, Inc. Methods and compositions for treating huntington's disease
WO2013141680A1 (en) 2012-03-20 2013-09-26 Vilnius University RNA-DIRECTED DNA CLEAVAGE BY THE Cas9-crRNA COMPLEX
DK2800811T3 (en) * 2012-05-25 2017-07-17 Univ Vienna METHODS AND COMPOSITIONS FOR RNA DIRECTIVE TARGET DNA MODIFICATION AND FOR RNA DIRECTIVE MODULATION OF TRANSCRIPTION
EP2880171B1 (en) 2012-08-03 2018-10-03 The Regents of The University of California Methods and compositions for controlling gene expression by rna processing
DE202013012610U1 (en) 2012-10-23 2017-11-24 Toolgen, Inc. A composition for cleaving a target DNA comprising a guide RNA specific for the target DNA and a Cas protein-encoding nucleic acid or Cas protein, and their use
WO2014089290A1 (en) * 2012-12-06 2014-06-12 Sigma-Aldrich Co. Llc Crispr-based genome modification and regulation
US8993233B2 (en) * 2012-12-12 2015-03-31 The Broad Institute Inc. Engineering and optimization of systems, methods and compositions for sequence manipulation with functional domains
DK2921557T3 (en) 2012-12-12 2016-11-07 Broad Inst Inc Design of systems, methods and optimized sequence manipulation guide compositions
AU2013359212B2 (en) 2012-12-12 2017-01-19 Massachusetts Institute Of Technology Engineering and optimization of improved systems, methods and enzyme compositions for sequence manipulation
US8697359B1 (en) 2012-12-12 2014-04-15 The Broad Institute, Inc. CRISPR-Cas systems and methods for altering expression of gene products
ES2658401T3 (en) 2012-12-12 2018-03-09 The Broad Institute, Inc. Supply, modification and optimization of systems, methods and compositions for the manipulation of sequences and therapeutic applications
US20140310830A1 (en) * 2012-12-12 2014-10-16 Feng Zhang CRISPR-Cas Nickase Systems, Methods And Compositions For Sequence Manipulation in Eukaryotes
ES2598115T3 (en) 2012-12-12 2017-01-25 The Broad Institute, Inc. Systems engineering, methods and guide compositions optimized for sequence manipulation
EP3825401A1 (en) * 2012-12-12 2021-05-26 The Broad Institute, Inc. Crispr-cas component systems, methods and compositions for sequence manipulation
MY170059A (en) 2012-12-17 2019-07-02 Harvard College Rna-guided human genome engineering
NZ712727A (en) 2013-03-14 2017-05-26 Caribou Biosciences Inc Compositions and methods of nucleic acid-targeting nucleic acids
KR102512979B1 (en) * 2013-06-04 2023-03-22 프레지던트 앤드 펠로우즈 오브 하바드 칼리지 Rna-guideded transcriptional regulation
US9267135B2 (en) 2013-06-04 2016-02-23 President And Fellows Of Harvard College RNA-guided transcriptional regulation
AU2014281027A1 (en) * 2013-06-17 2016-01-28 Massachusetts Institute Of Technology Optimized CRISPR-Cas double nickase systems, methods and compositions for sequence manipulation
CN116042726A (en) * 2013-07-09 2023-05-02 哈佛大学校长及研究员协会 Multiplex RNA guided genome engineering
SG11201600060VA (en) * 2013-07-10 2016-02-26 Harvard College Orthogonal cas9 proteins for rna-guided gene regulation and editing
US10563225B2 (en) 2013-07-26 2020-02-18 President And Fellows Of Harvard College Genome engineering
US10787684B2 (en) * 2013-11-19 2020-09-29 President And Fellows Of Harvard College Large gene excision and insertion
WO2015089473A1 (en) 2013-12-12 2015-06-18 The Broad Institute Inc. Engineering of systems, methods and optimized guide compositions with new architectures for sequence manipulation
WO2015105928A1 (en) * 2014-01-08 2015-07-16 President And Fellows Of Harvard College Rna-guided gene drives
US10959413B2 (en) * 2015-10-08 2021-03-30 President And Fellows Of Harvard College Multiplexed genome editing
US11746349B2 (en) * 2016-02-09 2023-09-05 President And Fellows Of Harvard College DNA-guided gene editing and regulation

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100076057A1 (en) * 2008-09-23 2010-03-25 Northwestern University TARGET DNA INTERFERENCE WITH crRNA
WO2013142578A1 (en) * 2012-03-20 2013-09-26 Vilnius University RNA-DIRECTED DNA CLEAVAGE BY THE Cas9-crRNA COMPLEX

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
HATOUM-ASLAN ET AL.: "Mature clustered, regularly interspaced, short palindromic repeats RNA (crRNA) length is measured by a ruler mechanism anchored at the precursor processing site.", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 108, no. 52, December 2011 (2011-12-01), pages 21218 - 21222, XP055250498 *
JINEK ET AL.: "A Programmable Dual-RNA-Guided DNA Endonuclease in Adaptive Bacterial Immunity.", SCIENCE, vol. 337, no. 6096, 17 August 2012 (2012-08-17), pages 816 - 821, XP055229606 *
JINEK ET AL.: "RNA-programmed genome editing in human cells.", ELIFE, vol. 2, 2013, pages E00471., XP055245475, Retrieved from the Internet <URL:http//:elife.elifesciences.org/content/2/e00471> [retrieved on 20140306] *
RHO ET AL.: "Diverse CRISPRs Evolving in Human Microbiomes.", PLOS GENETICS., vol. 8, no. 6, June 2012 (2012-06-01), pages 1 - 12, XP055255388 *

Cited By (421)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11708599B2 (en) 2011-01-31 2023-07-25 Roche Sequencing Solutions, Inc. Methods of identifying multiple epitopes in cells
US11932902B2 (en) 2011-01-31 2024-03-19 Roche Sequencing Solutions, Inc. Barcoded beads and method for making the same by split-pool synthesis
US11732290B2 (en) 2011-01-31 2023-08-22 Roche Sequencing Solutions, Inc. Methods of identifying multiple epitopes in cells
US11781171B1 (en) 2011-01-31 2023-10-10 Roche Sequencing Solutions, Inc. Methods of identifying multiple epitopes in cells
US11566278B2 (en) 2011-01-31 2023-01-31 Roche Sequencing Solutions, Inc. Methods of identifying multiple epitopes in cells
US11634752B2 (en) 2011-01-31 2023-04-25 Roche Sequencing Solutions, Inc. Kit for split-pool barcoding target molecules that are in or on cells or cell organelles
US11667956B2 (en) 2011-01-31 2023-06-06 Roche Sequencing Solutions, Inc. Methods of identifying multiple epitopes in cells
US11692214B2 (en) 2011-01-31 2023-07-04 Roche Sequencing Solutions, Inc. Barcoded beads and method for making the same by split-pool synthesis
US11939624B2 (en) 2011-01-31 2024-03-26 Roche Sequencing Solutions, Inc. Method for labeling ligation products with cell-specific barcodes II
US12065690B2 (en) 2011-01-31 2024-08-20 Roche Sequencing Solutions, Inc. Methods of identifying multiple epitopes in cells
US11560585B2 (en) 2011-01-31 2023-01-24 Roche Sequencing Solutions, Inc. Methods of identifying multiple epitopes in cells
US11859240B2 (en) 2011-01-31 2024-01-02 Roche Sequencing Solutions, Inc. Methods of identifying multiple epitopes in cells
US11926864B1 (en) 2011-01-31 2024-03-12 Roche Sequencing Solutions, Inc. Method for labeling ligation products with cell-specific barcodes I
US11512341B1 (en) 2011-01-31 2022-11-29 Roche Sequencing Solutions, Inc. Methods of identifying multiple epitopes in cells
US11932903B2 (en) 2011-01-31 2024-03-19 Roche Sequencing Solutions, Inc. Kit for split-pool barcoding target molecules that are in or on cells or cell organelles
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US9322006B2 (en) 2011-07-22 2016-04-26 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US12006520B2 (en) 2011-07-22 2024-06-11 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US11566276B2 (en) 2011-12-22 2023-01-31 President And Fellows Of Harvard College Compositions and methods for analyte detection
US11549136B2 (en) 2011-12-22 2023-01-10 President And Fellows Of Harvard College Compositions and methods for analyte detection
US11293052B2 (en) 2011-12-22 2022-04-05 President And Fellows Of Harvard College Compositions and methods for analyte detection
US11976318B2 (en) 2011-12-22 2024-05-07 President And Fellows Of Harvard College Compositions and methods for analyte detection
US11293051B2 (en) 2011-12-22 2022-04-05 President And Fellows Of Harvard College Compositions and methods for analyte detection
US11111521B2 (en) 2011-12-22 2021-09-07 President And Fellows Of Harvard College Compositions and methods for analyte detection
US11639518B2 (en) 2011-12-22 2023-05-02 President And Fellows Of Harvard College Compositions and methods for analyte detection
US11566277B2 (en) 2011-12-22 2023-01-31 President And Fellows Of Harvard College Compositions and methods for analyte detection
US10435678B2 (en) 2011-12-30 2019-10-08 Caribou Biosciences, Inc. Modified cascade ribonucleoproteins and uses thereof
US11939604B2 (en) 2011-12-30 2024-03-26 Caribou Biosciences, Inc. Modified cascade ribonucleoproteins and uses thereof
US9885026B2 (en) 2011-12-30 2018-02-06 Caribou Biosciences, Inc. Modified cascade ribonucleoproteins and uses thereof
US10711257B2 (en) 2011-12-30 2020-07-14 Caribou Biosciences, Inc. Modified cascade ribonucleoproteins and uses thereof
US10954498B2 (en) 2011-12-30 2021-03-23 Caribou Biosciences, Inc. Modified cascade ribonucleoproteins and uses thereof
US9834786B2 (en) 2012-04-25 2017-12-05 Regeneron Pharmaceuticals, Inc. Nuclease-mediated targeting with large targeting vectors
US10301646B2 (en) 2012-04-25 2019-05-28 Regeneron Pharmaceuticals, Inc. Nuclease-mediated targeting with large targeting vectors
US10358659B2 (en) 2012-05-25 2019-07-23 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11008590B2 (en) 2012-05-25 2021-05-18 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10533190B2 (en) 2012-05-25 2020-01-14 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11814645B2 (en) 2012-05-25 2023-11-14 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
EP3597749A1 (en) * 2012-05-25 2020-01-22 The Regents of The University of California Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription
US10550407B2 (en) 2012-05-25 2020-02-04 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10428352B2 (en) 2012-05-25 2019-10-01 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
AU2017225060B2 (en) * 2012-05-25 2019-01-17 Emmanuelle CHARPENTIER Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10421980B2 (en) 2012-05-25 2019-09-24 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10415061B2 (en) 2012-05-25 2019-09-17 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10407697B2 (en) 2012-05-25 2019-09-10 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10400253B2 (en) 2012-05-25 2019-09-03 The Regents Of The University Of California Methods and compositions or RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10612045B2 (en) 2012-05-25 2020-04-07 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10385360B2 (en) 2012-05-25 2019-08-20 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
EP3597749B1 (en) 2012-05-25 2023-07-26 The Regents of The University of California Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription
US10982230B2 (en) 2012-05-25 2021-04-20 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10982231B2 (en) 2012-05-25 2021-04-20 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10676759B2 (en) 2012-05-25 2020-06-09 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
EP2800811B1 (en) 2012-05-25 2017-05-10 The Regents of The University of California Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription
US10563227B2 (en) 2012-05-25 2020-02-18 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
AU2013266968B2 (en) * 2012-05-25 2017-06-29 Emmanuelle CHARPENTIER Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10988780B2 (en) 2012-05-25 2021-04-27 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10358658B2 (en) 2012-05-25 2019-07-23 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11674159B2 (en) 2012-05-25 2023-06-13 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10669560B2 (en) 2012-05-25 2020-06-02 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10443076B2 (en) 2012-05-25 2019-10-15 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10752920B2 (en) 2012-05-25 2020-08-25 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10988782B2 (en) 2012-05-25 2021-04-27 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
EP3241902A1 (en) * 2012-05-25 2017-11-08 The Regents of The University of California Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription
US10351878B2 (en) 2012-05-25 2019-07-16 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10526619B2 (en) 2012-05-25 2020-01-07 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11001863B2 (en) 2012-05-25 2021-05-11 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11008589B2 (en) 2012-05-25 2021-05-18 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11634730B2 (en) 2012-05-25 2023-04-25 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10570419B2 (en) 2012-05-25 2020-02-25 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10900054B2 (en) 2012-05-25 2021-01-26 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
EP2800811A4 (en) * 2012-05-25 2015-09-23 Univ California Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription
US10519467B2 (en) 2012-05-25 2019-12-31 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
EP3241902B1 (en) 2012-05-25 2018-02-28 The Regents of The University of California Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription
US10337029B2 (en) 2012-05-25 2019-07-02 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10640791B2 (en) 2012-05-25 2020-05-05 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11293034B2 (en) 2012-05-25 2022-04-05 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10577631B2 (en) 2012-05-25 2020-03-03 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11549127B2 (en) 2012-05-25 2023-01-10 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10513712B2 (en) 2012-05-25 2019-12-24 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10000772B2 (en) 2012-05-25 2018-06-19 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10626419B2 (en) 2012-05-25 2020-04-21 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10308961B2 (en) 2012-05-25 2019-06-04 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10597680B2 (en) 2012-05-25 2020-03-24 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11479794B2 (en) 2012-05-25 2022-10-25 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11473108B2 (en) 2012-05-25 2022-10-18 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10301651B2 (en) 2012-05-25 2019-05-28 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10793878B1 (en) 2012-05-25 2020-10-06 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11028412B2 (en) 2012-05-25 2021-06-08 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11401532B2 (en) 2012-05-25 2022-08-02 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10487341B2 (en) 2012-05-25 2019-11-26 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10266850B2 (en) 2012-05-25 2019-04-23 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10774344B1 (en) 2012-05-25 2020-09-15 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10113167B2 (en) 2012-05-25 2018-10-30 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
EP3401400B1 (en) 2012-05-25 2019-04-03 The Regents of The University of California Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription
US11332761B2 (en) 2012-05-25 2022-05-17 The Regenis of Wie University of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11186849B2 (en) 2012-05-25 2021-11-30 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
EP3401400A1 (en) * 2012-05-25 2018-11-14 The Regents of The University of California Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription
US11242543B2 (en) 2012-05-25 2022-02-08 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US10227611B2 (en) 2012-05-25 2019-03-12 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11274318B2 (en) 2012-05-25 2022-03-15 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11970711B2 (en) 2012-05-25 2024-04-30 The Regents Of The University Of California Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
US11384360B2 (en) 2012-06-19 2022-07-12 Regents Of The University Of Minnesota Gene targeting in plants using DNA viruses
US10851380B2 (en) 2012-10-23 2020-12-01 Toolgen Incorporated Methods for cleaving a target DNA using a guide RNA specific for the target DNA and Cas protein-encoding nucleic acid or Cas protein
EP3138910A1 (en) * 2012-12-06 2017-03-08 Sigma-Aldrich Co. LLC Crispr-based genome modification and regulation
EP2928496A4 (en) * 2012-12-06 2017-03-01 Sigma-Aldrich Co. LLC Crispr-based genome modification and regulation
EP3611263A1 (en) * 2012-12-06 2020-02-19 Sigma Aldrich Co. LLC Crispr-based genome modification and regulation
US10731181B2 (en) 2012-12-06 2020-08-04 Sigma, Aldrich Co. LLC CRISPR-based genome modification and regulation
US10745716B2 (en) 2012-12-06 2020-08-18 Sigma-Aldrich Co. Llc CRISPR-based genome modification and regulation
EP3135765A1 (en) * 2012-12-06 2017-03-01 Sigma-Aldrich Co. LLC Crispr-based genome modification and regulation
EP3138911A1 (en) * 2012-12-06 2017-03-08 Sigma-Aldrich Co. LLC Crispr-based genome modification and regulation
EP3138909A1 (en) * 2012-12-06 2017-03-08 Sigma-Aldrich Co. LLC Crispr-based genome modification and regulation
EP3138912A1 (en) * 2012-12-06 2017-03-08 Sigma-Aldrich Co. LLC Crispr-based genome modification and regulation
EP3141604A1 (en) * 2012-12-06 2017-03-15 Sigma-Aldrich Co. LLC Crispr-based genome modification and regulation
EP3360964A1 (en) * 2012-12-06 2018-08-15 Sigma Aldrich Co. LLC Crispr-based genome modification and regulation
EP3363902A1 (en) * 2012-12-06 2018-08-22 Sigma Aldrich Co. LLC Crispr-based genome modification and regulation
EP2784162B1 (en) 2012-12-12 2015-04-08 The Broad Institute, Inc. Engineering of systems, methods and optimized guide compositions for sequence manipulation
US8889418B2 (en) 2012-12-12 2014-11-18 The Broad Institute Inc. Engineering and optimization of improved systems, methods and enzyme compositions for sequence manipulation
US8865406B2 (en) 2012-12-12 2014-10-21 The Broad Institute Inc. Engineering and optimization of improved systems, methods and enzyme compositions for sequence manipulation
US8999641B2 (en) 2012-12-12 2015-04-07 The Broad Institute Inc. Engineering and optimization of systems, methods and compositions for sequence manipulation with functional domains
US10930367B2 (en) 2012-12-12 2021-02-23 The Broad Institute, Inc. Methods, models, systems, and apparatus for identifying target sequences for Cas enzymes or CRISPR-Cas systems for target sequences and conveying results thereof
US8889356B2 (en) 2012-12-12 2014-11-18 The Broad Institute Inc. CRISPR-Cas nickase systems, methods and compositions for sequence manipulation in eukaryotes
EP2896697B1 (en) 2012-12-12 2015-09-02 The Broad Institute, Inc. Engineering of systems, methods and optimized guide compositions for sequence manipulation
EP2764103B1 (en) 2012-12-12 2015-08-19 The Broad Institute, Inc. Crispr-cas systems and methods for altering expression of gene products
US8932814B2 (en) 2012-12-12 2015-01-13 The Broad Institute Inc. CRISPR-Cas nickase systems, methods and compositions for sequence manipulation in eukaryotes
US8871445B2 (en) 2012-12-12 2014-10-28 The Broad Institute Inc. CRISPR-Cas component systems, methods and compositions for sequence manipulation
US11041173B2 (en) 2012-12-12 2021-06-22 The Broad Institute, Inc. Delivery, engineering and optimization of systems, methods and compositions for sequence manipulation and therapeutic applications
US8895308B1 (en) 2012-12-12 2014-11-25 The Broad Institute Inc. Engineering and optimization of improved systems, methods and enzyme compositions for sequence manipulation
US8906616B2 (en) 2012-12-12 2014-12-09 The Broad Institute Inc. Engineering of systems, methods and optimized guide compositions for sequence manipulation
US9840713B2 (en) 2012-12-12 2017-12-12 The Broad Institute Inc. CRISPR-Cas component systems, methods and compositions for sequence manipulation
US9822372B2 (en) 2012-12-12 2017-11-21 The Broad Institute Inc. CRISPR-Cas component systems, methods and compositions for sequence manipulation
US8993233B2 (en) 2012-12-12 2015-03-31 The Broad Institute Inc. Engineering and optimization of systems, methods and compositions for sequence manipulation with functional domains
US8945839B2 (en) 2012-12-12 2015-02-03 The Broad Institute Inc. CRISPR-Cas systems and methods for altering expression of gene products
EP2825654B1 (en) 2012-12-12 2017-04-26 The Broad Institute, Inc. Crispr-cas component systems, methods and compositions for sequence manipulation
US11535863B2 (en) 2012-12-17 2022-12-27 President And Fellows Of Harvard College RNA-guided human genome engineering
US11359211B2 (en) 2012-12-17 2022-06-14 President And Fellows Of Harvard College RNA-guided human genome engineering
EP2931891B1 (en) 2012-12-17 2019-05-15 President and Fellows of Harvard College Rna-guided human genome engineering
US12018272B2 (en) 2012-12-17 2024-06-25 President And Fellows Of Harvard College RNA-guided human genome engineering
US11236359B2 (en) 2012-12-17 2022-02-01 President And Fellows Of Harvard College RNA-guided human genome engineering
US11512325B2 (en) 2012-12-17 2022-11-29 President And Fellows Of Harvard College RNA-guided human genome engineering
US11365429B2 (en) 2012-12-17 2022-06-21 President And Fellows Of Harvard College RNA-guided human genome engineering
US11312945B2 (en) 2013-01-16 2022-04-26 Emory University CAS9-nucleic acid complexes and uses related thereto
US10544405B2 (en) 2013-01-16 2020-01-28 Emory University Cas9-nucleic acid complexes and uses related thereto
US11299767B2 (en) 2013-03-12 2022-04-12 President And Fellows Of Harvard College Method for generating a three-dimensional nucleic acid containing matrix
US10125361B2 (en) 2013-03-14 2018-11-13 Caribou Biosciences, Inc. Compositions and methods of nucleic acid-targeting nucleic acids
US9909122B2 (en) 2013-03-14 2018-03-06 Caribou Biosciences, Inc. Compositions and methods of nucleic acid-targeting nucleic acids
US9809814B1 (en) 2013-03-14 2017-11-07 Caribou Biosciences, Inc. Compositions and methods of nucleic acid-targeting nucleic acids
US9725714B2 (en) 2013-03-14 2017-08-08 Caribou Biosciences, Inc. Compositions and methods of nucleic acid-targeting nucleic acids
US9803194B2 (en) 2013-03-14 2017-10-31 Caribou Biosciences, Inc. Compositions and methods of nucleic acid-targeting nucleic acids
US9410198B2 (en) 2013-03-14 2016-08-09 Caribou Biosciences, Inc. Compostions and methods of nucleic acid-targeting nucleic acids
US11312953B2 (en) 2013-03-14 2022-04-26 Caribou Biosciences, Inc. Compositions and methods of nucleic acid-targeting nucleic acids
US9260752B1 (en) 2013-03-14 2016-02-16 Caribou Biosciences, Inc. Compositions and methods of nucleic acid-targeting nucleic acids
US10526589B2 (en) 2013-03-15 2020-01-07 The General Hospital Corporation Multiplex guide RNAs
US10202619B2 (en) 2013-03-15 2019-02-12 System Biosciences, Llc Compositions and methods directed to CRISPR/Cas genomic engineering systems
JP2016517276A (en) * 2013-03-15 2016-06-16 ザ ジェネラル ホスピタル コーポレイション Increased specificity of RNA-guided genome editing using RNA-induced FokI nuclease (RFN)
US10844403B2 (en) 2013-03-15 2020-11-24 The General Hospital Corporation Increasing specificity for RNA-guided genome editing
JP2016512264A (en) * 2013-03-15 2016-04-25 ザ ジェネラル ホスピタル コーポレイション RNA-induced targeting of genomic and epigenomic regulatory proteins to specific genomic loci
JP2016512048A (en) * 2013-03-15 2016-04-25 リージェンツ オブ ザ ユニバーシティ オブ ミネソタ Plant genome manipulation using the CRISPR / Cas system
JP2021118726A (en) * 2013-03-15 2021-08-12 ザ ジェネラル ホスピタル コーポレイション Using rna-guided foki nucleases (rfns) to increase specificity for rna-guided genome editing
US10760064B2 (en) 2013-03-15 2020-09-01 The General Hospital Corporation RNA-guided targeting of genetic and epigenomic regulatory proteins to specific genomic loci
US20210207165A1 (en) * 2013-03-15 2021-07-08 Sigma-Aldrich Co. Llc Crispr-based genome modification and regulation
US9234213B2 (en) 2013-03-15 2016-01-12 System Biosciences, Llc Compositions and methods directed to CRISPR/Cas genomic engineering systems
JP2020039350A (en) * 2013-03-15 2020-03-19 ザ ジェネラル ホスピタル コーポレイション USING RNA-GUIDED FokI NUCLEASES (RFNS) TO INCREASE SPECIFICITY FOR RNA-GUIDED GENOME EDITING
JP2019205470A (en) * 2013-03-15 2019-12-05 リージェンツ オブ ザ ユニバーシティ オブ ミネソタ Engineering plant genomes using crispr/cas systems
US9567603B2 (en) 2013-03-15 2017-02-14 The General Hospital Corporation Using RNA-guided FokI nucleases (RFNs) to increase specificity for RNA-guided genome editing
US9567604B2 (en) 2013-03-15 2017-02-14 The General Hospital Corporation Using truncated guide RNAs (tru-gRNAs) to increase specificity for RNA-guided genome editing
JP2020031637A (en) * 2013-03-15 2020-03-05 ザ ジェネラル ホスピタル コーポレイション Rna-guided targeting of genetic and epigenomic regulatory proteins to specific genomic loci
US10415059B2 (en) 2013-03-15 2019-09-17 The General Hospital Corporation Using truncated guide RNAs (tru-gRNAs) to increase specificity for RNA-guided genome editing
US11098326B2 (en) 2013-03-15 2021-08-24 The General Hospital Corporation Using RNA-guided FokI nucleases (RFNs) to increase specificity for RNA-guided genome editing
US11920152B2 (en) 2013-03-15 2024-03-05 The General Hospital Corporation Increasing specificity for RNA-guided genome editing
US12065668B2 (en) 2013-03-15 2024-08-20 The General Hospital Corporation RNA-guided targeting of genetic and epigenomic regulatory proteins to specific genomic loci
JP7126588B2 (en) 2013-03-15 2022-08-26 ザ ジェネラル ホスピタル コーポレイション Increased specificity of RNA-guided genome editing using RNA-guided FokI nuclease (RFN)
US10544433B2 (en) 2013-03-15 2020-01-28 The General Hospital Corporation Using RNA-guided FokI nucleases (RFNs) to increase specificity for RNA-guided genome editing
US10138476B2 (en) 2013-03-15 2018-11-27 The General Hospital Corporation Using RNA-guided FokI nucleases (RFNs) to increase specificity for RNA-guided genome editing
US10119133B2 (en) 2013-03-15 2018-11-06 The General Hospital Corporation Using truncated guide RNAs (tru-gRNAs) to increase specificity for RNA-guided genome editing
US9885033B2 (en) 2013-03-15 2018-02-06 The General Hospital Corporation Increasing specificity for RNA-guided genome editing
US10378027B2 (en) 2013-03-15 2019-08-13 The General Hospital Corporation RNA-guided targeting of genetic and epigenomic regulatory proteins to specific genomic loci
US11168338B2 (en) 2013-03-15 2021-11-09 The General Hospital Corporation RNA-guided targeting of genetic and epigenomic regulatory proteins to specific genomic loci
US9738908B2 (en) 2013-03-15 2017-08-22 System Biosciences, Llc CRISPR/Cas systems for genomic modification and gene modulation
US11634731B2 (en) 2013-03-15 2023-04-25 The General Hospital Corporation Using truncated guide RNAs (tru-gRNAs) to increase specificity for RNA-guided genome editing
US10385359B2 (en) 2013-04-16 2019-08-20 Regeneron Pharmaceuticals, Inc. Targeted modification of rat genome
US10975390B2 (en) 2013-04-16 2021-04-13 Regeneron Pharmaceuticals, Inc. Targeted modification of rat genome
US12037596B2 (en) 2013-04-16 2024-07-16 Regeneron Pharmaceuticals, Inc. Targeted modification of rat genome
US10196652B2 (en) 2013-05-15 2019-02-05 Sangamo Therapeutics, Inc. Methods and compositions for treatment of a genetic condition
US10196651B2 (en) 2013-05-15 2019-02-05 Sangamo Therapeutics, Inc. Methods and compositions for treatment of a genetic condition
JP2016521975A (en) * 2013-05-15 2016-07-28 サンガモ バイオサイエンシーズ, インコーポレイテッド Methods and compositions for the treatment of genetic conditions
US10767194B2 (en) 2013-06-04 2020-09-08 President And Fellows Of Harvard College RNA-guided transcriptional regulation
EP4159243A1 (en) * 2013-06-04 2023-04-05 President and Fellows of Harvard College Rna-guided transcriptional regulation
AU2014274939B2 (en) * 2013-06-04 2020-03-19 President And Fellows Of Harvard College RNA-guideded transcriptional regulation
JP2019122384A (en) * 2013-06-04 2019-07-25 プレジデント アンド フェローズ オブ ハーバード カレッジ Rna guided transcriptional regulation
JP7036511B2 (en) 2013-06-04 2022-03-15 プレジデント アンド フェローズ オブ ハーバード カレッジ RNA-induced transcriptional regulation
US10640789B2 (en) 2013-06-04 2020-05-05 President And Fellows Of Harvard College RNA-guided transcriptional regulation
US11981917B2 (en) 2013-06-04 2024-05-14 President And Fellows Of Harvard College RNA-guided transcriptional regulation
EP3003392A4 (en) * 2013-06-04 2017-05-03 President and Fellows of Harvard College Rna-guideded transcriptional regulation
US10946108B2 (en) 2013-06-17 2021-03-16 The Broad Institute, Inc. Delivery, use and therapeutic applications of the CRISPR-Cas systems and compositions for targeting disorders and diseases using viral components
US10711285B2 (en) 2013-06-17 2020-07-14 The Broad Institute, Inc. Optimized CRISPR-Cas double nickase systems, methods and compositions for sequence manipulation
US10781444B2 (en) 2013-06-17 2020-09-22 The Broad Institute, Inc. Functional genomics using CRISPR-Cas systems, compositions, methods, screens and applications thereof
US11597949B2 (en) 2013-06-17 2023-03-07 The Broad Institute, Inc. Optimized CRISPR-Cas double nickase systems, methods and compositions for sequence manipulation
US12018275B2 (en) 2013-06-17 2024-06-25 The Broad Institute, Inc. Delivery and use of the CRISPR-CAS systems, vectors and compositions for hepatic targeting and therapy
US11008588B2 (en) 2013-06-17 2021-05-18 The Broad Institute, Inc. Delivery, engineering and optimization of tandem guide systems, methods and compositions for sequence manipulation
US10577630B2 (en) 2013-06-17 2020-03-03 The Broad Institute, Inc. Delivery and use of the CRISPR-Cas systems, vectors and compositions for hepatic targeting and therapy
US10011850B2 (en) 2013-06-21 2018-07-03 The General Hospital Corporation Using RNA-guided FokI Nucleases (RFNs) to increase specificity for RNA-Guided Genome Editing
US9163284B2 (en) 2013-08-09 2015-10-20 President And Fellows Of Harvard College Methods for identifying a target site of a Cas9 nuclease
US11920181B2 (en) 2013-08-09 2024-03-05 President And Fellows Of Harvard College Nuclease profiling system
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US10954548B2 (en) 2013-08-09 2021-03-23 President And Fellows Of Harvard College Nuclease profiling system
US10227581B2 (en) 2013-08-22 2019-03-12 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US9359599B2 (en) 2013-08-22 2016-06-07 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US9340800B2 (en) 2013-09-06 2016-05-17 President And Fellows Of Harvard College Extended DNA-sensing GRNAS
US9228207B2 (en) 2013-09-06 2016-01-05 President And Fellows Of Harvard College Switchable gRNAs comprising aptamers
US9526784B2 (en) 2013-09-06 2016-12-27 President And Fellows Of Harvard College Delivery system for functional nucleases
US9340799B2 (en) 2013-09-06 2016-05-17 President And Fellows Of Harvard College MRNA-sensing switchable gRNAs
US9322037B2 (en) 2013-09-06 2016-04-26 President And Fellows Of Harvard College Cas9-FokI fusion proteins and uses thereof
US9737604B2 (en) 2013-09-06 2017-08-22 President And Fellows Of Harvard College Use of cationic lipids to deliver CAS9
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10912833B2 (en) 2013-09-06 2021-02-09 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US9388430B2 (en) 2013-09-06 2016-07-12 President And Fellows Of Harvard College Cas9-recombinase fusion proteins and uses thereof
US10682410B2 (en) 2013-09-06 2020-06-16 President And Fellows Of Harvard College Delivery system for functional nucleases
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US11299755B2 (en) 2013-09-06 2022-04-12 President And Fellows Of Harvard College Switchable CAS9 nucleases and uses thereof
US9999671B2 (en) 2013-09-06 2018-06-19 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US11920128B2 (en) 2013-09-18 2024-03-05 Kymab Limited Methods, cells and organisms
AU2020213379B2 (en) * 2013-10-17 2022-08-18 Sangamo Therapeutics, Inc. Delivery Methods And Compositions For Nuclease-Mediated Genome Engineering
US10494648B2 (en) 2013-10-17 2019-12-03 Sangamo Therapeutics, Inc. Delivery methods and compositions for nuclease-mediated genome engineering
EP3441468A3 (en) * 2013-10-17 2019-04-03 Sangamo Therapeutics, Inc. Delivery methods and compositions for nuclease-mediated genome engineering
US11149267B2 (en) 2013-10-28 2021-10-19 The Broad Institute, Inc. Functional genomics using CRISPR-Cas systems, compositions, methods, screens and applications thereof
US11390887B2 (en) 2013-11-07 2022-07-19 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAS
US10190137B2 (en) 2013-11-07 2019-01-29 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAS
US10640788B2 (en) 2013-11-07 2020-05-05 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAs
US9228208B2 (en) 2013-12-11 2016-01-05 Regeneron Pharmaceuticals, Inc. Methods and compositions for the targeted modification of a genome
US10711280B2 (en) 2013-12-11 2020-07-14 Regeneron Pharmaceuticals, Inc. Methods and compositions for the targeted modification of a mouse ES cell genome
US9546384B2 (en) 2013-12-11 2017-01-17 Regeneron Pharmaceuticals, Inc. Methods and compositions for the targeted modification of a mouse genome
US11820997B2 (en) 2013-12-11 2023-11-21 Regeneron Pharmaceuticals, Inc. Methods and compositions for the targeted modification of a genome
US10208317B2 (en) 2013-12-11 2019-02-19 Regeneron Pharmaceuticals, Inc. Methods and compositions for the targeted modification of a mouse embryonic stem cell genome
US10377998B2 (en) 2013-12-12 2019-08-13 The Broad Institute, Inc. CRISPR-CAS systems and methods for altering expression of gene products, structural information and inducible modular CAS enzymes
US10550372B2 (en) 2013-12-12 2020-02-04 The Broad Institute, Inc. Systems, methods and compositions for sequence manipulation with optimized functional CRISPR-Cas systems
US11597919B2 (en) 2013-12-12 2023-03-07 The Broad Institute Inc. Systems, methods and compositions for sequence manipulation with optimized functional CRISPR-Cas systems
US11124782B2 (en) 2013-12-12 2021-09-21 President And Fellows Of Harvard College Cas variants for gene editing
US11149259B2 (en) 2013-12-12 2021-10-19 The Broad Institute, Inc. CRISPR-Cas systems and methods for altering expression of gene products, structural information and inducible modular Cas enzymes
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US11155795B2 (en) 2013-12-12 2021-10-26 The Broad Institute, Inc. CRISPR-Cas systems, crystal structure and uses thereof
US9068179B1 (en) 2013-12-12 2015-06-30 President And Fellows Of Harvard College Methods for correcting presenilin point mutations
US9840699B2 (en) 2013-12-12 2017-12-12 President And Fellows Of Harvard College Methods for nucleic acid editing
US11053481B2 (en) 2013-12-12 2021-07-06 President And Fellows Of Harvard College Fusions of Cas9 domains and nucleic acid-editing domains
US11591581B2 (en) 2013-12-12 2023-02-28 The Broad Institute, Inc. Compositions and methods of use of CRISPR-Cas systems in nucleotide repeat disorders
US11407985B2 (en) 2013-12-12 2022-08-09 The Broad Institute, Inc. Delivery, use and therapeutic applications of the CRISPR-Cas systems and compositions for genome editing
US10851357B2 (en) 2013-12-12 2020-12-01 The Broad Institute, Inc. Compositions and methods of use of CRISPR-Cas systems in nucleotide repeat disorders
US10240167B2 (en) 2014-02-11 2019-03-26 Inscripta, Inc. CRISPR enabled multiplexed genome engineering
US11078498B2 (en) 2014-02-11 2021-08-03 The Regents Of The University Of Colorado, A Body Corporate CRISPR enabled multiplexed genome engineering
US10435715B2 (en) 2014-02-11 2019-10-08 The Regents Of The University Of Colorado, A Body Corporate CRISPR enabled multiplexed genome engineering
US10465207B2 (en) 2014-02-11 2019-11-05 The Regents Of The University Of Colorado, A Body Corporate CRISPR enabled multiplexed genome engineering
US10669559B2 (en) 2014-02-11 2020-06-02 The Regents Of The University Of Colorado, A Body Corporate CRISPR enabled multiplexed genome engineering
US10711284B2 (en) 2014-02-11 2020-07-14 The Regents Of The University Of Colorado CRISPR enabled multiplexed genome engineering
US11702677B2 (en) 2014-02-11 2023-07-18 The Regents Of The University Of Colorado CRISPR enabled multiplexed genome engineering
US10266849B2 (en) 2014-02-11 2019-04-23 The Regents Of The University Of Colorado, A Body Corporate CRISPR enabled multiplexed genome engineering
US9982278B2 (en) 2014-02-11 2018-05-29 The Regents Of The University Of Colorado, A Body Corporate CRISPR enabled multiplexed genome engineering
US11345933B2 (en) 2014-02-11 2022-05-31 The Regents Of The University Of Colorado CRISPR enabled multiplexed genome engineering
US11639511B2 (en) 2014-02-11 2023-05-02 The Regents Of The University Of Colorado, A Body Corporate CRISPR enabled multiplexed genome engineering
US10351877B2 (en) 2014-02-11 2019-07-16 The Regents Of The University Of Colorado, A Body Corporate CRISPR enabled multiplexed genome engineering
US10731180B2 (en) 2014-02-11 2020-08-04 The Regents Of The University Of Colorado CRISPR enabled multiplexed genome engineering
US10364442B2 (en) 2014-02-11 2019-07-30 The Regents Of The University Of Colorado, A Body Corporate CRISPR enabled multiplexed genome engineering
US11795479B2 (en) 2014-02-11 2023-10-24 The Regents Of The University Of Colorado CRISPR enabled multiplexed genome engineering
US11028388B2 (en) 2014-03-05 2021-06-08 Editas Medicine, Inc. CRISPR/Cas-related methods and compositions for treating Usher syndrome and retinitis pigmentosa
US9938521B2 (en) 2014-03-10 2018-04-10 Editas Medicine, Inc. CRISPR/CAS-related methods and compositions for treating leber's congenital amaurosis 10 (LCA10)
US11141493B2 (en) 2014-03-10 2021-10-12 Editas Medicine, Inc. Compositions and methods for treating CEP290-associated disease
US10253312B2 (en) 2014-03-10 2019-04-09 Editas Medicine, Inc. CRISPR/CAS-related methods and compositions for treating Leber's Congenital Amaurosis 10 (LCA10)
US11339437B2 (en) 2014-03-10 2022-05-24 Editas Medicine, Inc. Compositions and methods for treating CEP290-associated disease
US11268086B2 (en) 2014-03-10 2022-03-08 Editas Medicine, Inc. CRISPR/CAS-related methods and compositions for treating Leber's Congenital Amaurosis 10 (LCA10)
US11242525B2 (en) 2014-03-26 2022-02-08 Editas Medicine, Inc. CRISPR/CAS-related methods and compositions for treating sickle cell disease
US12070022B2 (en) 2014-04-28 2024-08-27 Recombinetics, Inc. Methods for making genetic edits
US9487802B2 (en) 2014-05-30 2016-11-08 The Board Of Trustees Of The Leland Stanford Junior University Compositions and methods to treat latent viral infections
US10066241B2 (en) 2014-05-30 2018-09-04 The Board Of Trustees Of The Leland Stanford Junior University Compositions and methods of delivering treatments for latent viral infections
WO2016011080A2 (en) 2014-07-14 2016-01-21 The Regents Of The University Of California Crispr/cas transcriptional modulation
EP3169776A4 (en) * 2014-07-14 2018-07-04 The Regents of The University of California Crispr/cas transcriptional modulation
US11254933B2 (en) 2014-07-14 2022-02-22 The Regents Of The University Of California CRISPR/Cas transcriptional modulation
US11578343B2 (en) 2014-07-30 2023-02-14 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10077453B2 (en) 2014-07-30 2018-09-18 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
WO2016028843A2 (en) 2014-08-19 2016-02-25 President And Fellows Of Harvard College Rna-guided systems for probing and mapping of nucleic acids
WO2016036754A1 (en) 2014-09-02 2016-03-10 The Regents Of The University Of California Methods and compositions for rna-directed target dna modification
EP3998344A1 (en) * 2014-10-09 2022-05-18 Life Technologies Corporation Crispr oligonucleotides and gene editing
US10428310B2 (en) 2014-10-15 2019-10-01 Regeneron Pharmaceuticals, Inc. Methods and compositions for generating or maintaining pluripotent cells
US20170306306A1 (en) * 2014-10-24 2017-10-26 Life Technologies Corporation Compositions and Methods for Enhancing Homologous Recombination
US11680268B2 (en) 2014-11-07 2023-06-20 Editas Medicine, Inc. Methods for improving CRISPR/Cas-mediated genome-editing
US11697828B2 (en) 2014-11-21 2023-07-11 Regeneran Pharmaceuticals, Inc. Methods and compositions for targeted genetic modification using paired guide RNAs
US10457960B2 (en) 2014-11-21 2019-10-29 Regeneron Pharmaceuticals, Inc. Methods and compositions for targeted genetic modification using paired guide RNAs
CN105695485B (en) * 2014-11-27 2020-02-21 中国科学院上海生命科学研究院 Cas9 encoding gene for filamentous fungus Crispr-Cas system and application thereof
CN105695485A (en) * 2014-11-27 2016-06-22 中国科学院上海生命科学研究院 Cas9 encoding gene used for mycelial fungus Crispr-Cas system, and application thereof
US10900034B2 (en) 2014-12-03 2021-01-26 Agilent Technologies, Inc. Guide RNA with chemical modifications
US10337001B2 (en) 2014-12-03 2019-07-02 Agilent Technologies, Inc. Guide RNA with chemical modifications
US11234418B2 (en) 2014-12-10 2022-02-01 Regents Of The University Of Minnesota Genetically modified cells, tissues, and organs for treating disease
US10278372B2 (en) 2014-12-10 2019-05-07 Regents Of The University Of Minnesota Genetically modified cells, tissues, and organs for treating disease
US10993419B2 (en) 2014-12-10 2021-05-04 Regents Of The University Of Minnesota Genetically modified cells, tissues, and organs for treating disease
US9888673B2 (en) 2014-12-10 2018-02-13 Regents Of The University Of Minnesota Genetically modified cells, tissues, and organs for treating disease
US10696986B2 (en) 2014-12-12 2020-06-30 The Board Institute, Inc. Protected guide RNAS (PGRNAS)
US11624078B2 (en) 2014-12-12 2023-04-11 The Broad Institute, Inc. Protected guide RNAS (pgRNAS)
JP2017537645A (en) * 2014-12-19 2017-12-21 アプライズ バイオ, インコーポレイテッド Method for identifying multiple epitopes in a selected subpopulation of cells
JP7196143B2 (en) 2014-12-19 2022-12-26 エフ.ホフマン-ラ ロシュ アーゲー Methods for identifying multiple epitopes in selected subpopulations of cells
JP2021010388A (en) * 2014-12-19 2021-02-04 エフ.ホフマン−ラ ロシュ アーゲーF. Hoffmann−La Roche Aktiengesellschaft Method for identifying a plurality of epitopes in selected partial mass of cells
US11248240B2 (en) * 2015-01-29 2022-02-15 Meiogenix Method for inducing targeted meiotic recombinations
US11046952B2 (en) * 2015-03-16 2021-06-29 The Broad Institute, Inc. Encoding of DNA vector identity via iterative hybridization detection of a barcode transcript
US11851652B2 (en) 2015-04-06 2023-12-26 The Board Of Trustees Of The Leland Stanford Junior Compositions comprising chemically modified guide RNAs for CRISPR/Cas-mediated editing of HBB
US11306309B2 (en) 2015-04-06 2022-04-19 The Board Of Trustees Of The Leland Stanford Junior University Chemically modified guide RNAs for CRISPR/CAS-mediated gene regulation
US11535846B2 (en) 2015-04-06 2022-12-27 The Board Of Trustees Of The Leland Stanford Junior University Chemically modified guide RNAS for CRISPR/Cas-mediated gene regulation
US11180793B2 (en) 2015-04-24 2021-11-23 Editas Medicine, Inc. Evaluation of Cas9 molecule/guide RNA molecule complexes
US11390884B2 (en) 2015-05-11 2022-07-19 Editas Medicine, Inc. Optimized CRISPR/cas9 systems and methods for gene editing in stem cells
US11535871B2 (en) * 2015-05-14 2022-12-27 University Of Southern California Optimized gene editing utilizing a recombinant endonuclease system
US10117911B2 (en) 2015-05-29 2018-11-06 Agenovir Corporation Compositions and methods to treat herpes simplex virus infections
US11911415B2 (en) 2015-06-09 2024-02-27 Editas Medicine, Inc. CRISPR/Cas-related methods and compositions for improving transplantation
US11578312B2 (en) 2015-06-18 2023-02-14 The Broad Institute Inc. Engineering and optimization of systems, methods, enzymes and guide scaffolds of CAS9 orthologs and variants for sequence manipulation
US10494621B2 (en) 2015-06-18 2019-12-03 The Broad Institute, Inc. Crispr enzyme mutations reducing off-target effects
US10876100B2 (en) 2015-06-18 2020-12-29 The Broad Institute, Inc. Crispr enzyme mutations reducing off-target effects
US11925664B2 (en) 2015-07-31 2024-03-12 Intima Bioscience, Inc. Intracellular genomic transplant and methods of therapy
US10166255B2 (en) 2015-07-31 2019-01-01 Regents Of The University Of Minnesota Intracellular genomic transplant and methods of therapy
US11266692B2 (en) 2015-07-31 2022-03-08 Regents Of The University Of Minnesota Intracellular genomic transplant and methods of therapy
US11642375B2 (en) 2015-07-31 2023-05-09 Intima Bioscience, Inc. Intracellular genomic transplant and methods of therapy
US11642374B2 (en) 2015-07-31 2023-05-09 Intima Bioscience, Inc. Intracellular genomic transplant and methods of therapy
US11903966B2 (en) 2015-07-31 2024-02-20 Regents Of The University Of Minnesota Intracellular genomic transplant and methods of therapy
US11583556B2 (en) 2015-07-31 2023-02-21 Regents Of The University Of Minnesota Modified cells and methods of therapy
US10406177B2 (en) 2015-07-31 2019-09-10 Regents Of The University Of Minnesota Modified cells and methods of therapy
US11147837B2 (en) 2015-07-31 2021-10-19 Regents Of The University Of Minnesota Modified cells and methods of therapy
US11046954B2 (en) 2015-08-06 2021-06-29 Dana-Farber Cancer Institute, Inc. Targeted protein degradation to attenuate adoptive T-cell therapy associated adverse inflammatory responses
US11293023B2 (en) 2015-08-06 2022-04-05 Dana-Farber Cancer Institute, Inc. Tunable endogenous protein degradation
US11060078B2 (en) 2015-08-28 2021-07-13 The General Hospital Corporation Engineered CRISPR-Cas9 nucleases
US10093910B2 (en) 2015-08-28 2018-10-09 The General Hospital Corporation Engineered CRISPR-Cas9 nucleases
US9926546B2 (en) 2015-08-28 2018-03-27 The General Hospital Corporation Engineered CRISPR-Cas9 nucleases
US10633642B2 (en) 2015-08-28 2020-04-28 The General Hospital Corporation Engineered CRISPR-Cas9 nucleases
US10526591B2 (en) 2015-08-28 2020-01-07 The General Hospital Corporation Engineered CRISPR-Cas9 nucleases
US9512446B1 (en) 2015-08-28 2016-12-06 The General Hospital Corporation Engineered CRISPR-Cas9 nucleases
WO2017040348A1 (en) 2015-08-28 2017-03-09 The General Hospital Corporation Engineered crispr-cas9 nucleases
EP4036236A1 (en) 2015-08-28 2022-08-03 The General Hospital Corporation Engineered crispr-cas9 nucleases
EP3352795A4 (en) * 2015-09-21 2019-03-13 The Regents of The University of California Compositions and methods for target nucleic acid modification
US11667911B2 (en) 2015-09-24 2023-06-06 Editas Medicine, Inc. Use of exonucleases to improve CRISPR/CAS-mediated genome editing
US12043852B2 (en) 2015-10-23 2024-07-23 President And Fellows Of Harvard College Evolved Cas9 proteins for gene editing
US11214780B2 (en) 2015-10-23 2022-01-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US11542554B2 (en) 2015-11-03 2023-01-03 President And Fellows Of Harvard College Method and apparatus for volumetric imaging
US10336807B2 (en) 2016-01-11 2019-07-02 The Board Of Trustees Of The Leland Stanford Junior University Chimeric proteins and methods of immunotherapy
US10457961B2 (en) 2016-01-11 2019-10-29 The Board Of Trustees Of The Leland Stanford Junior University Chimeric proteins and methods of regulating gene expression
US9856497B2 (en) 2016-01-11 2018-01-02 The Board Of Trustee Of The Leland Stanford Junior University Chimeric proteins and methods of regulating gene expression
US11111287B2 (en) 2016-01-11 2021-09-07 The Board Of Trustees Of The Leland Stanford Junior University Chimeric proteins and methods of immunotherapy
US11773411B2 (en) 2016-01-11 2023-10-03 The Board Of Trustees Of The Leland Stanford Junior University Chimeric proteins and methods of regulating gene expression
WO2017165655A1 (en) * 2016-03-23 2017-09-28 Dana-Farber Cancer Institute, Inc. Methods for enhancing the efficiency of gene editing
US11421218B2 (en) 2016-03-23 2022-08-23 Dana-Farber Cancer Institute, Inc. Methods for enhancing the efficiency of gene editing
US11512311B2 (en) 2016-03-25 2022-11-29 Editas Medicine, Inc. Systems and methods for treating alpha 1-antitrypsin (A1AT) deficiency
US11597924B2 (en) 2016-03-25 2023-03-07 Editas Medicine, Inc. Genome editing systems comprising repair-modulating enzyme molecules and methods of their use
US11236313B2 (en) 2016-04-13 2022-02-01 Editas Medicine, Inc. Cas9 fusion molecules, gene editing systems, and methods of use thereof
US12049651B2 (en) 2016-04-13 2024-07-30 Editas Medicine, Inc. Cas9 fusion molecules, gene editing systems, and methods of use thereof
US11713485B2 (en) 2016-04-25 2023-08-01 President And Fellows Of Harvard College Hybridization chain reaction methods for in situ molecular detection
EP3450570A4 (en) * 2016-04-28 2019-11-20 Industry-Academic Cooperation Foundation Yonsei University Method for evaluating, in vivo, activity of rna-guided nuclease in high-throughput manner
CN109415756A (en) * 2016-04-28 2019-03-01 延世大学校产学协力团 For the active method of the nuclease of RNA guidance to be assessed in body in a manner of high-throughput
CN109415756B (en) * 2016-04-28 2022-08-09 延世大学校产学协力团 Methods for in vivo assessment of the activity of RNA-guided nucleases in a high-throughput manner
US10266851B2 (en) 2016-06-02 2019-04-23 Sigma-Aldrich Co. Llc Using programmable DNA binding proteins to enhance targeted genome modification
US12084675B2 (en) 2016-06-02 2024-09-10 Sigma-Aldrich Co. Llc Using programmable DNA binding proteins to enhance targeted genome modification
US10767175B2 (en) 2016-06-08 2020-09-08 Agilent Technologies, Inc. High specificity genome editing using chemically modified guide RNAs
US10287575B2 (en) 2016-06-24 2019-05-14 The Regents Of The University Of Colorado, A Body Corporate Methods for generating barcoded combinatorial libraries
US10294473B2 (en) 2016-06-24 2019-05-21 The Regents Of The University Of Colorado, A Body Corporate Methods for generating barcoded combinatorial libraries
US11584928B2 (en) 2016-06-24 2023-02-21 The Regents Of The University Of Colorado, A Body Corporate Methods for generating barcoded combinatorial libraries
US10017760B2 (en) 2016-06-24 2018-07-10 Inscripta, Inc. Methods for generating barcoded combinatorial libraries
WO2017037304A3 (en) * 2016-07-28 2017-06-01 Dsm Ip Assets B.V. An assembly system for a eukaryotic cell
US11149268B2 (en) 2016-07-28 2021-10-19 Dsm Ip Assets B.V. Assembly system for a eukaryotic cell
US11566263B2 (en) 2016-08-02 2023-01-31 Editas Medicine, Inc. Compositions and methods for treating CEP290 associated disease
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11702651B2 (en) 2016-08-03 2023-07-18 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10947530B2 (en) 2016-08-03 2021-03-16 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11999947B2 (en) 2016-08-03 2024-06-04 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US12084663B2 (en) 2016-08-24 2024-09-10 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
WO2018071892A1 (en) 2016-10-14 2018-04-19 Joung J Keith Epigenetically regulated site-specific nucleases
US11154574B2 (en) 2016-10-18 2021-10-26 Regents Of The University Of Minnesota Tumor infiltrating lymphocytes and methods of therapy
US10912797B2 (en) 2016-10-18 2021-02-09 Intima Bioscience, Inc. Tumor infiltrating lymphocytes and methods of therapy
US11820969B2 (en) 2016-12-23 2023-11-21 President And Fellows Of Harvard College Editing of CCR2 receptor gene to protect against HIV infection
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US11466271B2 (en) 2017-02-06 2022-10-11 Novartis Ag Compositions and methods for the treatment of hemoglobinopathies
US11311609B2 (en) 2017-02-08 2022-04-26 Dana-Farber Cancer Institute, Inc. Regulating chimeric antigen receptors
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11851690B2 (en) 2017-03-14 2023-12-26 Editas Medicine, Inc. Systems and methods for the treatment of hemoglobinopathies
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US12058986B2 (en) 2017-04-20 2024-08-13 Egenesis, Inc. Method for generating a genetically modified pig with inactivated porcine endogenous retrovirus (PERV) elements
WO2018195545A2 (en) 2017-04-21 2018-10-25 The General Hospital Corporation Variants of cpf1 (cas12a) with altered pam specificity
US11499151B2 (en) 2017-04-28 2022-11-15 Editas Medicine, Inc. Methods and systems for analyzing guide RNA molecules
US11963982B2 (en) 2017-05-10 2024-04-23 Editas Medicine, Inc. CRISPR/RNA-guided nuclease systems and methods
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
WO2018218206A1 (en) 2017-05-25 2018-11-29 The General Hospital Corporation Bipartite base editor (bbe) architectures and type-ii-c-cas9 zinc finger editing
WO2018218166A1 (en) 2017-05-25 2018-11-29 The General Hospital Corporation Using split deaminases to limit unwanted off-target base editor deamination
US10428319B2 (en) 2017-06-09 2019-10-01 Editas Medicine, Inc. Engineered Cas9 nucleases
US11098297B2 (en) 2017-06-09 2021-08-24 Editas Medicine, Inc. Engineered Cas9 nucleases
US9982279B1 (en) 2017-06-23 2018-05-29 Inscripta, Inc. Nucleic acid-guided nucleases
US10011849B1 (en) 2017-06-23 2018-07-03 Inscripta, Inc. Nucleic acid-guided nucleases
US11697826B2 (en) 2017-06-23 2023-07-11 Inscripta, Inc. Nucleic acid-guided nucleases
US10435714B2 (en) 2017-06-23 2019-10-08 Inscripta, Inc. Nucleic acid-guided nucleases
US10337028B2 (en) 2017-06-23 2019-07-02 Inscripta, Inc. Nucleic acid-guided nucleases
US10626416B2 (en) 2017-06-23 2020-04-21 Inscripta, Inc. Nucleic acid-guided nucleases
US11098325B2 (en) 2017-06-30 2021-08-24 Intima Bioscience, Inc. Adeno-associated viral vectors for gene therapy
US11866726B2 (en) 2017-07-14 2024-01-09 Editas Medicine, Inc. Systems and methods for targeted integration and genome editing and detection thereof using integrated priming sites
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11130999B2 (en) 2017-07-31 2021-09-28 Regeneron Pharmaceuticals, Inc. Cas-ready mouse embryonic stem cells and mice and uses thereof
US11866794B2 (en) 2017-07-31 2024-01-09 Regeneron Pharmaceuticals, Inc. Cas-ready mouse embryonic stem cells and mice and uses thereof
US11021719B2 (en) 2017-07-31 2021-06-01 Regeneron Pharmaceuticals, Inc. Methods and compositions for assessing CRISPER/Cas-mediated disruption or excision and CRISPR/Cas-induced recombination with an exogenous donor nucleic acid in vivo
US11932884B2 (en) 2017-08-30 2024-03-19 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US12031132B2 (en) 2018-03-14 2024-07-09 Editas Medicine, Inc. Systems and methods for the treatment of hemoglobinopathies
US11434491B2 (en) 2018-04-19 2022-09-06 The Regents Of The University Of California Compositions and methods for gene editing
WO2020163396A1 (en) 2019-02-04 2020-08-13 The General Hospital Corporation Adenine dna base editor variants with reduced off-target rna editing
US11795452B2 (en) 2019-03-19 2023-10-24 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11643652B2 (en) 2019-03-19 2023-05-09 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
WO2021105191A1 (en) 2019-11-29 2021-06-03 Basf Se Increasing resistance against fungal infections in plants
WO2021122687A1 (en) 2019-12-19 2021-06-24 Basf Se Increasing space-time-yield, carbon-conversion-efficiency and carbon substrate flexibility in the production of fine chemicals
WO2021122528A1 (en) 2019-12-20 2021-06-24 Basf Se Decreasing toxicity of terpenes and increasing the production potential in micro-organisms
WO2021202938A1 (en) 2020-04-03 2021-10-07 Creyon Bio, Inc. Oligonucleotide-based machine learning
US12057197B2 (en) 2020-04-03 2024-08-06 Creyon Bio, Inc. Oligonucleotide-based machine learning
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US12031126B2 (en) 2020-05-08 2024-07-09 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
WO2022216857A1 (en) * 2021-04-07 2022-10-13 Century Therapeutics, Inc. Gene transfer vectors and methods of engineering cells
US12098425B2 (en) 2021-04-08 2024-09-24 Readcoor, Llc Three-dimensional spatial molecular indexing
US11884915B2 (en) 2021-09-10 2024-01-30 Agilent Technologies, Inc. Guide RNAs with chemical modification for prime editing
EP4198124A1 (en) 2021-12-15 2023-06-21 Versitech Limited Engineered cas9-nucleases and method of use thereof

Also Published As

Publication number Publication date
US20170044569A9 (en) 2017-02-16
ZA201504739B (en) 2023-12-20
MX2021006741A (en) 2021-07-15
US10273501B2 (en) 2019-04-30
US20240279677A1 (en) 2024-08-22
US20160002670A1 (en) 2016-01-07
AU2021204023A1 (en) 2021-07-08
US20190249193A1 (en) 2019-08-15
ES2741951T3 (en) 2020-02-12
AU2021204024A1 (en) 2021-07-08
AU2019216665B2 (en) 2021-03-25
JP2016501036A (en) 2016-01-18
US20160032274A1 (en) 2016-02-04
US9260723B2 (en) 2016-02-16
MX2021006742A (en) 2021-07-15
MY170059A (en) 2019-07-02
US20190249194A1 (en) 2019-08-15
DK2931891T3 (en) 2019-08-19
US20220177913A1 (en) 2022-06-09
US11535863B2 (en) 2022-12-27
RU2699523C2 (en) 2019-09-05
KR20150095861A (en) 2015-08-21
HK1212376A1 (en) 2016-06-10
WO2014099750A3 (en) 2014-10-23
JP6700788B2 (en) 2020-05-27
SG10201704932UA (en) 2017-07-28
IL308158A (en) 2023-12-01
US20230295653A1 (en) 2023-09-21
CN105121641A (en) 2015-12-02
RU2015129018A (en) 2017-01-23
JP2021048882A (en) 2021-04-01
MX2015007743A (en) 2015-12-07
AU2013363194A1 (en) 2015-07-16
US20140342458A1 (en) 2014-11-20
BR112015014425A2 (en) 2017-10-10
EP2931891A1 (en) 2015-10-21
US11512325B2 (en) 2022-11-29
CA2895155C (en) 2021-07-06
US20140342456A1 (en) 2014-11-20
US11236359B2 (en) 2022-02-01
US12018272B2 (en) 2024-06-25
US11359211B2 (en) 2022-06-14
RU2019127316A (en) 2019-10-08
US20210222193A1 (en) 2021-07-22
US20240294939A1 (en) 2024-09-05
US20200308599A1 (en) 2020-10-01
JP2023168564A (en) 2023-11-24
RU2019127316A3 (en) 2020-07-06
AU2021204023B2 (en) 2023-03-16
SG10201912991WA (en) 2020-03-30
US20160304907A1 (en) 2016-10-20
AU2013363194B2 (en) 2019-05-16
JP2019076097A (en) 2019-05-23
US10435708B2 (en) 2019-10-08
US20150259704A1 (en) 2015-09-17
NZ709429A (en) 2021-01-29
US20140356958A1 (en) 2014-12-04
US9970024B2 (en) 2018-05-15
US20160160210A1 (en) 2016-06-09
EP4282970A2 (en) 2023-11-29
CA3081054A1 (en) 2014-06-26
US10717990B2 (en) 2020-07-21
WO2014099750A2 (en) 2014-06-26
US9023649B2 (en) 2015-05-05
IL239326A0 (en) 2015-07-30
AU2024201441A1 (en) 2024-03-21
CA2895155A1 (en) 2014-06-26
EP3553174A1 (en) 2019-10-16
US20150232833A1 (en) 2015-08-20
AU2019216665A1 (en) 2019-09-05
US20200048656A1 (en) 2020-02-13
SG11201504621RA (en) 2015-07-30
AU2021204024B2 (en) 2023-12-14
EP2931891B1 (en) 2019-05-15
EP2931891A4 (en) 2016-07-13
US11365429B2 (en) 2022-06-21
EP4282970A3 (en) 2024-01-17
US20140342457A1 (en) 2014-11-20
KR20220139433A (en) 2022-10-14
RU2766685C2 (en) 2022-03-15

Similar Documents

Publication Publication Date Title
US12018272B2 (en) RNA-guided human genome engineering

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13863815

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 239326

Country of ref document: IL

ENP Entry into the national phase

Ref document number: 2895155

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: MX/A/2015/007743

Country of ref document: MX

ENP Entry into the national phase

Ref document number: 2015549528

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 14653144

Country of ref document: US

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112015014425

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 20157018831

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2013863815

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2013363194

Country of ref document: AU

Date of ref document: 20131216

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2015129018

Country of ref document: RU

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 112015014425

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20150617