WO2014080054A1 - Método de diagnóstico y/o pronóstico de enfermedades neurodegenerativas - Google Patents
Método de diagnóstico y/o pronóstico de enfermedades neurodegenerativas Download PDFInfo
- Publication number
- WO2014080054A1 WO2014080054A1 PCT/ES2013/070713 ES2013070713W WO2014080054A1 WO 2014080054 A1 WO2014080054 A1 WO 2014080054A1 ES 2013070713 W ES2013070713 W ES 2013070713W WO 2014080054 A1 WO2014080054 A1 WO 2014080054A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- mitochondrial dna
- csf
- dna
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Definitions
- the present invention falls within the field of neurodegenerative diseases, specifically within the methods of diagnosis and / or prognosis of such diseases, preferably Alzheimer's, which are based on the quantification of biomarkers in isolated biological samples.
- AD Alzheimer's disease
- a long preclinical phase with abnormal, structural and functional biochemical changes in the brain.
- these changes suggest that the pathophysiological process of neurodegeneration of AD begins long before the onset of clinical symptoms of dementia. Therefore, the identification of new biomarkers that precede the onset of clinical symptoms of the disease is essential to advance knowledge of AD and to develop possible diagnostic and / or prognostic methods and early and efficient therapeutic treatments.
- biomarkers are used in diagnostic kit procedures that use antibody assays to detect levels of ⁇ -amyloid ( ⁇ ) and total tau (t-tau) and phosphorylated tau (ftau) proteins for diagnose AD in a pre-clinical state, before clinical symptoms of dementia manifest.
- An accumulation of ⁇ in the brain or a low concentration of ⁇ 1-42 in cerebrospinal fluid (CSF) or an increased level of t-tau and f-tau in CSF (Jack, CR et al., 2010, Lancet Neurol. 9, 1 19-128) indicate a positive diagnosis of AD.
- these two biomarkers support a good predictive value of a negative diagnosis of AD.
- AD Alzheimer's disease
- ⁇ levels correlate negatively with an accumulation. in the brain and a low concentration in CSF.
- the reason why the accumulation of ⁇ in the brain is associated with low concentrations of ⁇ -42 in CSF is unclear, although it may be due to a decrease in the release of ⁇ -42 from the brain to the CSF (Mawuenyega, KG et al. 2010, Science. 330, 1774).
- a high concentration of total tau in the CSF is considered to reflect a neuronal lesion associated with the accumulation of tau in the brain.
- AD mitochondrial dysfunction is involved in the pathophysiology of AD, but whether it precedes or is a consequence of the neurodegenerative process is still unclear.
- AD is associated with alterations in bioenergetics and mitochondrial function, since neurons are highly dependent on the aerobic energy provided by mitochondria (Swerdlow, RH et al. J. Alsheimers. Dis., 2010, 293-310) .
- WO200701 1322A2 provides analytical methods and systems for the pre- or post-symptomatic diagnosis of neurodegenerative disorders associated with the formation of deposits of ⁇ -amyloid and / or fibrils of ⁇ -amyloid, by quantifying or detecting said Mitochondrial DNA mutations in tissue or cells of an individual.
- Another method is described in WO9409162A1 for diagnose or predict a predisposition to AD that includes the detection of mutations or insertions in mitochondrial DNA.
- AD diagnostic and / or prognostic methods of AD have been described in which the levels of biomarkers such as ⁇ -amyloid and total and phosphorylated tau are measured, as well as mutations or polymorphisms in mitochondrial DNA.
- biomarkers such as ⁇ -amyloid and total and phosphorylated tau
- the CSF is in direct contact with the brain parenchyma, so it is considered to be the best fluid to identify possible changes in brain metabolism.
- these methods have the disadvantage that the diagnosis and / or prognosis is made in biological samples of tissue or CSF, which requires obtaining said samples through an invasive procedure in the patient, in addition to being unreliable methods for the diagnosis and / or early prevention of the disease.
- the present invention relates in a first aspect to the use of mitochondrial DNA as a quantitative biomarker for the diagnosis and / or prognosis of neurodegenerative diseases, preferably of AD.
- the present invention relates to an in vitro diagnostic and / or prognostic method of a neurodegenerative disease, preferably AD, based on the quantification of mitochondrial DNA in an isolated biological sample of a subject.
- the present invention relates to a kit for the diagnosis and / or prognosis of a neurodegenerative disease, preferably of AD, characterized in that it comprises at least one set of primers or probes for the quantification of mitochondrial DNA.
- the present invention relates to a use of the kit comprising primers and / or probes specific for mitochondrial DNA, for the diagnosis and / or prognosis of a neurodegenerative disease, preferably AD.
- the present invention proposes the use of mitochondrial DNA as a quantitative biomarker for the diagnosis and / or early prognosis of a neurodegenerative disease, preferably AD, and therefore provides an improved method of diagnosis and / or prognosis of a neurodegenerative disease, preferably of AD, based on the use of said biomarker.
- the method described in the present invention provides the advantage that it allows carry out an early diagnosis and / or prognosis of neurodegenerative disease, that is, before the clinical symptoms associated with said disease are manifested. This allows the patient to administer early and efficient therapeutic and / or prophylactic treatments.
- said method can be carried out in a wide variety of biological samples without their reliability and reproducibility being altered, including, for example, but without limiting our, blood, serum or plasma of the subject under study.
- the method of the invention does not necessarily require the performance of an invasive procedure in the patient, as is the case with other diagnostic methods known to date that require brain tissue or cerebrospinal fluid.
- this procedure is simple to perform, since the quantification of mitochondrial DNA can be performed by widely used nucleic acid quantification techniques, such as, but not limited to, PCR.
- the method described here is a sensitive, specific, reproducible method among laboratories and with less variability than the measurement of protein levels with antibodies used in the kits currently available for the diagnosis of neurodegenerative diseases.
- the present invention is a solution to the need to provide an improved method of diagnosis and / or early prognosis of neurodegenerative diseases, preferably of AD, detectable in a biological sample.
- the present invention relates to the use of mitochondrial DNA as a quantitative biomarker for the diagnosis and / or prognosis of a neurodegenerative disease, preferably, of AD.
- “Diagnostic” is understood as the procedure by which the presence or absence of a disease in a subject, preferably, of a neurodegenerative disease, more preferably of AD, is identified.
- prognosis refers to the procedure by which a prediction of the events that will occur in the development or course of a disease, preferably of a neurodegenerative disease, more preferably of AD, is established, including, but not limited to, the predisposition to suffer from such disease, relapse or the ability to respond to a certain treatment.
- the term "early”, as used in the present invention, refers to the diagnosis or prognosis of a disease, preferably of a neurodegenerative disease, more preferably of AD, in a subject in the early stages thereof, that is, before the onset of clinical symptoms.
- Quantitative biomarker refers to the amount or concentration of mitochondrial DNA used as an indicator of a neurodegenerative disease, preferably AD, and its developmental state.
- mitochondrial DNA is understood as the genetic material of the mitochondria that can be found both intracellularly and extracellularly or circulatingly.
- the intracellular genetic material is inside the cell and the extracellular or circulating genetic material is outside the cell, such as, but not limited to, in the environment of the cerebrospinal fluid, blood, serum, blood plasma, from saliva, from urine, from tear or from sweat. Therefore, in a preferred embodiment, the mitochondrial DNA referred to in the present invention is extracellular or circulating mitochondrial DNA.
- the mitochondrial DNA regions that are quantified in the present invention are at least one of the following: mtD-515, mtD-85, mtD-153 or mtD-123, in human.
- the first three regions are located in the sequence that is between the bases 14418 and 14932 (the exact location is shown in table 5) of the complete Cambridge human mitochondrial DNA reference sequence (RefSeq: NC_012920.1).
- These three regions encode the mitochondrial genes ND6, tRNA-Gly and CYTB;
- the mtDNA-123 region is between bases 805 and 927 of the complete Cambridge human mitochondrial DNA reference sequence (RefSeq: NC_012920.1).
- the mitochondrial DNA regions that are quantified in the present invention are at least one of the following: mtDNA-1 or mtDNA-699, in mice, which are located in the sequence between bases 214 and 912 (the exact location is shown in Table 5) that encodes the 12S ribosomal RNA mitochondrial gene according to the complete mouse mitochondrial DNA reference sequence (RefSeq: NC_005089.1).
- neurodegenerative disease is understood as a type of disease that groups a genus of cognitive disorders, such as, for example, but not limited to, Alzheimer's, Parkinson's, Creutzfeldt-Jakob's disease and multiple sclerosis. These cognitive disorders are due to an increase in cell death processes, reducing the number of neurons and generating changes in behavior.
- the definition of neurodegenerative disease in the present invention excludes frontotemporal dementia (DFT).
- Alzheimer's disease refers to a neurodegenerative disease that manifests as cognitive impairment and behavioral disorders. It is characterized in its typical form by a progressive loss of memory and other mental abilities, as nerve cells degenerate and / or die and different areas of the brain atrophy.
- frontotemporal dementia or “DFT” is understood as a clinical syndrome caused by the degeneration of the frontal lobe of the human brain, which can extend to the temporal lobe. It is one of the three syndromes caused by frontotemporal lobular degeneration, and the second most common cause of early onset dementia after Alzheimer's disease.
- the present invention relates to a method for the diagnosis and / or prognosis in vitro of a neurodegenerative disease, preferably AD, hereinafter "method of the invention”, which comprises the following steps:
- step (b) compare the value obtained in step (a) with a standard value.
- the mitochondrial DNA referred to in step (a) of the method of the present invention is mtDNA-515, mtDNA-85, mtD-123 and / or mtD-153, if the subject is human; MtDNA-1 15 and / or mtDNA-699, if the subject is a mouse.
- the mitochondrial DNA referred to in step (a) of the method of the invention is extracellular mitochondrial DNA.
- the measurement refers to the measurement of the amount or concentration of both intracellular and extracellular mitochondrial DNA, using DNA measurement techniques, such as, but not limited to, PCR, real-time quantitative PCR (qPCR), digital droplet PCR (ddPCR) or Southern Blot.
- DNA measurement techniques such as, but not limited to, PCR, real-time quantitative PCR (qPCR), digital droplet PCR (ddPCR) or Southern Blot.
- qPCR real-time quantitative PCR
- ddPCR digital droplet PCR
- Southern Blot a sample of cells.
- step (a) of the method of the invention is carried out by PCR, qPCR, ddPCR or Southern Blot. More preferably, step (a) is carried out by qPCR or ddPCR. Even more preferably, step (a) is carried out by ddPCR.
- PCR is understood as the polymerase chain reaction. It is a molecular biology technique whose objective is to obtain a large number of copies of a particular DNA fragment, starting from a minimum.
- the PCR is used for the amplification and subsequent quantification of the mitochondrial DNA of the biological sample, preferably to amplify the sequences mtD-515, mtD-85, mtD-123 and / or mtD-153, if the subject is human ; MtDNA-1 15 and / or mtDNA-699, if the subject is a mouse.
- PCR there are several types of PCR such as real-time or quantitative PCR and digital PCR in drops, among others.
- the main characteristic of the qPCR is that it allows quantifying the amount of DNA present in the original sample or identifying, with a very high probability, specific DNA samples from their melting temperature.
- DdPCR is a refinement of conventional polymerase chain reaction methods that can be used to directly quantify the nucleic acid content at a single molecule resolution level and amplify (clonally amplify) nucleic acids such as DNA, CDNA or RNA.
- the two PCR variants can be used for quantification of mitochondrial DNA, preferably extracellular, in a biological sample.
- Southern Blot refers to a molecular biology method that allows detecting the presence of a DNA sequence in a complex mixture of this nucleic acid and quantifying the DNA present in a biological sample
- the agarose gel electrophoresis technique is used in order to separate the DNA fragments according to their length and then a transfer to a membrane in which probe hybridization is performed.
- Said values or parameters comprise values of signal intensity obtained from any of the physical or chemical properties of mitochondrial DNA obtained by direct measurement, for example, intensity values of mass spectroscopy or nuclear magnetic resonance. Additionally, said values or parameters include all those obtained by indirect measurement such as production of proteins encoded by mtDNA, free radical generation or energy production.
- isolated biological sample refers to an isolated sample of an organism that may come from a physiological fluid and / or any cell or tissue of an organism.
- the biological sample isolated from step (a) is selected from the list consisting of: saliva, sweat, tears, urine, cerebrospinal fluid, blood, serum and blood plasma.
- the biological sample is cerebrospinal fluid.
- the biological sample is blood, serum or blood plasma.
- the biological sample is serum.
- cerebrospinal fluid refers to a transparent colored liquid, which bathes the brain and spinal cord. Numerous diseases alter its composition and its study is important, and often determining, in diseases of the central or peripheral nervous system. Those diseases include neurodegenerative diseases such as Alzheimer's.
- “Standard value” means any value or range of values derived from the quantification of mitochondrial DNA in a biological control sample from a healthy individual or in a mixture of biological samples derived from a control group.
- control group means a group of healthy individuals, of the same or similar age as the subject studied, from which values or ranges of concentration values or amount of mitochondrial DNA derived from the quantification of mitochondrial DNA in a collection of biological samples from said healthy individuals, and that are representative of the population in which the method of the invention is to be applied.
- the quantification of mitochondrial DNA must be performed in the same way, and be obtained from the same type of isolated biological sample as that from the subject to be studied in step (a) of the method of the invention.
- Healthy population in the present invention is understood as a set of individuals or subjects who do not have a neurodegenerative disease, preferably AD.
- Healthy individuals representative of the population in which the method of the invention is to be applied means those subjects who do not suffer from neurodegenerative diseases, preferably AD, at the time of extraction of the isolated biological sample to be analyzed and that as The group has a similar pattern in terms of, for example, but not limited to, race, age or gender distribution, than the population of patients or subjects to whom the method of the invention is to be applied.
- neurodegenerative diseases preferably AD
- the term "comparison,” as used in the present invention refers to, but is not limited to, the comparison of the amount of mitochondrial DNA. determined in the biological sample from step (a) with a standard value.
- the comparison described in section (b) of the method of the present invention can be performed manually or assisted by a computer.
- the method of the invention further comprises: c) assigning the subject of step (a) to the group of patients predisposed to suffer from a neurodegenerative disease, preferably AD, or to the group of patients suffering from a neurodegenerative disease, preferably the EA, when the value obtained in step (a) is significantly less than the standard value.
- An amount "significantly less” than a standard value can be established by one skilled in the art by using different statistical tools, for example, but not limited, by determining confidence intervals, determining the p-value, Student's test. two-tailed, Fisher discriminant functions, using Kruskal-Wallis analysis with Dunn's post-hoc multiple comparisons test, one-way ANOVA with Bonferroni's post-hoc multiple comparisons test or Kursal-Wallis U-test .
- step (a) of the method of the invention may be a human, but also a non-human mammal, such as, but not limited to, rodents, ruminants, felines or canids. Therefore, in another preferred embodiment, the subject from which the biological sample isolated from step (a) of the method of the invention is derived is a mammal. In a more preferred embodiment, the mammal is a human.
- kits for the diagnosis and / or prognosis of a neurodegenerative disease preferably of AD, hereinafter "kit of the invention”
- kit of the invention comprising at least one of the following sets of primers or probes: a) SEQ ID NO: 1 and SEQ ID NO: 4,
- the kit of the invention comprises primers SEQ ID NO: 3 and SEQ ID NO: 4 or SEQ ID NO: 9 and SEQ ID NO: 10.
- the present invention relates to the use of a kit comprising primers and / or specific probes for mitochondrial DNA, for the diagnosis and / or prognosis of a neurodegenerative disease, preferably AD.
- these primers and / or probes specific for mitochondrial DNA are specific for mitochondrial DNA mtD-515, mtD-85, mtD-123 and / or mtD-153, from human; or mtDNA-1 15 and / or mtDNA-699 mouse.
- said kit is the kit of the invention described above.
- the kit of the invention may comprise, without any limitation, labeled or unlabeled primers, labeled or unlabeled probes, buffers, agents to prevent contamination, marker compounds such as, but not limited to, fluorochromes, etc.
- the kit of the invention can include all the supports and containers necessary for its implementation and optimization.
- the kit of the invention may contain positive and negative controls.
- this kit further comprises instructions for carrying out the quantification of mitochondrial DNA as described in the invention.
- at least one of the primer sets or probes of the kit of the invention is labeled or immobilized.
- At least one of the primer sets or probes of the kit The invention is labeled with a tag selected from the list comprising: a radioisotope, a fluorescent or luminescent marker, an antibody, an antibody fragment, an affinity tag, an enzyme and a substrate of an enzyme.
- a tag selected from the list comprising: a radioisotope, a fluorescent or luminescent marker, an antibody, an antibody fragment, an affinity tag, an enzyme and a substrate of an enzyme.
- at least one of the sets of primers or probes of the kit of the invention is immobilized on a support, such as but not limited to, on a nylon matrix, on a plastic support or on beads.
- primer means a nucleic acid chain that serves as a starting point for DNA amplification. It is a short nucleic acid sequence that contains a free 3 'hydroxyl group that forms base pairs complementary to the template strand and acts as a starting point for the addition of nucleotides in order to copy and amplify the template strand.
- the primers bind to the ends of the mitochondrial DNA for amplification and detection by, for example, but not limited to, PCR.
- probe refers to a small DNA fragment labeled by fluorescence that emits signals detected by a laser and is used as a tool in, for example, but not limited to, the qPCR or ddPCR to quantify the mitochondrial DNA of a biological sample.
- Primers and / or probes specific for mitochondrial DNA preferably for mitochondrial DNA mtD-515, mtD-85, mtD-123 and / or mtD-153, from human; MtDNA-1 15 and / or mouse mtDNA-699 can be designed using primer design techniques and / or probes widely known in the state of the art.
- the primers referred to in the present invention are selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 7 , SEQ ID NO: 9 and SEQ ID NO: 10.
- the probes referred to in the present invention are selected from SEQ ID NO: 5 and SEQ ID NO: 8.
- Fig. 1 Decrease in the concentration of mitochondrial DNA in the cerebrospinal fluid of subjects with preclinical Alzheimer's disease.
- the concentration of mitochondrial DNA in the CSF samples was measured by qPCR with primers directed to a region between bases 14418 and 14932 of the human mitochondrial DNA sequence.
- Two of the PCR primer pairs (SEQ ID NO: 1 / SEQ ID NO: 2 and SEQ ID NO: 3 / SEQ ID NO: 4) were designed to amplify two short sequences (153 bp and 85 bp, mitochondrial DNA -153 and mitochondrial DNA-85, respectively) located at the ends of a longer sequence, 515 bp (mitochondrial DNA-515) which in turn can be amplified by the combination of the first and second pair direct and reverse primers of primers respectively (SEQ ID NO: 1 / SEQ ID NO: 4).
- Fig. 2 Analysis of diagnostic discrimination using the receiver operating characteristic curve (ROC) between the EA and FTLD groups.
- ROC receiver operating characteristic curve
- Fig. 3 The reduction in the number of mitochondrial DNA copies occurs before synaptic damage in cortical neuron cultures of APP / PS1 mice. Mitochondrial DNA copy numbers and synaptic proteins were measured in cortical neuron cultures of wild mice (WT) and APP / PS1 transgenic mice.
- the qPCR amplification curves of (A) mitochondrial DNA-85, (B) mitochondrial DNA-153 and (C) mitochondrial DNA-515 were performed on either a standard calibration of purified human mitochondrial DNA (100 copies) of cells HEK293T (STANDARD), LCR or ultrafiltered LCR (UF LCR).
- Direct CSF amplification of mitochondrial DNA results in an amplification curve with a slope significantly less than that obtained with the human mitochondrial DNA calibration pattern, indicating the presence of inhibitors that reduce the efficiency of the PCR reaction and compromise quantification. accurate.
- Fig. 5 Quantification of the number of copies of circulating extracellular mitochondrial DNA in CSF using ddPCR.
- the number of mitochondrial DNA copies was measured directly in CSF samples by ddPCR using the Bio-Rad QX100 Digital Droplet PCR platform.
- the mtDNA-153 amplification was obtained with primers SEQ ID NO: 1 and SEQ ID NO: 2 and a probe labeled FAM (SEQ ID NO: 8).
- the results were analyzed using the QuantaSoft program. Values are expressed as mean ⁇ SEM of the number of mitochondrial DNA copies per mi of CSF.
- C1, Control group, n 9.
- the subjects of these studies were selected from a cohort of 282 people recruited in the Alzheimer's Disease and other cognitive disorders unit of the Neurology Department of the Hospital Cl ⁇ nic de Barcelona. All subjects underwent clinical and neuropsychological evaluation and lumbar puncture. The subjects were classified by the presence or absence of dementia and according to their CSF concentrations of: ⁇ 1 -42, total amount of protein associated with microtubules tau (t-tau) and phosphorylated tau in threonine 181 (p-tau) (Tables) 1 to 4).
- EA patients diagnosed with probable AD using NINCDS / ADRDA 's criteria and with the typical characteristic biomarker profile that occurs in AD: low levels of ⁇ 1 -42 and elevated levels of t-tau and P-tau
- LAI asymptomatic subjects at risk of developing sporadic AD that have no cognitive deficit and only have low levels of ⁇ 1 -42 in CSF
- FTLD symptomatic patients diagnosed with any of the Frontotemporal dementia syndromes including Aphasia and semantic dementia, and with normal EA biomarkers in CSF.
- PSEN1 pre-symptomatic patients with a dominant PSEN1 mutation (M139T, K239N or I439S) with normal biomarkers in CSF and normal cognition
- C1 control group consisting of healthy subjects without cognitive deficits and normal biomarkers in old CSF equivalent to the LA ⁇ and EA groups.
- C2 control group of healthy subjects of age equivalent to the PSEN1 group without clinical, genetic or biochemical alterations.
- the pathological values used were the following: 1 ⁇ 1 -42 ⁇ 500 pg / ml; t-tau> 450 pg / ml, and p-tau> 75 pg / ml.
- Table 1 Age and biomarker characteristics of the study groups analyzed by PCR.
- Table 3 Clinical characteristics and individual values of biomarkers in patients analyzed by ddPCR.
- C1 control group consisting of healthy subjects without cognitive deficits, normal biomarkers in CSF, and of age equivalent to the groups of patients diagnosed with AD and FTLD.
- EA patients diagnosed with sporadic Alzheimer's disease with low levels of ⁇ 1 -42 and elevated levels of t-tau and tau-p in the CSF.
- FTLD patients diagnosed with frontotemporal lobar degeneration and with normal levels of biomarkers related to AD in the CSF. ** Significantly different from the corresponding control group (ONEWAY ANOVA with Bonferroni post-hoc comparisons, p ⁇ 0.01).
- CSF samples were obtained with informed consent following the procedure approved by the Ethical Committee of the Hospital Cl ⁇ nic de Barcelona in the Alzheimer's Disease and other cognitive disorders Unit of the Neurology Department. CSF samples were obtained by lumbar puncture between 09:00 and 12:00 in the morning. A small initial volume of CSF was set aside to determine the presence of cells and perform other biochemical measurements and then the collection of 10 ml of CSF began. To avoid contamination with blood cells, possibly acquired in the lumbar puncture process, CSF samples were centrifuged immediately after collection at 2000 g for 10 min at 4 0 C and stored at -80 ° C in polypropylene tubes before two hours after extraction.
- Biomarkers ⁇ 1 -42, T-tau and tau-p were measured by immunoenzymatic assays (Innogenetics, Ghent, Belgium). PCR amplification with primers aimed at amplifying a nuclear gene with high copy number such as 18S ribosomal RNA, showed that the CSF samples used in our experiments do not contain nuclear DNA above the detection limit of 0.6 genomes per sample , ruling out the possibility of CSF contamination with peripheral cell DNA.
- the concentration of circulating mitochondrial DNA in CSF samples was evaluated by qPCR with a standard calibration curve.
- the reactions were performed in at least ten replicates in a Corbett Rotor-Gene 6000 (Corbett, Mortlake, NSW, 2137, Australia).
- Each 20 I of PCR reaction consisted of 1X SsoFast EvaGreen (Bio-Rad Laboratories, Hercules, CA 94547, USA), 300 nM of each of the primers and 6.2 I of CSF sample.
- PCR primers were designed that amplify a region between bases 14418 and 14932 that encodes the mitochondrial genes ND6, tRNA-Glu and cytB, according to the Cambridge reference sequence for human mitochondrial DNA (RefSeq: NC_012920.1). Primers that are not associated with known single nucleotide polymorphisms were chosen. To confirm the specificity of the DNA amplification in the PCR reaction, three different combinations of primers designed to the same region of mitochondrial DNA were designed (Fig. 1 A, B). The 5'-3 'primer sequences are: SEQ ID NO: 1 CCCCTGACCCCCATGCCTCA, SEQ ID NO: 2 GCGGTGTGGTCGGGTGTGTT-, SEQ ID NO: 3
- the primers for this PCR reaction were designed to amplify a region between bases 805 and 927 of the mitochondrial DNA genome that encodes the 12S ribosomal RNA mitochondrial gene.
- the sequences of this combination of primers amplify a 123 bp product (mitochondrial DNA-123) and are: Direct (SEQ ID NO: 6), 5'-CCACGGGAAACAGCAGTGAT-3 '; Reverse (SEQ ID NO: 7), 'CTATTGACTTGGGTTAATCGTGTGA-3'.
- Mitochondrial DNA can accumulate oxidative or structural damage, and the longer the mitochondrial DNA sequence is, the greater the likelihood of having damaged bases that would prevent its amplification by the polymerase during the PCR reaction.
- PCR amplification of two different short sequences with the first two combinations of primers is intended to confirm the specificity of the mitochondrial DNA target.
- the longest sequence amplification was planned to assess the influence of the structural damage of mitochondrial DNA in the PCR reaction and as an additional confirmation of the specificity of the target.
- the conditions for the qPCR were optimized using the melting temperature curve analysis. The size of the amplified products and their homogeneity were estimated by gel electrophoresis.
- Amplification was performed using the following cycle conditions: 95 ° C, 2 min followed by 45 cycles at 95 ° C, 5 s, and 65 ° C, 10s, 20s and 60s for mitochondrial DNA-85, mitochondrial DNA- 153 and mitochondrial DNA 515- respectively.
- the measurements of the Threshold Cycles (Ct) were established within the exponential range.
- the quantification of the circulating mitochondrial DNA in the CSF was performed with a standard calibration curve of purified human mitochondrial DNA from HEK293T cells.
- the purified human mitochondrial DNA was obtained from mitochondria isolated by subcellular fractionation and Percoll gradient. Mitochondria were isolated from 1 x 10 7 HEK293T cells. The cells were washed, collected in 2 ml of isolation buffer (20 mM Hepes, 300 mM sucrose, 1 mM EDTA, 1 mM DTT, pH 7.4), and homogenized in a glass tissue crusher / Potter Teflon -Elvehjem. The crude homogenate was centrifuged once at 1 000 g for 10 min to remove the non-lysed cells and nuclei.
- the supernatant containing the crude mitochondrial fraction was deposited on a discontinuous Percoll gradient, 23/15/10/3% (v / v), in isolation buffer and centrifuged at a speed of 31,000g (Sorvall, FIBERLite F21 rotor) for 5 minutes.
- the fraction containing mitochondria located between layers 15 and 23% of Percoll was transferred to 1.5 ml microcentrifuge tubes and diluted 1: 1 (v: v) in isolation buffer. After mixing gently, the mitochondria were centrifuged at 20,000 g for 20 min. The supernatant was discarded and the DNA was extracted from the mitochondrial sediment by an alkaline lysis protocol (Wizard Plus Miniprep, Promega, Madison, Wl, USA).
- the mitochondrial DNA content in the mitochondrial DNA extract was evaluated by different methods: a) by qPCR with three combinations of primers: a combination of primers, SEQ ID NO: 1 / SEQ ID NO: 4, which amplifies the mtDNA region 515; the combination SEQ ID NO: 1 / SEQ ID NO: 2 that amplifies the mtDNA-153 region and the combination SEQ ID NO: 3 / SEQ ID NO: 4 that amplifies the mtDNA-85 region (Fig. 1A) against a standard curve of the corresponding amplified product cloned into plasmid pJET1 .2; b) by ddPCR.
- the concentration of mitochondrial DNA in CSF was calculated based on the calculation that a copy of mitochondrial DNA corresponds to 18.16 ag. Characterization studies indicated that mitochondrial DNA can be detected in human CSF samples between 29-35 Ct, corresponding to a range of 2-300 fg / mi. Consequently, the concentration range of the standard mitochondrial DNA calibration curve used in the experiments was 1,200 copies of mitochondrial DNA per reaction. The efficiency of the PCR reaction was greater than 0.95 in all the samples analyzed.
- Table 5 shows the primers designed and the corresponding sequences amplified by them.
- Table 5 shows the primers designed and the corresponding sequences amplified by them.
- Table 5 Designed primers and sequences amplified by them.
- NC_012920.1 214-328 bases SEQ ID NO:
- the reaction consisted of 1X ddPCR Mastermix, 900 nm of each of the primers SEQ ID NO: 1 and SEQ ID NO: 2 and 250 nM of a probe marked with FAM.
- the sequence SEQ ID NO: 8 of the probe was 6-carboxyfluorescein (FAM) -5'- CGCTGTAGTATATCCAAAGACAACCATCATTCCCCC-3'-BHQ-1.
- Drop formation was carried out by an emulsion formed by mixing 20 ⁇ 20 of the PCR reaction with 60 I of oil and the drops were generated using the QX100 microfluidic Drop Generator cartridge.
- PCR amplification was performed using a C1000 thermal cycler with the following conditions: 95 ° C 10 minutes, 40 repetitions of 94 ° C 59 0 1 min 30sec C, 98 ° C 10 min.
- the PCR conditions were previously optimized using mitochondrial DNA purified from HEK293T cells.
- the presence or absence of amplification in the drops was evaluated using QX100 Droplet Reader (FAM channel) and the results were analyzed using the QuantaSoft program. The results were expressed in copies of mitochondrial DNA by my CSF ( Figure 5).
- Table 6 shows the designed probes.
- the CSF samples were ultrafiltered using 0.5 ml Amicon Ultra filters (Millipore, MA, USA) with 10,000 MWCO. The samples were diluted to 10 times the initial volume with water and concentrated again to the initial volume by centrifugation at 14,000g for 10 min. This ultrafiltration procedure was performed twice.
- Genomic DNA for genotyping was obtained from the tail following the protocol of the Jackson Laboratory (Bar Harbor, Maine, USA). A length of 1 mm of tail was cut and incubated at 55 0 C in a buffer containing 50 mM KCI, 10 mM Tris-HCl pH 8.3, 2.5 mM MgCl 2 ⁇ 6H20, 0.45% (v / v) Nonidet P40, 0.45% (v / v) Tween 20 and 150 ug / mi Proteinase K (Gibco). After tissue digestion, the samples were incubated for 5 min at 95 0 C to inactivate proteinase K and 2 ⁇ of this sample were used for genotyping by PCR analysis.
- Animals were genotyped by multiplex PCR using the Advanced Supermix SSO reaction (Bio-Rad Laboratories) with primers targeting the APP transgene and the IL-II gene as a positive control.
- the primers were APP: direct (SEQ ID NO: 16), 5'- CATAGCAACCGTGATTGTCATC-3 'and reverse (SEQ ID NO: 17), 5'- TGGATTCTCATATCCGTTCTGC-3';
- IL-II direct (SEQ ID NO: 18), 5'- CTAGGCCACAGAATTGAAAGATCT-3 'and reverse (SEQ ID NO: 19) 5'-3' GTAGGTGGAAATTCTAGCATCATCC.
- the PCR conditions were: 2 min at 98 ° C of initial denaturation, followed by 45 cycles of 5 s of denaturation at 98 ° C, 30 s of primer hybridization and extension at 60 ° C.
- the genotype was determined by analysis of denaturation curves of PCR products .
- Total DNA was extracted by incubation of the cortical neurons in culture with SDS buffer (100 mM Tris-HCI, 10 mM EDTA, 0.5% SDS, 20 g / ml RNAse A, pH 8.0) for 1 hour at 37 0 C at an extraction volume of approximately 1 ⁇ per 1000 cells.
- SDS buffer 100 mM Tris-HCI, 10 mM EDTA, 0.5% SDS, 20 g / ml RNAse A, pH 8.0
- the extracts were incubated with proteinase K (100 ml) for 1 hour at 56 0 C, followed by 10 min at 95 0 C to inactivate the enzyme.
- the qPCR reaction was performed directly in extraction buffer to minimize the loss of mitochondrial DNA in column purification procedures. Characterization studies showed that the extraction buffer diluted to 1: 500 does not inhibit the efficiency of the PCR reaction.
- RNA mitochondrial-1 15 and mitochondrial DNA-699 which produce fragments of 1 15 and 699 base pairs, respectively.
- Each reaction contained 10 ⁇ of 2X SsoAdvanced Supermix (Bio-Rad Laboratories, Hercules, CA 94547, USA), 0.3 mM of each primer and 10 ⁇ of a 1: 250 dilution of the sample extracted in a final volume of 20 ⁇ .
- the sequences of the primers are: Direct mitochondrial DNA-1 (SEQ ID NO: 1 1) 5'- CTAGCCACACCCCCACGGGA-3 'and reverse (SEQ ID NO: 12) 5'- CGTATGACCGCGGTGGCTGG-3'; Mitochondrial DNA-699 the direct mitochondrial DNA primer-1 15 (SEQ ID NO: 1 1) and the reverse (SEQ ID NO: 13) 5'-3- CGGGCGGTGTGTGCGTACTT '.
- the PCR conditions were: 2 min at 95 ° C of initial denaturation, followed by 45 cycles of 5 s of denaturation at 95 ° C and 12 or 60 s of primer hybridization and extension at 60 0 C or 65 0 C for Mitochondrial DNA-1 15 and mitochondrial DNA-699 respectively.
- DNA nuclear DNA
- the sequences of the primers are: direct (SEQ ID NO: 14), 5'-CGCGGTTCTATTTTGTTGGT 3 'and reverse (SEQ ID NO: 15) 5'-AGTCGGCATCGTTTATGGTC-3'.
- the PCR conditions were: 2 min at 95 ° C of initial denaturation, followed by 45 cycles of 5 s of denaturation at 95 ° C and 20 s of primer hybridization and extension at 57 0 C. All reactions were performed in triplicate. . Measurements of threshold cycles (Ct) were established within the exponential range. Only reactions with efficiencies greater than 90% were considered. The absence of non-specific products was confirmed by denaturation curve analysis and gel electrophoresis. The quantification of the mitochondrial and 18S DNA copies of the ribosomal RNA of the DNA was obtained by means of a standard curve of the respective amplification products previously cloned into plasmids pJET1 .2.
- the results are expressed as number of copies of mitochondrial DNA divided by number of copies 18S rRNA.
- Example 2 Detection of circulating extracellular mitochondrial DNA in the CSF.
- Characterization studies showed that it is possible to detect extracellular mitochondrial DNA from a small volume (10 ⁇ ) of human CSF by PCR amplification.
- three different combinations of primers were used (Fig.
- a first pair of primers (SEQ ID NO: 1 / SEQ ID NO: 4) that amplifies a region of 515 base pairs in length (mitochondrial DNA-515) and two other pairs of primers (SEQ ID NO: 3 / SEQ ID NO: 4 and SEQ ID NO: 1 / SEQ ID NO: 2 respectively) nested within this region, amplifying 85 (mitochondrial DNA-85) and 153 (mitochondrial DNA-153) pairs of bases respectively ( Figures 1A, B).
- a qPCR analysis of the CSF samples was then done using a wide range of concentrations of an external standard of human mitochondrial DNA isolated from HEK 293T cells.
- mitochondrial DNA can be detected in CSF in a range between 29-35 Cts, which corresponds to circulating mtDNA concentrations between 2-300 fg / ml. Similar results were obtained with a different qPCR analysis technique based on TaqMan probes and using a different primer combination directed to a region of mitochondrial DNA encoding the ribosomal 12S RNA mitochondrial gene.
- Example 3 Analysis of circulating mitochondrial DNA levels in CSF in asymptomatic individuals at risk of developing AD and in patients diagnosed with sporadic AD.
- the group of EA patients showed a tendency to have a higher mitochondrial DNA content in the CSF than the ⁇ _ ⁇ group in the three primer combinations (SEQ ID NO: 1 / SEQ ID NO: 2; SEQ ID NO: 1 / SEQ ID NO: 4; and SEQ ID NO: 3 / SEQ ID NO: 4), but this difference was not statistically significant.
- no significant differences were observed between the groups in the percentage decrease in mitochondrial DNA amplification between longer products (mtDNA-515) and shorter fragments (mitochondrial DNA and mt-85-153 DNA).
- the decrease in mitochondrial DNA amplification could indicate a smaller number of copies of mitochondrial DNA or also loss of DNA integrity.
- Example 5 Analysis of mitochondrial DNA in young patients without cognitive alterations and without Tau and Amyloid- ⁇ biomarkers but carriers of a pathogenic mutation in PSEN1.
- the mitochondrial DNA content in the CSF of young pre-symptomatic subjects carrying gene mutations that cause AD is studied, and before reach a stage in which alterations appear in biomarkers related to AD.
- the CSF analysis of these pre-symptomatic subjects also revealed a marked reduction in the concentration of circulating mitochondrial DNA in the CSF compared to the corresponding age control group.
- Example 6 Analysis of circulating mitochondrial DNA levels in CSF using ddPCR in patients diagnosed with sporadic AD. Next we proceeded to determine if the differences in the mitochondrial DNA content in the CSF found in our experiments could be validated with a new PCR method, known as digital drop PCR, which has recently made it possible to directly quantify the acid content Nucleic at a resolution level of a single molecule.
- Example 7 Analysis of the number of mitochondrial DNA copies per cell in cortical neurons in culture of APP / PS1 transgenic mice as an animal model of AD.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Analytical Chemistry (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP13856389.5A EP2924124A4 (en) | 2012-11-22 | 2013-10-17 | METHOD FOR DIAGNOSIS AND / OR FORECASTING NEURODEEGENERATIVE DISEASES |
| US14/443,607 US20150361495A1 (en) | 2012-11-22 | 2013-10-17 | Method for the diagnosis and/or prognosis of neurodegenerative diseases |
| JP2015543486A JP2016502406A (ja) | 2012-11-22 | 2013-10-17 | 神経変性疾患の診断及び/又は予知の方法 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| ES201231807A ES2482866B1 (es) | 2012-11-22 | 2012-11-22 | Método de diagnóstico y/o pronóstico de enfermedades neurodegenerativas. |
| ESP201231807 | 2012-11-22 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2014080054A1 true WO2014080054A1 (es) | 2014-05-30 |
Family
ID=50775580
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/ES2013/070713 Ceased WO2014080054A1 (es) | 2012-11-22 | 2013-10-17 | Método de diagnóstico y/o pronóstico de enfermedades neurodegenerativas |
Country Status (5)
| Country | Link |
|---|---|
| US (1) | US20150361495A1 (https=) |
| EP (1) | EP2924124A4 (https=) |
| JP (1) | JP2016502406A (https=) |
| ES (1) | ES2482866B1 (https=) |
| WO (1) | WO2014080054A1 (https=) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3181701A1 (en) | 2015-12-17 | 2017-06-21 | Consejo Superior De Investigaciones Cientificas | Method for the sub-classification of patients suffering from parkinson disease |
| WO2017170571A1 (ja) * | 2016-03-28 | 2017-10-05 | 国立大学法人大阪大学 | 眼科疾患のバイオマーカー |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP6715526B2 (ja) * | 2016-03-28 | 2020-07-01 | 国立大学法人大阪大学 | ストレスバイオマーカー |
| FR3144164A1 (fr) | 2022-12-23 | 2024-06-28 | Neolys Diagnostics | Détermination du statut d’un individu vis-à-vis de la maladie d’Alzheimer |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1994009162A1 (en) | 1992-10-20 | 1994-04-28 | Emory University School Of Medicine | Detection of mitochondrial dna mutations associated with alzheimer's disease and parkinson's disease |
| WO2000063441A2 (en) * | 1999-04-20 | 2000-10-26 | Mitokor | Single nucleotide polymorphisms in mitochondrial genes that segregate with alzheimer's disease |
| WO2007011322A2 (en) | 2004-03-29 | 2007-01-25 | The Regents Of The University Of California | Methods and compositions for diagnosis of alzheimer's disease and other neurodegenerative disorders |
Family Cites Families (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPH1099085A (ja) * | 1996-05-16 | 1998-04-21 | Affymetrix Inc | ヒトミトコンドリアdnaの多形性 |
| US6218117B1 (en) * | 1998-06-15 | 2001-04-17 | Mitokor | Compositions and methods for identifying agents that quantitatively alter detectable extramitochondrial DNA:mitochondrial DNA ratios |
| US6441149B1 (en) * | 1998-06-15 | 2002-08-27 | Mitokor | Diagnostic method based on quantification of extramitochondrial DNA |
| IL159047A0 (en) * | 2001-05-29 | 2004-05-12 | Univ British Columbia | Pharmacological applications of mitochondrial dna assay |
| US20040009518A1 (en) * | 2002-05-14 | 2004-01-15 | The Chinese University Of Hong Kong | Methods for evaluating a disease condition by nucleic acid detection and fractionation |
| EP1877559B1 (en) * | 2005-04-18 | 2010-10-13 | Mitomics Inc. | Mitochondrial mutations and rearrangements as a diagnostic tool for the detection of sun exposure, prostate cancer and other cancers |
| EP2142923A2 (en) * | 2007-03-23 | 2010-01-13 | King's College London | Altered mitochondrial activity in diseases resulting from oxidative stress |
| US9050275B2 (en) * | 2009-08-03 | 2015-06-09 | Theta Biomedical Consulting & Development Co., Inc. | Methods of screening for and treating autism spectrum disorders and compositions for same |
| JP2013511991A (ja) * | 2009-11-25 | 2013-04-11 | クアンタライフ, インコーポレイテッド | 遺伝子材料を検出する方法および組成物 |
| JP5831919B2 (ja) * | 2011-02-21 | 2015-12-09 | 国立大学法人北海道大学 | 神経変性疾患の検査方法 |
-
2012
- 2012-11-22 ES ES201231807A patent/ES2482866B1/es not_active Expired - Fee Related
-
2013
- 2013-10-17 WO PCT/ES2013/070713 patent/WO2014080054A1/es not_active Ceased
- 2013-10-17 US US14/443,607 patent/US20150361495A1/en not_active Abandoned
- 2013-10-17 EP EP13856389.5A patent/EP2924124A4/en not_active Withdrawn
- 2013-10-17 JP JP2015543486A patent/JP2016502406A/ja active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1994009162A1 (en) | 1992-10-20 | 1994-04-28 | Emory University School Of Medicine | Detection of mitochondrial dna mutations associated with alzheimer's disease and parkinson's disease |
| WO2000063441A2 (en) * | 1999-04-20 | 2000-10-26 | Mitokor | Single nucleotide polymorphisms in mitochondrial genes that segregate with alzheimer's disease |
| WO2007011322A2 (en) | 2004-03-29 | 2007-01-25 | The Regents Of The University Of California | Methods and compositions for diagnosis of alzheimer's disease and other neurodegenerative disorders |
Non-Patent Citations (9)
| Title |
|---|
| "Guide for the care and use of laboratory animals", 1996, NATIONAL ACADEMY PRESS |
| BIAN, H. ET AL., NEUROLOGY, vol. 70, 2008, pages 1827 - 1835 |
| FAHY, E. ET AL.: "'Multiplex fluorescence-based primer extension method for quantitative mutation analysis of mitochondrial DNA and its diagnostic application for Alzheimer's disease'", NUCLEIC ACIDS RESEARCH, vol. 25, no. 15, 1997, pages 3102 - 3109, XP002133461 * |
| JACK, C. R. ET AL., LANCET NEUROL., vol. 9, 2010, pages 119 - 128 |
| LAKATOS A. ET AL., NEUROBIOL AGING, vol. 31, no. 8, 2010, pages 1355 - 1363 |
| MAWUENYEGA, K.G. ET AL., SCIENCE, vol. 330, 2010, pages 1774 |
| PODLESNIY, P. ET AL.: "Low cerebrospinal fluid concentration of mitochondrial DNA in preclinical Alzheimer disease", ANNALS OF NEUROLOGY, vol. 74, no. 5, November 2013 (2013-11-01), pages 655 - 668, XP055253227 * |
| See also references of EP2924124A4 |
| SWERDLOW, R.H. ET AL., J. ALSHEIMERS. DIS., 2010, pages 293 - 310 |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3181701A1 (en) | 2015-12-17 | 2017-06-21 | Consejo Superior De Investigaciones Cientificas | Method for the sub-classification of patients suffering from parkinson disease |
| WO2017170571A1 (ja) * | 2016-03-28 | 2017-10-05 | 国立大学法人大阪大学 | 眼科疾患のバイオマーカー |
Also Published As
| Publication number | Publication date |
|---|---|
| EP2924124A1 (en) | 2015-09-30 |
| JP2016502406A (ja) | 2016-01-28 |
| ES2482866B1 (es) | 2015-05-12 |
| ES2482866A1 (es) | 2014-08-04 |
| EP2924124A4 (en) | 2016-08-31 |
| US20150361495A1 (en) | 2015-12-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Podlesniy et al. | Low cerebrospinal fluid concentration of mitochondrial DNA in preclinical Alzheimer disease | |
| US20190002982A1 (en) | Systems For Biomarker Detection | |
| Lue et al. | TREM 2 protein expression changes correlate with a lzheimer's disease neurodegenerative pathologies in post‐mortem temporal cortices | |
| Marques et al. | Epigenetic regulation of BACE1 in Alzheimer’s disease patients and in transgenic mice | |
| Cheng et al. | Prognostic serum miRNA biomarkers associated with Alzheimer’s disease shows concordance with neuropsychological and neuroimaging assessment | |
| Dong et al. | Clinical spectrum and genetic landscape for hereditary spastic paraplegias in China | |
| US10041959B2 (en) | Micro-RNA, autoantibody and protein markers for diagnosis of neuronal injury | |
| ES3032995T3 (en) | Biomarkers of traumatic brain injury | |
| Kudo et al. | Integrative gene–tissue microarray-based approach for identification of human disease biomarkers: application to amyotrophic lateral sclerosis | |
| JP2010536372A5 (https=) | ||
| ES2482866B1 (es) | Método de diagnóstico y/o pronóstico de enfermedades neurodegenerativas. | |
| US20130316338A1 (en) | CCR6 As A Biomarker of Alzheimer's Disease | |
| CN112980941B (zh) | 一种诊断受试者是否患阿尔茨海默病的试剂盒及其用途 | |
| Nakata et al. | Plasma microRNA miR-26b as a potential diagnostic biomarker of degenerative myelopathy in Pembroke welsh corgis | |
| ES3060495T3 (en) | Circulating mirnas as biomarkers for diagnosis of mild cognitive impairment and alzheimer¿s disease | |
| US11041205B2 (en) | Molecular targets for ALS and related disorders | |
| JP2012532623A (ja) | スクリーニング法 | |
| Wang et al. | Spatiotemporal transcriptomic profiling reveals metabolic dysfunction prior to overt tauopathy in the PS19 mouse model | |
| Washington et al. | Peripheral markers of TBI and blood− brain barrier disruption | |
| Kracht | The kaleidoscope of microglia phenotypes: Microglia transcriptional phenotypes from development to disease | |
| Rogers | Cis-Regulatory Elements: Relevance for Alzheimer's Disease | |
| WO2025125705A1 (es) | Biomarcadores nucleares de la enfermedad de alzheimer, sus usos y métodos | |
| Blanch et al. | sKL/mKL Transcript Ratio and Protein Localization Define a Species-and Region-Specific Klotho Signature in the CNS and AD Progression | |
| Kamal et al. | BDNF-AS is a promising downregulated biomarker for the diagnosis in different disease types in multiple sclerosis | |
| Hua et al. | Microglial P2X4 receptors promote ApoE degradation and cognitive deficits in Alzheimer disease |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13856389 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2015543486 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2013856389 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14443607 Country of ref document: US |