WO2014051510A1 - Estimation de l'effet secondaire de la statine - Google Patents

Estimation de l'effet secondaire de la statine Download PDF

Info

Publication number
WO2014051510A1
WO2014051510A1 PCT/SE2013/051120 SE2013051120W WO2014051510A1 WO 2014051510 A1 WO2014051510 A1 WO 2014051510A1 SE 2013051120 W SE2013051120 W SE 2013051120W WO 2014051510 A1 WO2014051510 A1 WO 2014051510A1
Authority
WO
WIPO (PCT)
Prior art keywords
upr
statin
subject
response
determining
Prior art date
Application number
PCT/SE2013/051120
Other languages
English (en)
Inventor
Marc Pilon
Manish RAUTHAN
Original Assignee
Marc Pilon
Rauthan Manish
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Marc Pilon, Rauthan Manish filed Critical Marc Pilon
Publication of WO2014051510A1 publication Critical patent/WO2014051510A1/fr

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6887—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids from muscle, cartilage or connective tissue
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/78—Connective tissue peptides, e.g. collagen, elastin, laminin, fibronectin, vitronectin, cold insoluble globulin [CIG]
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/10—Musculoskeletal or connective tissue disorders

Definitions

  • the present embodiments generally relate to side effect assessment, and in particular to assessment of a risk of statin side effects in subjects.
  • statin-based treatments Millions of patients around the world (>20 million patients in the USA) receive daily statin-based treatments to lower circulating cholesterol levels and thereby prevent cardiovascular diseases. Furthermore, the prescription rates for statins are increasing, with some investigators recommending statins for all individuals above the age of 50 years old, irrespective of cholesterol status.
  • Statins are inhibitors that act by inhibiting 3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) reductase, the rate-limiting enzyme in the mevalonate pathway of cholesterol biosynthesis. This pathway is also essential for the synthesis of other important molecules, such as the short lipids containing prenyl groups that are attached to small GTPases (hydrolase enzymes that can bind and hydrolyze guanosine triphosphate (GTP)) to target them to membranes; dolichol-P, an intermediate during protein glycosylation; and coenzyme Q (CoQ), a soluble antioxidant that is also part of the respiratory chain in mitochondria.
  • GTP small GTPases
  • dolichol-P an intermediate during protein glycosylation
  • CoQ coenzyme Q
  • Statins also have anti-inflammatory effects and are promising anticancer agents. The molecular basis for many of the non-cholesterol-mediated effects of statins is poorly understood, which curtails their usefulness.
  • Statins also have side effects for which the mechanisms are poorly understood. For instance, many patients treated with statins experience adverse side effects including muscle pains (myopathies) or even muscle breakdown (rhabdomyolysis). While the side effects caused by statins are usually well- tolerated, there are low incidences of severe adverse effects: rhabdomyolysis and neuropathy occur in 3.4 and 12 cases per 100 000 person-years, respectively. Furthermore, 10-15 % of the patients experience statin-induced myopathies that often lead to treatment discontinuation. It would therefore be beneficial to identify those patients at risk for statin-induced side effects before prescribing statins.
  • US 7,611 ,902 discloses a diagnostic method for determining statin-induced myopathy.
  • the method includes collecting a lipidomic profile from a biological sample and comparing it to reference lipidomic markers that have been established by combining a pro-inflammatory muscle tissue gene expression profile with a lipidomic profile associated with high dosage statin treatment.
  • US 2010/0310574 discloses a diagnostic method for detecting statin-mediated myopathy.
  • the method comprises measuring the level of an atrogin-1 polypeptide, which is a muscle-specific F-box protein that is generally highly expressed during muscle atrophy. This measured level is compared to a reference level and an alteration in the atrogin-1 level relative to the reference level is diagnostic of a statin-mediated myopathy.
  • US 2003/0224470 discloses a diagnostic method for detecting statin-mediated myopathy. The method comprises detecting the presence of 3-methylglutaconic acid in the urine of the patient taking statin.
  • US 2012/0202205 discloses a diagnostic method for detecting the susceptibility of a patient to statin- induced myopathy.
  • the method comprises detecting the presence or absence of one or more polymorphisms in the SLC01 B1 gene, which encodes the organic anion transport protein OATP1 B1 that is known to affect the hepatic uptake and biliary excretion of various drugs, including statins.
  • US 2007/0202518 discloses a diagnostic method for predicting a patient's susceptibility to muscular injury and muscular side effects in response to statin therapy.
  • the method comprises detecting genetic variants in angiotensin II Type 1 receptor (AGTR1) and nitric oxide synthase 3 (NOS3) genes.
  • AGTR1 angiotensin II Type 1 receptor
  • NOS3 nitric oxide synthase 3
  • An aspect of the embodiments relates to a method of determining the susceptibility of a subject, preferably a mammalian subject and more preferably a human subject, to at least one statin-induced side effect.
  • the method comprises determining a mitochondrial unfolded protein response (UPR mt ) response for the subject and determining the susceptibility of the subject to the at least one statin- induced side effect based on the determined UPR mt response.
  • UPR mt mitochondrial unfolded protein response
  • a related aspect of the embodiments defines a kit configured to determine the susceptibility of a subject, preferably a mammalian subject and more preferably a human subject, to at least one statin- induced side effect.
  • the kit comprises means configured to determine a UPR mt response for the subject.
  • the kit also comprises instructions defining that the susceptibility of the subject to the at least one statin-induced side effect is determined based on the determined UPR mt response.
  • Another aspect of the embodiments relates to a method of determining a suitable dosage for a subject, preferably a mammalian subject and more preferably a human subject, in need of treatment with at least one statin.
  • the method comprises determining the susceptibility of the subject to at least one statin-induced side effect as defined above and determining a suitable dosage of the at least one statin for the treatment based, at least partly, on the determined susceptibility of the subject to the at least one statin-induced side effect.
  • a related aspect of the embodiments defines a kit configured to determine a suitable dosage for a subject, preferably a mammalian subject and more preferably a human subject, in need of treatment with at least one statin.
  • the kit comprises means configured to determine the susceptibility of the subject to at least one statin-induced side effect.
  • the means is in the form of the above mentioned kit configured to determine the susceptibility of a subject to at least one statin- induced side effect.
  • the kit also comprises instructions defining that the suitable dosage of the at least one statin for the treatment is determined based, at least partly, on the determined susceptibility of the subject to the at least one statin-induced side effect.
  • a further aspect of the embodiments relates to a method of reducing the risk of side effects in a subject, preferably a mammalian subject and more preferably a human subject, during treatment with at least one statin.
  • the method comprises determining a suitable dosage of the at least one statin for the subject as defined above and administering the at least one statin according to the determined dosage to the subject.
  • a related aspect of the embodiments defines a kit configured to reduce the risk of side effects in a subject, preferably a mammalian subject and more preferably a human subject, during treatment with at least one statin.
  • the kit comprises means configured to determine a suitable dosage of the at least one statin for the subject.
  • the means is in the form of the above mentioned kit configured to determine a suitable dosage for a subject in need of treatment with at least one statin.
  • the kit also comprises instructions defining that the at least one statin is to be administered to the subject according to the determined dosage.
  • Fig. 1 illustrates an overview of the screening strategy used to isolate and identify mutations that confer fluvastatin resistance in Caenor abditis elegans.
  • Fig. 2 illustrates mutations in atfs-1 that confer resistance to inhibitors of the mevalonate pathway.
  • A Simplified version of the mevalonate pathway, its sub-branches, and sites of action of various inhibitors. The cholesterol branch of the pathway is absent in C. elegans.
  • B Fluvastatin dose- response curve of different atfs-1 alleles. The novel atfs-1 alleles confer resistance to rosuvastatin (C) and to ibandronate (D).
  • C-E Mevalonate abrogates the effects of fluvastatin on wild-type worms, but has no effect on three gain-of-function atfs-1 mutants. The bars in (C-E) show the average ⁇ SEM (n>20).
  • Fig. 3 illustrates that the novel atfs-1 mutants carry gain-of-function (gof) alleles that activate the UPR mt .
  • A RNAi against atfs-1 suppresses the fluvastatin resistance of the atfs-1 ⁇ et15) allele.
  • the control RNAi vector (L4440) has no effect.
  • B The affe- " /(gk3094) loss-of-function mutant is hypersensitive to fluvastatin. It fails to grow on 0.1 mM, a concentration that has only a minor effect on wild-type and no effect on the atfs-1 ⁇ et15) gain-of-function allele.
  • Fig. 4 illustrates that pre-induction of UPR mt using ethidium bromide protects against the adverse effects of statins in nematodes, yeast, and mammalian cells.
  • A-B Worms pre-treated with ethidium bromide are viable and grow into fertile adults when subsequently cultivated on 0.5 mM fluvastatin.
  • C The fission yeast Sacc aromyces pombe tolerates higher doses of fluvastatin when pre-treated with 250 ng/ml or 500 ng/ml ethidium bromide.
  • the mammalian fibroblast cell line NIH 3T3 shows better viability in the presence of 1 mM fluvastatin when it has been pre-treated with 1 ⁇ / ⁇ ethidium bromide. Bars show the average readout from the Presto Blue Cell Viability assay (Invitrogen) ⁇ SEM (n>5 wells; ***: p ⁇ 0.001).
  • Fig. 5 illustrates that the affe-ffgof) alleles protect C. elegans against prenylation inhibition.
  • A Images of wild-type (WT), atfs-1 (gk3094), and atfs-1(et15) worms cultivated for 96 hours on control or gliotoxin (100 ⁇ ) plates.
  • the gain-of-function atfs-1 (et15) allele confers partial resistance to gliotoxin while the loss-of-function affe-1 (gk3094) allele confers hypersensitivity as assessed by measuring growth (B) or viability (C) after 96 hours on 100 ⁇ gliotoxin.
  • the affe-1 [et15) allele can partially rescue the protein prenylation defects caused by fluvastatin.
  • the protein prenylation reporter (pGLO-1 P::GFP- CAAX) shows clear membrane enrichment in untreated L1 larvae for both wild-type and affe-1 ⁇ et15). In L1 larvae from parents cultivated in the presence of 0.5 mM statin for 48 hours, only the affe-1 ⁇ et15) mutant continues to show membrane enrichment (white arrowheads).
  • E Quantification of the prenylation assay using pGLO-1 P::GFP-CAAX. The results are presented as the number of intestinal cells showing distinct membrane enrichment.
  • Fig. 6 illustrates that the statin-resistant mutants are less healthy than wild-type worms.
  • the affe- 1 (gof) mutants have reduced life span compared to wild-type worms. Mean life spans in days were: wild-type (15.68 ⁇ 0.85), et15 (11.35 ⁇ 0.64), et17 (13.44 ⁇ 0.82), and et18 (12.62 ⁇ 0.67).
  • the brood size of the affe-1 (gof) mutants is smaller than for wild-type worms.
  • Fig. 7 illustrates that pre-induction of the UPR mt protects C. elegans and mammalian cells from the effects of statins.
  • A Worms pre-treated with paraquat are able to reach adulthood and reproduce while worms placed directly on fluvastatin arrest as small larvae.
  • B Paraquat pre-treatment protects C. elegans from the lethal effects of statins.
  • C NIH 3T3 cells pre-treated with ethidium bromide show better cell morphology and adhesion when subsequently cultured in the presence of 10 mM fluvastatin. The deleterious effects of statins on NIH 3T3 are on-target effects because they can be abrogated by including 10 mM mevalonate in the culture medium.
  • Fig. 8 illustrates that the atfsA [et15) allele confers resistance to the respiration inhibitory effects of fluvastatin (A), but not to the growth inhibitory effects of three respiratory chain inhibitors (C-D).
  • Fig. 9 schematically illustrates UPR mt activation pathway in a human cell (1).
  • Fig. 10 illustrates that prolonged treatment with ethdium bromide results in activation of mitochondrial chaperones (hsp10 and hsp75) in mouse fibroblast 3T3 cells.
  • the figure also illustrates that the QPCR method can be used to monitor the levels of UPR mt activation. Error bars are standard error of the mean of biological triplicates for each gene.
  • the present embodiments generally relate to side effect assessment, and in particular to assessment of a risk of statin-induced side effects in subjects.
  • the embodiments enable identification of subjects that are susceptible to at least one statin-induced side effect if the subject is undergoing treatment with the at least one statin.
  • the present embodiments can therefore be used to identify subjects that should avoid statins during treatment of, for instance, high cholesterol levels. For those subjects alternative cholesterol lowering medicaments or treatments could be more beneficial.
  • the present embodiments can also be used to individually adapt statin dosages for subjects based on their susceptibility to statin-induced side effects. Hence, the suitable statin dosages for these subjects can be determined to minimize or at least reduce the risk of developing side effects from treatment with statin.
  • HMG-CoA reductase inhibitors are a class of drugs used to, among others, lower cholesterol levels by inhibiting the enzyme HMG- CoA reductase, which plays a central role in the production of cholesterol in the liver, see Fig. 2A.
  • Statin-induced side effects refer to side effects seen in some subjects undergoing statin treatment. Such side effects include muscle pain (myopathy), muscle breakdown (rhabdomyolysis) and neuropathy. Embodiments as disclosed herein can therefore be used to detect subjects susceptible to statin-induced myopathy, susceptible to statin-induced rhabdomyolysis, susceptible to statin-induced neuropathy or susceptible to at least two of statin-induced myopathy, statin-induced rhabdomyolysis and statin-induced neuropathy.
  • the embodiments are based on the effects of the mitochondrial unfolded protein response (UPR mt ) in protecting cells and organisms against the side effects of statins.
  • UPR mt mitochondrial unfolded protein response
  • a subject's UPR mt response determines or at least significantly affects the subject's susceptibility to statin-induced side effects.
  • UPR mt is a stress response configured to maintain protein-folding homeostasis within mitochondria.
  • UPR mt generally activates transcription of nuclear-encoded mitochondrial chaperone and protease genes to promote protein homeostasis within the organelle.
  • the mitochondrial chaperones are required for protein import and facilitate protein folding, whereas the proteases degrade proteins that fail to fold or assembly correctly.
  • Mitochondria-localized chaperones include a heat shock protein 70 kDa (HSP70) family member, mtHSP70, as well as HSP60 and HSP10, sometimes referred to as chaperonin 60 (CPN60) and CPN10, respectively.
  • a further mitochondrial chaperone is mtDnaJ, also referred to as HSP40.
  • Mitochondrial proteases include the protease encoded by the ClpP gene.
  • Fig. 9 is a schematic illustration of UPR mt signaling in a mammalian cell.
  • UPR mt is generally initiated by the activation of the chop gene and the c/ebp gene through a respective AP-1 element in the chop promoter and c/ebp gene.
  • CHOP C/EBP homology protein
  • C/ ⁇ CCAAT-enhancer-binding protein ⁇
  • the promoters of these UPR mt responsive genes comprise a CHOP element (GPTTGCA, wherein P denotes the purine nucleoside adenosine or guanosine) to which the CHOP- C/ ⁇ dimer binds.
  • Mitochondrial response genes typically also comprise two additional conserved promoter elements denoted mitochondrial unfolded protein response element 1 (MURE1) and MURE2.
  • synthesis of the corresponding transcript and translation of the encoded protein as well as any post-translational modification, such as phosphorylation, processing, cleavage, glycosylation, etc., and transport to the mitochondria of the UPR mt response or effector proteins, such as mitochondrial chaperones, e.g. mtHSP70, HSP60, HSP10, and/or mitochondrial protease, such as ClpP.
  • mitochondrial chaperones e.g. mtHSP70, HSP60, HSP10, and/or mitochondrial protease, such as ClpP.
  • the degree of activation of UPR mt in response to a given mitochondrial stress may vary among subjects, and such variations are revealed in varying levels of expression and localization to the mitochondria of the UPR mt response or effector proteins.
  • the difference in susceptibility to statin-induced side effects as seen among patients is, according to the present embodiments, based, at least partly, on differences in UPR mt responses among the patients.
  • techniques for monitoring UPR mt responses, or detecting or scoring differences in UPR mt responses can be used to determine the susceptibility of a subject to statin-induced side effects and detect subjects that are likely to suffer from such statin-induced side effects if prescribed statin to, for instance, lower the cholesterol level in the subjects.
  • variation in UPR mt activity/regulation may account for the variation in the effects that statins have on different patients.
  • UPR mt signaling and response differs significantly from the more well known and studied endoplasmic reticulum unfolded protein response (UPR er ).
  • UPR er involves a wide range of genes and has three signaling pathways: IRE-1 , PERK and ATF6.
  • the genes and proteins involved in UPR er are generally different from the genes and proteins of the UPR mt signaling.
  • statins on the nematode C. elegans, a well established model organism, have previously been described (3). That article established C. elegans as an excellent platform with which to elucidate the non-cholesterol activities of statins.
  • randomly mutagenized C. elegans have been screened to isolate mutants that can be propagated in the presence of statins, i.e. that are resistant to statins.
  • statin-resistant mutants were identified, and, astonishingly, all of them had activating mutations in the same protein, i.e. activating transcription factor associated with stress-1 (ATFS-1). This protein is the key activator of the UPR mt stress response that can protect mitochondria in C elegans.
  • UPR mt Activation of UPR mt also protected yeast cells and mammalian cells from the effects of statins.
  • the UPR mt is a mechanism that can protect human cells from the deleterious effects of statins.
  • C. elegans is eminently suited to study the cholesterol-independent effects of statins because it lacks the sterol synthesis branch of the mevalonate pathway but retains the other branches (Fig. 2A).
  • statins cause decreased protein prenylation, induction of the UPR er , growth arrest, and lethality. These are all on-target effects of statins because they can be abrogated by the inclusion of mevalonate in the culture medium.
  • ATFS-1 mitochondrial targeting signal
  • NLS nuclear localization signal
  • ATFS-1 is not efficiently targeted to the mitochondria and therefore allowed to accumulate in the nucleus and activate target genes, including the mitochondrial chaperones HSP-6 and HSP60.
  • the novel statin-resistant atfs-1 alleles are gain-of-function (gof) mutations because:
  • null affe-1 (gk3094) allele is hypersensitive to statin (Fig. 3B);
  • the UPR mt appears to be an evolutionarily conserved mechanism to cope with the consequences of an impaired mevalonate pathway because statin resistance was also induced in the yeast Saccharomyces pombe (Fig. 4C) and the mammalian fibroblast line NIH 3T3 when the mitochondrial stress response was activated (Fig. 4D and Fig. 7C).
  • Fig. 4C yeast Saccharomyces pombe
  • NIH 3T3 when the mitochondrial stress response was activated
  • Fig. 4D and Fig. 7C Conservation of the UPR mt as a statin resistance mechanism in C. elegans, S. pombe, and mammals is especially important in view of the fact that the latter two types of organisms do have the branch of the mevalonate pathway that leads to sterol synthesis, which is lacking in C. elegans.
  • the cytotoxic effects of statins are primarily related to mitochondria homeostasis even in organisms where the main output of the pathway is considered to be ste
  • statins i.e. statins
  • Fig. 8A fluvastatin treatment causes reduced respiration in C. elegans, and the atfs- ⁇ ⁇ et15) mutant respires normally even in the presence of fluvastatin
  • Gliotoxin is an inhibitor of farnesyl-transferase, the enzyme that ligates farnesyl-groups to the C-terminal end of small GTPases, resulting in growth defects and lethality in worms. Gliotoxin also suppresses the effect of an activated form of the Ras GTPase.
  • the affe-1 (efi 5) gain-of-function mutant is resistant to gliotoxin while the affe-1 (gk3094) null mutant is hypersensitive (Figs. 5A-5B).
  • statins exert their negative effects on mitochondria via inhibition of small GTPases (Figs. 5A-B).
  • the affe- ⁇ ⁇ etlS) and affe-1 [et18) mutants were also partially resistant to the prenylation inhibitory effects of statins (Figs. 5C-5D).
  • statins interfere with mitochondria homeostasis, the mechanism is related to the effects of statins on small GTPase prenylation, and the UPR mt is a powerful protective pathway (Fig. 5E).
  • Fig. 5E Many studies have previously pointed to mitochondria as a basis for the adverse effects of statins, but no mechanism had been proposed that could protect cells from these effects.
  • Data as presented herein indicate that UPR mt can help preserve mitochondria homeostasis in the presence of statins, which allows the cells to better utilize the residual output from the mevalonate pathway, hence sustaining essential GTPase prenylation.
  • An aspect of the embodiments relates to a method of determining the susceptibility of a subject, preferably a mammalian subject and more preferably a human subject, to at least one statin-induced side effect.
  • the method comprises determining a UPR mt response for the subject and determining the susceptibility of the subject to the at least one statin-induced side effect based on the determined UPR mt response.
  • the method further comprises administering at least one statin to the subject based on the determined susceptibility.
  • the method further comprises withholding administration of a statin based on the determined susceptibility.
  • Another aspect of the embodiments relates to a method of determining a suitable dosage for a subject, preferably a mammalian subject and more preferably a human subject, in need of treatment with at least one statin.
  • the method comprises determining the susceptibility of the subject to at least one statin-induced side effect as defined above and determining a suitable dosage of the at least one statin for the treatment based, at least partly, on the determined susceptibility of the subject to the at least one statin-induced side effect.
  • a further aspect of the embodiments relates to a method of reducing the risk of side effects in a subject, preferably a mammalian subject and more preferably a human subject, during treatment with at least one statin.
  • the method comprises determining a suitable dosage of the at least one statin for the subject as defined above and administering the at least one statin according to the determined dosage to the subject.
  • An additional aspect of the embodiments relates to a method of treating a subject, preferably a mammalian subject and more preferably a human subject, with at least one statin, comprising determining a suitable dosage of the at least one statin for the subject as defined above and administering the at least one statin according to the determined dosage to the subject.
  • a further aspect of the embodiments relates to a method of treating a subject, preferably a mammalian subject and more preferably a human subject, with at least one statin, comprising administering a suitable dosage of the at least one statin, the suitable dosage is determined as defined above.
  • An additional aspect of the embodiments relates to a method of treating a subject in need of treatment with at least one statin, preferably a mammalian subject and more preferably a human subject, comprising administering at least one statin to a subject that has been determined to have a normal or enhanced UPR mt response.
  • a normal or enhanced UPR mt response is one that is equal to or greater than the UPR mt response measured in a population of subjects that do not exhibit side effects in response to statin administration.
  • a further aspect of the embodiments relates to a method of monitoring a subject, preferably a mammalian subject and more preferably a human subject, that is currently being treated with at least one statin by determining the UPR mt response of the subject and lowering the dose of at least one statin or halting administration of at least one statin if the UPR mt response is below normal or baseline UPR mt response.
  • Another aspect of the embodiments relates to an assay for determining the susceptibility of a subject, preferably a mammalian subject and more preferably a human subject, to at least one statin-induced side effect, the assay comprising determining a UPR mt response for the subject and determining the susceptibility of the subject to the at least one statin-induced side effect based on the determined UPR mt response.
  • statin could suffer from any medical condition for which statin could be prescribed as medicament.
  • the subject is suffering from high (circulating) cholesterol levels.
  • the anti-inflammatory or anticancer effects of statins are used so the subject is suffering from an inflammatory or cancer disease.
  • kits configured to determine the susceptibility of a subject, preferably a mammalian subject and more preferably a human subject, to at least one statin- induced side effect.
  • the kit comprises means configured to determine a UPR mt response for the subject.
  • the kit also comprises instructions defining that the susceptibility of the subject to the at least one statin-induced side effect is determined based on the determined UPR mt response.
  • a further aspect of the embodiments relates to a kit configured to determine a suitable dosage for a subject, preferably a mammalian subject and more preferably a human subject, in need of treatment with at least one statin.
  • the kit comprises means configured to determine the susceptibility of the subject to at least one statin-induced side effect.
  • the means is in the form of the above mentioned kit configured to determine the susceptibility of a subject to at least one statin- induced side effect.
  • the kit also comprises instructions defining that the suitable dosage of the at least one statin for the treatment is determined based, at least partly, on the determined susceptibility of the subject to the at least one statin-induced side effect.
  • kits configured to reduce the risk of side effects in a subject, preferably a mammalian subject and more preferably a human subject, during treatment with at least one statin.
  • the kit comprises means configured to determine a suitable dosage of the at least one statin for the subject.
  • the means is in the form of the above mentioned kit configured to determine a suitable dosage for a subject in need of treatment with at least one statin.
  • the kit also comprises instructions defining that the at least one statin is to be administered to the subject according to the determined dosage.
  • the determination of the UPR mt response in a subject can be performed according to various embodiments as further described below. Also the determination of a subject's susceptibility to at least one statin-induced side effect based on the determined UPR mt response can be performed according to various embodiments.
  • the determination of the UPR mt response could involve determining the expression and/or activity level of at least one gene involved in the UPR mt .
  • the translation and/or activity level of at least one protein encoded by a gene involved in the UPR mt response could be determined.
  • the determination of the subject's susceptibility could involve comparing a value representing expression and/or activity level of the at least one gene and/or a value representing translation and/or activity level of the at least one protein with a respective threshold.
  • the subject has a high value, indicating an active UPR mt response, he/she could be predicted to be less susceptible to a statin-induced side effect as compared to a subject having a comparatively lower value.
  • the threshold alternatively, exceeds or is equal to the threshold
  • the subject is predicted or determined to have a low susceptibility to statin-induced side effects
  • the value is equal to or below the threshold (alternatively, is below the threshold) the subject is predicted to have a high susceptibility to statin-induced side effects.
  • This concept can be extended to the case with more than one threshold per activity/expression/translation value.
  • subjects could be categorized to either have low susceptibility, medium susceptibility or high susceptibility to statin-induced side effect depending on whether the determined value representing the subject's UPR mt response exceeds a first threshold and a second threshold, is below the first threshold but exceeds the second threshold or is below both the first and second threshold, respectively.
  • each such determined value is preferably compared to a respective threshold or a respective set of thresholds.
  • the determination of the subject's susceptibility could then be based on the combined assessment of the different values and their respective threshold(s).
  • the value(s) of the threshold(s) can be determined by the person skilled in the art, for instance by dividing test subjects into two groups; one containing subjects diagnosed as suffering from statin- induced side effects and one containing subjects that do not suffer from any statin-induced side effects.
  • the value(s) of the expression and/or activity of the at least one gene and/or of the translation and/or activity of the at least one protein is(are) then determined for the test subjects.
  • the threshold value(s) is(are) then set to enable a discrimination between the susceptible test subjects and the non- susceptible test subjects.
  • a respective control pattern e.g. an average gene or protein profile or pattern
  • the prediction of a subject's susceptibility to statin-induced side effects could then be based on pattern matching by calculating a respective measure indicating how close the subject's gene or protein profile matches the control or average gene or protein profile of the two test groups.
  • statin-induced side effects such as statin-induced myopathy, statin- induced rhabdomyolysis, and statin-induced neuropathy.
  • a respective threshold, set of thresholds or average gene or protein profiles could be determined and used for each such type of statin-induced side effect.
  • Determination of UPR mt response in a subject can be performed according to various embodiments as is further disclosed herein.
  • genotyping is used to determine the UPR mt response in a subject.
  • genotyping is used to detect or determine whether a subject has a mutation or an allele associated with susceptibility to statin-induced side effects in any of the genes involved in the UPR mt signaling, i.e. inferior or impaired UPR mt response, such as reduced or inferior UPR mt activation or impaired UPR mt regulation.
  • the genotyping approach could be used to detect or determine whether a subject has no mutation or an allele associated with low or no susceptibility to statin-induced side effects in any of the genes involved in the UPR mt signaling, i.e. normal or even enhanced UPR mt response.
  • a body sample preferably a body fluid sample and more preferably a blood sample
  • the blood sample could be collected in a tube containing heparin as anticoagulant.
  • DNA from the blood sample is purified, for instance using the QIAamp DNA Blood Mini Kit (Qiagen).
  • the purified DNA can then be used as a template in an amplification assay, e.g., a polymerase chain reaction (PCR) to amplify a target gene involved in the UPR mt signaling, a target portion of a gene involved in the UPR mt signaling and/or a regulatory sequence, such as promoter sequence or a portion thereof, of a gene involved in the UPR mt signaling.
  • amplification assay e.g., a polymerase chain reaction (PCR) to amplify a target gene involved in the UPR mt signaling, a target portion of a gene involved in the UPR mt signaling and/or a regulatory sequence, such as promoter sequence or a portion thereof, of a gene involved in the UPR mt signaling.
  • PCR polymerase chain reaction
  • the HotStarTaq Plus DNA Polymerase kit Qiagen
  • Qiagen can be used in the PCR-based amplification.
  • PCR can be used to amplify the chop gene using the primers 5'- GTCAGAGACTTAAGTCT-3' (SEQ ID NO: 1) and 5'-TGGCTCATAGAAAGTCA-3' (SEQ ID NO: 2) and the HotStarTaq Plus DNA Polymerase kit (Qiagen).
  • the resulting 3.9 kb product containg the chop gene sequence and obtained with the two above- mentioned primers can be separated on a 0.8 % agarose (Sigma) gel in a Tris-Borate-EDTA buffer using a Standard Submarine Electrophoresis Unit (Hoefer), cut out from the gel and the DNA is purified using a QIAquick Gel Extraction Kit (Qiagen).
  • the purified DNA can then be used for DNA sequencing to detect any mutation or target allele.
  • the purified DNA may be recovered in 50 ⁇ water and shipped for sequencing to the company Eurofins, using their Value Read service. Presence of a mutation or indicative polymorphism in the sequence is predictive of impaired activity in the UPR mt of the patient, hence gives an impaired UPR mt response. Such a patient is then regarded as being susceptible to statin-induced side effects. This type of assay is based on a correlation between genetic variant and UPR mt activity and statin sensitivity in patients.
  • Such genetic variants could be identified by correlating single-nucleotide polymorphism (SNP) variants with UPR mt activity among individuals, or by sequencing parts of the genomes of individuals that vary in their UPR mt . Then, variations in genes that are part of the UPR mt signaling can be identified and tested to determine whether these gene variants explain the variation in UPR mt . Genotyping of patients would then be used to predict who is at risk for the statin side effects.
  • SNP single-nucleotide polymorphism
  • genotype there are many ways to genotype including sequencing; hybridization-based methods, such as dynamic allele-specific hybridization, molecular beacons, SNP microarrays; enzyme-based methods, such as restriction fragment length polymorphism, PCR-based methods, flap endonuclease, primer extension, 5'-nuclease, oligonucleotide ligase assay; and other post-amplification methods, such as single strand conformation polymorphism, temperature gradient gel electrophoresis, denaturing high performance liquid chromatography, high-resolution melting of the entire amplicon, use of DNA mismatch-binding proteins and SNPIex.
  • quantitative PCR quantitative PCR (QPCR) can be used to determine the UPR mt response in a subject.
  • QPCR is used to determine the cellular UPR mt response in a sample taken from the subject. It is then possible to determine how the UPR mt response is affected by statin addition. Thus, if the subject is capable of providing an effective UPR mt in response to the statin addition, the subject is regarded as being less susceptible to statin-induced side effect. However, if the statin-induced UPR mt response is impaired or inferior as determined by QPCR the subject is regarded as being susceptible to statin-induced side effects.
  • a body sample preferably a body fluid sample and more preferably a blood sample
  • a body fluid sample is taken from a patient that is candidate for statin therapy and collected, e.g., in a clinical Purple tube containing EDTA as anticoagulant.
  • the white blood cells are then purified, e.g., by preparative centrifugation as follows:
  • the cells are resuspended in, for instance, RPMI 1640 culture medium (ATCC Modification) (InVitrogen) containing 10 % fetal calf serum (InVitrogen) to a density of 500,000 cells per ml, then dispensed into, for instance, six wells of a 96-well plate. Fluvastatin or another statin to be tested is added to three of the wells to a final concentration of, e.g., 10 ⁇ and the three other wells serve as controls. The wells are kept at 37°C for 4 hours in an incubator with an air C0 2 concentration of 5 %.
  • RPMI 1640 culture medium ATCC Modification
  • InVitrogen 10 % fetal calf serum
  • Fluvastatin or another statin to be tested is added to three of the wells to a final concentration of, e.g., 10 ⁇ and the three other wells serve as controls.
  • the wells are kept at 37°C for 4 hours in an incubator
  • the mRNA from the cultures is purified using the Dynabeads® mRNA DIRECTTM Kit (InVitrogen) or some other mRNA purifying kit.
  • the purified mRNA is then used as a template in a QPCR using the Fast SYBR® Master Mix (InVitrogen) or some other kit to amplify a transcript of a target gene involved in the UPR mt signaling or a transcript of a target portion of a gene involved in the UPR mt signaling.
  • QPCR can be used to amplify the Hsp60 mRNA transcript using the primers 5'- TAGAGGCGGAGGGAGGGGA-3' (SEQ ID NO: 3) and 5'- TCTCCACAGAAAGGCTGCT-3' (SEQ ID NO: 4).
  • the average ratio of the QPCR results of fluvastatin-treated wells over the control wells provides a UPR mt score or value that is representative of the UPR mt response of the subject and thereby representative of the patient's susceptibility to fluvastatin-induced side effects.
  • the UPR mt score can be compared to a defined threshold. In such a case, if the UPR mt score is below the threshold, the subject is regarded as being susceptible to fluvastatin- induced side effect.
  • enzyme-linked immunosorbant assay can be used to determine the UPR mt response in a subject.
  • ELISA enzyme-linked immunosorbant assay
  • ELISA is used to determine the cellular UPR mt response in a sample taken from the subject. It is then possible to determine how the UPR mt response is affected by statin addition.
  • statin addition if the subject is capable of providing an effective UPR mt in response to the statin addition, the subject is regarded as being less susceptible to statin-induced side effect.
  • the statin-induced UPR mt response is impaired or inferior as determined by ELISA the subject is regarded as being susceptible to statin-induced side effects.
  • a body sample preferably a body fluid sample and more preferably a blood sample
  • a body fluid sample is taken from a patient that is candidate for statin therapy and collected, e.g., in a clinical Purple tube containing EDTA as anticoagulant.
  • the white blood cells are then purified, e.g., by preparative centrifugation as follows:
  • the cells are resuspended in, for instance, RPMI 1640 culture medium (ATCC Modification) (InVitrogen) containing 10 % fetal calf serum (InVitrogen) to a density of 500,000 cells per ml, then dispensed into, for instance, 12 wells of a 96-well plate. Fluvastatin or another statin to be tested is added to six of the wells to a final concentration of, e.g., 10 ⁇ and the six other wells serve as controls. The wells kept at 37°C for 4 hours in an incubator with an air C0 2 concentration of 5 %. The abundance of at least one of the proteins involved in the UPR mt signaling can then be determined.
  • RPMI 1640 culture medium ATCC Modification
  • InVitrogen 10 % fetal calf serum
  • Fluvastatin or another statin to be tested is added to six of the wells to a final concentration of, e.g., 10 ⁇ and the six other
  • the abundance of the HSP60 protein is determined in half of the samples and the abundance of an internal control protein, such as alpha-tubulin, is determined in the other half of the samples.
  • This determination can be performed, e.g., using an In-Cell ELISA Detection Kit (Thermo Scientific) together with a custom-developed anti-HSP60 antibody and an anti-alpha tubulin antibody (Thermo Scientific).
  • the average ratio of the ELISA results (HSP60 over alpha-tubulin ratio) of fl uvastati n-treated wells over the control wells provides a UPR mt score or value that is representative of the UPR mt response of the subject and thereby representative of the patient's susceptibility to fl u astati n-i n d uced side effects.
  • the UPR mt score can be compared to a defined threshold. In such a case, if the UPR mt score is below the threshold, the subject is regarded as being susceptible to fluvastatin- induced side effect.
  • a variant of the ELISA concept could be to monitor UPR mt activity by providing a fixed amount of a substrate then quantifying the UPR mt chaperone activity using an antibody that discriminates between two folded states, i.e. pre- versus post-chaperone.
  • the UPR mt response involves the expression of chaperones that modify protein folding as well as proteases.
  • a substrate for one of the chaperones or proteases e.g. a modified form of green fluorescent protein or other reporter protein
  • Detection of this color or absorbance change using a spectrophotometer would be a measurement of the UPR mt response.
  • immunoassay-based techniques and/or techniques that involve measuring amounts of cellular RNA.
  • immunoassay-based techniques to measure UPR mt response comprise Western blotting, ELISA, indirect immunofluorescence assays and immunoprecipitation assays.
  • techniques involving measuring an amount of cellular RNA comprise amplification assays (quantitative or semiquantitative PCR) or hybridization assays (Northern blotting, slot blotting, dot blotting, nuclease protection assays or microarray assays). Also allele specific oligonucleotides or enzymatic techniques could be used.
  • a measure of UPR mt response in mammals, such as humans, may involve measuring the level of expression and/or activity of any of the genes and/or their encoded proteins involved in the UPR mt signaling.
  • Non-limiting examples include the mitochondrial chaperones, such as mtHSP70 (TRAP1), HSP60, HSP10, and mtDNAJ, the mitochondrial proteases, such as ClpP and HtrA2, and/or the transcription regulators JNK2, CHOP, CEBPp, SatB2, Ubl5 and the nuclear hormone receptor estrogen receptor alpha (ERa) or any combination thereof.
  • the level of expression and/or activity of two or more e.g.
  • the determination of a UPR mt response is then preferably based on profile or pattern matching between a gene or protein profile generated from a subject and a reference gene or protein profile obtained from at least one subject known to be suffering from statin-induced side effects or at least one subject known to not suffer from any statin-induced side effects.
  • Monoclonal and polyclonal antibodies useful for measuring UPR mt response can be produced by methods known in the art. Methods to design nucleic acid sequences useful for detecting a specific amount of cellular RNA in a hybridization or amplification based methodology are also known in the art.
  • kits of the embodiments comprise means to perform the intended function, i.e. determine a UPR mt response in a subject, determine the susceptibility of the subject to at least one statin-induced side effect or determine a suitable dosage of the at least one statin for the subject.
  • the particular means of the kits depend on which of the UPR mt response assessment technique used.
  • the kit when using genotyping the kit comprises the primers required to amplify the target gene involved in the UPR mt signaling, the target portion of a gene involved in the UPR mt signaling and/or the regulatory sequence of a gene involved in the UPR mt signaling.
  • the kit optionally, but preferably, also comprises reagents needed to produce the purified DNA. Examples of such reagents include QIAamp DNA Blood Mini Kit, HotStarTaq Plus DNA Polymerase kit and/or QIAquick Gel Extraction Kit.
  • the kit may optionally also comprise a tube containing heparin or other anticoagulant, Tris-Borate-EDTA buffer and/or agarose for forming an agarose gel.
  • the kit may optionally also comprise instructions defining the particular mutation(s) and/or allele(s) that is(are) indicative of susceptibility of a subject to statin-induced side effects. Hence, the user of the kit could then verify whether the current patient has a particular mutation and/or allele that is associated with such susceptibility.
  • the kit comprises the primers required to amplify a transcript of a target gene involved in the UPR mt signaling or a transcript of a target portion of a gene involved in the UPR mt signaling.
  • the kit optionally, but preferably, also comprises reagents needed to get the QPCR result. Examples of such reagents include Dynabeads® mRNA DIRECTTM Kit and/or the FAST SYBR® Master Mix.
  • the kit may optionally also comprise a tube containing EDTA or other anticoagulant, ammonium chloride solution and/or RPMI 1640 culture medium with fetal calf serum or other culture medium. In an optional approach the kit may also comprise fluvastatin or another statin.
  • the kit may optionally also comprise instructions defining the threshold to which the UPR mt score or value is to be compared. Hence, the user of the kit could then verify whether the current patient has a UPR mt score that is associated with such susceptibility.
  • the kit comprises antibodies, such as monoclonal or polyclonal antibodies or fragments thereof, that specifically bind to the target protein involved in the UPR mt signaling and optionally also antibodies directed against the internal standard protein.
  • the kit optionally, but preferably, also comprises reagents needed to get the ELISA result. Examples of such reagents include In-Cell ELISA Detection Kit.
  • the kit may optionally also comprise a tube containing EDTA or other anticoagulant, ammonium chloride solution and/or RPM1 1640 culture medium with fetal calf serum or other culture medium. In an optional approach the kit may also comprise fluvastatin or another statin.
  • the kit may optionally also comprise instructions defining the threshold to which the UPR mt score or value is to be compared. Hence, the user of the kit could then verify whether the current patient has a UPR mt score that is associated with such susceptibility.
  • the particular mutation(s), allele(s) and/or thresholds used in the kits of the embodiments can be determined using the methods disclosed herein applied to a first group of patients that are not susceptible to statin-induced side effects and to a second group of patients that are suffering from statin-induced side effects. By then comparing the UPR mt scores or values (if using QPCR or ELISA) obtained from the patients in these different groups a suitable threshold value could be set. Correspondingly, the target nucleotide sequences could be compared between the two groups in order to identify the mutation(s) or allele(s) that are found among the patients in the second group but not among or at least being less common in the first group.
  • each kit concept is to assess how well a patient's UPR mt response would protect against the negative effects of inhibitors of the mevalonate pathway, such as statins.
  • Each example offers a concept of what the kit might be like, but the components of each example are possibly interchangeable.
  • a general embodiment relates to a method of determining a susceptibility of a subject to at least one statin-induced side effect.
  • the method comprises determining a mitochondrial unfolded protein response (UPR mt ) response for the subject.
  • the method also comprises determining the susceptibility of the subject to the at least one statin-induced side effect based on the UPR mt response.
  • UPR mt mitochondrial unfolded protein response
  • determining the UPR mt response comprises determining the UPR mt response using genotyping on a body sample taken from the subject.
  • determining the UPR mt response comprises purifying DNA from the body sample. Determining the UPR mt response also comprises amplifying at least a portion of a gene involved in UPR mt signaling and/or at least a portion of a regulatory sequence of a gene involved in the UPR mt signaling. Determining the UPR mt response further comprises detecting presence or absence of at least one mutation or allele in the at least a portion of the gene and/or the at least a portion of the regulatory sequence indicative of susceptibility to the at least one statin-induced side effect.
  • determining the UPR mt response comprises determining the UPR mt response using quantitative polymerase chain reaction (QPCR) on a body sample taken from the subject.
  • QPCR quantitative polymerase chain reaction
  • determining the UPR mt response comprises purifying mRNA from the body sample. Determining the UPR mt response also comprises amplifying a transcript of at least a portion of a gene involved in UPR mt signaling using QPCR to form a quantitative value of the activity of the gene. Determining the UPR mt response further comprises determining the UPR mt response based on the quantitative value.
  • the method also comprises culturing cells from the body sample in presence of a statin and culturing cells from the body sample in the absence of the statin.
  • purifying the mRNA and amplifying the transcript are performed on the cells cultured in presence of the statin and on the cells cultured in absence of the statin.
  • determining the UPR mt response comprises determining the UPR mt response using enzyme-linked immunosorbant assay (ELISA) on a body sample taken from the subject.
  • determining the UPR mt response comprises determining a quantity of a protein involved in the UPR mt signaling using the ELISA and determining the UPR mt response based on the quantity.
  • the method also comprises culturing cells from the body sample in presence of a statin and culturing cells from the body sample in the absence of the statin. In this embodiment, determining the quantity is performed on the cells cultured in presence of the statin and on the cells cultured in absence of the statin. The method further comprises determining a quantity of a reference protein not involved in the UPR mt signaling using the ELISA for the cells cultured in presence of the statin and for the cells cultured in absence of the statin.
  • the method additionally comprises calculating a first ratio between the quantity of the protein and the quantity of the reference protein for the cells cultured in presence of the statin, and calculating a second ratio between the quantity of the protein and the quantity of the reference protein for the cells cultured in absence of the statin.
  • the method also comprises calculating a quotient between the first ratio and the second ratio.
  • determining the UPR mt response comprises determining the UPR mt response based on a comparison between the quotient and a threshold value.
  • determining the susceptibility comprises determining susceptibility of the subject to at least one of statin-induced myopathy, statin-induced rhabdomyolysis, and statin-induced neuropathy based on the UPR mt response.
  • the subject is a mammalian subject and preferably a human subject.
  • determining the UPR mt response for the subject comprises determining a level of expression and/or activity of at least one gene in a group consisting of mitochondrial chaperon mtHSP70, HSP60, HSP10 and mtDNAJ; mitochondrial protease CIpP and HtrA2; transcription factor JNK2, CHOP, CEBP , SatB2 and Ubl5; and nuclear hormone receptor estrogen receptor alpha, ERa.
  • determining the UPR mt response for the subject comprises determining a level of expression and/or activity of a protein encoded by at least one gene in the group.
  • Another general embodiment relates to a method of determining a suitable dosage for a subject in need of treatment with at least one statin.
  • the method comprises determining a susceptibility of the subject to at least one statin-induced side effect according the method disclosed above.
  • the method also comprises determining the suitable dosage of the at least one statin for the treatment based on the susceptibility of the subject to the at least one statin-induced side effect.
  • a further general embodiment relates to a method of reducing a risk of side effects in a subject during treatment with at least one statin.
  • the method comprises determining a suitable dosage of the at least one statin for the subject according to the method disclosed above.
  • the method also comprises administering the at least one statin to the subject according to the suitable dosage.
  • a general embodiment further relates to a kit configured to determine a susceptibility of a subject to at least one statin-induced side effect comprising means configured to determine a mitochondrial unfolded protein response (UPR mt ) response for the subject.
  • URR mt mitochondrial unfolded protein response
  • the kit also comprises instructions defining that the susceptibility of the subject to the at least one statin-induced side effect is determined based on the UPR mt response.
  • the kit also comprises polymerase chain reaction primers complementary to at least a portion of a gene involved in UPR mt signaling and/or at least a portion of a regulatory sequence of a gene involved in the UPR mt signaling.
  • the kit also comprises quantitative polymerase chain reaction primers complementary to at least a portion of a gene involved in UPR mt signaling and/or at least a portion of a regulatory sequence of a gene involved in the UPR mt signaling.
  • the kit also comprises antibodies that specifically bind to a portion of a protein involved in UPR mt signaling.
  • Another general embodiment relates to a kit configured to determine a suitable dosage for a subject in need of treatment with at least one statin comprising means configured to determine a mitochondrial unfolded protein response (UPR mt ) response for the subject.
  • the kit also comprises instructions defining that the suitable dosage of the at least one statin for the treatment is determined based on the UPR mt response.
  • a further general embodiment relates to a kit configured to reduce a risk of side effects in a subject during treatment with at least one statin comprising means configured to determine a suitable dosage of the at least one statin for the subject.
  • the kit also comprises instructions defining that the at least one statin is to be administered to the subject according to the suitable dosage.
  • Fig. 1 In order to discover the mechanisms by which worms of Caenor abditis elegans can become resistant to statins, the strategy outlined in Fig. 1 was followed. This strategy involved mutagenizing normal wild- type N2 worms (obtained from the C. elegans Genetics Center m Minnesota) for 4 hours by incubation in the presence of 0.5 % ethyl methane sulfonate (EMS) according to the standard protocol (6). The worms were then washed with water and placed on a culture dish. Two hours later, vigorous hermaphrodite L4 animals were transferred to a new culture plate.
  • EMS ethyl methane sulfonate
  • Outcrossing was done by mating wild-type N2 males to a suppressor, then crossing the male progeny to wild-type hermaphrodites. Individual progeny from this cross were picked to individual plates then screened for resistance to statin. Five such cycles were carried out amounting to ten outcrosses.
  • the genomes of suppressor mutant that had been outcrossed 4 or 6 times were sequenced to a depth of 25-40x as previously described (7).
  • the sequencing results were analyzed using the MAPQGene software to produce tables listing all differences between the reference N2 genome and that of the mutants, and sort these differences by criteria such as non-coding substitutions, termination mutations, splice-site mutations, etc. (8).
  • hot spots i.e. small genomic area containing several mutations. Mutations in the hot spot(s) that were still retained after ten outcrosses were considered candidate statin-resistance mutations. In the case of et15-et18, it was mutations in the gene atfs-1 that conferred resistance to statins.
  • the resulting worms were grown on normal plates and the expression of the reporters documented by photographing the worms using epifluorescence microscopy.
  • the results showed that the ATFS-1 mutations et15, et17 and et18 activated the UPR mt reporters but not the UPR er reporter. These results were consistent with the ATFS-1 mutations causing constitutive UPR mt , but not UPR er , activation and that UPR mt activation was the protective mechanism against the statin effects.
  • Fluvastatin was added to the resuspended culture to achieve a final concentration of 0.1 mM, 0.2 mM, or 0.4 mM.
  • the culture was grown for 24 hrs and then equilibrated to an ODeoonm of 0.5.
  • the equilibrated culture was serially diluted in two-fold increments, spotted on YES agar plates, and incubated for 48 hrs at 30°C, then photographed.
  • the results (Fig. 4C) showed that EtBr pre-treatment allowed the yeast cells to grow better when challenged by the presence of fluvastatin.
  • yeast cells and worms were both protected from statins when their UPR mt was preactivated by an EtBr treatment.
  • statins in these cells were due to on-target inhibition of HMG- CoA reductase since providing mevalonate completely protected the cells from the effects of statins, as would be expected.
  • yeast cells, worms and mammalian cells were all protected from statins when their UPR mt is preactivated by an EtBr treatment.
  • This experiment described a third way to activate the UPR mt and protected worms from the effects of statins.
  • Activating mutations in the gene atfs-1 were used in several experiments as the UPR mt activation mechanism leading to statin resistance in C. elegans.
  • Experiment 9 used EtBr as a UPR mt activation treatment, which also protected worms from the effects of statins.
  • a third method was used to activate the UPR mt , namely cultivating worms in the presence of paraquat, which caused oxidative damage to the mitochondria leading to UPR mt activation.
  • the reaction was then incubated for 10 minutes at 25°C, 120 min at 37°C, 5 min at 85°C then stored at 4°C (can also be stored at -20°C for extended periods).
  • the QPCR Assay was then performed as follows. Reagents: 1. EVAgreen (5 x HOT FIREPOL EvaGreen qPCR Mix; Cat no. 08-36-00001) from SOLIS BIODYNE; 2. Primers (forward and reverse, see below); 3. cDNA sample; 4. Optical adhesive covers (Bio-rad; Cat no. MSB1001); and 5. 96-well optical reaction plate. (Bio-rad; Cat no. HSP9601). Each reaction was prepared by mixing: cDNA (10 ⁇ ; Dilute the stock 5X i.e.
  • hsp10 omHSP10/FOR1 : AGTTTCTTCCGCTCTTTGACAG (SEQ ID NO: 5) and omHSP10/REV1 : TGCCACCTTTGGTTACAGTTTC (SEQ ID NO: 6)
  • hsp75 omHSP75-F: AACTGTGCCTGTGTTCCTGG (SEQ ID NO: 7)
  • omHSP75-R TGTTCCTTAGGGTTCACTGGT (SEQ ID NO: 8).
  • the hsp10 and hsp75 mRNAs were increased 2- and 8-fold compared to non-treated cells, respectively.
  • a blood sample is taken from a selected number, such as 50, patients that have taken statins for 1 year or more and experienced no side effects.
  • a blood sample is also taken from a selected numbers, such as 50, patients that discontinued statin therapy because of serious side effects.
  • the UPR mt response of all blood samples is analyzed using one of the previously disclosed methods or kits.
  • a "UPR mt response or score" may be obtained for each patient.
  • the patients with a UPR mt response or score below the defined threshold experience the serious side effects.
  • the UPR mt responses or scores from the patients suffering no side effects and/or from the patients suffering from statin-induced side effects can also be used to set a threshold value with regard to the UPR mt response or score.
  • a UPR mt response or score below (or above) the threshold indicates that a patient is susceptible to statin-induced side effects whereas a UPR mt response or score above (or below) the threshold indicates that a patient has low or no risk or likelihood of suffering from any side effects due to a statin therapy.
  • a blood sample is taken from a patient prescribed statin therapy or currently on statin therapy.
  • the UPR mt response of the blood sample is analyzed using one of the previously disclosed method or kits.
  • a UPR mt response or score may be obtained for the patient.
  • This UPR mt response or score is then compared to the threshold determined as disclosed in Experiment 18 to assess whether the patient is susceptible to statin-induced side effects.
  • the comparison between the determined UPR mt response or score can then be used as basis for determining whether the patient should be prescribed statin- therapy or not, and/or determining a suitable dosage of the statin for the patient.
  • a patient in need of statin therapy, prescribed statin therapy, or currently on statin therapy is administered at least one statin if the patient has a UPR mt response or score that is equal to or above the threshold determined as disclosed in Experiment 18.
  • a patient in need of statin therapy or prescribed statin therapy is withheld from administration of a statin or is administered a lower dose of at least one statin if the patient has a UPR mt response or score that is below the threshold determined as disclosed in Experiment 18.
  • a patient that is currently on statin therapy is administered a lower dose of at least one statin or withdrawn from statin treatment if the patient has or develops a UPR mt response or score that is below the threshold determined as disclosed in Experiment 18.
  • IRE1 couples endoplasmic reticulum load to secretory capacity by processing the XBP-1 mRNA, Nature M5, 92-96 (2002).

Abstract

Selon l'invention, des patients sensibles pour des des effets secondaires induits par la statine peuvent être identifiés à l'aide de procédés et de trousses qui reposent sur la réponse à une protéine mitochondriale non repliée (UPRmt).
PCT/SE2013/051120 2012-09-28 2013-09-27 Estimation de l'effet secondaire de la statine WO2014051510A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201261707119P 2012-09-28 2012-09-28
US61/707,119 2012-09-28

Publications (1)

Publication Number Publication Date
WO2014051510A1 true WO2014051510A1 (fr) 2014-04-03

Family

ID=50388732

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/SE2013/051120 WO2014051510A1 (fr) 2012-09-28 2013-09-27 Estimation de l'effet secondaire de la statine

Country Status (1)

Country Link
WO (1) WO2014051510A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007061995A2 (fr) * 2005-11-21 2007-05-31 Novartis Ag Biomarqueurs pour la myopathie induite par la statine ou rhabdomyolyse
US20070202518A1 (en) * 2005-11-18 2007-08-30 Genomas, Inc. Physiogenomic method for predicting statin injury to muscle and muscle side effects

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070202518A1 (en) * 2005-11-18 2007-08-30 Genomas, Inc. Physiogenomic method for predicting statin injury to muscle and muscle side effects
WO2007061995A2 (fr) * 2005-11-21 2007-05-31 Novartis Ag Biomarqueurs pour la myopathie induite par la statine ou rhabdomyolyse

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
MÔRCK, C. ET AL.: "Statins inhibit protein lipidation and induce the unfolded protein response in the non-sterol producing nematode Caenorhabditis elegans", PNAS, vol. 106, no. 43, October 2009 (2009-10-01), pages 18285 - 18290 *
PELLEGRINO M.W. ET AL.: "Signaling the mitochondrial unfolded protein response", BIOCHIMICA ET BIOPHYSICA ACTA, March 2012 (2012-03-01), pages 410 - 416 *

Similar Documents

Publication Publication Date Title
Verma et al. Gene polymorphisms in the NALP3 inflammasome are associated with interleukin‐1 production and severe inflammation: relation to common inflammatory diseases?
Takano et al. An X-linked channelopathy with cardiomegaly due to a CLIC2 mutation enhancing ryanodine receptor channel activity
Feske et al. The duration of nuclear residence of NFAT determines the pattern of cytokine expression in human SCID T cells
Leung et al. Human atopic dermatitis complicated by eczema herpeticum is associated with abnormalities in IFN-γ response
Reimertz et al. Gene expression during ER stress–induced apoptosis in neurons: induction of the BH3-only protein Bbc3/PUMA and activation of the mitochondrial apoptosis pathway
Esteves et al. Loss of association of REEP2 with membranes leads to hereditary spastic paraplegia
Li et al. The association of serotonin transporter genetic polymorphisms and irritable bowel syndrome and its influence on tegaserod treatment in Chinese patients
Chun et al. Improved diagnostic testing for ataxia–telangiectasia by immunoblotting of nuclear lysates for ATM protein expression
US10337004B2 (en) Methods and compositions for treating a subject with a SMAD7 antisense oligonucleotide
Tcymbarevich et al. The impact of the rs8005161 polymorphism on G protein-coupled receptor GPR65 (TDAG8) pH-associated activation in intestinal inflammation
CN103957705A (zh) 适用于预测对醋酸格拉替雷的临床反应的单核苷酸多态性
Hao et al. K48-linked KLF4 ubiquitination by E3 ligase Mule controls T-cell proliferation and cell cycle progression
Dächsel et al. Digenic parkinsonism: investigation of the synergistic effects of PRKN and LRRK2
Vélez et al. Mutations modifying sporadic Alzheimer's disease age of onset
Vemula et al. A rare sequence variant in intron 1 of THAP 1 is associated with primary dystonia
AU2022202688A1 (en) Genetic predictors of a response to treatment with CRHR1 antagonists
JP4948768B2 (ja) 精神障害に対する感受性の診断または予測方法
Urquhart et al. A novel heat shock protein alpha 8 (Hspa8) molecular network mediating responses to stress-and ethanol-related behaviors
Clarke et al. Functional characterization of the atopy-associated gene PHF11
US20040248286A1 (en) Nucleic acid molecules that are differentially regulated in a bipolar disorder and uses thereof
US6962776B2 (en) Methods and materials for evaluating cardiovascular conditions
WO2014051510A1 (fr) Estimation de l'effet secondaire de la statine
RU2700565C1 (ru) Способ определения предрасположенности к развитию ожирения у детей в условиях избыточной контаминации алюминием
WO2005058142A2 (fr) Diagnostic du diabete
JP2006514821A (ja) 新規なｋｃｎｑポリペプチド、それらのモジュレータ及び精神障害の治療におけるそれらの使用

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13841663

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13841663

Country of ref document: EP

Kind code of ref document: A1