WO2014039010A1 - Isolated oligonucleotides, methods and kits for detection, identification and/or quantitation of chikungunya and dengue viruses - Google Patents
Isolated oligonucleotides, methods and kits for detection, identification and/or quantitation of chikungunya and dengue viruses Download PDFInfo
- Publication number
- WO2014039010A1 WO2014039010A1 PCT/SG2013/000386 SG2013000386W WO2014039010A1 WO 2014039010 A1 WO2014039010 A1 WO 2014039010A1 SG 2013000386 W SG2013000386 W SG 2013000386W WO 2014039010 A1 WO2014039010 A1 WO 2014039010A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- nucleic acid
- dengue
- virus
- chikungunya
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
Definitions
- the present invention relates to an isolated oligonucleotide, a method and kit for detection, identification and/or quantitation of virus.
- the present invention also relates to a medical diagnostic kit for detecting viruses and primers suitable for use in such a kit.
- Dengue and Chikungunya viruses cause very similar early symptoms in infected patients that can be difficult to differentiate without performing a costly and time consuming series of diagnostic tests and analysis.
- the Dengue and Chikungunya viruses have been diagnosed primarily via serological methods.
- Sero diagnosis of the viruses is dependent on the stage of a viral infection and generally can only detect the infection towards the end of the first week of illness.
- Some sero diagnosis methods target specific viral proteins and are able to detect the infection earlier. However, these methods may be effective only for a short window of time, for example after infection but before the production of antibodies that bind to these viral proteins in patient bodies. The short window of time makes the detection difficult.
- RT-PCR Real-Time Reverse Transcriptase PCR
- SYBR green I real time RT-PCR
- the Targeted viruses are the 4 serotypes of the Dengue virus namely DENV1 , DENV2, DENV3, and DENV4.
- the Detection limit for each serotype is 10/PFU.
- the Sensitivity / No. of confirmed samples is 100% / 90 and the Specificity / No. of healthy samples is 100% / 20.
- the Targeted viruses and the respective Detection limits are DENV1 with limit of 500 RNA copies / assay, DENV2 with a limit of 500 RNA copies / assay, DENV3 with a limit of 10000 RNA copies / assay, DENV4 with a limit of 500 RNA copies / assay and CHIKV (refers to the Chikungunya virus) with a limit of 100 RNA copies / assay.
- the Sensitivity / No. of confirmed samples for Dengue is 100% / 28 DENV and the The Sensitivity / No. of confirmed samples for Chikungunya is 100% / 22 CHIKV.
- the Specificity / No. of healthy samples is 100% / 20.
- an isolated oligonucleotide comprising a nucleic acid sequence having at least 80% homology to a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 20:
- GGC GAC CCG TGG ATA AAG A SEQ ID NO: 15
- ACT GCA GAT GCC CGC CAT TA SEQ ID NO: 16
- a combination of sets of primers for detection, identification and /or quantitation of at least two viruses, or a nucleic acid of the at least two viruses, in a sample wherein the combination comprises at least one set of primers having nucleic acid sequences with at least 80% homology to the nucleic acid sequences selected from the group consisting of Sets 1 to 5, and at least one set of primers having nucleic acid sequences with at least 80% homology to the nucleic acid sequences selected from the group consisting of Sets 6 to 11 :
- a method for detection, identification and/or quantitation of at least one virus, or the nucleic acid of the at least one virus, in a sample comprising:
- step (a) performing an amplification reaction on the sample in the presence of at least one set of primers having nucleic acid sequences with at least 80% homology to the nucleic acid sequences selected from the group consisting of Sets 1 to 11.
- the step (a) may be performed in the presence of a fluorescent dye which exhibits increased fluorescence intensity upon binding to an amplification product.
- the method may further comprise:
- the method may be for detection, identification and/or quantitation of at least two viruses in a sample, and the amplification reaction is performed in the presence of at least one set of primers having the nucleic acid sequences with at least 80% homology to the nucleic acid sequences selected from the group consisting of Sets 1 to 5, and at least one set of primers having the nucleic acid sequences with at least 80% homology to the nucleic acid sequences selected from the group consisting of Sets 6 to 11.
- the method may further comprise:
- nucleic acid amplification reaction mixture that comprises said sample and a fluorescent dye, wherein the dye exhibits increased fluorescence intensity upon binding to a double-stranded nucleic acid
- step (ii) measuring the emitted light produced by the mixture of step (i);
- Steps (ii) and (iv) may each further comprise a step of providing excitation light to the reaction mixture and conveying fluorescent light emitted by the reaction mixture to a detector, wherein at steps (ii) and (iv) the amount of emitted light produced by exposing the mixture to excitation light is determined, and at step (iv) the relative amount of emitted light produced at steps (ii) and (iv) is compared to determine if amplification has occurred and optionally to quantify the amount of a target nucleic acid in the sample.
- the step (a) may comprise a real time reverse transcription polymerase chain reaction.
- the fluorescent dye may be SYBR Green I (2-(N-(3-dimethylaminopropyl)-N- propylamino)-4-(2,3-dihydro-3-methyl-(benzo-1 ,3-thiazol-2-yl)-methylidene)-1- phenylquinolinium chloride).
- kits for detection, identification and/or quantification of at least one virus in a sample comprising at least one oligonucleotide according to the first aspect of the embodiment of the present invention.
- the at least one virus or the at least two viruses mentioned above may be selected from Chikungunya virus, Dengue Virus Serotype 1 , Dengue Virus Serotype 2, Dengue Virus Serotype 3 and Dengue Virus Serotype 4.
- Figure 1 shows a melt curve profile of the amplification product of a sample containing a Chikungunya virus obtained using a primer pair with the name, CHKCAP.
- Figure 2 shows a melt curve profile of the amplification product of a sample containing a Chikungunya virus obtained using a primer pair with the name, CHKMET2.
- Figure 3 shows a melt curve profile of the amplification product of a sample containing a Chikungunya virus obtained using a primer pair with the name, CHK4 from a Chikungunya sequence.
- Figure 4 shows a melt curve profile of the amplification product of a sample containing a Chikungunya virus obtained using a primer pair with the name, CHK9.
- Figure 5 shows a melt curve profile of the amplification product of a sample containing a Chikungunya virus obtained using a primer pair with the name, CHK13.
- Figure 6 shows a melt curve profile of the amplification product of a sample containing a Chikungunya virus obtained using a primer pair with the name, CHK15.
- Figure 7 shows a melt curve profile of the amplification product of a sample containing a Dengue virus obtained using a primer pair with the name, DEN4.
- Figure 8 shows a melt curve profile of the amplification product of a sample containing a Dengue virus obtained using a primer pair with the name, DEN7m1.
- Figure 9 shows a melt curve profile of the amplification product of a sample containing a Dengue virus obtained using a primer pair with the name, DEN16.
- Figure 10 shows a melt curve profile of the amplification product of a sample containing a Dengue virus obtained using a combination primer pair containing CHK4 and DEN 16.
- Figure 11 shows a melt curve profile of the amplification product of a sample containing a Dengue virus obtained using a combination primer pair containing CHK15 and DEN16.
- Figure 12 shows a melt curve profile of the amplification product of a sample containing a Dengue virus obtained using a combination primer pair containing CHK13 and DEN7m1.
- Figure 13 shows a melt curve profile of the amplification product of a sample containing a Dengue virus obtained using a combination primer pair containing CHK9 and DEN7m1.
- Figure 14 shows a melt curve profile of the amplification product of samples containing Dengue virus obtained using a combination primer pair containing CHIK13 and DEN7m1.
- Figure 15 shows a melt curve profile of the amplification product of samples containing Dengue virus obtained using a combination primer pair containing CHIK13 and DEN7m1.
- Figure 16 shows a melt curve profile of the amplification product of samples containing Dengue virus obtained using a combination primer pair containing CHIK13 and DEN7m1.
- Figure 17 shows a melt curve profile of the amplification product of samples containing Dengue virus obtained using a combination primer pair containing CHIK13 and DEN7m1.
- Figure 18 shows a melt curve profile of the amplification product of samples containing Chikungunya virus obtained using a combination primer pair containing CHIK13 and DEN7m1.
- Figure 19 shows a melt curve profile of the amplification product of samples containing Chikungunya virus obtained using a combination primer pair containing CHIK13 and DEN7m1.
- Figure 20 illustrates melting temperature intervals for identification of the Dengue and Chikungunya viruses.
- Figure 21 shows a standard curve for quantitating a Dengue virus strain.
- Figure 22 shows a standard curve for quantitating a Dengue virus strain.
- Figure 23 shows a standard curve for quantitating a Dengue virus strain.
- Figure 24 shows a standard curve for quantitating a Dengue virus strain.
- Figure 25 shows a standard curve for quantitating a Chikungunya virus.
- Amplification (or amplification reaction): To increase the number of copies of a nucleic acid molecule.
- the resulting amplification products are called "amplicons.”
- Amplification of a nucleic acid molecule refers to use of a technique that increases the number of copies of a nucleic acid molecule in a sample.
- An example of amplification is the polymerase chain reaction (PCR), in which a sample is contacted with a pair of oligonucleotide primers under conditions that allow for the hybridization of the primers to a nucleic acid template in the sample.
- PCR polymerase chain reaction
- the primers are extended under suitable conditions, dissociated from the template, re- annealed, extended, and dissociated to amplify the number of copies of the nucleic acid. This cycle can be repeated.
- the product of amplification (or amplification product) can be characterized by such techniques as electrophoresis, restriction endonuclease cleavage patterns, oligonucleotide hybridization or ligation, and/or nucleic acid sequencing. Characterization of the product of amplification refers to, for example, determining the size or sequence of the product.
- Other examples of in vitro amplification include but are not limited to real time PCR; reverse transcriptase PCR (RT-PCR); real time reverse transcriptase PCR (real time RT-PCR). -
- Nucleic acid molecule or sequence: A deoxyribonucleotide or ribonucleotide polymer including without limitation, cDNA, mRNA, genomic DNA, viral genome RNA, and synthetic (such as chemically synthesized) DNA or RNA.
- the nucleic acid can be double stranded (ds) or single stranded (ss). Where single stranded, the nucleic acid can be the sense strand or the antisense strand.
- Nucleic acids can include natural nucleotides (such as A, T/U, C, and G), and can also include analogs of natural nucleotides, such as labeled nucleotides.
- Nucleotide The fundamental unit of nucleic acid molecules.
- a nucleotide includes a nitrogen-containing base attached to a pentose monosaccharide with one, two, or three phosphate groups attached by ester linkages to the saccharide moiety.
- the major nucleotides of DNA are deoxyadenosine 5'-triphosphate (dATP or A), deoxyguanosine 5'-triphosphate (dGTP or G), deoxycytidine 5'-triphosphate (dCTP or C) and deoxythymidine 5'-triphosphate (dTTP or T).
- the major nucleotides of RNA are adenosine 5'-triphosphate (ATP or A), guanosine 5'-triphosphate (GTP or G), cytidine 5'-triphosphate (CTP or C) and uridine 5'-triphosphate (UTP or U).
- Nucleotides include those nucleotides containing modified bases, modified sugar moieties and modified phosphate backbones, for example as described in U.S. Patent No. 5,866,336 to Nazarenko et al. (herein incorporated by reference).
- Primers Short nucleic acid molecules, such as a DNA oligonucleotide, for example sequences of at least 15 nucleotides, which can be annealed to a complementary target nucleic acid molecule by nucleic acid hybridization to form a hybrid between the primer and the target nucleic acid strand.
- a primer can be extended along the target nucleic acid molecule by a polymerase enzyme. Therefore, primers can be used to amplify a target nucleic acid molecule, wherein the sequence of the primer is specific for the target nucleic acid molecule, for example so that the primer will hybridize to the target nucleic acid molecule under very high stringency hybridization conditions. The specificity of a primer increases with its length.
- a primer that includes 30 consecutive nucleotides will anneal to a target sequence with a higher specificity than a corresponding primer of only 15 nucleotides.
- probes and primers can be selected that include at least 15, 20, 25, 30, 35, 40, 45, 50 or more consecutive nucleotides.
- a primer is at least 15 nucleotides in length, such as at least 15 contiguous nucleotides complementary to a target nucleic acid molecule.
- Particular lengths of primers that can be used to practice the methods of the present disclosure include primers having at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 , at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31 , at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 45, at least 50, or more contiguous nucleotides complementary to the target nucleic acid molecule to be amplified, such as a primer of 15-60 nucleotides, 15-50 nucleotides, or 15-30 nucleotides.
- Primer pairs can be used for amplification of a nucleic acid sequence, for example, by PCR, real time PCR, or other nucleic-acid amplification methods known in the art.
- a "forward" primer may be a primer 5' to a reference point on a nucleic acid sequence.
- a "reverse” primer may be a primer 3' to a reference point on a nucleic acid sequence.
- at least one forward and one reverse primer are included in an amplification reaction.
- PCR primer pairs can be derived from a known sequence by using computer programs intended for that purpose such as Primer (Version 0.5, ⁇ 1991 , Whitehead Institute for Biomedical Research, Cambridge, MA).
- Real time PCR A method for detecting and measuring products generated during each cycle of a PCR, which are proportionate to the amount of template nucleic acid prior to the start of PCR.
- the information obtained such as an amplification curve, can be used to determine the presence of a target nucleic acid and/or quantitate the initial amounts of a target nucleic acid sequence.
- real time PCR is real time reverse transcriptase PCR (real time RT-PCR).
- Quantitating a nucleic acid molecule Determining or measuring a quantity (such as a relative quantity) of nucleic acid molecules present, such as the number of amplicons or the number of nucleic acid molecules present in a sample. In some examples, it is determining -the relative amount or actual number of nucleic acid molecules present in a sample.
- a diagnostic platform of an example embodiment of the present invention for detecting, identifying and/or quantitating nucleic acids, in particular, viral genome RNA of the Chikungunya and Dengue viruses, present in a biological sample is described as follows. The diagnostic platform is herein denoted as Arbo-Q.
- Arbo-Q is an SYBR® Green I real time RT-PCR based assay where viral nucleic acids could be detected and/or quantitated based on change in fluorescent signal from SYBR Green molecules that are bound to amplification products of the viral nucleic acids.
- a Chikungunya virus is generally a small (about 60-70 nm-diameter), spherical, enveloped, positive-strand RNA virus.
- the Chikungunya virus may comprise any strain of the Chikungunya virus.
- the Chikungunya virus may comprise the IND-63-WB1 strain (Gen Bank accession no. EF027140).
- the Chikungunya virus may comprise any of the following: NC004162 :D570/06 (Africa), EU244823:ITA07-RAI (Italy), EU037962:Wuerzburg(Germany), EF012359.D570/06 (Mauritius/island nation off the coast of the African continent), EF210157:DRDEHydlSW06 (India), EF452493:AF15561 (Bangkok), AF369024:S27- African prototype (Africa), DQ443544: LR2006OPY1 (Travelers Returning from Indian Ocean Islands) and AF490259: Ross (Ross/Scotland);
- a Dengue virus generally consists of 4 serotypes. They include Dengue Virus Type 1 , Dengue Virus Type 2, Dengue Virus Type 3 and Dengue Virus Type 4.
- the Dengue virus has a sssRNA based genome of approximately 11000 base pairs (bp).
- the Dengue virus may comprise any strain of the Dengue virus.
- the Dengue virus may comprise a Dengue Virus Type 1 strain D1/SG/06K2290DK1/2006 (EU081281 ). It may comprise any one or more of EU081281 , EU081276, EU081261 , NC_001477, AY762084, and M87512.
- the Dengue virus may comprise a Dengue Virus Type 2 strain D2/SG/05K3295DK1/2005 (EU081177). It may comprise any one or more of EU081177, NC_001474 , AF169680, M20558, AY858036, and AB122022.
- the Dengue virus may comprise a Dengue Virus Type 3 strain Singapore (AY662691 ). It may comprise any one or more of EU081225, EU081221 , EU081197,NC 001475, AY66269, and EU081214.
- the Dengue virus may comprise a Dengue Virus Type 4 strain ThD4_0734_00 (AY618993). It may comprise any one or more of AY762085, AY947339, NC_002640, AY618993, AY152120, and AY762085.
- the Chikungunya virus or the Dengue virus may comprise a human Chikungunya or Dengue virus or an animal Chikungunya or Dengue virus.
- SYBR Green I (2-(N-(3-dimethylaminopropyl)-N-propylamino)-4-(2,3-dihydro-3-methyl- (benzo-1 ,3-thiazol-2-yl)-methylidene)-1-phenylquinolinium chloride; sigma aldrich) is an asymmetrical cyanine dye capable of binding to RNA and DNA, preferentially to DNA and more preferentially to ds DNA. The resulting DNA-dye-complex absorbs blue light (Amax at about 497 nm) and emits green light (Amax at about 520 nm). When bound to ds DNA, SYBR Green I exhibits significantly increased fluorescence intensity over that exhibited when it is bound to ss DNA or RNA.
- SYBR Green I technology can be used in real time PCR (or real time RT-PCR) analysis.
- the binding of SYBR Green I to nucleic acid is not sequence-specific and the fluorescent signal produced when in complex with ds DNA is directly proportionate to the length and amount of ds DNA copies synthesized during an amplification reaction of a nucleic acid.
- SYBR Green I technology based real time PCR or real time RT-PCR can provide sensitive and precise methods for detection, identification and quantification of nucleic acids in samples.
- the SYBR green I dye may be replaced by other fluorescent dyes with equivalent or higher specificity and capable of binding to double strand amplification products.
- fluorescent dyes may include any fluorescent dye that is capable of binding to ds DNA, and one that exhibits significantly increased fluorescence intensity upon binding to ds DNA compared to the case when the fluorescent dye is bound to other nucleic acids.
- Arbo-Q can work in any real time thermal cycler instrument which is capable of performing PCR, measuring fluorescence in real time and determining melting temperatures (Tm) of the amplification products.
- primers having Chikungunya nucleic acid sequences (or in short, Chikungunya sequences) and Dengue nucleic acid sequences (or in short, Dengue sequences) are used for detection of Chikungunya and Dengue viruses (or nucleic acids therefrom) in a biological sample.
- the Chikungunya and Dengue sequences described here may be single stranded or double stranded.
- Dengue sequences were selected based on the genome sequences of all four serotypes of Dengue virus as shown below:
- the Chikungunya sequence was selected based on the genome sequence of Chikungunya virus isolate SGEHICHD122508 (NCBI ACCESSION: FJ445502).
- Chikungunya sequence(s) and “Dengue sequence(s)” should be taken to comprise any specific sequence(s) disclosed in this document, for example, a sequence or sequences set out in tables 1 and 2, as well as any variants-, fragments, derivatives and homologues of such specific nucleic acid sequence(s).
- Primers having the sequences in table 1 can be used for detection of the Dengue virus, including the 4 serotypes of the Dengue virus, and primers having the sequences in table 2 can be used for detection of the Chikungunya virus. Primer names are provided for each sequence in the tables 1 and 2.
- CHKCAP R G GTTTCTTTTTAG GTG G CTG
- CHIKV4 F GCGGACCTGGCCAAACTG
- Sequences showing about 50% homology to the Chikungunya sequences and Dengue sequences as set out in tables 1 and 2 may be used in other example embodiments of the present invention. Furthermore, in ascending order of reliability, the sequences used in other example embodiments may be that showing at least about 60% homology, at least about 70% homology, at least about 80% homology, at least about 90% homology or at least about 95% homology to the sequences shown in tables 1 and 2.
- the Chikungunya sequences and Dengue sequences set out in tables 1 and 2 are selected from regions not within the highly conserved regions of the Chikungunya and Dengue viral genomes. Therefore, the primers having the Chikungunya sequences and Dengue sequences set out in tables 1 and 2 are capable of detecting and differentiating different geographical isolates of the Chikungunya and Dengue viruses (i.e. the 4 serotypes of the Dengue virus). Furthermore, it is noted that three primer sets (having prefixes "DEN4", "DEN7M” and "DENV16" respectively) having the Dengue sequences are provided in table 1. Each of the primer sets is able to effectively detect and differentiate the 4 serotypes of Dengue viruses independently.
- a forward primer (with name containing "F") may be paired with its corresponding reverse primer (with name containing "R") in the same table of sequences.
- DEN4 F may be paired with DEN4 R.
- CHKCAP F may be paired with CHKCAP R.
- DEN7M3 F may be used as a forward primer in a pair with either one of the reverse primers, DEN7M1 R, DEN7M2 R or DEN7M3 R, respectively.
- Each pair of primers may be used independently, or more than one pair of primers may be used in combination in a single tube reaction to detect the the Chikungunya virus and one of the Dengue viruses (i.e. the 4 serotypes) (or nucleic acids therefrom).
- One pair of primers selected from the primers having the Chikungunya sequences may be used in combination with one pair of primers selected from the primers having the Dengue sequences, so that both the Chikungunya virus and the Dengue virus (or nucleic acids therefrom) can be detected in a biological sample simultaneously by carrying out a single tube reaction. This helps to specifically detect the respective virus genome RNA templates in a multiplex real time platform format.
- the primers having the Chikungunya and Dengue sequences may be highly compatible during the amplification reactions. Therefore, one set of the primers having the Chikungunya sequences and one set of the primers having the Dengue sequences can be used in combination and still perform well under the same thermal cycling conditions in a single tube reaction.
- Arbo-Q and the primers having sequences in tables 1 and 2 can enable fast, affordable, convenient, specific and sensitive detection, identification and/or quantitation of the Chikungunya and Dengue viruses at the serotype level. It is appreciated that the primers having the Chikungunya and Dengue sequences in tables 1 and 2 show high specificity and sensitivity towards the targeted viruses. An advantage of these primers is that the formation of primer dimer during amplification reactions by using such primers is negligible and this results in precise identification and accurate quantification of the viruses.
- the primers used in the present invention are designed against highly conserved regions of the Chikungunya and Dengue viral genome and this translates to broad practicability of detecting different geographical isolates.
- the primers designed for the Dengue virus serotyping are able to detect all four Dengue serotypes and differentiate them according to the melting temperature of the amplicon.
- the primers having sequences described in this document for the Chikungunya and Dengue viruses are highly compatible during the amplification process which means processes for both viruses will performed well under the same thermal cycling conditions.
- the detection of the Chikungunya and Dengue viruses may comprise the following steps.
- a biological sample may be processed to extract nucleic acids, such as messenger RNA (mRNA). Thereafter, the mRNA may be reverse transcribed to cDNA.
- the cDNA may be amplified using primers having the Chikungunya and Dengue sequence(s).
- the amplification reaction may comprise PCR reactions, RT-PCR reactions, real time PCR reactions, and real time RT-PCR reactions.
- the amplification reaction may also comprise singleplex PCR reactions and multiplex PCR reactions.
- An amplification reaction normally comprise multiple amplification cycles.
- the fluorescence of the amplification products may be captured.
- Amplification graphs of the amplification reaction may be checked for the threshold cycle (Ct) value of the amplification products.
- Ct threshold cycle
- the Ct value represents the cycle by which the fluorescence of a sample is increased to a level higher than the background fluorescence in the amplification cycle.
- a melt curve analysis may be performed. Melt curves are used for comparison of the melting temperatures of the amplification products. Different ds DNA molecules (such as the amplification products from different viral nucleic acids) melt at different temperatures. The melting temperatures are dependent on a number of factors including GC content, amplification product length, secondary and tertiary structure, and chemical formulation of the reaction chemistry.
- a method for identifying nucleic acids present in an unknown biological sample by analysing the melt curve of nucleic acid amplification products to determine the presence and identity of known nucleic acids.
- the melt curve of the nucleic acid amplification products may indicate melting temperatures of the nucleic acids present in the unknown sample. Correlating these melting temperatures of the nucleic acids present in the unknown sample analysed to melting temperatures of known nucleic acids associated with reference samples containing specific viruses and/or viral serotypes can enable identification and/or detection of a virus selected from the Chikungunya and Dengue viruses (i.e. the 4 serotypes) in the unknown sample.
- detection and identification of both the Chikungunya and Dengue viruses can be carried out on the unknown sample and simultaneous identification of different serotypes of Dengue virus in the unknown sample can be carried out through a single tube reaction.
- Identification of the Chikungunya virus and the different serotypes of Dengue virus (or nucleic acids therefrom) in the unknown sample can be accomplished by analysing the melt curve profile of the unknown sample and comparing (or matching) it with a melt curve profile (or melt curve profiles) of a reference sample (or reference samples) containing nucleic acids of the Chikungunya and/or Dengue viruses.
- One advantage of the example embodiments of the present invention is that information relating to the melt curve profile of the unknown sample can be obtained during the course of the amplification reaction and may be analyzed thereafter. As such, there is no requirement for any additional step (such as gel electrophoresis) to be conducted after the amplification reaction to characterize the amplification products so as to determine which of the Chikungunya virus or the different serotypes of Dengue virus are present in the unknown sample.
- Components of reaction mixtures and protocols that are suitable for the methodology of the present invention are set out in the example embodiments of the present invention that are herein described. However, it would be clear to the skilled person that the present invention would still work if these were varied according to techniques known in the art.
- the diagnostic platform derived using SYBR Green l-based system significantly reduces the cost of each detection (about 10 times lower in cost than probe based real time PCR methods known in the art), yet maintaining a comparable or higher degree of specificity and sensitivity of the primers to the viral genome RNA templates.
- the method employing the diagnostic platform of the example embodiment may be used with other primer sets and may thus be used to detect other viruses, for example human alphaviruses and flaviviruses.
- kits for Dengue virus and Chikungunya virus are based on ELISA or immunofluorescence techniques which rely on detection of antibodies produced in the human body in response to Dengue virus and Chikungunya virus infection. Even though these serological tests are able to differentiate between serotypes, a significant limitation is that such kits can detect the Dengue virus and Chikungunya virus only at a time that sufficient antibodies are produced in the human body and become detectable by applying the kits. These kits may not be able to detect early stage viral infection.
- molecular based diagnostic technology involving the use of probe-based real time PCR can be used for a more rapid, sensitive and specific detection of viral infection of the Dengue virus and the Chikungunya virus at very early time point of viral infection.
- the probe-based real time PCR diagnostic technology platform can be 10 times more expensive and of relatively low sensitivity. For example, of 306 confirmed cases of Dengue virus infections, this method was only able to detect about 89.6% of the cases. The detection limit is about 100 viral RNA copies per microliter of reaction.
- example embodiments of the present invention enables detection of as low as 0.1 PFU or 10 viral RNA copies per reaction for Dengue virus serotypes 1 , 2, 3, 4 and the Chikungunya virus.
- Arbo-Q the molecular diagnostic platform which is described in an example embodiment of the present invention, requires only a single tube, one step real time RT-PCR reaction that could not only distinguish Chikungunya virus from Dengue virus, but also have the capacity to differentiate between the serotypes of Dengue 1 , 2, 3, 4, and absolutely quantitating the target viruses simultaneously.
- the SYBR Green I based real time RT-PCR reaction carried out by example embodiments of the present invention can be 10 times lower in cost that of a conventional probe based assay. This is because the most costly reagent in probe based real time reaction is the synthesis of the probe itself, while the cost of the primers are the same in both methods.
- Dengue fever rapid test devices also known as one-step dengue tests, are a solid phase immuno-chromatographic assay for the rapid, qualitative and differential detection of Dengue IgG and/or IgM antibodies to Dengue fever virus in human serum, plasma or whole blood.
- Dengue IVD test devices that a company, Atlas Link Biotech, is supplying are intended for professional use , as an aid in the presumptive diagnosis between primary and secondary Dengue infection.
- the ELISA IgG can be used to establish previous exposure to Dengue fever or as an epidemiological tool for dengue virus IgG seropreyalence surveys.
- the IgM Capture ELISA is a qualitative assay for the detection of human serum IgM antibodies to Dengue virus infections to be used in support of the diagnosis of acute Dengue virus infections in humans.
- the Dengue IgG/lgM kit has shown to be highly sensitive and specific for Dengue IgG and IgM antibodies.
- the sensitivity of Focus IgG and IgM kit for onset patient sample is only 55% and 36% respectively. It is more sensitive (95% and 93% respectively) to > 1 week post-onset patient samples, while it is too late for a diagnostic purpose. Usually, it takes from 3 to 5 days after the onset of the symptoms to detect anti- Dengue virus IgM and from 1 to 14 days to anti-dengue virus IgG to become detectable, depending on whether the patient has primary or secondary infections.
- IgM is only present from the day 5 after onset of fever which made it not suitable for early diagnosis.
- - IgG is only present from the day 10-14 after onset of freer and persists for life. This might result in false positive result in patients who had viral infection previously.
- the flavivirus non-structural protein NS 1 is a candidate protein for rapid diagnosis of Dengue in endemic countries.
- Dengue NS1 antigen capture kits are based on either one-step sandwich format microplate enzyme immunoassay or irrirnunochromatographic test (ICT) for the detection of NS1 antigen. Some advantages of the above Dengue NS1 antigen capture kits is as follows.
- Circulating NS1 has been shown to be detectable from the first day to the early convalescent phase after onset of disease.
- MAb Monoclonal antibody-based serotype-specific NS1 assays can be used to differentiate between flaviviruses.
- Dengue NS1 antigen capture kits is as follows. - NS1 is not detectable once anti-NS1 IgG antibodies are produced.
- NS1 only appeared in short period especially in secondary infection. Unable to serotype Dengue virus.
- Some existing test kits for PCR detection for Dengue and Chikungunya viral RNA is as follows. - ⁇ - Dengue LC RealArtTM RT-PCR Kit (Artus, Hamburg, Germany)
- the principle of the Tagman real time detection is based on the fluorogenic 5'nuclease assay.
- the DNA polymerase cleaves the probe at the 5' end and separates the reporter dye from the quencher dye only when the probe hybridizes to the target DNA. This cleavage results in the fluorescent signal generated by the cleaved reporter dye, which is monitored in real time by the PCR detection system.
- the PCR cycle at which an increase in the fluorescence signal is detected initially (Ct) is proportional to the amount of the specific PCR product. Monitoring the fluorescence intensities in real time allows the detection of the accumulating product without having to re-open the reaction tube after the amplification.
- example embodiments of the present invention such as the diagnostic platform Arbo-Q for the Dengue and Chikungunya viruses is effective from the onset of the viral infection.
- Arbo-Q is suitable for early viral detection upon onset of infection as indicated by viral fever. The virus could be found in the blood for up till 5-7 days from the onset of the fever.
- Nano-quantity amount of sample volume (0.5-1 ⁇ ) - human serum or mucosal secretions 0.5-1 ⁇
- Viral RNA was extracted from 200 ⁇ of infected cell culture supernatant or patient serum samples using PureLinkTM Viral RNA Mini Kit (Invitrogen, USA), following the manufacturer's protocols. The viral RNA was eluted in a volume of 30 ⁇ of elution buffer and stored at -20°C for future use.
- the thermal profile consist of reverse transcription at 44°C for 30 min, and polymerase activation at 94°C for 2 min, followed by 40 cycles of PCR at 94°C for 15 sec and 60 °C for 30 sec.
- the fluorescence emitted is captured at the end of the extension step of each cycle at 530 nm.
- Amplification graphs are checked for the threshold cycle (Ct) value of the PCR product.
- the Ct value represents the cycle by which the fluorescence of a sample increased to a level higher than the background fluorescence in the amplification cycle.
- Melt curve analysis is performed after the PCR amplification to verify that the correct amplification product (amplicon) is amplified by examining its specific melting temperature (Tm).
- a peak in the melt curve of a sample corresponds to the melting temperature of the amplification products of that sample.
- the melting temperature of each sample was used to identify the Chikungunya virus and the Dengue serotype, and the samples sharing the same melting temperature were interpreted as containing the same virus or the same serotype of the Dengue virus.
- Formulation for Arbo-Q assay reaction mixture is set out in the table below.
- Figures 1 to 6 show example melt curve profiles of a reference biological sample containing the Chikungunya virus.
- the melt curve profiles are plotted by conducting singleplex real time RT-PCR reactions using primer pairs having the Chikungunya sequences of Table 2.
- the melt curve profiles of Figures 1 to 6 are named as CHKCAP (associated y ith primer pair, CHKCAP F and CHKCAP R, from Table 2, Figure 1 ), CHKMET2 (associated with primer pair, CHKMET2 F and CHKMET2 R, from Table 2, Figure 2), CHK4 (associated with primer pair, CHIKV4 F and CHIKV4 R, from Table 2, Figure 3), CHK9 (associated with primer pair, CHIK9 F and CHIK9 R, from Table 2, Figure 4), CHK13 (associated with primer pair.
- CHKCAP associated y ith primer pair, CHKCAP F and CHKCAP R, from Table 2, Figure 1
- CHKMET2 associated with primer pair, CHKMET2 F and CHKMET2 R, from Table 2,
- Figures 1 to 6 relate to Singleplex real time RT-PCR Profiles of the Chikungunya virus.
- the melt curve profiles in Figures 1 to 6 may be used as references for detecting and identifying the Chikungunya virus in an unknown sample.
- the unknown sample may be subjected to real time RT-PCR reaction using any primer pair associated with either one of Figures 1 to 6. Thereafter, the melt curve profile of the unknown sample can be plotted. If the melt curve profile of the unknown sample associated with a primer pair from either one of Figures 1 to 6 correlates with the corresponding reference melt curve profile associated with the same primer pair, it is indication that the Chikungunya virus is present in the unknown sample.
- Correlation of the melt curve profile of the unknown sample with the melt curve profile of the reference melt curve profile is indicated by the overlapping of peak Derivative Reporter (-Rn) values on or about the melting temperature of the reference melt curve profile when the two melt curve profiles are compared (or matched).
- the melting temperatures of Figures 1 to 6 are 82.23 °C for CHKCAP, 82.75 °C for CHKMET2, 86.62 °C for CHK4, 82.19 °C for CHK9, 87.99 °C for CHK13 and 85.16 °C for CHK15, respectively.
- Figures 7 to 9 relate to Singleplex real time RT-PCR Profiles of the Dengue virus.
- Figures 7 to 9 show example meltcurve profiles of reference samples containing the Dengue virus serotypes 1 -4. The melt curve profiles are plotted by conducting singleplex real time RT-PCR reactions using primer pairs having the sequences of Table 1.
- the melt curve profiles of Figures 7 to 9 are named as DEN4 (associated with primer pair, DEN4 F and DEN4 R, from Table 1 , Figure 7), DEN7m1 (associated with primer pair, DEN7m3 F and DEN7m1 R, from Table 1 , Figure 8) and DEN16 (associated with primer pair, DENV16 F and DENV16 R, from Table 1 , Figure 9), respectively.
- DEN4 associated with primer pair, DEN4 F and DEN4 R, from Table 1 , Figure 7
- DEN7m1 associated with primer pair, DEN7m3 F and DEN7m1 R, from Table 1 , Figure 8
- DEN16 associated with primer pair, DENV16 F and DENV16 R, from Table 1 , Figure 9
- the melt curve profiles of the four serotypes 1-4 of Dengue viruses are plotted in a single graph and they are indicated by DENV1 , DENV2, DENV3, and DENV4 respectively.
- Each curve of the serotypes 1-4 has a
- NTC Non Template Control
- Each primer pair of the Dengue sequences is designed to enable each serotype of the Dengue virus to have a melt curve profile with a distinct peak in the Derivative Reporter (-Rn) value at a specific melting temperature.
- Each of the melt curve profiles may be used as a reference for detecting and identifying the Dengue virus, and in particular, for detecting and identifying different serotypes of the Dengue virus in an unknown sample.
- an unknown sample can be subjected to real time RT-PCR reaction by using the primer pairs associated with either one of Figures 7 to 9. Thereafter, the melt curve profile of the unknown sample can be plotted. If the melt curve profile of the unknown sample associated with a primer pair from either one of Figures 7 to 9 correlates with the corresponding reference melt curve profile associated with the same primer pair that is plotted for a particular serotype of the Dengue virus, it is indication that the particular serotype of the Dengue virus is present in the unknown sample.
- a primer pair from the Chikungunya sequences of table 2 can be used in combination with a primer pair from the Dengue sequences of table 1 in a single tube reaction. It is noted that the melt curve profiles of the Chikungunya virus are different from those of the Dengue virus. Furthermore, the melt curve profiles of the serotypes of the Dengue virus are different from each other.
- Figures 10 to 13 relate to multiplex real time PCR Profiles of the Dengue and Chikungunya viruses.
- the RNAs of the Chikungunya virus, Dengue Virus Type 1 , Dengue Virus Type 2, Dengue Virus Type 3 and Dengue Virus Type 4 are subjected to a real time RT-PCR reaction by using a combination of the Chikungunya sequence set CHK4 and the Dengue sequence set DEN16 ( Figure 10), a combination of the Chikungunya sequence set CHK15 and the Dengue sequence set DEN16 ( Figure 11 ), a combination of the Chikungunya sequence set CHK13 and the Dengue sequence set DEN7m1 ( Figure 12), the Chikungunya sequence set CHK9 and the Dengue sequence set DEN7m1 ( Figure 13), respectively.
- the Chikungunya sequence set CHK4 is associated with primer pair, CHIKV4 F and CHIKV4 R, from Table 2.
- the Dengue sequence set DEN 16 is associated with primer pair, DENV16 F and DENV16 R, from Table 1.
- the Chikungunya sequence set CHK15 is associated with primer pair, CHIK15 F and CHIK15 R, from Table 2.
- the Chikungunya sequence set CHK13 is associated with primer pair, CHIK13 F and CHIK13 R, from Table 2.
- the Dengue sequence set DEN7m1 is associated with primer pair, DEN7m3 F and DEN7M1 R, from Table 1.
- the Chikungunya sequence set CHK9 is associated with CHIK9 F and CHIK9 R, from Table 2.
- the melt curve profile of an unknown biological sample from a patient suspected to be infected by the Chikungunya and/or dengue viruses can be compared (or matched) with the melt curve profiles of the reference samples to detect and identify whether the Chikungunya and/or serotypes 1- 4 of the dengue virus are present in the unknown biological sample. If the melt curve profile(s) of the unknown biological sample matches one or more of the melt curves plotted for the reference samples, the patient would be deemed to be infected by the corresponding virus of the matching melt curve.
- an unknown patient sample may produce one or more melt curves with distinct peaks.
- two respective melt curves can be generated and the presence of both the Chikungunya virus and one of the Dengue serotypes can be detected from the unknown patient sample and in a single assay.
- the more than one melt curves with distinct peaks can be matched with the melt curves plotted based on reference samples to detect the presence of the Chikungunya virus and one of the Dengue serotypes.
- melt curves (same or substantially same melting temperature) from singleplex reactions (as shown in Figures 1 to 9) and multiplex reactions (as shown in Figures 10 to 13) indicates a consistent specific amplification, as well as, negligible interference between the Dengue sequences and the Chikungunya sequences.
- This feature enables the present example embodiment of the present invention to allow specific and accurate assay for Dengue and Chikungunya virus detection and quantitation.
- NTC Non Template Control
- results of a laboratory test on laboratory Dengue (DENV) strains i.e. strains cultivated in a laboratory
- DENV1 , DENV2, DENV3 and DENV4 results of a laboratory test on laboratory Dengue (DENV) strains (i.e. strains cultivated in a laboratory) of the four serotypes, DENV1 , DENV2, DENV3 and DENV4 is described as follows.
- the strains are tested by using the combination of primer pair for DENV7M1 from Table 1 and primer pair for CHIK13 from Table 2 on an Applied Biosystems® StepOnePlusTM Real- Time PCR System.
- Table 5 results of a laboratory test on laboratory Dengue (DENV) strains (i.e. strains cultivated in a laboratory) of the four serotypes, DENV1 , DENV2, DENV3 and DENV4 is described as follows.
- the strains are tested by using the combination of primer pair for DENV7M1 from Table 1 and primer pair for CHIK13 from Table 2 on an
- the tested viral RNA was extracted from 40 ⁇ of infected culture supernatant from each Dengue serotype using QIAamp viral RNA mini kit (QIAGEN, Germany) by following the manufacturer's protocols.
- the viral RNA was extracted from 140 ⁇ of infected culture supernatant from three different Chikungunya virus strains, Strains 1 to 3, using QIAamp viral RNA mini kit (QIAGEN, Germany) by following the manufacturer's protocols.
- Real time RT-PCR reactions were performed for each of the viral RNA samples associated with the three Chikungunya virus strains, and the melting temperature of the amplification product of the individual viral RNA sample was recorded and shown in the Table 6 and jn Figures 18 and 19.
- the graphs in Figures 18 and 19, and the data extracted from the graphs in Table 6 shows that the melting temperature, Tm, of each of the samples falls in the range between 87.000 - 88.000 °C.
- Tm intervals for identification of the dengue serotypes (DENV1 , DENV2, DENV3 or DENV4) or the Chikungunya virus (CHIKV) are described with reference to Figure 20 as follows. From the Tm variations obtained through tests carried out, such as those described with reference to Figures 14 to 19, for each Dengue serotype or the Chikungunya virus (CHIKV), a Tm interval system as illustrated by a graph in Figure 20 can be derived for viral identification.
- the presence of a Dengue serotype (DENV1 , DENV2, DENV3 or DENV4) or the Chikungunya virus (CHIKV) in an unknown sample can be identified by comparing the Tm, measured after performing real time RT-PCR and which are associated with the unknown sample, with the Tm intervals in Figure 20.
- Chikungunya virus in an unknown sample can be identified if the Tm associated with the unknown sample is in the range of 87.00°C to 88.00 °C.
- Dengue serotype, DENV1 in an unknown sample can be identified if the Tm associated with the unknown sample is in the range of 85.60°C to 87.00 °C.
- Dengue serotype, DENV3 in an unknown sample can be identified if the Tm associated with the unknown sample is in the range of 84.50°C to 85.60 °C.
- Dengue serotype, DENV4 in an unknown sample can be identified if the Tm associated with the unknown sample is in the range of 82.80°C to 84.50 °C.
- Dengue serotype, DENV2 in an unknown sample can be identified if the Tm associated with the unknown sample is in the range of 81.50°C to 82.80 °C.
- the viral RNA is extracted from 140 ⁇ of infected culture supernatant and patient serum samples using QIAamp viral RNA mini kit (QIAGEN, Germany), following the manufacturer's protocols.
- the viral RNA is eluted in a volume of 30 ⁇ of elution buffer and was stored at -80°C till use.
- RNA quantification of viral RNA was achieved by generating standard curves from 10- fold serial dilutions of RNA isolated from a prototype virus with known titre (Plaque forming unit (PFU) per mL) which was determined by plaque assay.
- PFU protein forming unit
- a method for generating standard curves for the four Dengue serotypes and the Chikungunya virus illustrating viral quantitation by SYBR green l-based real time RT- PCR using DENV7m1/CHK13 primer combination is described as follows.
- RNA standards i.e. RNAs of samples with known viral titre
- RNA of samples from patients suspected to be infected with one of the dengue serotypes or the Chikungunya virus i.e. samples to be quantitated
- RNA of samples from patients suspected to be infected with one of the dengue serotypes or the Chikungunya virus i.e. samples to be quantitated
- the real time RT-PCR conditions for the one-step SYBR green I RT-PCR consist of a 30min reverse transcription step at 44°C and then 5 min of Taq polymerase activation at 94°C, followed by 40 cycles of PCR at 94°C for 15s (denaturation), and an annealing and extension step at 60°C for 1 min.
- the fluorescence emitted by the amplification product of all the standards is captured at the end of the extension step of each cycle at 530 nm.
- Amplification graphs of all the standards are checked for the threshold cycle (Ct) value of the amplification product.
- the Ct value represents the cycle by which the fluorescence of a tested sample increases to a level higher than the background fluorescence in the amplification cycle.
- Ct values of the 10-fold serial diluted RNA standards were plotted versus RNA quantity (PFU/mL) and the curves as plotted are known as the standard curves.
- the Melt Curve Analysis as described previously with reference to Figures 6 to 13 is performed after PCR amplification to verify that the correct amplification product is amplified by examining its specific melting temperature (Tm).
- Tm specific melting temperature
- the Tm for each sample was used to identify the dengue serotype or the Chikungunya virus and the samples sharing the same Tm were interpreted as belonging to the same Dengue serotype or the Chikungunya virus.
- Each of the standard curves as shown in Figures 21 to 25 were generated by graphing the Ct value for the tested sample versus the logarithmic scale of the DNA concentration used.
- the x value which is the logarithm of 10 will be calculated as follows.
- the final viral titre will be 10 449 (PFU/mL)
- PCR Efficiency io ⁇ 1/slope
- E the PCR Efficiency
- slope the gradient of the linear equation
- y represents Ct value and x represents the virus quantity.
- a correlation value, R2, of the standard curve in Figure 21 is equal to 0.997 and it is indicative of good linear correlation.
- the PCR Efficiency of the reaction relating to Figure 21 is 98.342%.
- y represents Ct value
- x represents the virus quantity.
- a correlation value, R2 of the standard curve in Figure 22 is equal to 0.959 and it is indicative of good linear correlation.
- the PCR Efficiency of the reaction relating to Figure 22 is 94.186%.
- y represents Ct value and x represents the virus quantity.
- a correlation value, R2, of the standard curve in Figure 23 is equal to 0.998 and it is indicative of good linear correlation.
- the PCR Efficiency of the reaction relating to Figure 23 is 98.342%.
- y represents Ct value and x represents the virus quantity.
- a correlation value, R2, of the standard curve in Figure 24 is equal to 0.998 and it is indicative of good linear correlation.
- the PCR Efficiency of the reaction relating to Figure 24 is 98.342%.
- y represents Ct value and x represents the virus quantity.
- a correlation value, R2, of the standard curve in Figure 25 is equal to 0.982 and it is indicative of good linear correlation.
- the PCR Efficiency of the reaction relating to Figure 25 is 98.342%.
- Sensitivity Number of positive specimens/(number of positive specimens + number of false negative specimens) X 100%.
- Embodiments of the present invention seek to address at least one of the problems in the prior art.
- a molecular technique based diagnostic platform e.g. Arbo-Q
- the molecular technique based diagnostic platform is based on real time RT-PCR tests.
- the PCR test based diagnostic platform provides early diagnostic detection of the Chikungunya and Dengue viruses.
- the methodology and medical diagnostic kit of embodiments of the present invention utilises a diagnostic platform (e.g. Arbo-Q) that is capable of fast diagnosis, affordable, easy to use, provides specific and sensitive detection, identification and/or quantification of the Chikungunya and Dengue viruses.
- the diagnostic platform may be utilized in various diagnostic settings such as polyclinics, hospitals and research, medical and public health laboratories.
- the primer sets having the Chikungunya and Dengue sequences of embodiments of the present invention are able to work simultaneously in a single tube reaction to specifically detect the respective virus genome RNA templates in a multiplex real time platform format.
- a sample containing just a Chikungunya virus in one assay or tube reaction, can be detected and identified using the primers from table 2 and the Chikungunya virus can be quantitated as well.
- a sample containing just one Dengue serotype in one assay or tube reaction, can be detected and identified using the primers from table 1 and the Dengue serotype can be quantitated as well.
- a sample containing the Chikungunya virus and one Dengue serotype in one assay or tube reaction, can be detected and identified using a primer pair from table 1 (which works for any one of the Dengue serotypes) and a primer pair from table 2 (which works for Chikungunya virus).
- table 1 which works for any one of the Dengue serotypes
- table 2 which works for Chikungunya virus
- quantitation of each of the Chikungunya virus or the Dengue serotype in the sample may require more than one assays.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Virology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Description
ISOLATED OLIGONUCLEOTIDES, METHODS AND KITS FOR
DETECTION, IDENTIFICATION AND/OR QUANTITATION OF
CHIKUNGUNYA AND DENGUE VIRUSES FIELD OF INVENTION
The present invention relates to an isolated oligonucleotide, a method and kit for detection, identification and/or quantitation of virus. In particular, the present invention also relates to a medical diagnostic kit for detecting viruses and primers suitable for use in such a kit.
BACKGROUND
One of the biggest challenges for health authorities, national health policy administrators and infectious disease clinicians is the early diagnostic detection and differentiation of Dengue and Chikungunya viruses in countries endemic for both viral diseases. Dengue and Chikungunya viruses cause very similar early symptoms in infected patients that can be difficult to differentiate without performing a costly and time consuming series of diagnostic tests and analysis. Traditionally, the Dengue and Chikungunya viruses have been diagnosed primarily via serological methods. However, Sero diagnosis of the viruses is dependent on the stage of a viral infection and generally can only detect the infection towards the end of the first week of illness. Some sero diagnosis methods target specific viral proteins and are able to detect the infection earlier. However, these methods may be effective only for a short window of time, for example after infection but before the production of antibodies that bind to these viral proteins in patient bodies. The short window of time makes the detection difficult.
In both cases of virus infection, the limitations in the diagnosis methods may impede proper clinical management of patients. Hospital infrastructures may be unnecessarily overburdened as patients infected with the mild form of the Dengue virus and the Chikungunya virus need not be hospitalized.
Recent advances in molecular techniques and in rapid detection technology resulted in the common utilization of molecular methods in the detection of the Dengue and
Chikungunya viruses. However, existing methods that are able to detect the Chikungunya and Dengue viruses require separate reactions to be carried out, which are costly and inconvenient to use. Some examples are provided as follows.
A study conducted on "Cost-Effective Real-Time Reverse Transcriptase PCR (RT- PCR) To Screen for Dengue Virus followed by Rapid Single-Tube Multiplex RT-PCR for Serotyping of the Virus" (Journal of Clinical Microbiology, Mar. 2007, p. 935-941 ) adopted a methodology using SYBR green I based real time RT-PCR. RT-PCR refers to reverse transcriptase polymerase chain reaction. The Targeted viruses are the 4 serotypes of the Dengue virus namely DENV1 , DENV2, DENV3, and DENV4. The Detection limit for each serotype is 10/PFU. The Sensitivity / No. of confirmed samples is 100% / 90 and the Specificity / No. of healthy samples is 100% / 20.
A study (hereinafter "Kumar et al") conducted on "Development and evaluation of a 1- step duplex reverse transcription polymerase chain reaction for differential diagnosis of Chikungunya and Dengue infection" (Diagnostic Microbiology and Infectious Disease 62 (2008) 52- 57) adopted a methodology using conventional PCR. The Targeted viruses and the respective Detection limits are DENV1 with limit of 500 RNA copies / assay, DENV2 with a limit of 500 RNA copies / assay, DENV3 with a limit of 10000 RNA copies / assay, DENV4 with a limit of 500 RNA copies / assay and CHIKV (refers to the Chikungunya virus) with a limit of 100 RNA copies / assay. The Sensitivity / No. of confirmed samples for Dengue is 100% / 28 DENV and the The Sensitivity / No. of confirmed samples for Chikungunya is 100% / 22 CHIKV. The Specificity / No. of healthy samples is 100% / 20.
A study conducted on "Rapid detection, serotyping and quantitation of Dengue viruses by TaqMan real-time one-step RT-PCR" (Journal of Virological Methods 138 (2006) 123-130) adopted a methodology using TaqMan probe based real time PCR. The Targeted virus is DENV1-4 and the Detection limit is 100 RNA copies / μΙ. The Sensitivity / No. of confirmed samples is 89.54% / 306 and the Specificity / No. of healthy samples is 100% / 70.
A study conducted on "Rapid detection and serotyping of Dengue virus by multiplex RT-PCR and real-time SYBR green RT-PCR" (Singapore Medical Journal 2007; 48 (7) : 665) adopted a methodology using SYBR Green I based real time RT-PCR. The Targeted virus is DENV1-4 and the Detection limit is 50 RNA copies / μΙ. The Sensitivity / No. of confirmed samples is 99.09% / 210 and the Specificity / No. of healthy samples is 100% / 70.
In summary, current methods including those adopted in the examples above are not able to provide rapid, sensitive and reliable detection of both Chikungunya and Dengue viruses, and/or to differentiate between different serotypes of Dengue viruses, are not effective for a longer period of time from onset of an infection, are costly, are not easy to use and requires more than a single reaction.
SUMMARY OF THE INVENTION
In accordance with a first aspect of an example embodiment of the present invention, there is provided an isolated oligonucleotide comprising a nucleic acid sequence having at least 80% homology to a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 20:
CCACCTGGGCCAAGAACAT (SEQ ID NO:1 );
CTACAGGCAGCACGGTTTGC (SEQ ID NO:2);
GAAGACATTGACTGYTGGTGCAA (SEQ ID NO:3);
CGATGTTTCCACGCCCCTTC (SEQ ID NO:4);
ACA TGT TTC CAA GCC CCC TTC (SEQ ID NO:5);
GCC CCT TCG GAC GAC ATC CA (SEQ ID NO:6);
GCATGCCGACATGGGTTATTG (SEQ ID NO: 7);
GTGCCATGGTCCTGCTGTTTGT (SEQ ID NO:8);
GCGGTACCCCAACAGAAG (SEQ ID NO:9);
G GTTTCTTTTTAG GTG G CTG (SEQ ID NO: 10);
TCTATGCTGTACATGCACCCACG (SEQ ID NO:11 );
GTACATGAACGGGGTTGTGTCAAA (SEQ ID NO: 12);
GCGGACCTGGCCAAACTG (SEQ ID NO: 13);
CGAGAGGGCTGTACGGGCT (SEQ ID NO: 14);
GGC GAC CCG TGG ATA AAG A (SEQ ID NO: 15);
ACT GCA GAT GCC CGC CAT TA (SEQ ID NO: 16);
CGAGATACTGCCCGTCCCGT (SEQ ID NO: 17);
GTCACGCGTCTCCGCTGTTT (SEQ ID NO: 18);
ACGACGGCCGAGTCCTAGTG (SEQ ID NO: 19) ; and
CCAGTACCAGTCCTGCGGCT (SEQ ID NO:20).
In accordance with a second aspect of an example embodiment of the present invention, there is provided a combination of sets of primers for detection, identification and /or quantitation of at least two viruses, or a nucleic acid of the at least two viruses, in a sample, wherein the combination comprises at least one set of primers having nucleic acid sequences with at least 80% homology to the nucleic acid sequences selected from the group consisting of Sets 1 to 5, and at least one set of primers having nucleic acid sequences with at least 80% homology to the nucleic acid sequences selected from the group consisting of Sets 6 to 11 :
Set 1 - DEN4
FP: 5' CCACCTGGGCCAAGAACAT 3' (SEQ ID NO: 1 )
RP: 5' CTACAGGCAGCACGGTTTGC 3' (SEQ ID NO:2);
Set 2 - DEN7M1
FP: 5' GAAGACATTGACTGYTGGTGCAA 3' (SEQ ID NO:3)
RP: 5' CGATGTTTCCACGCCCCTTC 3' (SEQ ID NO:4);
Set 3 - DEN7M2
FP: 5' GAAGACATTGACTGYTGGTGCAA 3' (SEQ ID NO:3)
RP: 5' ACA TGT TTC CAA GCC CCC TTC 3' (SEQ ID NO:5);
Set 4 - DEN7 3
FP: 5' GAAGACATTGACTGYTGGTGCAA 3' (SEQ ID NO:3)
RP: 5' GCC CCT TCG GAC GAC ATC CA 3' (SEQ ID NO:6);
Set 5 - DENV16
FP: 5' GCATGCCGACATGGGTTATTG 3' (SEQ ID NO:7)
RP: 5' GTGCCATGGTCCTGCTGTTTGT 3' (SEQ ID NO:8); Set 6 - CHKCAP
FP: 5' GCGGTACCCCAACAGAAG 3' (SEQ ID NO:9)
RP: 5' GGTTTC I I I I I AGGTGGCTG 3' (SEQ ID NO: 10);
Set 7 - CHKMET2
FP: 5' TCTATG CTGTAC ATG C ACCCACG 3' (SEQ ID NO: 11 )
RP: 5' GTACATGAACGGGGTTGTGTCAAA 3' (SEQ ID NO:12);
Set 8 - CHIKV4
FP: 5' GCGGACCTGGCCAAACTG 3' (SEQ ID NO: 13)
RP: 5' CGAGAGGGCTGTACGGGCT 3' (SEQ ID NO: 14);
Set 9 - CHIK9
FP: 5' GGC GAC CCG TGG ATA AAG A 3' (SEQ ID NO: 15)
RP: 5' ACT GCA GAT GCC CGC CAT TA 3' (SEQ ID NO: 16);
Set 10 - CHIK13
FP: 5' CGAGATACTGCCCGTCCCGT 3' (SEQ ID NO: 17)
RP: 5' GTCACGCGTCTCCGCTGTTT 3' (SEQ ID NO: 18); and
Set 11 - CHIK15
FP: 5' ACGACGGCCGAGTCCTAGTG 3' (SEQ ID NO: 19)
RP: 5' CCAGTACCAGTCCTGCGGCT 3' (SEQ ID NO:20).
In accordance with a third aspect of an example embodiment of the present invention, there is provided a method for detection, identification and/or quantitation of at least one virus, or the nucleic acid of the at least one virus, in a sample, comprising:
(a) performing an amplification reaction on the sample in the presence of at least one set of primers having nucleic acid sequences with at least 80% homology to the nucleic acid sequences selected from the group consisting of Sets 1 to 11. The step (a) may be performed in the presence of a fluorescent dye which exhibits increased fluorescence intensity upon binding to an amplification product.
The method may further comprise:
(c) obtaining a melt curve of the amplification product; and
(d) identifying the virus associated with the amplification product by matching the melt curve of the amplification product with a melt curve of at least one reference sample with a known nucleic acid, wherein the amplification product is associated with a virus having the known nucleic acid if the melt curve of the amplification product matches with the melt curve of the at least one reference sample.
The method may be for detection, identification and/or quantitation of at least two viruses in a sample, and the amplification reaction is performed in the presence of at least one set of primers having the nucleic acid sequences with at least 80% homology to the nucleic acid sequences selected from the group consisting of Sets 1 to 5, and at least one set of primers having the nucleic acid sequences with at least 80% homology to the nucleic acid sequences selected from the group consisting of Sets 6 to 11.
The method may further comprise:
(i) providing a nucleic acid amplification reaction mixture that comprises said sample and a fluorescent dye, wherein the dye exhibits increased fluorescence intensity upon binding to a double-stranded nucleic acid;
(ii) measuring the emitted light produced by the mixture of step (i);
(iii) treating said mixture under conditions for amplifying said target nucleic acid to produce amplified double-stranded nucleic acid;
(iv) measuring the emitted light produced by the mixture of step (iii) to determine if amplification has occurred and optionally to quantify the amount of a target nucleic acid in the sample. Steps (ii) and (iv) may each further comprise a step of providing excitation light to the reaction mixture and conveying fluorescent light emitted by the reaction mixture to a detector, wherein at steps (ii) and (iv) the amount of emitted light produced by exposing the mixture to excitation light is determined, and at step (iv) the relative amount of emitted light produced at steps (ii) and (iv) is compared to determine if amplification has occurred and optionally to quantify the amount of a target nucleic acid in the sample.
The step (a) may comprise a real time reverse transcription polymerase chain reaction.
The fluorescent dye may be SYBR Green I (2-(N-(3-dimethylaminopropyl)-N- propylamino)-4-(2,3-dihydro-3-methyl-(benzo-1 ,3-thiazol-2-yl)-methylidene)-1- phenylquinolinium chloride).
In accordance with a fourth aspect of the embodiment of the present invention, there is provided a kit for detection, identification and/or quantification of at least one virus in a sample, comprising at least one oligonucleotide according to the first aspect of the embodiment of the present invention.
The at least one virus or the at least two viruses mentioned above may be selected from Chikungunya virus, Dengue Virus Serotype 1 , Dengue Virus Serotype 2, Dengue Virus Serotype 3 and Dengue Virus Serotype 4.
BRIEF DESCRIPTION OF DRAWINGS
Embodiments of the invention will be better understood and readily apparent to one skilled in the art from the following written description, by way of example only and in conjunction with the drawings, in which:
Figure 1 shows a melt curve profile of the amplification product of a sample containing a Chikungunya virus obtained using a primer pair with the name, CHKCAP. Figure 2 shows a melt curve profile of the amplification product of a sample containing a Chikungunya virus obtained using a primer pair with the name, CHKMET2.
Figure 3 shows a melt curve profile of the amplification product of a sample containing a Chikungunya virus obtained using a primer pair with the name, CHK4 from a Chikungunya sequence.
Figure 4 shows a melt curve profile of the amplification product of a sample containing a Chikungunya virus obtained using a primer pair with the name, CHK9.
Figure 5 shows a melt curve profile of the amplification product of a sample containing a Chikungunya virus obtained using a primer pair with the name, CHK13.
Figure 6 shows a melt curve profile of the amplification product of a sample containing a Chikungunya virus obtained using a primer pair with the name, CHK15.
Figure 7 shows a melt curve profile of the amplification product of a sample containing a Dengue virus obtained using a primer pair with the name, DEN4. Figure 8 shows a melt curve profile of the amplification product of a sample containing a Dengue virus obtained using a primer pair with the name, DEN7m1.
Figure 9 shows a melt curve profile of the amplification product of a sample containing a Dengue virus obtained using a primer pair with the name, DEN16.
Figure 10 shows a melt curve profile of the amplification product of a sample containing a Dengue virus obtained using a combination primer pair containing CHK4 and DEN 16.
Figure 11 shows a melt curve profile of the amplification product of a sample containing a Dengue virus obtained using a combination primer pair containing CHK15 and DEN16.
Figure 12 shows a melt curve profile of the amplification product of a sample containing a Dengue virus obtained using a combination primer pair containing CHK13 and DEN7m1.
Figure 13 shows a melt curve profile of the amplification product of a sample containing a Dengue virus obtained using a combination primer pair containing CHK9 and DEN7m1.
Figure 14 shows a melt curve profile of the amplification product of samples containing Dengue virus obtained using a combination primer pair containing CHIK13 and DEN7m1.
Figure 15 shows a melt curve profile of the amplification product of samples containing Dengue virus obtained using a combination primer pair containing CHIK13 and DEN7m1. Figure 16 shows a melt curve profile of the amplification product of samples containing Dengue virus obtained using a combination primer pair containing CHIK13 and DEN7m1.
Figure 17 shows a melt curve profile of the amplification product of samples containing Dengue virus obtained using a combination primer pair containing CHIK13 and DEN7m1.
Figure 18 shows a melt curve profile of the amplification product of samples containing Chikungunya virus obtained using a combination primer pair containing CHIK13 and DEN7m1.
Figure 19 shows a melt curve profile of the amplification product of samples containing Chikungunya virus obtained using a combination primer pair containing CHIK13 and DEN7m1.
Figure 20 illustrates melting temperature intervals for identification of the Dengue and Chikungunya viruses.
Figure 21 shows a standard curve for quantitating a Dengue virus strain.
Figure 22 shows a standard curve for quantitating a Dengue virus strain. Figure 23 shows a standard curve for quantitating a Dengue virus strain. Figure 24 shows a standard curve for quantitating a Dengue virus strain. Figure 25 shows a standard curve for quantitating a Chikungunya virus.
DETAILED DESCRIPTION
Bibliographic references mentioned in the present specification are provided for reference convenience and they are listed in the form of a list of references and added at the end of this description. The whole content of the bibliographic references is herein incorporated by reference.
To facilitate review of the various embodiments of the invention, the following explanations of terms are provided: Amplification (or amplification reaction): To increase the number of copies of a nucleic acid molecule. The resulting amplification products are called "amplicons." Amplification of a nucleic acid molecule (such as a DNA or RNA molecule) refers to use of a technique that increases the number of copies of a nucleic acid molecule in a sample. An example of amplification is the polymerase chain reaction (PCR), in which a sample is contacted with a pair of oligonucleotide primers under conditions that allow for the hybridization of the primers to a nucleic acid template in the sample. The primers are extended under suitable conditions, dissociated from the template, re- annealed, extended, and dissociated to amplify the number of copies of the nucleic acid. This cycle can be repeated. The product of amplification (or amplification product) can be characterized by such techniques as electrophoresis, restriction endonuclease cleavage patterns, oligonucleotide hybridization or ligation, and/or nucleic acid sequencing. Characterization of the product of amplification refers to, for example, determining the size or sequence of the product. Other examples of in vitro amplification include but are not limited to real time PCR; reverse transcriptase PCR (RT-PCR); real time reverse transcriptase PCR (real time RT-PCR). -
Nucleic acid (molecule or sequence): A deoxyribonucleotide or ribonucleotide polymer including without limitation, cDNA, mRNA, genomic DNA, viral genome RNA, and synthetic (such as chemically synthesized) DNA or RNA. The nucleic acid can be double stranded (ds) or single stranded (ss). Where single stranded, the nucleic acid can be the sense strand or the antisense strand. Nucleic acids can include natural nucleotides (such as A, T/U, C, and G), and can also include analogs of natural nucleotides, such as labeled nucleotides.
Nucleotide: The fundamental unit of nucleic acid molecules. A nucleotide includes a nitrogen-containing base attached to a pentose monosaccharide with one, two, or three phosphate groups attached by ester linkages to the saccharide moiety.
The major nucleotides of DNA are deoxyadenosine 5'-triphosphate (dATP or A), deoxyguanosine 5'-triphosphate (dGTP or G), deoxycytidine 5'-triphosphate (dCTP or C) and deoxythymidine 5'-triphosphate (dTTP or T). The major nucleotides of RNA are adenosine 5'-triphosphate (ATP or A), guanosine 5'-triphosphate (GTP or G), cytidine 5'-triphosphate (CTP or C) and uridine 5'-triphosphate (UTP or U).
Nucleotides include those nucleotides containing modified bases, modified sugar moieties and modified phosphate backbones, for example as described in U.S. Patent No. 5,866,336 to Nazarenko et al. (herein incorporated by reference).
Primers: Short nucleic acid molecules, such as a DNA oligonucleotide, for example sequences of at least 15 nucleotides, which can be annealed to a complementary target nucleic acid molecule by nucleic acid hybridization to form a hybrid between the primer and the target nucleic acid strand. A primer can be extended along the target nucleic acid molecule by a polymerase enzyme. Therefore, primers can be used to amplify a target nucleic acid molecule, wherein the sequence of the primer is specific for the target nucleic acid molecule, for example so that the primer will hybridize to the target nucleic acid molecule under very high stringency hybridization conditions. The specificity of a primer increases with its length. Thus, for example, a primer that includes 30 consecutive nucleotides will anneal to a target sequence with a higher specificity than a corresponding primer of only 15 nucleotides. Thus, to obtain greater specificity, probes and primers can be selected that include at least 15, 20, 25, 30, 35, 40, 45, 50 or more consecutive nucleotides.
In particular examples, a primer is at least 15 nucleotides in length, such as at least 15 contiguous nucleotides complementary to a target nucleic acid molecule. Particular lengths of primers that can be used to practice the methods of the present disclosure include primers having at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 , at least 22, at least 23, at least 24, at least 25, at least 26, at least
27, at least 28, at least 29, at least 30, at least 31 , at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 45, at least 50, or more contiguous nucleotides complementary to the target nucleic acid molecule to be amplified, such as a primer of 15-60 nucleotides, 15-50 nucleotides, or 15-30 nucleotides.
Primer pairs can be used for amplification of a nucleic acid sequence, for example, by PCR, real time PCR, or other nucleic-acid amplification methods known in the art. For example, a "forward" primer may be a primer 5' to a reference point on a nucleic acid sequence. A "reverse" primer may be a primer 3' to a reference point on a nucleic acid sequence. In general, at least one forward and one reverse primer are included in an amplification reaction. PCR primer pairs can be derived from a known sequence by using computer programs intended for that purpose such as Primer (Version 0.5, © 1991 , Whitehead Institute for Biomedical Research, Cambridge, MA).
Real time PCR: A method for detecting and measuring products generated during each cycle of a PCR, which are proportionate to the amount of template nucleic acid prior to the start of PCR. The information obtained, such as an amplification curve, can be used to determine the presence of a target nucleic acid and/or quantitate the initial amounts of a target nucleic acid sequence. In some examples, real time PCR is real time reverse transcriptase PCR (real time RT-PCR).
Quantitating a nucleic acid molecule: Determining or measuring a quantity (such as a relative quantity) of nucleic acid molecules present, such as the number of amplicons or the number of nucleic acid molecules present in a sample. In some examples, it is determining -the relative amount or actual number of nucleic acid molecules present in a sample. A diagnostic platform of an example embodiment of the present invention for detecting, identifying and/or quantitating nucleic acids, in particular, viral genome RNA of the Chikungunya and Dengue viruses, present in a biological sample, is described as follows.
The diagnostic platform is herein denoted as Arbo-Q. Arbo-Q is an SYBR® Green I real time RT-PCR based assay where viral nucleic acids could be detected and/or quantitated based on change in fluorescent signal from SYBR Green molecules that are bound to amplification products of the viral nucleic acids.
A Chikungunya virus is generally a small (about 60-70 nm-diameter), spherical, enveloped, positive-strand RNA virus.
The Chikungunya virus may comprise any strain of the Chikungunya virus. The Chikungunya virus may comprise the IND-63-WB1 strain (Gen Bank accession no. EF027140). The Chikungunya virus may comprise any of the following: NC004162 :D570/06 (Africa), EU244823:ITA07-RAI (Italy), EU037962:Wuerzburg(Germany), EF012359.D570/06 (Mauritius/island nation off the coast of the African continent), EF210157:DRDEHydlSW06 (India), EF452493:AF15561 (Bangkok), AF369024:S27- African prototype (Africa), DQ443544: LR2006OPY1 (Travelers Returning from Indian Ocean Islands) and AF490259: Ross (Ross/Scotland);
A Dengue virus generally consists of 4 serotypes. They include Dengue Virus Type 1 , Dengue Virus Type 2, Dengue Virus Type 3 and Dengue Virus Type 4. The Dengue virus has a sssRNA based genome of approximately 11000 base pairs (bp).
The Dengue virus may comprise any strain of the Dengue virus. The Dengue virus may comprise a Dengue Virus Type 1 strain D1/SG/06K2290DK1/2006 (EU081281 ). It may comprise any one or more of EU081281 , EU081276, EU081261 , NC_001477, AY762084, and M87512.
The Dengue virus may comprise a Dengue Virus Type 2 strain D2/SG/05K3295DK1/2005 (EU081177). It may comprise any one or more of EU081177, NC_001474 , AF169680, M20558, AY858036, and AB122022.
The Dengue virus may comprise a Dengue Virus Type 3 strain Singapore (AY662691 ). It may comprise any one or more of EU081225, EU081221 , EU081197,NC 001475, AY66269, and EU081214.
The Dengue virus may comprise a Dengue Virus Type 4 strain ThD4_0734_00 (AY618993). It may comprise any one or more of AY762085, AY947339, NC_002640, AY618993, AY152120, and AY762085. The Chikungunya virus or the Dengue virus may comprise a human Chikungunya or Dengue virus or an animal Chikungunya or Dengue virus.
SYBR Green I (2-(N-(3-dimethylaminopropyl)-N-propylamino)-4-(2,3-dihydro-3-methyl- (benzo-1 ,3-thiazol-2-yl)-methylidene)-1-phenylquinolinium chloride; sigma aldrich) is an asymmetrical cyanine dye capable of binding to RNA and DNA, preferentially to DNA and more preferentially to ds DNA. The resulting DNA-dye-complex absorbs blue light (Amax at about 497 nm) and emits green light (Amax at about 520 nm). When bound to ds DNA, SYBR Green I exhibits significantly increased fluorescence intensity over that exhibited when it is bound to ss DNA or RNA.
SYBR Green I technology can be used in real time PCR (or real time RT-PCR) analysis. The binding of SYBR Green I to nucleic acid is not sequence-specific and the fluorescent signal produced when in complex with ds DNA is directly proportionate to the length and amount of ds DNA copies synthesized during an amplification reaction of a nucleic acid. Hence, SYBR Green I technology based real time PCR (or real time RT-PCR) can provide sensitive and precise methods for detection, identification and quantification of nucleic acids in samples.
It is appreciated that the SYBR green I dye may be replaced by other fluorescent dyes with equivalent or higher specificity and capable of binding to double strand amplification products. Examples of such fluorescent dyes may include any fluorescent dye that is capable of binding to ds DNA, and one that exhibits significantly increased fluorescence intensity upon binding to ds DNA compared to the case when the fluorescent dye is bound to other nucleic acids.
Arbo-Q can work in any real time thermal cycler instrument which is capable of performing PCR, measuring fluorescence in real time and determining melting temperatures (Tm) of the amplification products.
In the example embodiment, primers having Chikungunya nucleic acid sequences (or in short, Chikungunya sequences) and Dengue nucleic acid sequences (or in short, Dengue sequences) are used for detection of Chikungunya and Dengue viruses (or nucleic acids therefrom) in a biological sample.
The Chikungunya and Dengue sequences described here may be single stranded or double stranded.
The Dengue sequences were selected based on the genome sequences of all four serotypes of Dengue virus as shown below:
Dengue virus 1 strain DENV-1/SG/07K3640DK1/2008 (NCBI ACCESSION:
GQ398255);
Dengue virus 2 strain DENV-2/SG/07K3608DK1/2008 (NCIB ACCESSION: GQ398265);
Dengue virus type 3 strain D3/SG/05K3329DK1/2005 (NCBI ACCESSION: EU081205); and
Dengue virus 4 strain DENV-4/SG/06K2270DK1/2005 (NCBI ACCESSION: GQ398256).
The Chikungunya sequence was selected based on the genome sequence of Chikungunya virus isolate SGEHICHD122508 (NCBI ACCESSION: FJ445502).
Where the context admits, the terms "Chikungunya sequence(s)" and "Dengue sequence(s)" should be taken to comprise any specific sequence(s) disclosed in this document, for example, a sequence or sequences set out in tables 1 and 2, as well as any variants-, fragments, derivatives and homologues of such specific nucleic acid sequence(s). Primers having the sequences in table 1 can be used for detection of the Dengue virus, including the 4 serotypes of the Dengue virus, and primers having the sequences in table 2 can be used for detection of the Chikungunya virus. Primer names are provided for each sequence in the tables 1 and 2.
Table 1
Primer Name Sequence
DEN4 F CCACCTGGGCCAAGAACAT
DEN4 R CTACAGGCAGCACGGTTTGC
DEN7M3 F G AAG AC ATTG ACTG YTG GTG CAA
DEN7 1 R CGATGTTTCCACGCCCCTTC
DEN7M2 R ACA TGT TTC CAA GCC CCC TTC
DEN7M3 R GCC CCT TCG GAC GAC ATC CA
DENV16 F G C ATG CCG AC ATG G GTTATTG
DENV16 R GTGCCATGGTCCTGCTGTTTGT
Table 2
Primer Name Sequence
CHKCAP F GCGGTACCCCAACAGAAG
CHKCAP R G GTTTCTTTTTAG GTG G CTG
CHKMET2 F TCTATGCTGTACATGCACCCACG
CHKMET2 R GTACATGAACGGGGTTGTGTCAAA
CHIKV4 F GCGGACCTGGCCAAACTG
CHIKV4 R CGAGAGGGCTGTACGGGCT
CHIK9 F GGC GAC CCG TGG ATA AAG A
CHIK9 R ACT GCA GAT GCC CGC CAT TA
CHIK13 F CGAGATACTGCCCGTCCCGT
CHIK13 R G I CACGCG I I CCGC I G I I I
CHIK15 F ACGACGGCCGAGTCCTAGTG
CHIK15 R CCAGTACCAGTCCTGCGGCT
Sequences showing about 50% homology to the Chikungunya sequences and Dengue sequences as set out in tables 1 and 2 may be used in other example embodiments of the present invention. Furthermore, in ascending order of reliability, the sequences used in other example embodiments may be that showing at least about 60% homology, at least about 70% homology, at least about 80% homology, at least about 90% homology or at least about 95% homology to the sequences shown in tables 1 and 2.
It is appreciated that the Chikungunya sequences and Dengue sequences set out in tables 1 and 2 are selected from regions not within the highly conserved regions of the
Chikungunya and Dengue viral genomes. Therefore, the primers having the Chikungunya sequences and Dengue sequences set out in tables 1 and 2 are capable of detecting and differentiating different geographical isolates of the Chikungunya and Dengue viruses (i.e. the 4 serotypes of the Dengue virus). Furthermore, it is noted that three primer sets (having prefixes "DEN4", "DEN7M" and "DENV16" respectively) having the Dengue sequences are provided in table 1. Each of the primer sets is able to effectively detect and differentiate the 4 serotypes of Dengue viruses independently.
When in use, a forward primer (with name containing "F") may be paired with its corresponding reverse primer (with name containing "R") in the same table of sequences. For example, DEN4 F may be paired with DEN4 R. CHKCAP F may be paired with CHKCAP R. Furthermore, it is appreciated that DEN7M3 F may be used as a forward primer in a pair with either one of the reverse primers, DEN7M1 R, DEN7M2 R or DEN7M3 R, respectively.
Each pair of primers may be used independently, or more than one pair of primers may be used in combination in a single tube reaction to detect the the Chikungunya virus and one of the Dengue viruses (i.e. the 4 serotypes) (or nucleic acids therefrom). One pair of primers selected from the primers having the Chikungunya sequences may be used in combination with one pair of primers selected from the primers having the Dengue sequences, so that both the Chikungunya virus and the Dengue virus (or nucleic acids therefrom) can be detected in a biological sample simultaneously by carrying out a single tube reaction. This helps to specifically detect the respective virus genome RNA templates in a multiplex real time platform format.
The primers having the Chikungunya and Dengue sequences may be highly compatible during the amplification reactions. Therefore, one set of the primers having the Chikungunya sequences and one set of the primers having the Dengue sequences can be used in combination and still perform well under the same thermal cycling conditions in a single tube reaction.
Together, Arbo-Q and the primers having sequences in tables 1 and 2 can enable fast, affordable, convenient, specific and sensitive detection, identification and/or quantitation of the Chikungunya and Dengue viruses at the serotype level.
It is appreciated that the primers having the Chikungunya and Dengue sequences in tables 1 and 2 show high specificity and sensitivity towards the targeted viruses. An advantage of these primers is that the formation of primer dimer during amplification reactions by using such primers is negligible and this results in precise identification and accurate quantification of the viruses.
It is further appreciated that the primers used in the present invention are designed against highly conserved regions of the Chikungunya and Dengue viral genome and this translates to broad practicability of detecting different geographical isolates. Advantageously, the primers designed for the Dengue virus serotyping are able to detect all four Dengue serotypes and differentiate them according to the melting temperature of the amplicon. In addition, the primers having sequences described in this document for the Chikungunya and Dengue viruses are highly compatible during the amplification process which means processes for both viruses will performed well under the same thermal cycling conditions.
In the example embodiment, the detection of the Chikungunya and Dengue viruses may comprise the following steps.
A biological sample may be processed to extract nucleic acids, such as messenger RNA (mRNA). Thereafter, the mRNA may be reverse transcribed to cDNA. The cDNA may be amplified using primers having the Chikungunya and Dengue sequence(s). The amplification reaction may comprise PCR reactions, RT-PCR reactions, real time PCR reactions, and real time RT-PCR reactions. The amplification reaction may also comprise singleplex PCR reactions and multiplex PCR reactions. An amplification reaction normally comprise multiple amplification cycles. The fluorescence of the amplification products may be captured. Amplification graphs of the amplification reaction may be checked for the threshold cycle (Ct) value of the amplification products. The Ct value represents the cycle by which the fluorescence of a sample is increased to a level higher than the background fluorescence in the amplification cycle.
Following amplification, a melt curve analysis may be performed. Melt curves are used for comparison of the melting temperatures of the amplification products. Different ds DNA molecules (such as the amplification products from different viral nucleic acids) melt at different temperatures. The melting temperatures are dependent on a number of factors including GC content, amplification product length, secondary and tertiary structure, and chemical formulation of the reaction chemistry.
In the example embodiment, a method is provided for identifying nucleic acids present in an unknown biological sample by analysing the melt curve of nucleic acid amplification products to determine the presence and identity of known nucleic acids. In particular, the melt curve of the nucleic acid amplification products may indicate melting temperatures of the nucleic acids present in the unknown sample. Correlating these melting temperatures of the nucleic acids present in the unknown sample analysed to melting temperatures of known nucleic acids associated with reference samples containing specific viruses and/or viral serotypes can enable identification and/or detection of a virus selected from the Chikungunya and Dengue viruses (i.e. the 4 serotypes) in the unknown sample.
Furthermore, in the example embodiment, detection and identification of both the Chikungunya and Dengue viruses (i.e. the 4 serotypes) (or nucleic acids therefrom) can be carried out on the unknown sample and simultaneous identification of different serotypes of Dengue virus in the unknown sample can be carried out through a single tube reaction. Identification of the Chikungunya virus and the different serotypes of Dengue virus (or nucleic acids therefrom) in the unknown sample can be accomplished by analysing the melt curve profile of the unknown sample and comparing (or matching) it with a melt curve profile (or melt curve profiles) of a reference sample (or reference samples) containing nucleic acids of the Chikungunya and/or Dengue viruses. One advantage of the example embodiments of the present invention is that information relating to the melt curve profile of the unknown sample can be obtained during the course of the amplification reaction and may be analyzed thereafter. As such, there is no requirement for any additional step (such as gel electrophoresis) to be conducted after the amplification reaction to characterize the amplification products so as to determine which of the Chikungunya virus or the different serotypes of Dengue virus are present in the unknown sample.
Components of reaction mixtures and protocols that are suitable for the methodology of the present invention are set out in the example embodiments of the present invention that are herein described. However, it would be clear to the skilled person that the present invention would still work if these were varied according to techniques known in the art.
In an example embodiment of the present invention, the diagnostic platform derived using SYBR Green l-based system significantly reduces the cost of each detection (about 10 times lower in cost than probe based real time PCR methods known in the art), yet maintaining a comparable or higher degree of specificity and sensitivity of the primers to the viral genome RNA templates. Furthermore, the method employing the diagnostic platform of the example embodiment, may be used with other primer sets and may thus be used to detect other viruses, for example human alphaviruses and flaviviruses.
In prior art technologies, platforms based on RT-PCR are developed for the detection of either Dengue or Chikungunya but not both viruses simultaneously with serotyping capability for Dengue viruses. Although Kumar et al show multiplexed detection for Dengue and Chikungunya, the technology is based on conventional PCR, rather than real time PCR, which is semi-sensitive and quantitative. Furthermore, it is appreciated that the primers used in the Kumar et al study are different from the set of primers used in the example embodiments of the present invention as described.
Most known medical diagnostic kits for Dengue virus and Chikungunya virus are based on ELISA or immunofluorescence techniques which rely on detection of antibodies produced in the human body in response to Dengue virus and Chikungunya virus infection. Even though these serological tests are able to differentiate between serotypes, a significant limitation is that such kits can detect the Dengue virus and Chikungunya virus only at a time that sufficient antibodies are produced in the human body and become detectable by applying the kits. These kits may not be able to detect early stage viral infection.
Alternatively, molecular based diagnostic technology involving the use of probe-based real time PCR can be used for a more rapid, sensitive and specific detection of viral infection of the Dengue virus and the Chikungunya virus at very early time point of viral
infection. However, the probe-based real time PCR diagnostic technology platform can be 10 times more expensive and of relatively low sensitivity. For example, of 306 confirmed cases of Dengue virus infections, this method was only able to detect about 89.6% of the cases. The detection limit is about 100 viral RNA copies per microliter of reaction.
In contrast, example embodiments of the present invention enables detection of as low as 0.1 PFU or 10 viral RNA copies per reaction for Dengue virus serotypes 1 , 2, 3, 4 and the Chikungunya virus. Arbo-Q, the molecular diagnostic platform which is described in an example embodiment of the present invention, requires only a single tube, one step real time RT-PCR reaction that could not only distinguish Chikungunya virus from Dengue virus, but also have the capacity to differentiate between the serotypes of Dengue 1 , 2, 3, 4, and absolutely quantitating the target viruses simultaneously. -
The SYBR Green I based real time RT-PCR reaction carried out by example embodiments of the present invention can be 10 times lower in cost that of a conventional probe based assay. This is because the most costly reagent in probe based real time reaction is the synthesis of the probe itself, while the cost of the primers are the same in both methods.
The following description provides some information on currently used methods of detection and/or serotyping of Dengue and Chikungunya viruses. Some existing test kits for serological detection for presence of IgG and/or IgM against Dengue and Chikungunya viruses is as follows.
- Dengue Fever Virus ELISA IgG/lgM Test Kits (Cat: EL1500G and EL1500M, Focus Technologies, USA)
- Rapid Test One Step® Dengue IgG/lgM test kit (HEALTH-CHEM
DIAGNOSTICS LLC, USA)
- Anigen Rapid CDV Ab Test Kit (Animal Genetics, Inc., Korea)
- OneStep Dengue RapiCardTM Insta Test (Cat: 173106L-25, CORTEZ DIAGNOSTICS, INC. USA)
- Chikungunya IgG/lgM IIFT kit (Cat: Fl 293a-1010M, EURO I MM UN AG Lubeck, Germany)
- On-site Chikungunya IgM lateral flow rapid test kit (Cat: R0065c, CTK Biotech Inc., San Diego, USA)
- NovaLisa™ Chikungunya IgM/lgG kit (Cat: CHIM/G0590, Novatec)
The above Dengue fever rapid test devices, also known as one-step dengue tests, are a solid phase immuno-chromatographic assay for the rapid, qualitative and differential detection of Dengue IgG and/or IgM antibodies to Dengue fever virus in human serum, plasma or whole blood. Furthermore, the Dengue IVD test devices that a company, Atlas Link Biotech, is supplying are intended for professional use, as an aid in the presumptive diagnosis between primary and secondary Dengue infection.
Some advantages of the above Dengue fever rapid test devices is as follows.
- The ELISA IgG can be used to establish previous exposure to Dengue fever or as an epidemiological tool for dengue virus IgG seropreyalence surveys.
- The IgM Capture ELISA is a qualitative assay for the detection of human serum IgM antibodies to Dengue virus infections to be used in support of the diagnosis of acute Dengue virus infections in humans.
- The Dengue IgG/lgM kit has shown to be highly sensitive and specific for Dengue IgG and IgM antibodies.
Some disadvantages of the above Dengue fever rapid test devices is as follows.
The sensitivity of Focus IgG and IgM kit for onset patient sample is only 55% and 36% respectively. It is more sensitive (95% and 93% respectively) to > 1 week post-onset patient samples, while it is too late for a diagnostic purpose. Usually, it takes from 3 to 5 days after the onset of the symptoms to detect anti- Dengue virus IgM and from 1 to 14 days to anti-dengue virus IgG to become detectable, depending on whether the patient has primary or secondary infections.
- Unable to serotype Dengue 1 , 2, 3, 4.
IgM is only present from the day 5 after onset of fever which made it not suitable for early diagnosis.
- IgG is only present from the day 10-14 after onset of freer and persists for life. This might result in false positive result in patients who had viral infection previously. Some existing test kits for serological detection for presence of NS1 of Dengue virus are as follows.
- Pan-E DENGUE EARLY ELISA (PanBio Diagnostics, Brisbane, Australia)
- Platelia™ Dengue NS1 Ag-ELISA (Biorad Laboratories, Marnes-La-Coquette, France)
- Dengue NS1 Ag STRIP (Biorad Laboratories, Mames-La-Coquette, France)
The flavivirus non-structural protein NS 1, a highly conserved and secreted glycoprotein, is a candidate protein for rapid diagnosis of Dengue in endemic countries.
Dengue NS1 antigen capture kits are based on either one-step sandwich format microplate enzyme immunoassay or irrirnunochromatographic test (ICT) for the detection of NS1 antigen. Some advantages of the above Dengue NS1 antigen capture kits is as follows.
Rapid, convenient and cost-effective
Circulating NS1 has been shown to be detectable from the first day to the early convalescent phase after onset of disease.
- Monoclonal antibody (MAb)-based serotype-specific NS1 assays can be used to differentiate between flaviviruses.
Some Disadvantages of the above Dengue NS1 antigen capture kits is as follows. - NS1 is not detectable once anti-NS1 IgG antibodies are produced.
NS1 only appeared in short period especially in secondary infection. Unable to serotype Dengue virus.
Some existing test kits for PCR detection for Dengue and Chikungunya viral RNA is as follows. - ^
- Dengue LC RealArt™ RT-PCR Kit (Artus, Hamburg, Germany)
- Dengue Virus General-type Real Time RT-PCR Kit (Cat No: ER-0101 -01 , Shanghai ZJ Bio-Tech Co., Ltd., China)
- RealStar CHIKV RT-PCR kit (astra Diagnostics, Hamburg, Germany}
The principle of the Tagman real time detection is based on the fluorogenic 5'nuclease assay. During the PCR reaction, the DNA polymerase cleaves the probe at the 5' end and separates the reporter dye from the quencher dye only when the probe hybridizes to the target DNA. This cleavage results in the fluorescent signal generated by the cleaved reporter dye, which is monitored in real time by the PCR detection system. The PCR cycle at which an increase in the fluorescence signal is detected initially (Ct) is proportional to the amount of the specific PCR product. Monitoring the fluorescence intensities in real time allows the detection of the accumulating product without having to re-open the reaction tube after the amplification.
Some advantages of the above PCR detection kits is as follows.
- Rapid and specific.
- It is able to serotype four serotypes of DENV (Dengue virus).
Some disadvantages of the above PCR detection kits is as follows.
About 100 times more costly as compare to Arbo-Q SYBR Green I based real time RT-PCR assay, which is based on an example embodiment of the present invention.
- Relative low sensitivity as compare to Arbo-Q SYBR Green I based real time RT-PCR assay, which is based on an example embodiment of the present invention.
From the information provided, it can be observed that prior art methods are not effective over a sufficiently long period of time from onset of an viral infection. In contrast, example embodiments of the present invention such as the diagnostic platform Arbo-Q for the Dengue and Chikungunya viruses is effective from the onset of the viral infection. Arbo-Q is suitable for early viral detection upon onset of infection as
indicated by viral fever. The virus could be found in the blood for up till 5-7 days from the onset of the fever.
The following provides a summary of the features of Arbo-Q:
· Single tube, one step reaction with increased sensitivity and specificity.
Inexpensive (SGD$ 20 per patient sample) as compared to the probe-based real time RT-PCR (SGD$ 200 per patient sample).
Multiplexing capability for simultaneous detection of different viral pathogens with unique set of primers and reaction conditions.
· Nano-quantity amount of sample volume (0.5-1 ΟμΙ) - human serum or mucosal secretions.
Rapid (within 1 hr, excluding viral RNA extraction) and simple signal development process.
Minimal cross-talk and variations between samples.
· Highly adaptable for diagnostic application of other infectious diseases, chronic diseases and cancer markers.
Example embodiments of the present invention will now be further described with reference to the following examples which are provided by way of illustration, and are not intended to be limiting for the present invention.
Example 1
Viral RNA extraction
Viral RNA was extracted from 200μΙ of infected cell culture supernatant or patient serum samples using PureLink™ Viral RNA Mini Kit (Invitrogen, USA), following the manufacturer's protocols. The viral RNA was eluted in a volume of 30μΙ of elution buffer and stored at -20°C for future use.
Viral detection and serotyping by Arbo-Q
All real time RT-PCRs were performed with 1 μΙ of RNA template in 20μΙ reactions. Samples containing the RNAs of Chikungunya virus, Dengue Virus Type 1 , Dengue Virus Type 2, Dengue Virus Type 3 and Dengue Virus Type 4 were subject to the real
time RT-PCR reactions.. One-step SYBR Green l-based real time RT-PCR was carried out on the Applied Biosystems 7500 Real-Time PCR system. Samples were assayed in 20 μΙ reaction mixtures containing 10 μΙ of 2 * reaction mixes, 0.25 μΜ of each forward and reverse primer, 1 μΙ (50 units) of M-MLV Reverse Transcriptase, 1 μΙ of viral RNA and 6 μΙ of nuclease free water. The thermal profile consist of reverse transcription at 44°C for 30 min, and polymerase activation at 94°C for 2 min, followed by 40 cycles of PCR at 94°C for 15 sec and 60 °C for 30 sec. The fluorescence emitted is captured at the end of the extension step of each cycle at 530 nm. Amplification graphs are checked for the threshold cycle (Ct) value of the PCR product. The Ct value represents the cycle by which the fluorescence of a sample increased to a level higher than the background fluorescence in the amplification cycle. Melt curve analysis is performed after the PCR amplification to verify that the correct amplification product (amplicon) is amplified by examining its specific melting temperature (Tm). A peak in the melt curve of a sample corresponds to the melting temperature of the amplification products of that sample. The melting temperature of each sample was used to identify the Chikungunya virus and the Dengue serotype, and the samples sharing the same melting temperature were interpreted as containing the same virus or the same serotype of the Dengue virus. Formulation for Arbo-Q assay reaction mixture is set out in the table below.
Table 3
COMPONENT Volume (μΙ_) Final concentration
SYBR Green 10 1 * Taq DNA polymerase, TaqReadyMix 10 mM Tris-HCI, 50 mM
KCI, 3.0 mM MgCI2 , 0.2 mM dNTP, Stabilizers
DENV Forward Primer 0.5 250 nM
DENV Reverse Primer 0.5 250 nM
CHIKV Forward Primer 0.5 250 nM
CHIKV Reverse Primer 0.5 250 nM
Reference Dye (ROX) 1 1 X
M-MLV reverse 1 1 unit/pL
transcriptase
RNA template 1 10 ng (for primer verification)
25mM MgCI2 Optional 3.0 mM (without addition)
Nuclease Free Water Top up to 20 μί
The following conditions were set up for real time RT-PCT reactions.
Table 4
Arbo-Q assay protocol
Melt Curve Analysis
Figures 1 to 6 show example melt curve profiles of a reference biological sample containing the Chikungunya virus. The melt curve profiles are plotted by conducting singleplex real time RT-PCR reactions using primer pairs having the Chikungunya sequences of Table 2. The melt curve profiles of Figures 1 to 6 are named as CHKCAP (associated y ith primer pair, CHKCAP F and CHKCAP R, from Table 2, Figure 1 ), CHKMET2 (associated with primer pair, CHKMET2 F and CHKMET2 R, from Table 2, Figure 2), CHK4 (associated with primer pair, CHIKV4 F and CHIKV4 R, from Table 2, Figure 3), CHK9 (associated with primer pair, CHIK9 F and CHIK9 R, from Table 2, Figure 4), CHK13 (associated with primer pair. CHIK13 F and CHIK13 R, from Table 2, Figure 5) and CHK15 (associated with primer pair, CHIK15 F and CHIK 5 R, from Table 2, Figure 6), respectively.
Figures 1 to 6 relate to Singleplex real time RT-PCR Profiles of the Chikungunya virus. The melt curve profiles in Figures 1 to 6 may be used as references for detecting and identifying the Chikungunya virus in an unknown sample. For instance, the unknown sample may be subjected to real time RT-PCR reaction using any primer pair associated with either one of Figures 1 to 6. Thereafter, the melt curve profile of the unknown sample can be plotted. If the melt curve profile of the unknown sample associated with a primer pair from either one of Figures 1 to 6 correlates with the corresponding reference melt curve profile associated with the same primer pair, it is indication that the Chikungunya virus is present in the unknown sample.
Correlation of the melt curve profile of the unknown sample with the melt curve profile of the reference melt curve profile is indicated by the overlapping of peak Derivative Reporter (-Rn) values on or about the melting temperature of the reference melt curve profile when the two melt curve profiles are compared (or matched). The melting temperatures of Figures 1 to 6 are 82.23 °C for CHKCAP, 82.75 °C for CHKMET2, 86.62 °C for CHK4, 82.19 °C for CHK9, 87.99 °C for CHK13 and 85.16 °C for CHK15, respectively.
Figures 7 to 9 relate to Singleplex real time RT-PCR Profiles of the Dengue virus. Figures 7 to 9 show example meltcurve profiles of reference samples containing the Dengue virus serotypes 1 -4. The melt curve profiles are plotted by conducting singleplex real time RT-PCR reactions using primer pairs having the sequences of Table 1. The melt curve profiles of Figures 7 to 9 are named as DEN4 (associated with primer pair, DEN4 F and DEN4 R, from Table 1 , Figure 7), DEN7m1 (associated with primer pair, DEN7m3 F and DEN7m1 R, from Table 1 , Figure 8) and DEN16 (associated with primer pair, DENV16 F and DENV16 R, from Table 1 , Figure 9), respectively.- In each one of Figures 7 to 9, the melt curve profiles of the four serotypes 1-4 of Dengue viruses are plotted in a single graph and they are indicated by DENV1 , DENV2, DENV3, and DENV4 respectively. Each curve of the serotypes 1-4 has a distinct peak in Derivative Reporter (-Rn) value at a specific temperature, which is interpreted as the melting temperature of the sample.
In each of Figures 8 and 9, there is present a Non Template Control (NTC) curve which refers to the curve associated with a sample that does not contain any nucleic acid template or nucleic acid template of RNA viruses other than Chikungunya virus and
Dengue virus. As shown in Figures 8 and 9, the NTC curves peaks in the region between 78°C and 80 °C, which is away from the melting temperatures of the amplification products of the samples containing the Chikungunya and Dengue nucleic acids. This indicates that interference of formation of the primer dimer in the real time RT-PCR reaction is negligible and the melt curve profiles are accurate.
Each primer pair of the Dengue sequences is designed to enable each serotype of the Dengue virus to have a melt curve profile with a distinct peak in the Derivative Reporter (-Rn) value at a specific melting temperature. Each of the melt curve profiles may be used as a reference for detecting and identifying the Dengue virus, and in particular, for detecting and identifying different serotypes of the Dengue virus in an unknown sample.
For instance, an unknown sample can be subjected to real time RT-PCR reaction by using the primer pairs associated with either one of Figures 7 to 9. Thereafter, the melt curve profile of the unknown sample can be plotted. If the melt curve profile of the unknown sample associated with a primer pair from either one of Figures 7 to 9 correlates with the corresponding reference melt curve profile associated with the same primer pair that is plotted for a particular serotype of the Dengue virus, it is indication that the particular serotype of the Dengue virus is present in the unknown sample.
In another example embodiment of the present invention, with reference to Figures 10 to 13, a primer pair from the Chikungunya sequences of table 2 can be used in combination with a primer pair from the Dengue sequences of table 1 in a single tube reaction. It is noted that the melt curve profiles of the Chikungunya virus are different from those of the Dengue virus. Furthermore, the melt curve profiles of the serotypes of the Dengue virus are different from each other.
Figures 10 to 13 relate to multiplex real time PCR Profiles of the Dengue and Chikungunya viruses. In Figures 10 to 13, the RNAs of the Chikungunya virus, Dengue Virus Type 1 , Dengue Virus Type 2, Dengue Virus Type 3 and Dengue Virus Type 4 are subjected to a real time RT-PCR reaction by using a combination of the Chikungunya sequence set CHK4 and the Dengue sequence set DEN16 (Figure 10), a combination of the Chikungunya sequence set CHK15 and the Dengue sequence set DEN16 (Figure 11 ), a combination of the Chikungunya sequence set CHK13 and the
Dengue sequence set DEN7m1 (Figure 12), the Chikungunya sequence set CHK9 and the Dengue sequence set DEN7m1 (Figure 13), respectively.
In the present example embodiment of the present invention, the Chikungunya sequence set CHK4 is associated with primer pair, CHIKV4 F and CHIKV4 R, from Table 2. The Dengue sequence set DEN 16 is associated with primer pair, DENV16 F and DENV16 R, from Table 1. The Chikungunya sequence set CHK15 is associated with primer pair, CHIK15 F and CHIK15 R, from Table 2. The Chikungunya sequence set CHK13 is associated with primer pair, CHIK13 F and CHIK13 R, from Table 2. The Dengue sequence set DEN7m1 is associated with primer pair, DEN7m3 F and DEN7M1 R, from Table 1. The Chikungunya sequence set CHK9 is associated with CHIK9 F and CHIK9 R, from Table 2.
In Figures 10 to 13, the melt curve profiles of reference samples containing nucleic acid of serotypes 1-4 of the Dengue virus, and Chikungunya virus are plotted. Multiple curves are plotted in a single image in each of the Figures 10 to 13. Each of the curves is associated with one virus selected from the Chikungunya virus and the serotypes 1-4 of the Dengue virus. Each curve has a peak value at a specific melting temperature that is distinct from other curves. Therefore, the melt curve profile of an unknown biological sample from a patient suspected to be infected by the Chikungunya and/or dengue viruses can be compared (or matched) with the melt curve profiles of the reference samples to detect and identify whether the Chikungunya and/or serotypes 1- 4 of the dengue virus are present in the unknown biological sample. If the melt curve profile(s) of the unknown biological sample matches one or more of the melt curves plotted for the reference samples, the patient would be deemed to be infected by the corresponding virus of the matching melt curve.
It is noted that an unknown patient sample may produce one or more melt curves with distinct peaks. By using different sets of primers, for instance, one set from table 2 for the Chikungunya and another set from table 1 for any one of the serotypes of Dengue, two respective melt curves can be generated and the presence of both the Chikungunya virus and one of the Dengue serotypes can be detected from the unknown patient sample and in a single assay. The more than one melt curves with distinct peaks can be matched with the melt curves plotted based on reference
samples to detect the presence of the Chikungunya virus and one of the Dengue serotypes.
The overlaying of melt curves (same or substantially same melting temperature) from singleplex reactions (as shown in Figures 1 to 9) and multiplex reactions (as shown in Figures 10 to 13) indicates a consistent specific amplification, as well as, negligible interference between the Dengue sequences and the Chikungunya sequences. This feature enables the present example embodiment of the present invention to allow specific and accurate assay for Dengue and Chikungunya virus detection and quantitation.
Similar to Figures 8 and 9, in each of the Figures 11 and 13, there is present a Non Template Control (NTC) curve which refers to the curve associated with a sample that does not contain any nucleic acid template or nucleic acid template of RNA viruses other than Chikungunya virus and Dengue virus. As shown in Figures 11 and 13, the NTC curves peaks around 78°C, which is away from the melting temperatures of the amplification products of the samples containing the Chikungunya and Dengue nucleic acids. This indicates that interference of formation of the primer dimer in the real time RT-PCR reaction is negligible and the melt curve profiles are accurate.
Example 2
With reference to Figures 14 to 17 and Table 5, results of a laboratory test on laboratory Dengue (DENV) strains (i.e. strains cultivated in a laboratory) of the four serotypes, DENV1 , DENV2, DENV3 and DENV4 is described as follows. The strains are tested by using the combination of primer pair for DENV7M1 from Table 1 and primer pair for CHIK13 from Table 2 on an Applied Biosystems® StepOnePlus™ Real- Time PCR System. Table 5
In the laboratory test, the tested viral RNA was extracted from 40μΙ of infected culture supernatant from each Dengue serotype using QIAamp viral RNA mini kit (QIAGEN, Germany) by following the manufacturer's protocols.
Real time RT-PCR reactions were performed in quadruplicates for each of the viral RNA samples of the four Dengue serotypes (hence, 4 melting temperatures from 4 samples of each serotype), and the melting temperature of the amplification product of the individual viral RNA sample was recorded and shown in Table 5 and in Figures 14 to 17 respectively. The melt curves in Figure 14 and the data extracted from melt curves in Table 5 shows that the melting temperature, Tm, of each of the 4 samples for DENV1 falls in the range between 85.724 - 85,171 °C.
The melt curves in Figure 15 and the data extracted from melt curves in Table 5 shows that the melting temperature, Tm, of each of the 4 samples for DENV2 falls in the range between 82.603 - 82.754 °C.
The melt curves in Figure 16 and the data extracted from melt curves in Table 5 shows that the melting temperature, Tm, of each of the 4 samples for DENV3 falls in the range between 85.432 - 85.581 °C.
The melt curves in Figure 17 and the data extracted from melt curves in Table 5 shows that the melting temperature, Tm, of each of the 4 samples for DENV4 falls in the range between 83.645 - 83.794 °C. With reference to Figures 18 and 19 and Table 6, results of a laboratory test on laboratory Chikungunya (CHIKV) strains (i.e. strains cultivated in a laboratory) is described as follows. The strains are tested by using the combination of primer pair for DENV7M1 from Table 1 and primer pair for CHIK13 from Table 2 on an Applied Biosystems® StepOnePlus™ Real-Time PCR Systems.
Table 6
In the laboratory test, the viral RNA was extracted from 140μΙ of infected culture supernatant from three different Chikungunya virus strains, Strains 1 to 3, using QIAamp viral RNA mini kit (QIAGEN, Germany) by following the manufacturer's protocols. Real time RT-PCR reactions were performed for each of the viral RNA samples associated with the three Chikungunya virus strains, and the melting temperature of the amplification product of the individual viral RNA sample was recorded and shown in the Table 6 and jn Figures 18 and 19. The graphs in Figures 18 and 19, and the data extracted from the graphs in Table 6 shows that the melting temperature, Tm, of each of the samples falls in the range between 87.000 - 88.000 °C.
The melting temperature (Tm) intervals for identification of the dengue serotypes (DENV1 , DENV2, DENV3 or DENV4) or the Chikungunya virus (CHIKV) are described with reference to Figure 20 as follows.
From the Tm variations obtained through tests carried out, such as those described with reference to Figures 14 to 19, for each Dengue serotype or the Chikungunya virus (CHIKV), a Tm interval system as illustrated by a graph in Figure 20 can be derived for viral identification.
The presence of a Dengue serotype (DENV1 , DENV2, DENV3 or DENV4) or the Chikungunya virus (CHIKV) in an unknown sample can be identified by comparing the Tm, measured after performing real time RT-PCR and which are associated with the unknown sample, with the Tm intervals in Figure 20. With reference to Figure 20, Chikungunya virus in an unknown sample can be identified if the Tm associated with the unknown sample is in the range of 87.00°C to 88.00 °C. Dengue serotype, DENV1 in an unknown sample can be identified if the Tm associated with the unknown sample is in the range of 85.60°C to 87.00 °C. Dengue serotype, DENV3 in an unknown sample can be identified if the Tm associated with the unknown sample is in the range of 84.50°C to 85.60 °C. Dengue serotype, DENV4 in an unknown sample can be identified if the Tm associated with the unknown sample is in the range of 82.80°C to 84.50 °C. Dengue serotype, DENV2 in an unknown sample can be identified if the Tm associated with the unknown sample is in the range of 81.50°C to 82.80 °C.
Example 3
Quantitation of the Chikungunya and Dengue viruses Viral RNA extraction and preparation of the Chikungunya and Dengue virus RNA standards is described as follows.
The viral RNA is extracted from 140μΙ of infected culture supernatant and patient serum samples using QIAamp viral RNA mini kit (QIAGEN, Germany), following the manufacturer's protocols. The viral RNA is eluted in a volume of 30μΙ of elution buffer and was stored at -80°C till use.
The quantification of viral RNA was achieved by generating standard curves from 10- fold serial dilutions of RNA isolated from a prototype virus with known titre (Plaque forming unit (PFU) per mL) which was determined by plaque assay. For the purpose of
generating each standard curve as shown in Figures 21 to 25 respectively, 4 standards prepared by 10-fold serial dilutions are used.
A method for generating standard curves for the four Dengue serotypes and the Chikungunya virus illustrating viral quantitation by SYBR green l-based real time RT- PCR using DENV7m1/CHK13 primer combination is described as follows.
In the method, all the 10-fold serial diluted RNA standards (i.e. RNAs of samples with known viral titre) and RNA of samples from patients suspected to be infected with one of the dengue serotypes or the Chikungunya virus (i.e. samples to be quantitated) were subjected to the real time RT-PCR assay on Applied Biosystems® StepOnePlus™ Real-Time PCR Systems using the manufacturer's protocols.
The real time RT-PCR conditions for the one-step SYBR green I RT-PCR consist of a 30min reverse transcription step at 44°C and then 5 min of Taq polymerase activation at 94°C, followed by 40 cycles of PCR at 94°C for 15s (denaturation), and an annealing and extension step at 60°C for 1 min.
The fluorescence emitted by the amplification product of all the standards is captured at the end of the extension step of each cycle at 530 nm.
Amplification graphs of all the standards are checked for the threshold cycle (Ct) value of the amplification product. The Ct value represents the cycle by which the fluorescence of a tested sample increases to a level higher than the background fluorescence in the amplification cycle. Ct values of the 10-fold serial diluted RNA standards were plotted versus RNA quantity (PFU/mL) and the curves as plotted are known as the standard curves.
The Melt Curve Analysis as described previously with reference to Figures 6 to 13 is performed after PCR amplification to verify that the correct amplification product is amplified by examining its specific melting temperature (Tm). The Tm for each sample was used to identify the dengue serotype or the Chikungunya virus and the samples sharing the same Tm were interpreted as belonging to the same Dengue serotype or the Chikungunya virus.
Each of the standard curves as shown in Figures 21 to 25 were generated by graphing the Ct value for the tested sample versus the logarithmic scale of the DNA concentration used. The regression line formula in the form of a linear equation, y = mx+b, of the standard curve can be used to determine the logarithm (with base 10) of the viral titre of an unknown sample by plugging the Ct value obtained for the sample as the y value and solving for x. To determine the viral titre in terms of PFU/mL for an unknown sample, one need to raise 10 to the power of the number received when solving for x (i.e. 10x = sample viral titre in PFU/mL). For example, with reference to the linear equation of Figure 21 , if the Ct value of a sample is 16 i.e. y = 16, the x value, which is the logarithm of 10 will be calculated as follows.
16 = -3.362x + 31.102
x = (16 - 31.102)/(-3.362)
x = 4.49 (approximated to two decimal places)
Hence, the final viral titre will be 10 449 (PFU/mL) To determine the amplification efficiency of the PCR reaction (i.e. PCR Efficiency), a formula E = io~1/slope is used, where E is the PCR Efficiency, and the variable, slope, is the gradient of the linear equation, y = mx+b (m = slope), associated with each of the Figures 21 to 25. To determine the percentage of the PCR efficiency, the equation PCR Efficiency % = (E-1 ) x 100% is used.
Figure 21 shows a standard curve with a linear equation of y=-3.362x+31.102 that is derived by linear interpolation of the results of the 4 standards for the Dengue serotype, DENV1. In the equation, y represents Ct value and x represents the virus quantity. A correlation value, R2, of the standard curve in Figure 21 is equal to 0.997 and it is indicative of good linear correlation. The PCR Efficiency of the reaction relating to Figure 21 is 98.342%.
Figure 22 shows a standard curve with a linear equation of y=-3.47x+27.966 that is derived by linear interpolation of the results of the 4 standards for the Dengue serotype,
DENV2. In the equation, y represents Ct value and x represents the virus quantity. A correlation value, R2, of the standard curve in Figure 22 is equal to 0.959 and it is indicative of good linear correlation. The PCR Efficiency of the reaction relating to Figure 22 is 94.186%.
Figure 23 shows a standard curve with a linear equation of y=-3.631x+29.704 that is derived by linear interpolation of the results of the 4 standards for the Dengue serotype, DENV3. In the equation, y represents Ct value and x represents the virus quantity. A correlation value, R2, of the standard curve in Figure 23 is equal to 0.998 and it is indicative of good linear correlation. The PCR Efficiency of the reaction relating to Figure 23 is 98.342%.
Figure 24 shows a standard curve with a linear equation of y=-3.536x+32.027 that is derived by linear interpolation of the results of the 4 standards for the Dengue serotype, DENV4. In the equation, y represents Ct value and x represents the virus quantity. A correlation value, R2, of the standard curve in Figure 24 is equal to 0.998 and it is indicative of good linear correlation. The PCR Efficiency of the reaction relating to Figure 24 is 98.342%. Figure 25 shows a standard curve with a linear equation of y=-3.146x+35.792 that is derived by linear interpolation of the results of the 4 standards for the Chikungunya virus, CHIKV. In the equation, y represents Ct value and x represents the virus quantity. A correlation value, R2, of the standard curve in Figure 25 is equal to 0.982 and it is indicative of good linear correlation. The PCR Efficiency of the reaction relating to Figure 25 is 98.342%.
It is appreciated that quantitation of one virus selected from the Chikungunya virus and the four Dengue serotypes can be performedin example embodiments of the present invention. Once a positive signal based on the melt curve analysis as described earlier to confirm the presence of a specific virus (selected from Chikungunya virus and the four Dengue serotypes) in a particular sample is received, the amount of virus that is present in the same sample can be derived based on the Ct value associated with the virus. This Ct value can be plugged into the linear equation of the standard curve (e.g. Figures 21 to 25) of the corresponding virus and thereafter perform the logarithmic
function as described in the above example with reference to Figure 21 to determine the specific virus titre.
Example 4
The sensitivity and specificity results derived after using Arbo-Q (i.e. the diagnostic platform of an example embodiment described herein) assay validation on patient and healthy individual serum samples are set out in the table 7 below.
The formula for Sensitivity and Specificity in Table 7 is as follows.
Sensitivity = Number of positive specimens/(number of positive specimens + number of false negative specimens) X 100%.
Specificity = Number of negative specimens/(number of negative specimens + number of false positive specimens) X 100%.
Embodiments of the present invention seek to address at least one of the problems in the prior art. Generally, in an embodiment of the present invention, a molecular technique based diagnostic platform (e.g. Arbo-Q) is developed for detection, identification and/or quantification of the Chikungunya and Dengue viruses. The molecular technique based diagnostic platform is based on real time RT-PCR tests. In contrast to conventional sero diagnosis methods, the PCR test based diagnostic platform provides early diagnostic detection of the Chikungunya and Dengue viruses.
The methodology and medical diagnostic kit of embodiments of the present invention utilises a diagnostic platform (e.g. Arbo-Q) that is capable of fast diagnosis, affordable,
easy to use, provides specific and sensitive detection, identification and/or quantification of the Chikungunya and Dengue viruses. The diagnostic platform may be utilized in various diagnostic settings such as polyclinics, hospitals and research, medical and public health laboratories.
In addition, advantageously, the primer sets having the Chikungunya and Dengue sequences of embodiments of the present invention are able to work simultaneously in a single tube reaction to specifically detect the respective virus genome RNA templates in a multiplex real time platform format.
For instance, according to an example embodiment of the present invention, in one assay or tube reaction, a sample containing just a Chikungunya virus can be detected and identified using the primers from table 2 and the Chikungunya virus can be quantitated as well. According to another example embodiment of the present invention, in one assay or tube reaction, a sample containing just one Dengue serotype can be detected and identified using the primers from table 1 and the Dengue serotype can be quantitated as well. According to yet another example embodiment of the present invention, in one assay or tube reaction, a sample containing the Chikungunya virus and one Dengue serotype can be detected and identified using a primer pair from table 1 (which works for any one of the Dengue serotypes) and a primer pair from table 2 (which works for Chikungunya virus). However, in this uncommon case, quantitation of each of the Chikungunya virus or the Dengue serotype in the sample may require more than one assays. Whilst exemplary embodiments of the invention have been described in detail, many variations are possible within the scope of the invention as will be clear to a skilled reader. -
References:
1 ) Ho PS, Ng MM, Chu JJ. Establishment of one-step SYBR green-based real time-PCR assay for rapid detection and quantification of Chikungunya virus infection. Virol J. 2010 Jan 21 ;7:13.
2) Yee-Ling Lai, Youne-Kow Chung, Hwee-Cheng Tan, Hoon-Fang Yap, Grace Yap, Eng-Eong Ooi, and Lee-Ching Ng. Journal of Clinical Microbiology, Mar. 2007, p. 935-941 3) Paban Kumar Dash, ManmohanParida, S.R. Santhosh, ParagSaxena, AmbujSrivastava, MamidiNeeraja, V. Lakshmi, P.V. LakshmanaRao. Diagnostic Microbiology and Infectious Disease 62 (2008) 52- 57
4) Yong Yean Kong, Chong Heng Thay, Tan Chong Tin, Shamala Devi. Journal of Virological Methods 138 (2006) 123-130
5) Yong Y K, Thayan R, Chong H T, Tan C T, Sekaran S D . SingaporeMed J 2007; 48 (7) : 665
Claims
1. An isolated oligonucleotide comprising a nucleic acid sequence having at least 80% homology to a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 20:
CCACCTGGGCCAAGAACAT (SEQ ID NO:1 );
CTAC AG G C AG C ACG GTTTG C (SEQ ID NO:2);
G AAG AC ATTG ACTG YTG GTG C AA (SEQ ID NO:3);
CGATGTTTCCACGCCCCTTC (SEQ ID NO:4);
ACA TGT TTC CAA GCC CCC TTC (SEQ ID NO:5);
GCC CCT TCG GAC GAC ATC CA (SEQ ID NO:6);
GCATGCCGACATGGGTTATTG (SEQ ID NO:7);
GTG CCATGGTCCTG CTGTTTGT (SEQ ID NO:8);
GCGGTACCCCAACAGAAG (SEQ ID NO:9);
GGTTTCTTTTTAGGTGGCTG (SEQ ID NO:10);
TCTATG CTGTAC ATG CACCC ACG (SEQ ID NO:11 );
GTACATGAACGGGGTTGTGTCAAA (SEQ ID NO: 12);
GCGGACCTGGCCAAACTG (SEQ ID NO: 13);
CGAGAGGGCTGTACGGGCT (SEQ ID NO: 14);
GGC GAC CCG TGG ATA AAG A (SEQ ID NO:15);
ACT GCA GAT GCC CGC CAT TA (SEQ ID NO:16);
CGAGATACTGCCCGTCCCGT (SEQ ID NO: 17);
GTCACGCGTCTCCGCTGTTT (SEQ ID NO: 18);
ACGACGGCCGAGTCCTAGTG (SEQ ID NO: 19) ; and
CCAGTACCAGTCCTGCGGCT (SEQ ID NO:20).
2. A combination of sets of primers for detection, identification and /or quantitation of at least two viruses, or a nucleic acid of the at least two viruses, in a sample, wherein the combination comprises at least one set of primers having nucleic acid sequences with at least 80% homology to the nucleic acid sequences selected from the group consisting of Sets 1 to 5, and at least one set of primers having nucleic acid sequences with at least 80% homology to the nucleic acid sequences selected from the group consisting of Sets 6 to 11 :
Set 1 - DEN4
FP: 5' CCACCTGGGCCAAGAACAT 3' (SEQ ID N0:1 )
RP: 5' CTACAGGCAGCACGGTTTGC 3' (SEQ ID N0:2);
Set 2 - DEN7M1
FP: 5' GAAGACATTGACTGYTGGTGCAA 3' (SEQ ID N0:3)
RP: 5' CGATGTTTCCACGCCCCTTC 3' (SEQ ID N0:4);
Set 3 - DEN7M2
FP: 5' GAAGACATTGACTGYTGGTGCAA 3' (SEQ ID N0:3) RP: 5' ACA TGT TTC CAA GCC CCC TTC 3' (SEQ ID N0:5);
Set 4 - DEN7M3
FP: 5' GAAGACATTGACTGYTGGTGCAA 3' (SEQ ID N0:3) RP: 5' GCC CCT TCG GAC GAC ATC CA 3' (SEQ ID NO:6);
Set 5 - DENV16
FP: 5' GCATGCCGACATGGGTTATTG 3' (SEQ ID NO:7) RP: 5' GTGCCATGGTCCTGCTGTTTGT 3' (SEQ ID N0:8); Set 6 - CHKCAP
FP: 5' GCGGTACCCCAACAGAAG 3' (SEQ ID NO:9)
RP: 5' GGTTTCTTTTTAGGTGGCTG 3' (SEQ ID NO: 10);
Set 7 - CHKMET2
FP: 5' TCTATGCTGTACATGCACCCACG 3' (SEQ ID NO: 11 )
RP: 5' GTACATGAACGGGGTTGTGTCAAA 3' (SEQ ID NO: 12);
Set 8 - CHIKV4
FP: 5' GCGGACCTGGCCAAACTG 3' (SEQ ID NO: 13)
RP: 5' CGAGAGGGCTGTACGGGCT 3' (SEQ ID NO: 14);
Set 9 - CHIK9
FP: 5' GGC GAC CCG TGG ATA AAG A 3' (SEQ ID NO: 15) RP: 5' ACT GCA GAT GCC CGC CAT TA 3' (SEQ ID NO:16);
Set 10 - CHIK13
FP: 5' CGAGATACTGCCCGTCCCGT 3' (SEQ ID NO: 17)
RP: 5' GTCACGCGTCTCCGCTGTTT 3' (SEQ ID NO: 18); and Set 11 - CHIK15
FP: 5' ACGACGGCCGAGTCCTAGTG 3' (SEQ ID NO: 19)
RP: 5' CCAGTACCAGTCCTGCGGCT 3' (SEQ ID NO:20).
3. The combination of sets of primers according to claim 2, wherein the at least two viruses are selected from Chikungunya virus, Dengue Virus Serotype 1 , Dengue Virus
Serotype 2, Dengue Virus Serotype 3 and Dengue Virus Serotype 4.
4. A method for detection, identification and/or quantitation of at least one virus, or the nucleic acid of the at least one virus, in a sample, comprising:
(a) performing an amplification reaction on the sample in the presence of at least one set of primers having nucleic acid sequences with at least 80% homology to the nucleic acid sequences selected from the group consisting of Sets 1 to 11.
5. The method according to claim 4, wherein the step (a) is performed in the presence of a fluorescent dye which exhibits increased fluorescence intensity upon binding to an amplification product.
6. The method according to claim 5, wherein the method further comprises:
(c) obtaining a melt curve of the amplification product; and
(d) identifying the virus associated with the amplification product by matching the melt curve of the-amplification product with a melt curve of at least one reference sample with a known nucleic acid, wherein the amplification product is associated with a virus having the known nucleic acid if the melt curve of the amplification product matches with the melt curve of the at least one reference sample.
7. The method according to any one of claims 4 to 6, wherein the method is for detection, identification and/or quantitation of at least two viruses, in a sample, and the amplification reaction is performed in the presence of at least one set of primers having the nucleic acid sequences with at least 80% homology to the
nucleic acid sequences selected from the group consisting of Sets 1 to 5, and at least one set of primers having the nucleic acid sequences with at least 80% homology to the nucleic acid sequences selected from the group consisting of Sets 6 to 11.
8. The method according to any one of claims 4 to 7, wherein the method further comprises:
(i) providing a nucleic acid amplification reaction mixture that comprises said sample and a fluorescent dye, wherein the dye exhibits increased fluorescence intensity upon binding to a double-stranded nucleic acid;
(ii) measuring the emitted light produced by the mixture of step (i);
(iii) treating said mixture under conditions for amplifying said target nucleic acid to produce amplified double-stranded nucleic acid;
(iv) measuring the emitted light produced by the mixture of step (iii) to determine if amplification has occurred and optionally to quantify the amount of a target nucleic acid in the sample.
9. The method according to claim 8, wherein steps (ii) and (iv) each further comprise a step of providing excitation light to the reaction mixture and conveying fluorescent light emitted by the reaction mixture to a detector, wherein at steps (ii) and (iv) the amount of emitted light produced by exposing the mixture to excitation light is determined, and at step (iv) the relative amount of emitted light produced at steps (ii) and (iv) is compared to determine if amplification has occurred and optionally to quantify the amount of a target nucleic acid in the sample.
10. The method according to any one of claims 4 to 9, wherein the step (a) comprises a-real time reverse transcription polymerase chain reaction.
11. The method according to any one of claims 5 to 10, wherein the fluorescent dye is SYBR Green I (2-(N-(3-dimethylaminopropyl)-N-propylamino)-4-(2,3-dihydro-3- methyl-(benzo-1 ,3-thiazol-2-yl)-methylidene)-1-phenylquinolinium chloride).
12. A kit for detection, identification and/or quantitation of at least one virus, or the nucleic acid in the at least one virus, in a sample, comprising at least one oligonucleotide according to claim 1.
13. The method or kit according to any one of claims 4 to 12, wherein the at least one virus is selected from Chikungunya virus, Dengue Virus Serotype 1, Dengue Virus Serotype 2, Dengue Virus Serotype 3 and Dengue Virus Serotype 4.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| IN2669DEN2015 IN2015DN02669A (en) | 2012-09-04 | 2013-09-04 | |
| SG11201502511YA SG11201502511YA (en) | 2012-09-04 | 2013-09-04 | Isolated oligonucleotides, methods and kits for detection, identification and/or quantitation of chikungunya and dengue viruses |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201261696512P | 2012-09-04 | 2012-09-04 | |
| US61/696,512 | 2012-09-04 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2014039010A1 true WO2014039010A1 (en) | 2014-03-13 |
Family
ID=50237476
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/SG2013/000386 Ceased WO2014039010A1 (en) | 2012-09-04 | 2013-09-04 | Isolated oligonucleotides, methods and kits for detection, identification and/or quantitation of chikungunya and dengue viruses |
Country Status (3)
| Country | Link |
|---|---|
| IN (1) | IN2015DN02669A (en) |
| SG (1) | SG11201502511YA (en) |
| WO (1) | WO2014039010A1 (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106755565A (en) * | 2015-11-20 | 2017-05-31 | 广东省疾病预防控制中心 | A kind of kit based on fluorescent PCR method joint-detection dengue fever virus and datum hole Kenya virus |
| WO2017124054A1 (en) * | 2016-01-14 | 2017-07-20 | The Board Of Trustees Of The Leland Stanford Junior University | Methods and reagents for detection of chikungunya virus and zika virus |
| CN112111599A (en) * | 2019-06-19 | 2020-12-22 | 台达电子国际(新加坡)私人有限公司 | Multiple detection kit and method for drogong virus and zika virus |
| US11591660B2 (en) | 2016-01-14 | 2023-02-28 | The Board Of Trustees Of The Leland Stanford Junior University | Methods and reagents for detection of chikungunya virus or chikungunya virus and dengue virus |
| EP4038199A4 (en) * | 2019-10-03 | 2023-04-19 | Agency for Science, Technology and Research | METHOD FOR DETECTING OR DIFFERENTIATING CHIKUNGUNYA, DENGUE AND ZIKA VIRUSES |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050244851A1 (en) * | 2004-01-13 | 2005-11-03 | Affymetrix, Inc. | Methods of analysis of alternative splicing in human |
| US7314750B2 (en) * | 2002-11-20 | 2008-01-01 | Affymetrix, Inc. | Addressable oligonucleotide array of the rat genome |
| US20090123928A1 (en) * | 2007-10-11 | 2009-05-14 | The Johns Hopkins University | Genomic Landscapes of Human Breast and Colorectal Cancers |
| US20100041595A1 (en) * | 2005-05-27 | 2010-02-18 | Bbs-Bioactive Bone Substitutes Oy | Bone morphogenetic protein 3 and osteogenic devices and pharmaceutical products containing thereof |
| US20100323348A1 (en) * | 2009-01-31 | 2010-12-23 | The Regents Of The University Of Colorado, A Body Corporate | Methods and Compositions for Using Error-Detecting and/or Error-Correcting Barcodes in Nucleic Acid Amplification Process |
| EP1144613B1 (en) * | 1999-01-14 | 2011-09-28 | Bolder Biotechnology, Inc. | Methods for making proteins containing free cysteine residues |
| CN102776297A (en) * | 2012-08-09 | 2012-11-14 | 中山大学达安基因股份有限公司 | Reagent kit for distinguishing and detecting dengue virus/yellow fever virus/west nile virus/chikungunya virus |
| WO2013080307A1 (en) * | 2011-11-29 | 2013-06-06 | 株式会社 東芝 | Primer set for amplifying mosquito-borne virus, assay kit for detecting mosquito-borne virus, and detection method using said primer set and said assay kit |
-
2013
- 2013-09-04 SG SG11201502511YA patent/SG11201502511YA/en unknown
- 2013-09-04 WO PCT/SG2013/000386 patent/WO2014039010A1/en not_active Ceased
- 2013-09-04 IN IN2669DEN2015 patent/IN2015DN02669A/en unknown
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1144613B1 (en) * | 1999-01-14 | 2011-09-28 | Bolder Biotechnology, Inc. | Methods for making proteins containing free cysteine residues |
| US7314750B2 (en) * | 2002-11-20 | 2008-01-01 | Affymetrix, Inc. | Addressable oligonucleotide array of the rat genome |
| US20050244851A1 (en) * | 2004-01-13 | 2005-11-03 | Affymetrix, Inc. | Methods of analysis of alternative splicing in human |
| US20100041595A1 (en) * | 2005-05-27 | 2010-02-18 | Bbs-Bioactive Bone Substitutes Oy | Bone morphogenetic protein 3 and osteogenic devices and pharmaceutical products containing thereof |
| US20090123928A1 (en) * | 2007-10-11 | 2009-05-14 | The Johns Hopkins University | Genomic Landscapes of Human Breast and Colorectal Cancers |
| US20100323348A1 (en) * | 2009-01-31 | 2010-12-23 | The Regents Of The University Of Colorado, A Body Corporate | Methods and Compositions for Using Error-Detecting and/or Error-Correcting Barcodes in Nucleic Acid Amplification Process |
| WO2013080307A1 (en) * | 2011-11-29 | 2013-06-06 | 株式会社 東芝 | Primer set for amplifying mosquito-borne virus, assay kit for detecting mosquito-borne virus, and detection method using said primer set and said assay kit |
| CN102776297A (en) * | 2012-08-09 | 2012-11-14 | 中山大学达安基因股份有限公司 | Reagent kit for distinguishing and detecting dengue virus/yellow fever virus/west nile virus/chikungunya virus |
Non-Patent Citations (5)
| Title |
|---|
| DATABASE GENBANK 1 March 2007 (2007-03-01), accession no. H332662.1 * |
| DATABASE GENBANK 2 December 2008 (2008-12-02), accession no. Q552423.1 * |
| NAZE, F. ET AL.: "Simultaneous detection and quantitation of Chikungunya. Dengue and West Nile viruses by multiplex RT-PCR assays and Dengue virus typing using High Resolution Melting", JOURNAL OF VIROLOGICAL METHODS, vol. 162, 2009, pages 1 - 7 * |
| PONGSIRI, P. ET AL.: "Multiplex real..time RT·PCR for detecting chikungunya virus and dengue virus", ASIAN PACIFIC JOURNAL OF TROPICAL MEDICINE, vol. 5, 2012, pages 342 - 346 * |
| YANG, C.-F. ET AL.: "'Screening of mosquitoes using SYBR Green i-based real-time RT- PCR with group-specific primers for detection of Flaviviruses and alphaviruses in Taiwnn", JOURNAL OF VIROLOGICAL METHODS, vol. 168, 2010, pages 147 - 151 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106755565A (en) * | 2015-11-20 | 2017-05-31 | 广东省疾病预防控制中心 | A kind of kit based on fluorescent PCR method joint-detection dengue fever virus and datum hole Kenya virus |
| WO2017124054A1 (en) * | 2016-01-14 | 2017-07-20 | The Board Of Trustees Of The Leland Stanford Junior University | Methods and reagents for detection of chikungunya virus and zika virus |
| US11591660B2 (en) | 2016-01-14 | 2023-02-28 | The Board Of Trustees Of The Leland Stanford Junior University | Methods and reagents for detection of chikungunya virus or chikungunya virus and dengue virus |
| CN112111599A (en) * | 2019-06-19 | 2020-12-22 | 台达电子国际(新加坡)私人有限公司 | Multiple detection kit and method for drogong virus and zika virus |
| EP4038199A4 (en) * | 2019-10-03 | 2023-04-19 | Agency for Science, Technology and Research | METHOD FOR DETECTING OR DIFFERENTIATING CHIKUNGUNYA, DENGUE AND ZIKA VIRUSES |
Also Published As
| Publication number | Publication date |
|---|---|
| IN2015DN02669A (en) | 2015-09-04 |
| SG11201502511YA (en) | 2015-05-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Nagaraj et al. | Ante mortem diagnosis of human rabies using saliva samples: comparison of real time and conventional RT-PCR techniques | |
| US8354230B2 (en) | Multiplex detection assay for influenza and RSV viruses | |
| Shahrajabian et al. | Different methods for molecular and rapid detection of human novel coronavirus | |
| JPWO2017212904A1 (en) | Rapid detection method of African swine fever virus using LAMP method combining multiple primer sets | |
| WO2014039010A1 (en) | Isolated oligonucleotides, methods and kits for detection, identification and/or quantitation of chikungunya and dengue viruses | |
| EP3980564A1 (en) | Methods and compositions for human papillomaviruses and sexually transmitted infections detection, identification and quantification | |
| CN103025893A (en) | Probes and primers for detection of dengue | |
| WO2012060779A1 (en) | Method for detection of enterovirus ev71 | |
| JPWO2018042598A1 (en) | Zika virus detection primer set | |
| CN115927743B (en) | Composition, kit and method for simultaneously detecting HSV-1, HSV-2 and VZV | |
| JP6181742B2 (en) | HEV assay | |
| JP2013516984A (en) | Method for ensuring amplification of abnormal nucleic acids in a sample | |
| JP7105553B2 (en) | Dual-probe assay for target nucleic acid detection | |
| Zhang et al. | A high-throughput DNA analysis method based on isothermal amplification on a suspension microarray for detecting mpox virus and viruses with comparable symptoms | |
| WO2013064834A1 (en) | Dengue assay | |
| WO2015034764A9 (en) | Hpv detection in urine | |
| JP6592697B2 (en) | Serotype 2 dengue virus detection kit, serotype 3 dengue virus detection kit, and dengue virus detection kit | |
| Metawlly et al. | Low cost detection of hepatitis C virus RNA in HCV infected patients by SYBR Green I real-time PCR | |
| Sritong et al. | Development of an integrated sample amplification control for salivary point-of-care pathogen testing | |
| KR102076343B1 (en) | Composition for detecting adenovirus type 55 using Real-time LAMP and uses thereof | |
| WO2012021106A1 (en) | Detection of dengue virus serotypes 1 to 4 | |
| RU2715617C1 (en) | Set of oligonucleotide primers and a fluorescence-labeled probe for identifying a west nile virus genotype 2 | |
| Daskou et al. | Α 2-stage, nested-like nucleic acid amplification method (IsoPCR) for the highly sensitive detection of HPV16 and HPV18 DNA | |
| KR102402765B1 (en) | Multiplex RT-LAMP composition for diagnosis of SARS-CoV-2 infection and uses thereof | |
| WO2014029851A1 (en) | Diagnosis of hpv-induced cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13835819 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: IDP00201501922 Country of ref document: ID |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 13835819 Country of ref document: EP Kind code of ref document: A1 |



