WO2014029851A1

WO2014029851A1 - Diagnosis of hpv-induced cancer

Info

Publication number: WO2014029851A1
Application number: PCT/EP2013/067477
Authority: WO
Inventors: Elise JACQUIN; Jean-Luc Pretet; Christiane Mougin
Original assignee: Universite De Franche Comte; Centre Hospitalier Universitaire De Besancon
Priority date: 2012-08-22
Filing date: 2013-08-22
Publication date: 2014-02-27

Abstract

The present invention relates to the diagnosis of the HVP-induced cancer lesions in a subject, and more particularly to the detection of the methylation status of HPV specific target regions in cervical or anal lesions of clinical samples. The methods of the invention includes extracting DNA of a clinical sample; treating said DNA with bisulfite for conversion of unmethylated cytosine; amplifying at least one DNA target region, said target region comprising at least 4 methylation sites in Long Control Region (LCR) of HPV types associated to HPV-induced invasive cancer, subjecting said amplified target region to methylation-sensitive high resolution melting analysis.

Description

DIAGNOSIS OF HPV-INDUCED CANCER

FIELD OF THE INVENTION

The present invention relates to the diagnosis of the HVP-induced cancer in a subject, and more particularly to the detection of the methylation status of HPV specific target regions in cervical or anal lesions of clinical samples.

BACKGROUND OF THE INVENTION Since the 50's, introduction of cervical cancer screening by Papanicolaou (Pap) smear has led to a substantial reduction in deaths from cervical cancer. However, screening based on cytology is far from being perfect especially due to its low reproducibility and low sensitivity. Now, it is recognized that high-risk human papillomaviruses (HR HPV) are the etiologic agents of intraepithelial precancerous lesions andinvasive cancer of the cervix (Bosh 1995, Walboomers 1999). Only persistentinfections are predictive for prevalent as well as incident cervical lesions (Wallin 1999, Dalstein 2003), and amongst the 13 HR HPV, HPV 16 represents the most carcinogenic genotype.

Numerous large randomized prospective studies have evaluated HR HPV testing in primary screening and concluded that HPV testing represents a unique opportunity to identify women with precancerous and cancerous lesions with a high sensitivity (Mayrand, 2007, Naucler 2007, Riethmuller 2008, Ronco). But now there is still a need to develop specific screening tools that would permit to identify, among HPV - and particularly among HPV 16 - infected women those at risk of presenting a cervical lesion. It has recently been shown that HPV 16 load quantification could be an interesting viral biomarker for both incident (Monnier Benoit 2006) and prevalent (Saunier 2008) cervical lesions.

DING et al. [EUROPEAN JOURNAL OF OBSTETRICS & GYNECOLOGY ABD REPRODUCTIVE BIOLOGY, 2009, Vol. 147, p. 215-220] have investigated the methylation patterns of CpGdinucleotides contained within the LCR of the HPV 16 genome, in a collection of clinical specimens comprising the full spectrum of cervical carcinogenesis. The authors concluded that methylation of HPV 16 LCR is highly associated with severity of cervical neoplasm. This study and other (see for example, BRANDSMA et al. [VIROLOGY, 2009, Vol. 389, p. 100-107] or KALANTARI et al. [VIROLOGY, 2009, Vol. 390, p. 261-267]) made use of bisulfite treatment followed by sequencing to determine the methylation status of HPV 16 DNA regions.

SNELLENBERG et al. [VIROLOGY, 2012, Vol. 422, p. 357-365] reported another method to determine the methylation status of the E2 binding sites of HPV 16 in cervical lesions and showed that HPV16 E2BSs methylation appeared highly frequent in SCC lesions, with particularly E2BS3 methylation occurring proportional to the severity of cervical diseases.

Despite these findings, there is still a need to identify fast, specific and cost-effective methods to diagnose HVP-induced cancerous lesions in clinical samples.

WOJDACZ et al. [NUCLEIC ACIDS RESEARCH, 2007, Vol. 35, No. 6, doi: 10.1093/nar/gkm013] have disclosed a method, called methylation sensitive high resolution melting (MS-HRM). The method is proposed as a new approach for sensitive and high-throughput assessment of methylation. The method has been used for analysis of heterogeneous DNA methylation in chronic lymphocytic leukemia [CANDILORO et al., EPIGENETICS, 2011, Vol. 6, No. 4, p. 500-507]. Nevertheless, WOJDACZ et al. [Supra] pointed out that the sensitivity of the method will depend on the length and the number of differences between methylated and unmethylated PCR products, thereby requiring empiric determination of its sensitivity for each particular diagnostic assay.

SUMMARY OF THE INVENTION

It has now surprisingly been found that the methylation status of HPV can be determined and correlated to the presence of cancerous lesions in clinical samples using methylation sensitive high resolution melting (MS-HRM) analysis, thereby providing a new simple, specific and cost-efficient way to diagnose HPV-induced cancerous lesions in a subject.

Accordingly, the present invention provides in vitro methods of predicting the presence of HPV- induced invasive cancers in a subject, said method comprising:

a. providing a clinical sample susceptible to present HPV-induced lesions, previously collected from the subject;

b. extracting DNA of said clinical sample;

c. treating said DNA with bisulfite for conversion of unmethylated cytosine; and,

d. amplifying at least one DNA target region, said target region comprising at least 4 methylation sites in Long Control Region (LCR) of HPV types associated to HPV-induced invasive cancer,

e. subjecting said amplified target region to methylation-sensitive high resolution melting analysis and obtaining high-resolution melt curve specific of said amplified target region, and, f. comparing said high-resolution melt curve specific of said amplified target region obtained at step e. with one or more high-resolution melt curves obtained with specific control and/or standardized DNA appropriate for deriving the corresponding methylation status of said amplified target region, thereby predicting the presence of HPV-induced invasive cancerous lesions depending on the corresponding methylation status,

g. optionally, determining the methylation pattern of said amplified target region by DNA sequencing and thereby confirming the prediction of step f.

Such method is more particularly suited for the detection of HPV-induced cervical cancer or anal cancer.

In one preferred embodiment, a typical clinical sample may be obtained from cervical or anal clinical sample, for example, cervical or anal scrapings, containing HPV16 DNA. In such specific embodiment, the method according to the invention preferably comprises, at step d., the amplification of a target region containing E2-binding sites of HPV16.

The invention also relates to the diagnostic kit, for the detection of HPV-induced invasive cancer, for carrying out the in vitro method as defined above. Preferably, such kit comprises:

a. a pair of primers for amplification of target region in LCR of HPV comprising at least 4 methylation sites, and, optionally, reagents for DNA amplification, b. standardized HPV16 DNA, for example comprising DNA of SEQ ID NO: l that harbors 5/5 methylated cytosines in the target region, and/or DNA comprising SEQ ID NO:l that harbours 0/5 methylated cytosines in the target region, or mixes thereof, c. optionally, control DNA template with known methylation status, and,

d. optionally, instructions for carrying out PCR reactions.

A specific embodiment of such kit, comprises a pair of primers essentially consisting in SEQ ID NO:2 and SEQ ID NO:3, and their functional variants, capable of amplifying a HPV16 target region corresponding to SEQ ID NO: l.

DETAILED DESCRIPTION OF THE INVENTION In a first aspect, the present invention provides in vitro methods of predicting the presence of HPV- induced invasive cancers in a subject, said method comprising:

a. providing a clinical sample susceptible to contain HPV-induced cancerous lesions, previously collected from the subject; b. extracting DNA of said clinical sample;

d. amplifying at least one DNA target region, said target region comprising at least 4 methylation sites in Long Control Region (LCR) of HPV types associated to HPV -induced invasive cancer,

e. subjecting said amplified target region to methylation-sensitive high resolution melting analysis and obtaining high-resolution melt curve specific of said amplified target region, and, f. comparing said high-resolution melt curve specific of said amplified target region obtained at step e. with one or more high-resolution melt curves specific obtained with control DNA appropriate for deriving the corresponding methylation status of said amplified target region, thereby predicting the presence of HPV-induced invasive cancerous lesions depending on the corresponding methylation status,

As used herein, the term "predicting" or "diagnosing" is used interchangeably and refers to a method that allows determining the presence or absence of certain phenotype, character or disease, with a certain level of probability. In the present case, the methods allow to determine the presence of HPV- induced invasive cancer lesions in a clinical sample, with a certain level of probability (i.e., that is significantly higher than random determination).

Cervical cancer is almost exclusively associated with human papillomavirus (HPV) infection. Human papillomaviruses constitute a group of more than 100 types of viruses, as identified by variations in DNA sequence. The various HPVs cause a variety of cutaneous and mucosal diseases. Certain types may cause warts, or papillomas, which are benign (noncancerous) tumors. Others have been found to cause invasive carcinoma of the uterine cervix.

HPVs are broadly classified into low-risk and high-risk types, based on their ability to induce malignant changes in infected cells. Low risk HPV types such as 1, 2, 4, 6, 11, 13 and 32 are primarily associated with benign lesions or common warts while the high risk types, such as 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 68, 73 and 82 are primarily associated with premalignant and malignant epithelial lesions.

Therefore, the present method encompasses not only the detection of invasive cervical cancer (the preferred embodiment), but also other invasive cancers that are induced by HPV, particularly of the high-risk type and provides a method for predicting the presence of HPV (high-risk type)-induced cancerous lesions.

Other invasive cancers that are induced by HPV and may be predicted according to the method of the invention include without limitation, HPV-induced cancer from oral cavity, oropharynx, anus, penis, vulva, vagina.

Providing a clinical sample

The method of the invention can be carried out on any clinical sample where there is a need to determine the presence of HPV-induced cancerous lesions. Said clinical sample is obtained from human subject in need of the diagnostic method.

In one specific embodiment, said sample is a clinical sample obtained from human, in particular a woman. The clinical sample may be obtained from body tissues or fluids, susceptible to contain human papillomavirus DNA. For example, said clinical sample may be obtained from urine, blood including without limitation peripheral blood or plasma, circulating HPV -containing cells in blood, stool, sputum, bronchoalveolar fluid, endotracheal aspirates; wounds, cerebrospinal fluid, lymph node, exsudate and more generally any human biopsy tissue or body fluids, tissues or materials. In a preferred embodiment, especially for diagnosing HPV-induced cervical or anal cancerous lesions, said clinical sample is obtained from cervical or anal scrapings respectively.

The method may be more specifically directed to patients, previously diagnosed as HPV positive, and preferably patients with persistent infection, e.g. more than 6 months, preferably more than 12 months of HPV infection. HPV infection may be determined by clinically relevant HR HPV test, for example the digene HC2 High-risk HPV DNA test (Qiagen), the cobas® HPV Test (Roche Diagnostics) or the GP5+/6+ PCR described in de RodaHusman et al. (1996).

Accordingly, in one specific embodiment, said clinical samples are selected from subject diagnosed to be infected persistently (for a duration of at least 6 or at least 12 months) with human papillomavirus, and more preferably with high risk HPV type associated to high risk of HPV-induced cancerous lesions, such as, HPV 16, HPV 18, HPV45, HPV31 and HPV33.

In a more specific embodiment, said clinical samples are selected from women diagnosed to be infected persistently (for a duration of at least 6 or at least 12 months) with HPV16.

In another related embodiment, said clinical samples are selected from clinical samples with high titer of human papillomavirus, preferably high titer of HPV16. HPV titer may be determined by real time PCR for example as described in Saunier et al. 2008. Extracting DNA of clinical sample

At step b) of the method, the clinical sample may first be treated to physically, chemically and/or mechanically disrupt tissue or cell structure, thus releasing intracellular components.

A DNA extraction step is then carried out. Such extraction step should allow obtaining total DNA in a good enough quality for its use as nucleic acid template for subsequent steps of bisulfite treatment and PCR amplification. Extraction methods are well described in the art and any appropriate methods can be used depending on the amount of starting material, the quality of the sample and the nature of the biological material or nucleic acids contained in the clinical sample.

Treating DNA with bisulfite for conversion of unmethylated cytosine

At step c), the extracted DNA is subjected to bisulfite treatment. Bisulfite treatment is a well-known method in the art to convert unmethylated cytosine residue to uracile, but leaving 5-methylcytosine residue unaffected. Thus, the step of bisulfite treatment is carried out to introduce specific changes in the DNA sequence that will depend on the methylation status of individual cytosine residues, and preferably to convert every single unmethylated cytosine residue to uracile. Kits for performing bisulfite treatment are commercially available (Cells to CpGBisulfite Conversion Kit, Applied Biosys terns).

Amplifying at least one target region using said bisulfite treated DNA

According to the method of the invention, at least one nucleic acid amplification step is performed. This one or more amplification steps should allow the amplification of at least one target region with appropriate length and methylation sites to enable discriminating melting curves by high-resolultion melting analysis depending on the methylation status of the target region.

As used herein, the term "nucleic acid amplification" refers to any known procedure for obtaining multiple copies of a target nucleic acid sequence or its complementary or fragments thereof, using sequence-specific probes, referred to as primers. Known amplification methods include, for example, Polymerase Chain Reaction (PCR), Ligase Chain Reaction (LCR)....

In one preferred embodiment, said one or more amplification steps carried out in the method of the invention are PCR amplifications. Methods for carrying out PCR amplifications are thoroughly described in the literature, for example in "PCR Primer: A laboratory Manual" Dieffenbach and Dveksler, eds. Cold Spring Harbor Laboratory Press, 1995.

In one related specific embodiment, Real-Time PCR is used. Real-time PCR allows not only the detection of a target sequence in a clinical sample but also its quantification. Real-time PCR is widely used in molecular diagnostic, in particular, for medical biology, and in microbiology [ESPY et al., 2006, Clinical Microbiology Reviews, 2006, 19(1), 165-256]. The term "real-time" refers to periodic monitoring during PCR. Indeed, the real-time procedure follows the general pattern of PCR, but amplicons are quantified after each round of amplification.

Preferably, devices for performing High-resolution Melting PCR are used. Devices for performing HRM PCR are also commercially available (e.g. 7500 Fast Real-time PCR System, SmartCycler® II from Cepheid®, LightCycler® from Roche® or MX3005P® from Stratagene). For HRM analysis of the amplicons, intercalating agent, such as Syto 9, or other saturating fluorescent dyes may be used during the PCR reaction. An example is the MeltDoctor™ HRM dye consisting of Syto 9 dye, as commercialized by Applied Biosystems with its MeltDoctor® HRM Mix. Advantageously, an intercalating agent for HRM analysis is selected so as to release or reduce specific signal, such as a fluorescent signal, dependent upon the denaturation state of the DNA (single vs double strand), therefore allowing to determine the melting temperature, Tm of a specific DNA.

As used herein, the term "primers" refers to an oligonucleotide sequence of at least 10 nucleotides, for example from 10 to 50 nucleotides, for example, from 18 to 25 nucleotides, that is designed to hybridize with a complementary portion of a target region, and will function as the starting point for the polymerization of nucleotides (primer extension) at each amplification cycle during PCR.

In one preferred embodiment; the primers for use in the amplification step are selected to amplify a target region comprising at least 4 methylation sites in Long Control Region (LCR) of HPV types associated to HPV-induced invasive cancer.

It has been indeed observed that the methylation pattern is correlated with the presence of HPV- induced lesions. More specifically, methylation status of regions situated in LCR of HPV, preferably HPV 16, have been associated to the presence of HPV-induced cancerous lesions.

As used herein, the term "methylation site" refers to CpG nucleotides that can be naturally methylated in vivo. The LCR region of HPV16 contains 16 known methylation sites. For example, in HPV16 LCR target region of SEQ ID NO: l, there are 5 known methylation sites, with corresponding cytosines at positions 26, 32, 38, 47 and 53 of SEQ ID NO: l.

In one specific embodiment, the target region to be amplified contains the E2 binding-sites of HPV 16 Long Control Region, comprising at least 4 methylation sites, for example at positions 26, 32, 38, 47 of SEQ ID NO: l. One example of such target region is the region containing the E2 binding-sites of HPV16. In a preferred embodiment, said target region is the region comprising the first (E2BS#1) and the second (E2BS#2) binding sites as shown in Figure 2. More specifically said target region is SEQ ID NO:l. By the term "target region" it is understood that the amplified nucleotide sequence may not have exactly the same sequence as SEQ ID NO: l but may include certain natural variations, due for example to natural polymorphism, and of course, it includes the artificial variations due to bisulfite treatment of unmethylated cytosine.

Other target regions may be a target region containing the E2 binding-sites of HPV16 Long Control Region, comprising at least 4 methylation sites in the E2 binding sites E2BS#1 and E2BS#2, overlapping fully or partially SEQ ID NO: l and having a nucleotide length which is equal to the length of SEQ ID NO:l ± 20 nucleotides.

Design and molecular characterization of the sets of primers specific of E2-binding sites of HPV16 comprising at least 4 methylation sites

In a specific embodiment, a set of primers is therefore designed for PCR amplification of target region containing at least the four methylation sites within the E2 binding-sites of HPV16 Long Control Region, more specifically, the first and second E2 binding sites of HPV16 LCR as shown in Figure 2, with corresponding cytosines at positions 26, 32, 38, 47 of SEQ ID NO: l. In a related specific embodiment, the set of primers is designed for PCR amplification of target region containing the 5 methylation sites of SEQ ID NO:l.

As used herein "a set of primers" refers to at least two primers, one primer hybridizing to the one end of one strand of a target nucleic acid region to be amplified, and the other primer hybridizing to the other strand at the other end of the target nucleotide sequence to be amplified. A set of primers thereby defines the end sequences of the amplified product or amplicon. Preferably, the set of primers specific of target nucleic acid region are defined so as to amplify target sequences below 150bp, more preferably comprised between 90 and 130bp, for example HObp.

The set of primers used in the method of the invention may have a melting temperature Tm from 35°C to 50°C, preferably of between 38°C to 45°C, wherein the Tm is calculated with 50mM of NaCl and 0% formamide. Such primers may preferably not hybridize to themselves or to other primers used in the same amplification step of the method. Algorithms or softwares for designing and selecting appropriate target nucleotide sequences and primers are available in the art. See for examplethe Methyl Primer Express software vl.O (Applied Biosystems).

As used herein, the term "amplicons" refers to nucleic acids that have been synthesized (amplified) during the amplification steps, having a nucleotide sequence corresponding to the target nucleic acid region. According to the methods of the invention, an amplicon that may be detected according to the methods of the invention is the amplicon corresponding to the target region of SEQ ID NO: l or a region fully overlapping SEQ ID NO:l, or its natural variants and bisulfite treated sequence. In a preferred embodiment, one set of primers is designed so as to specifically amplify nucleic acid target region of SEQ ID NO: 1.

As used herein, the term "specifically hybridizing" means that the primer is at least 60%, 70%, 80%, 90%, 95% or 100% identical to its target nucleotide sequence.

As used herein, the percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i. e., % identity = # of identical positions/total # of positions x 100), taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm, as described below.

The percent identity between two nucleotide sequences may be performed using BLAST and BLAST2.0 algortihms (Altschul, (1997) Nucl. Acids. Res. 25: 3389-3402). The BLASTN program for nucleic acid sequences uses the default parameters.

Preferably, the set of primers are designed so as to hybridize to a region which do not comprise any methylation site (to avoid methylation dependent variation of PCR amplification reaction).

In preferred embodiments, the following set of primers may be used:

A pair of primers of SEQ ID NO:2 and SEQ ID NO:3, or their functional variants, suitable to amplify said target region of SEQ ID NO:l in HPV16 containing bisulfite treated DNA.

Functional variant set of primers as those primers described above, for example, include primers containing at least 10, 15 or 20 consecutive nucleotides of the primers described above, as long as they retain their capacity to amplify with substantially the same sensitivity and specificity their target nucleotide region as compared to the original sets of primers, when performing the same PCR amplification step (under similar conditions).

Other variant sets of primers that may be used are primers that are identical to the set of primers of SEQ ID NO:2 and SEQ ID NO:3 as defined above, except that they have no more than 1, 2, 3, 4 or 5 nucleotides substitution, deletion and/or insertion when compared with the corresponding original primers.

Subjecting the amplified target region to methylation-sensitive high resolution melting analysis

At step e) of the methods of the invention, the amplified target region (i.e. the amplicon) is subjected to methylation-sensitive high resolution melting analysis. High-resolution melting analysis consists of subjecting the amplified product (containing the intercalating labelling agent) to incremental temperature (for example, from a temperature below the estimated melting temperature to a temperature above the melting temperature) and recording at each incremental step (e.g. 1% ramping corresponding to 0.3°C.s^-1) the signal emitted by the intercalating agent, that is dependent upon the denaturation status of the DNA. A high-melt melt curve recording the signal as a function of the temperature is thus obtained.

Methods for performing high-resolution melting analysis and collecting high-melt curves are described in the Art (Wojdacz and Dobrovic, 2007) and also described in the Examples below.

Comparing high-melt curve specific of the amplified target region with one or more high- resolution melt curves specific of control DNA

Due to the difference in the methylation status of the starting DNA material, such resulting high- resolution melt curve obtained at step e. of the method will be specific of each starting DNA material and be correlated with the methylation status.

As used herein the term "methylation status" is used to refer to any information about the methylation of the tested DNA material in the target region. According to the method of the invention, information about the methylation of the tested DNA material in the target region may not be sufficient to derive with certainty the exact percentage of methylation in the target region, but should be sufficient to predict the presence of cancerous lesions.

To correlate a specific high-resolution melt curve with a methylation status, control DNA may be synthesized, that corresponds, for example, to a certain known pattern of methylation. Typically, in a specific embodiment where a target region of SEQ ID NO:l is amplified, control DNA may consist of DNA sequence comprising 0, 1, 2, 3, 4 or 5 thymine replacing the cytosines of the 5 methylation sites, thereby reflecting respectively a methylation status of 5/5 ; 4/5 ; 3/5 ; 2/5 ; 1/5 ; 0/5 cytosines of the target region. Examples of such control DNA sequence that can be used for high-resolution melting analysis are the DNA of SEQ ID NOs:8-15, as defined in the Examples. These control DNA may be used to assess position effect.

Controls may also consist of a defined mixture of the above control DNA sequences.

Other DNA control appropriate for deriving the corresponding methylation status of said amplified target region may be designed by the skilled person. For example standardized HPV16 DNA may be obtained by mixing in appropriate proportion of DNA comprising SEQ ID NO:l that harbors 5/5 methylated cytosines in the target region and DNA comprising SEQ ID NO: l that harbors 0/5 methylated cytosines in the target region. Preferably a series of standardized HPV16 DNA may contain 0%, 25%, 50%, 75% and 100% of target region with 5/5 methylated cytosines. Standardized HPV16 DNA may be run in parallel to clinical samples to determine a percentage of methylation of the HPV16 target region.

In the methods of the invention, the methylation status of the target region, derived from the high- resolution melting analysis permits the prediction of HPV-induced invasive cancerous lesions.

Typically, as evidenced in the Examples below, a methylation status that corresponds to at least 25% methylation in the target region of SEQ ID NO: l, comprising the 4 methylation sites of E2-binding sites E2BS#1 and E2BS#2 of LCR and a fifth methylation site known to bind the transcription factor Spl of HPV16, is indicative of HPV-induced invasive cancerous lesions, more specifically HPV- induced cervical or anal cancerous lesions, with a specificity superior to 90% (96%) and a sensitivity superior to 40% (46%).

Kits for predicting the presence of HPV-induced invasive cancer in a subject

It is another aspect of the invention to provide a kit for carrying out the prediction methods as described above.

In one embodiment, the diagnostic kit according to the invention may comprise:

a) a pair of primers for amplification of a target region in LCR of HPV comprising at least 4 methylation sites, and, optionally, reagents for DNA amplification,

b) standardized HPV 16 DNA,

c) optionally, control DNA template for MS-HRM analysis, with known methylation profile, and,

d) optionally, instruction for carrying out PCR amplification.

Target region and corresponding pair of primers that are suitable for carrying out the methods of the invention have been defined above. In a preferred embodiment, the diagnostic kit comprises a pair of primers essentially consisting in SEQ ID NO:2 and SEQ ID NO:3 and their functional variants capable of amplifying the target region corresponding to SEQ ID NO: l.

Standardized HPV 16 DNA may comprise DNA of SEQ ID NO: l that harbors 5/5 methylated cytosines in the target region, DNA comprising SEQ ID NO: l that harbors 0/5 methylated cytosines in the target region. Preferably a series of standardized HPV 16 DNA may contain mixes of such DNAs, for exemple 0%, 25%, 50%, 75% and 100% of target region with 5/5 methylated cytosines. Control DNA templates are appropriate for proper correlation of MS-HRM curve and methylation status. According, in one specific embodiment, said control DNA templates for MS-HRM analysis, comprises one or more of the following controls:

a) Negative control of SEQ ID NO:8;

b) Positive control for 100% methylation of SEQ ID NO:9,

c) Mixes of SEQ ID NO:8 and SEQ ID NO:9,and/or,

d) Any one of SEQ ID NO: 10-15.

The kit may further comprise buffers and reagents suitable for the preparation of the clinical sample, DNA extraction, bisulfite treatment, and/or nucleic acid amplification steps and/or MS-HRM analysis.

In one specific embodiment, the kit may further comprise typical reagents used in PCR reaction such as, DNA polymerases, deoxyribonucleoside triphosphates (dNTPs, ie: dATP, dCTP, dTTP, dGTP), an aqueous buffered medium that may include monovalent ions, e.g. potassium chloride, a source of divalent cations, e.g. magnesium, and a buffering agent such as TRIS, HEPES or MOPS and the like. Other agents that may be present in the buffer medium include chelating agents such as BSA.

The kit may further comprise dyes and other probes useful for real-time PCR and MS-HRM analysis. The kit may also comprise appropriate instructions for use, especially for carrying out real-time PCR reactions and MS-HRM analysis.

The kit may be presented in a carrier being compartmentalized to receive one or more containers such as tubes or vials.

In the following, the invention will be illustrated, without any limitation, by means of the following examples as well as the figures.

FIGURE LEGENDS

Figure 1: HPV16 Long Control Region

Figure 2: E2 binding sites in the Long Control Region of HPV16 EXAMPLES

In the following description, all molecular biology experiments for which no detailed protocol is given are performed according to standard protocol. Materials and Methods

Primer design for MS-HRM targeting the HPV16 E2 Binding Sites #1 and #2 in the Long Control Region (LCR)

For the design of the MS-HRM PCR primers, we have used the NCBI sequence reference NC_001526.2 for the complete HPV16 genome. The HPV16 Long Control Region (figure 1) starts at nucleotide 7266 and stops at nucleotide 82 (in bold in figure 1).

Our method of MS-HRM PCR permits to analyze the methylation status of two E2 Binding sites (E2BS) located upstream of the p97 early promoter in the HPV16 LCR (nucleotide 37 to 57 of NC_001526.2). Each E2BS contains two CpGdinucletotides: at positions 37 and 43of NC_001526.2 for E2BS#2 and at positions 52 and 58 of NC_001526.2for E2BS#1. The MS-HRM PCR targets a fifth CpG dinucleotide in position 31 of NC_001526.2 located within the Spl binding site (Figure 2). Primer sequences for the MS-HRM PCR are as follow:

E2BS_For: 5 ' - AATAATTTATGTATAAAATTAAGGG-3 ' (SEQ ID NO:2)

E2BS_Rev: 5 ' -ATCCTAAAAC ATTAC AATTCTCTTTT-3 ' (SEQ ID NO:3) No CpG has been included in the primer sequences so that they can amplify both unmethylated and methylated E2BS sequences after bisulfite treatment of DNA. MS-HRM PCR primers generate an amplicon of 110 bp. The sequence of the amplicon is:

AATAATTCATGTATAAAACTAAGGGCGTAACCGAAATCGGTTGAACCGAAACCGGTTAG TATAAAAGCAGACATTTTATGCACCAAAAGAGAACTGCAATGTTTCAGGAC (SEQ ID NO: l)

The sequence of the E2BS PCR fragment after bisulfiteconvertion of unmethylated DNA is as follows:

AATAATTTATGTATAAAATTAAGGGTGTAATTGAAATTGGTTGAATTGAAATTGGTTAGT ATAAAAGTAGATATTTTATGTATTAAAAGAGAATTGTAATGTTTTAGGAT (SEQ ID NO:4)

The sequence of the E2BS PCR fragment after bisulfiteconvertion of fully methylated DNA is as follows:

AATAATTTATGTATAAAATTAAGGGCGTAATCGAAATCGGTTGAATCGAAATCGGTTAG TATAAAAGTAGATATTTTATGTATTAAAAGAGAATTGTAATGTTTTAGGA (SEQ ID NO:5) E2BS-MS-HRM PCR conditions

MS-HRM PCR experiments targeting the HPV16 E2 Binding sites (E2BS) were performed on the 7500 Fast Real Time PCR System (Applied Biosystems). The reaction was performed in a final volume of 20 μΐ. containing the Melt Doctor™ HRM Master Mix IX (Applied Biosystems), 300 nM of E2BS_For and E2BS_Rev primers and 2 μΕ of bisulfite converted DNA. After an initial denaturation step at 95°C for 10 min, 40 cycles of amplification were performed (95°C for 15 sec, 50° for 20 sec, 60°C for 1 min). High-resolution melting curves were generated by collecting fluorescence continuously at a ramping rate of 0.3 °C/s from 50°C to 95°C immediately following PCR cycling. High Resolution Melting curves were analyzed using the HRM Software (Applied Biosystems). Standard curves used for absolute quantification of E2BS copy number were established using serial dilutions (1:10) of pLCR.02 0/5 (described below) containing 10 to 10⁶ copies/μΕ.

Construction ofplasmid matrix to mimic different methylation profiles

Total DNA was extracted from SiHa cells (harboringunmethylated targeted DNA) and CaSki cells (harboring partially methylated targeted DNA) treated or not with a demethylating agent (5-Aza-2- deoxycytidine). The bisulfite conversion of DNA purified from these cell lines was performed using the Cells-to-CpG™ Bisulfite Conversion Kit (Life Technologies, Villebon-sur-Yvette, France) according to the manufacturer's instructions. DNA (250 or 500 ng in 45 μΕ) was denatured at 50°C for 10 min with 5 μΕ of the Denaturation Reagent (Life Technologies). Then, 100 μΐ_^ of reconstituted Conversion Reagent was added to the denatured DNA and the solution was incubated for 2 cycles at 65°C for 30 min, 95°C for 1.5 min followed by 30 min at 65°C. Treated DNA was purified on the columns provided in the kit. Several washing were performed to remove salts and sulfonic groups and the converted DNA was eluted in 40 μΐ_^ of Elution Buffer applied twice on the column. A conventional PCR was realized with primers LCR.02_For and LCR.02_Rev with the following conditions (30 sec at 94°C, 30 sec at 48°C, 30 sec at 72°C for 40 cylcles). This PCR was previously described by Ding et al. (2009) and lead to the amplification of a 237 bp fragment from position 7781 to 112. The primer sequences are:

LCR.02_For: 5 ' - ATTTTAGTTTAT AT ATGAATTGTGTA AAGG-3 ' (SEQ ID NO:6)

LCR.02_Rev: 5 ' -CTAAAAC ATTAC AATTCTCTTTTAATAC AT-3 ' (SEQ ID NO:7)

PCR products were cloned into pGEM®-T Easy Vector (Promega) and several clones named pLCR.02 x/5 were selected for DNA sequencing. We have isolated numerous clones with different E2BS methylation profiles. The sequences of the different clones available in our laboratory are described below. E2BS sequence from pLCR.02 0/5 corresponding to unmethylated HPV16 DNA

AATAATTTATGTATAAAATTAAGGGTGTAATTGAAATTGGTTGAATTGAAATTGGTTAGT ATAAAAGTAGATATTTTATGTATTAAAAGAGAATTGTAATGTTTTAG (SEQ ID NO: 8)

E2BS sequence from pLCR.02 5/5 corresponding to fully methylated HPV16 DNA

AATAATTTATGTATAAAATTAAGGGCGTAATCGAAATCGGTTGAATCGAAATCGGTTAG TATAAAAGTAGATATTTTATGTATTAAAAGAGAATTGTAATGTTTTAG (SEQ ID NO:9)

E2BS sequence from pLCR.02 corresponding to partially methylated HPV16 DNA

- pLCR.02 2/5: two methylated CpG

A ATA ATTTATGTAT AAAATTA AGGGTGT AATTGA AATCGGTTG AATCGAA ATTGGTTAGT ATAAAAGTAGATATTTTATGTATTAAAAGAGAATTGTAATGTTTTAG (SEQ ID NO: 10)

- pLCR.02 3/5: three methylated CpG

a)

AATAATTTATGTATAAAATTAAGGGCGTAATCGAAATCGGTTGAATTGAAATTGGTTAGT ATAAAAGTAGATATTTTATGTATTAAAAGAGAATTGTAATGTTTTAG (SEQ ID NO: 11) b)

AATAATTTATGTATAAAATTAAGGGTGTAATTGAAATCGGTTGAATCGAAATCGGTTAGT ATAAAAGTAGATATTTTATGTATTAAAAGAGAATTGTAATGTTTTAG (SEQ ID NO: 12)

- pLCR.02 4/5: four methylated CpG

a)

AATAATTTATGTATAAAATTAAGGGCGTAATCGAAATCGGTTGAATCGAAATTGGTTAGT ATAAAAGTAGATATTTTATGTATTAAAAGAGAATTGTAATGTTTTAG (SEQ ID NO: 13) b)

AATAATTTATGTATAAAATTAAGGGCGTAATTGAAATCGGTTGAATCGAAATCGGTTAGT ATAAAAGTAGATATTTTATGTATTAAAAGAGAATTGTAATGTTTTAG (SEQ ID NO: 14) c)

AATAATTTATGTATAAAATTAAGGGCGTAATCGAAATTGGTTGAATCGAAATCGGTTAGT ATAAAAGTAGATATTTTATGTATTAAAAGAGAATTGTAATGTTTTAG (SEQ ID NO: 15)

These plasmids were used to assess whether our method allowed the discrimination of different methylation profiles (position effect).

To assess the resolution of the HRM method, mixes of pLCR.02 5/5 (mimicking fully methylated target) and pLCR.02 0/5 (mimicking fully unmethylated target) were set in order to obtain 0, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 and 100% of methylation. All mixes were run in quadruplicates in the same experiment. Construction of standardized DNA for methylation quantification

In order to obtain fully methylated DNA matrix, 1 μg of CaSki DNA was treated with 4 units of MethylaseSssI (New England Biolabs, Evry, France) in a final volume of 50 xL containing IX NE Buffer and 160 μΜ S-Adenosylmethionine during 4 h at 37°C followed by 20 min at 65°C. The QIAEXII Gel Extraction Kit (QIAGEN) was used to purify and concentrate the modified DNA.

For unmethylated matrix we have used the plasmid pBR322-HPV16 that contains the HPV16 whole genome (plasmidic DNA is not methylated in bacteria). pBR322-HPV16 was diluted in calibrated Human Genomic DNA (Roche, Meylan, France).

Methylated and unmethylated DNA were mixed to mimic samples with 0, 25, 50, 75 and 100% of fully methylated E2BS. These DNA mixes were converted with sodium bisulfite and then analysed by E2BS-MS-HRM PCR. Six replicates of each target were used to assess the repeatability of the technique.

Results

Validation of the E2BS-MS-HRM PCR

The MS-HRM PCR is a quantitative method that has been evaluated in terms of specificity, repeatability, efficiency, reproducibility, lower limit of quantification (LLOQ).

Specificity, repeatability, efficiency, LLOQ

Specificity, repeatability, efficiency and LLOQ were determined with DNA derived from CaSki cells, SiHa cells and pLCR.02.0/5.

The melting curves were obtained after amplification of the HPV16 E2BS sequence from the LCR.02 0/5 plasmid (unmethylated), bisulfite converted CaSki cell DNA (partially methylated) or SiHa cell DNA (unmethylated). We observed for each DNA matrix a single pick (SybR green labeling) indicating that the PCR amplified a unique amplicon indicating that the PCR is specific. The melting temperatures varied from 68 to 70°C according to the DNA matrix.

Serial 1/10 dilutions of bisulfite converted CaSki DNA have been used to analyze the repeatability, the efficiency and the lower limit of quantification of the MS-HRM PCR. Theoretical copy number of E2BS varied from 1 to 10⁵ copies of HPV16 DNA/μΕ. Eight replicates of each dilution of bisulfite converted CaSki DNA have been quantified on the same plate. The efficiency reached a satisfying value of 1.94. Only 6/8 replicates with the lowest dilution (1 copy^L) have been amplified. Thus established the LLOQ at 10 copies^L.

The results show a good repeatability with CV below 30% (Table 1).

Reproducibility

Serial 1 :10 dilutions of the pLCR.02 5/5 (10 to 10⁶ E2BS copies^L) and serial 1 :10 dilutions of the pLCR.02 0/5 (10 to 10⁶ E2BS copies^L) were analyzed with the MS-HRM PCR in 8 independent experiments to assess the reproducibility of the technique.Reproducibility was good with variance < 5 (Table 2).

Table 2: Reproducibility

Validation ofHRM analysis

HRM discrimination of methylated and unmethylated sequences, position effect

The HRM analysis of pLCR.02 0/5, pLCR.02 2/5, pLCR.02 3/5, pLCR.02 4/5 and pLCR.02 5/5 defined 4 groups of variants. No discrimination was made between pLCR.02 3/5 and pLCR.02 4/5. Moreover, no position effect was noted when pLCR.02 3/5 a) -b) and pLCR02. 4/5 a) -b) -c) were analysed (data not shown).

HRM resolution

HRM analysis of mixes of pLCR.05 0/5 and pLCR.05 5/5 in different proportions defined 5 variants corresponding to:

- the mixes with 0%, 5% et 10% and 15% of methylated matrix

- the mixes with 15%, 20% et 25% of methylated matrix

- the mixes with 30%, 35%, 40%, 45%, 50%, 55%, and 60% of methylated matrix

- the mixes with 65%, 70%, 75%, 80%, 85% and 90% of methylated matrix

- the mixes with 95% and 100% of methylated matrix.

These results (data not shown) indicate that the technique can retrieve a percentage of methylation with a resolution of 25%. Thus, we set 5 levels of methylation: 0%, 25%, 50%, 75% and 100%.

Validation of standardized HPV16 DN A for E2BS methylation quantification

E2BS MS-HRM PCR analysis defined 5 profiles corresponding to the different mixes. A single pick was obtained for 0% of methylation (Tm=67°C) and for 100% of methylation (Tm=70°C) whereas two picks were present for mixes with 25%, 50% and 75% of methylated target. The six replicates exhibit the same HRM profile indicating a good repeatability of the technique (Data not shown).

E2BS methylation as a diagnostic marker for cervical cancer

We conducted a preliminary study on cervical smears classified as Negative for Intraepithelial Lesion or Malignancy (NILM), Low grade Squamous Intraepithelial lesion (LSIL), High grade Squamous Intraepithelial lesion (HSIL) and cervical cancer.

The extracted DNA has been converted with sodium bisulfite before HPV16 E2BS MS-HRM PCR analysis. The quantification of methylation level has been determined with the standardized DNA. Most if not all samples with a NILM, LSIL or HSIL cytology present no methylation. In contrast 46% of cancer sample exhibits >25% of methylation.

With a cut off set at 25% of methylation, we obtained a sensitivity of 46% and a specificity of 95% for the identification of patient with a cancer (Table 3). Table 3: Methylation % of the E2BS in clinical samples representative of the natural history of cervical cancer.

Methylation

; ._\ NILM (n=15) _: ; I.SIUn=21 > ^■ ^■ IISII. (n=27> - Cancer (n=13> ^' leveH% >

0% 93,3% 90,5% 100,0% 53,8%

25% . ^•.•.^•■6^.%·^' _. ^·'.^· · ^""■■■'9$% ^■:: ^{' · "}: ^' 30,8% .- ·_.·^·

>50% - - - 15,4% E2BS methylation in anal cancer

We conducted a study on 45 HPV16 positive anal carcinoma biopsies.

The extracted DNA has been converted with sodium bisulfite before HPV16 E2BS MS-HRM PCR analysis. The quantification of methylation level has been determined with the standardized DNA. Twenty two percent of anal carcinomas presented methylated E2BS#1 E2BS#2 and Spl binding sites. Among them, 6,5% exhibit ]0-10%] of methylation, 6,5% exhibit ] 10-25%] of methylation and 9% exhibit ]25-50%] of methylation. The methylation level, determined according to the method described in Jacquin et al. 2013, varied from 10 to 41%.

Table 4: Useful nucleotide and amino acid sequences for practicing the invention

SEQ Nucleotide or amino acid sequence

ID

NO

1 Amplicon of target region

AATAATTCATGTATAAAACTAAGGGCGTAACCGAAATCGGTTGAACCGAAAC CGGTTAGTATAAAAGCAGACATTTTATGCACCAAAAGAGAACTGCAATGTTTC AGGAC

2 Primer E2BS_For: 5 ' - A ATAATTT ATGTAT AAA ATTAAGGG-3 '

Primer E2BS_Rev: 5 ' - ATCCTA AAAC ATT AC AATTCTCTTTT-3 '

3

4 E2BS PCR fragment after bisulfite convertion of unmethylated DNA:

AATAATTTATGTATAAAATTAAGGGTGTAAJT;GAAATTGGTTGAATTGAAATT GGTTAGTATAAAAGTAGATATTTTATGTATTAAAAGAGAATTGTAATGTTTTA

GGAT

5 Sequence of the E2BS PCR fragment after bisulfite convertion of methylated DNA:

AATAATTTATGTATAAAATTAAGGGCGTAATCGAAATCGGTTGAATCGAAAT CGGTTAGTATAAAAGTAGATATTTTATGTATTAAAAGAGAATTGTAATGTTTT AGGA

6 Primer LCR.02_For: 5 ' - ATTTTAGTTTATATATGAATTGTGTAAAGG-3 ' (SEQ ID NO:6)

Primer LCR.02_Rev: 5 ' -CTAAAACATTACAATTCTCTTTTAATACAT-3 '

7

E2BS sequence from pLCR.02 0/5 corresponding to unmethylated HPV16 DNA

8

AATAATTTATGTATAAAATTAAGGGTGTAATTGAAATTGGTTGAATTGAAATTGGTTAGT ATAAAAGTAGATATTTTATGTATTAAAAGAGAATTGTAATGTTTTAG

E2BS sequence from pLCR.02 5/5 corresponding to fully methylated HPV16 DNA

9

AATAATTTATGTATAAAATTAAGGGCGTAATCGAAATCGGTTGAATCGAAATCGGTTAGT ATAAAAGTAGATATTTTATGTATTAAAAGAGAATTGTAATGTTTTAG

E2BS sequence from pLCR.02 corresponding to partially methylated HPV16 DNA

10

- pLCR.02 2/5: two methylated CpG

AATAATTTATGTATAAAATTAAGGGTGTAATTGAAATCGGTTGAATCGAAATTGGTTAGT ATAAAAGTAGATATTTTATGTATTAAAAGAGAATTGTAATGTTTTAG

11 - pLCR.02 3/5: three methylated CpG

AATAATTTATGTATAAAATTAAGGGCGTAATCGAAATCGGTTGAATTGAAATTGGTTAGT ATAAAAGTAGATATTTTATGTATTAAAAGAGAATTGTAATGTTTTAG

12 three methylated CpG

AATAATTTATGTATAAAATTAAGGGTGTAATTGAAATCGGTTGAATCGAAATCGGTTAGT ATAAAAGTAGATATTTTATGTATTAAAAGAGAATTGTAATGTTTTAG

- pLCR.02 4/5: four methylated CpG

13

AATAATTTATGTATAAAATTAAGGGCGTAATCGAAATCGGTTGAATCGAAATTGGTTAGT ATAAAAGTAGATATTTTATGTATTAAAAGAGAATTGTAATGTTTTAG

14 four methylated CpG

AATAATTTATGTATAAAATTAAGGGCGTAATTGAAATCGGTTGAATCGAAATCGGTTAGT ATAAAAGTAGATATTTTATGTATTAAAAGAGAATTGTAATGTTTTAG

15 four methylated CpG

AATAATTTATGTATAAAATTAAGGGCGTAATCGAAATTGGTTGAATCGAAATCGGTTAGT ATAAAAGTAGATATTTTATGTATTAAAAGAGAATTGTAATGTTTTAG

References:

Throughout this application, various references describe the state of the art to which this invention pertains.

Bosch FX, Manos MM, Munoz N, et al. Prevalence of human papillomavirus in cervical cancer: a worldwide perspective. International biological study on cervical cancer (IBSCC) Study Group. J Natl Cancer Inst 1995, 87, 796-802. Dalstein V, Riethmuller D, Pretet JL, et al. Persistence and load of high-risk HPV are predictors for development of high-grade cervical lesions: A longitudinal French cohort study. Int J Cancer 2003, 106, 396-403.

Jacquin E, Morel A, Valmary-Degano S, Monnien F, Ramanah R, Carcopino X, Saunier M, Bravo I, Mougin C, Pretet JL. Specific methylation of HPV16 promoter region in cervical cancer samples determined with HRM PCR method. J Clin Microbiol, Published ahead of print 17 July 2013, doi: 10.1128/JCM.01106-13

Mayrand MH, Duarte-Franco E, Rodrigues I, Walter SD, Hanley J, Ferenczy A, et al. Human papillomavirus DNA versus Papanicolaou screening tests for cervical cancer. N Engl J Med 2007;357: 1579-88.

Monnier-Benoit, S., Dalstein, V., Riethmuller, D., Lalaoui, N., Mougin, C. &Pretet, J. L.

(2006).Dynamics of HPV16 DNA load reflect the natural history of cervical HPV-associated lesions. J ClinVirol 35, 270-7.

Naucler P, Ryd W, Tornberg S, Strand A, Wadell G, Elfgren K, et al. Human papillomavirus and Papanicolaou tests to screen for cervical cancer. N Engl J Med 2007;357: 1589-97.

Riethmuller D, Ramanah R, Pretet JL, Mougin C. Integrating HPV testing for primary screening? J

GynecolObstetBiolReprod (Paris) 2008;37(Suppl. 1):S 139-51.

de RodaHusman et al, The use of general primers GP5 and GP6 elongated at their 3' ends with adhacent highly conserved sequences improves human papillomavirus detection by PCR. J Gen Virol. 1995. Apr 76 (Pt 4): 1057-1062

Ronco G, Giorgi-Rossi P, Carozzi F, Confortini M, Dalla Palma P, Del Mistro A, et al. Efficacy of human papillomavirus testing for the detection of invasive cervical cancers and cervical intraepithelial neoplasia: a randomised controlled trial. Lancet Oncol 2010; 11 :249-57.

Saunier M, Monnier-Benoit S, Mauny F, Dalstein V, Briolat J, Riethmuller D, Kantelip B, Schwarz E, Mougin C, Pretet JL. HPV16 DNA load and physical state allow the identification of HPV16 infected women with high-grade lesions or cervical carcinoma. J ClinMicrobiol. 2008, 46, 3678-

3685

Walboomers JM, Jacobs MV, Manos MM, et al. Human papillomavirus is a necessary cause of invasive cervical cancer worldwide. J Pathol 1999, 189, 12-19.

Wallin KL, Wiklund F, Angstrom T, et al. Type-specific persistence of human papillomavirus DNA before the development of invasive cervical cancer. N Engl J Med 1999, 341, 1633-1638.

Claims

An in vitro method for predicting the presence of HPV-induced invasive cancer in a subject, said method comprising:

a. providing a clinical sample susceptible to contain HPV-induced lesions, previously collected from the subject;

b. extracting DNA of said clinical sample;

c. treating said DNA with bisulfite for conversion of unmethylated cytosine;

d. amplifying at least one target region, using said bisulfite treated DNA as a template, said target region comprising at least 4 methylation sites in Long Control Region (LCR) of HPV types associated to HPV-induced invasive cancer,

e. subjecting said amplified target region to methylation-sensitive high resolution melting analysis and obtaining high-resolution melt curve specific of said amplified target region,

f. comparing said high-resolution melt curve specific of said amplified target region obtained at step e. with one or more high-resolution melt curves specific of control DNA appropriate for deriving the corresponding methylation status of said amplified target region, thereby predicting the presence of HPV-induced cancerous lesions depending on the corresponding methylation status,

g. optionally, determining the methylation pattern of said amplified target region by DNA sequencing and thereby confirming the prediction of step g.

The method according to Claim 1, wherein said clinical sample is obtained from cervical or anal scrapings.

The method according to Claim 1 or 2, wherein said clinical sample is selected among those containing human papillomavirus DNA.

The method according to any one of Claims 1 to 3, wherein said clinical sample is selected from subject diagnosed to be infected persistently with HPV, preferably HPV16, HPV18, HPV45, HPV31 and HPV33.

5. The method according to any one of Claims 1 to 4, wherein said HPV-type associated to HPV-induced invasive cancer is HPV 16.

6. The method according to any one of Claims 1 to 5, wherein, said target region contains E2- binding site of HPV16.

7. The method according to any one of Claims 1 to 6, wherein said target region contains at least 4, methylation sites contained in the E2-binding sites of HPV16, preferably the first and second E2 binding sites of HPV16 LCR comprising 4 methylation sites with corresponding cytosines at positions 26, 32, 38, 47 of SEQ ID NO: 1.

8. The method according to Claim 6 or 7, wherein said target region corresponds to the nucleotide sequence of SEQ ID NO:l.

9. The method according to Claim 8, wherein a pair of primers of SEQ ID NO:2 and SEQ ID NO:3 or their functional variants, is used to amplify said target region of SEQ ID NO: l.

10. The method according to any one of Claims 1 to 9, wherein said DNA amplification at step d. is performed by real-time PCR.

11. A diagnostic kit, for predicting the presence of HPV-induced invasive cancer in a subject, according to a method as claimed in any one of Claims 1 to 10, said kit comprising:

a. a pair of primers for amplification of a target region in LCR of HPV comprising at least 4 methylation sites, and, optionally, reagents for DNA amplification, b. standardized DNA,

c. optionally, control DNA template for MS-HRM analysis, with known methylation profile, and,

d. optionally, instruction for carrying out PCR amplification.

12. The diagnostic kit according to Claim 11, wherein said target region is a region comprising at least 4 methylation sites in Long Control Region (LCR) of HPV types associated to HPV- induced invasive cancer, for example in the E2-binding sites region.

13. The diagnostic kit according to any one of Claims 11 to 12, wherein said target region is a nucleotide sequence of SEQ ID NO:l.

14. The diagnostic kit according to any one of Claims 10 to 12, wherein said pair of primers essentially consists in SEQ ID NO:2 and SEQ ID NO:3 and their functional variants capable of amplifying the target region corresponding to SEQ ID NO: l. The diagnostic kit according to any one of Claims 12 to 14, wherein said control DNA templates for MS-HRM analysis, comprises one or more of the following controls:

a. Negative control of SEQ ID NO: 8,

b. Control for 100% methylation of SEQ ID NO:9,

c. Mixes of SEQ ID NO:8 and SEQ ID NO:9, and/or,

d. Any one of SEQ ID NO:10-15.