WO2014038888A1 - Protéine de fusion comprenant ros1 et composition de traitement du cancer la comprenant - Google Patents

Protéine de fusion comprenant ros1 et composition de traitement du cancer la comprenant Download PDF

Info

Publication number
WO2014038888A1
WO2014038888A1 PCT/KR2013/008071 KR2013008071W WO2014038888A1 WO 2014038888 A1 WO2014038888 A1 WO 2014038888A1 KR 2013008071 W KR2013008071 W KR 2013008071W WO 2014038888 A1 WO2014038888 A1 WO 2014038888A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
fragment
fusion
seq
fusion protein
Prior art date
Application number
PCT/KR2013/008071
Other languages
English (en)
Korean (ko)
Inventor
서정선
김영태
주영석
김은희
강진형
Original Assignee
주식회사 마크로젠
서울대학교산학협력단
가톨릭대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 마크로젠, 서울대학교산학협력단, 가톨릭대학교 산학협력단 filed Critical 주식회사 마크로젠
Publication of WO2014038888A1 publication Critical patent/WO2014038888A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/71—Receptors; Cell surface antigens; Cell surface determinants for growth factors; for growth regulators
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K19/00—Hybrid peptides, i.e. peptides covalently bound to nucleic acids, or non-covalently bound protein-protein complexes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/15—Medicinal preparations ; Physical properties thereof, e.g. dissolubility
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57423—Specifically defined cancers of lung
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/112—Disease subtyping, staging or classification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Definitions

  • a fusion protein comprising a ROS1 protein or fragment thereof as a diagnostic marker for cancer and / or as a therapeutic target, comprising: a fusion protein of coiled-coil domain containing 6 (CCCC6) and receptor tyrosine kinase 1 (ROS1), the fusion protein
  • CCCC6 coiled-coil domain containing 6
  • ROS1 receptor tyrosine kinase 1
  • Lung cancer is one of the most common cancers in humans and is the leading cause of cancer-related deaths worldwide. Although low-dose computed tomography screening techniques have increased the initial diagnosis rate, lung cancer is still a fatal disease with a very poor prognosis. Lung cancer can be classified from histopathological point of view as follows: Lung adenocarcinoma is the most common type that frequently occurs in nonsmokers or small smokers and female patients. Over the past decade, lung adenocarcinoma has been central to lung cancer research, and understanding of lung adenocarcinoma in the present invention has advanced in all aspects, including pathology, molecular biology, genetics, radiology and clinical treatment.
  • gefitinib an epidermal growth factor (EGFR ) tyrosine kinase inhibitor
  • EGFR epidermal growth factor
  • Crizotinib a dual inhibitor against anaplastic lymphoma kinase ( ALK ) and MET tyrosine kinase, has been shown to be effective in lung cancer patients containing the ALK fusion gene. From these pivotal studies, treatment strategies for lung adenocarcinoma are shifting from tissue-based approaches to key mutation-related therapies.
  • the present inventors hereby fused all or part of a receptor tyrosine kinase 1 (ROS1) with a specific fusion partner, such as all or part of a coiled-coil domain containing 6 (CCCC6), specifically in human solid tumors, particularly lung cancer.
  • ROS1 receptor tyrosine kinase 1
  • CCCC6 coiled-coil domain containing 6
  • one embodiment of the present invention provides a fusion protein of CCDC6 (coiled-coil domain containing 6) or a fragment thereof and receptor tyrosine kinase 1 (ROS1) or a fragment thereof.
  • CCDC6 coil-coil domain containing 6
  • ROS1 receptor tyrosine kinase 1
  • Another example provides a fusion gene encoding the fusion protein.
  • the fusion protein or fusion gene can be used as a cancer diagnostic marker.
  • Another example provides a pharmaceutical composition for diagnosing cancer comprising the fusion protein and / or a fusion gene encoding the fusion protein and / or a substance which interacts with mRNA corresponding to the fusion gene.
  • Another example is a method for cancer diagnosis or cancer diagnosis comprising detecting the fusion protein and / or a fusion gene encoding the fusion protein and / or mRNA corresponding to the fusion gene in a biological sample obtained from a patient.
  • a method for cancer diagnosis or cancer diagnosis comprising detecting the fusion protein and / or a fusion gene encoding the fusion protein and / or mRNA corresponding to the fusion gene in a biological sample obtained from a patient.
  • Another example provides a pharmaceutical composition for preventing and / or treating cancer comprising the fusion protein inhibitor and / or an inhibitor of a fusion gene encoding the fusion protein as an active ingredient.
  • Another example provides a method of preventing or treating cancer, comprising administering the fusion protein inhibitor and / or an inhibitor of a fusion gene encoding the fusion protein to a patient in need thereof.
  • Another example provides the use for the prevention or treatment of cancer of a composition comprising said fusion protein inhibitor and / or an inhibitor of a fusion gene encoding said fusion protein.
  • Another example includes processing a candidate to a cell expressing the fusion protein to determine the level of fusion protein expression, wherein the fusion protein is compared with cells that have not been treated before or with the candidate.
  • the candidate substance is selected as an anticancer agent.
  • RNA sequencing is one of the most effective means to understand the overall genetic basis of cancer, including gene expression, point mutations, fusion genes, and alternative splicing.
  • lung cancer which is a representative solid cancer.
  • Analysis by transcriptome sequencing in combination with whole-exome sequencing (n 76) confirmed the fusion protein specific for lung cancer to complete the present invention.
  • Transcript sequencing is a suitable method for detecting key mutations in cancer because it can test for aberrant RNA variants such as fusion genes and alternative splicing as well as somatic point mutations.
  • the present invention is the first large-scale lung adenocarcinoma study using RNA sequencing.
  • transcriptomes of 87 surgical specimens obtained from Korean patients were analyzed in combination with exome and RNA sequencing results of 77 contiguous normal tissues.
  • the gene expression profile shows stronger perturbation in cancer tissues obtained from smokers.
  • somatic mutations in transforming genes such as EGFR , KRAS , NRAS , BRAF , PIK3CA, MET and CTNNB1 were identified.
  • the frequency of EGFR mutations was extremely high ( ⁇ 60%) in Korean patients, which can be explained by the haplotype of EGFR , which predominates in Asians.
  • chimeric transcripts including ALK , RET , ROS1 and other tyrosine kinase genes (such as FGFR2 , PDGFRA and AXL ), which are very likely to be key driver mutations in lung cancer. Seems to be.
  • the findings indicate that surgical specimens of cancer (eg, non-small cell lung cancer, NSCLC) patients are not found in surrounding normal tissue samples within the same tissue as the surgical specimen but are the same chromosomes or different chromosomes that are specifically expressed in cancer tissue. It was confirmed that there is a fusion gene in which two genes located at the fusion gene and / or a fusion protein generated by the fusion gene is expressed.
  • cancer eg, non-small cell lung cancer, NSCLC
  • Fusion genes specifically present in cancer tissues identified in the present invention are summarized in Table 1 below:
  • the fusion genes listed in Table 1 have been found to be specifically observed in cancer tissues, the fusion genes and / or the fusion proteins are useful as biomarkers for cancer diagnosis and targets for cancer treatment.
  • a CCDC6-ROS1 fusion protein in which a CCDC6 protein or a fragment thereof and a ROS1 protein or a fragment thereof are fused;
  • FGFR2-CIT fusion proteins in which the FGFR2 protein or fragment thereof and the CIT protein or fragment thereof are fused;
  • An AXL-MBIP fusion protein in which an AXL protein or a fragment thereof and a MBIP protein or a fragment thereof are fused;
  • APLP2-TNFSF11 fusion protein wherein the APLP2 protein or fragment thereof and the TNFSF11 protein or fragment thereof are fused;
  • MAP4K3-PRKCE fusion protein in which MAP4K3 protein or fragment thereof and PRKCE protein or fragment thereof are fused
  • BCAS3-MAP3K3 fusion protein wherein the BCAS3 protein or fragment thereof and the MAP3K3 protein or fragment thereof are fused
  • KRAS-CDH13 fusion protein in which KRAS protein or fragment thereof and CDH13 protein or fragment thereof are fused
  • ZFYVE9-CGA fusion proteins in which a ZFYVE9 protein or fragment thereof and a CGA protein or fragment thereof are fused;
  • ERBB2IP-MAST4 fusion protein wherein the ERBB2IP protein or fragment thereof and the MAST4 protein or fragment thereof are fused
  • a TPD52L1-TRMT11 fusion protein in which a TPD52L1 protein or a fragment thereof and a TRMT11 protein or a fragment thereof are fused;
  • TXNRD1-GPR133 fusion protein in which TXNRD1 protein or fragment thereof and GPR133 protein or fragment thereof are fused
  • fusion proteins selected from the group consisting of:
  • Another example provides a fusion gene (polynucleotide molecule) encoding the fusion protein.
  • the fusion protein and / or a fusion gene encoding the same may be usefully used as a diagnostic marker of cancer.
  • Break points (or fusion sites) of protein fragments that are fusion partners herein are described based on the exon of the gene encoding them, and the N-terminus (for C-terminal fusion partners) or C of the fragment.
  • the cleavage at any of the intron sites between the end of the end (in the case of an N-terminal fusion partner) and the exon that is cleaved and removed does not affect the amino acid sequence of the protein fragment being encoded, so the actual cleavage point May be any point of the intron portion.
  • the CCDC6 gene which encodes a coiled-coil domain containing 6 (CCDC6) protein, may be from human and is located on human chromosome 10 (q21.2), where the CCDC6 protein encoded is a protein with a total amino acid length of 474aa. to be.
  • the CCDC6 protein or fragment of CCDC6 protein is the N-terminal fusion partner of the CCDC6-ROS1 fusion protein.
  • the CCDC6 gene is GenBank accession no. It may have a nucleotide sequence provided to NM_005436, CCDC6 protein may be a protein having an amino acid sequence encoded by NM_005436.
  • the fragment of the CCDC6 protein is an amino acid encoded by the nucleotide sequence from the first exon of NM_005436 to exon 5 (the 61572393-61572553 base site based on the position ((-) strand) on chromosome 10). It may have a sequence, it may be a form in which one nucleotide (c) that does not form a codon at the 3 'end of exon 5 is present.
  • the genes encoding fragments of the CCDC6 protein and the CCDC6 protein encoded therefrom are summarized in Tables 2 and 3 below:
  • the ROS1 gene which encodes a receptor tyrosine kinase 1 (ROS1) protein, may be from human and is located on human chromosome 6 (q22.1), and the ROS1 protein encoded therefrom is a protein having a total amino acid length of 2347aa.
  • the ROS1 protein or fragment of ROS1 protein is the C-terminal fusion partner of the CCDC6-ROS1 fusion protein.
  • the ROS1 gene is GenBank accession no. It may have a nucleotide sequence provided to NM_002944, the ROS1 protein may be a protein having an amino acid sequence encoded by NM_002944.
  • the fragment of the ROS1 protein may have an amino acid sequence encoded by the nucleotide sequence from exon 35 of NM_002944 (117642422-117642557 base site based on the position ((-) strand) on chromosome 6) to the last exon.
  • the first two nucleotides (tc) starting at the 5 'end of exon 35 may be in a codon-free form, and further included in the fragment of the CCDC6 protein as described above upon fusion with the fragment of the CCDC6 protein. It is linked to one nucleotide (c) to form a codon (ctc) to encode one amino acid (L).
  • Tables 4 and 5 summarized in Tables 4 and 5 below:
  • Table 4 Gene encoding a fragment of ROS1 protein ROS1 gene (Accession No.) Coding Site-CDS of the ROS1 Protein Coding site of ROS1 protein fragment: exon criteria Coding site of ROS1 protein fragment: cDNA criteria Break-point location on chromosome Break-point site sequence NM_002944 200-7243 (7044 bp) (SEQ ID NO: 7) Exxon 35-site to last exon 5841 ⁇ 7243 (2nt (tc) + 1401bp; 1403bp total) (SEQ ID NO: 8) chr6: 117642557] (5 'end of exon 35) tctggcatagaagatta (SEQ ID NO: 9)
  • the fusion gene (CCDC6-ROS1 fusion gene) encoding the 'CCDC6 protein or a fragment thereof and the CCDC6-ROS1 fusion protein in which the ROS1 protein or a fragment thereof is fused' (CCDC6-ROS1 fusion gene) has a CCDC6 protein or a fragment thereof as described above at the 5'-end. It may comprise a polynucleotide molecule encoding and a polynucleotide molecule encoding a ROS1 protein or fragment thereof as described above at the 3'-end.
  • the CCDC6-ROS1 fusion gene may be a fusion gene in which the nucleotide sequence of the first exon of NM_005436 to exon 5 at the 5 'end and the nucleotide sequence of the exon 35 to the last exon of NM_002944 at the 3' end are linked.
  • the CCDC6-ROS1 fusion gene has a 233th to 1079th nucleotide sequence (SEQ ID NO: 2) of NM_005436 at the 5 'end, and the 5841th to 7243th nucleotide sequence of NM_002944 at the 3' end (SEQ ID NO: 8) may be a linked fusion gene (SEQ ID NO: 13; fusion site: SEQ ID NO: 14).
  • the CCDC6-ROS1 fusion protein is a fusion protein in which the CCDC6 protein or fragment as described above at the N-terminus and the ROS1 protein or fragment as described above at the C-terminus are linked, for example, exon at the first exon of NM_005436 at the 5 'end.
  • the FGFR2 gene which encodes a fibroblast growth factor receptor 2 (FGFR2) protein, may be from human and is located on human chromosome 10 (q26.13), where the FGFR2 protein is a protein encoded therefrom.
  • the FGFR2 protein or fragment of FGFR2 protein is the N-terminal fusion partner of the FGFR2-CIT fusion protein.
  • the FGFR2 gene is GenBank accession no.
  • NM_001144914, NM_001144916, NM_001144915, NM_001144917, NM_001144918, NM_022970, NM_000141, NM_001144913, NM_001144919, etc. may have the nucleotide sequence provided, and the FGFR2 protein may be encoded by any of these nucleotide sequences.
  • the fragment of the FGFR2 protein comprises an amino acid sequence encoded by the nucleotide sequence from the first exon of the nucleotide sequence to exon 19 (123243212-123243317 base site relative to the position ((-) strand) on chromosome 10). It may be to have.
  • the genes encoding fragments of the FGFR2 protein and the FGFR2 protein encoded therefrom are summarized in Tables 6 and 7:
  • the CIT gene encoding the CIT [citron (rho-interacting, serine / threonine kinase 21)] protein may be of human origin and is located on human chromosome 12 (q24.23), the length of which is encoded by the CIT protein. Protein of 2027aa.
  • the CIT protein or fragment of CIT protein is the C-terminal fusion partner of the FGFR2-CIT fusion protein.
  • the CIT gene is GenBank accession no. It may have a nucleotide sequence provided in NM_007174, the CIT protein may be a protein having an amino acid sequence encoded by the nucleotide sequence.
  • the fragment of the CIT protein may have an amino acid sequence encoded by the nucleotide sequence from exon 24 of the nucleotide sequence (120180216-12018026 base site relative to the position ((-) strand) on chromosome 12) to the last exon.
  • the genes encoding fragments of the CIT protein and the CIT protein encoded therefrom are summarized in Tables 8 and 9 below:
  • the fusion gene encoding the FGFR2-CIT fusion protein in which the FGFR2 protein or fragment thereof and the CIT protein or fragment thereof is fused is a FGFR2 protein or fragment thereof as described above at the 5'-end.
  • the FGFR2-CIT fusion gene has the N_0017 terminal of NM_001144914, NM_001144916, NM_001144915, NM_001144917, NM_001144918, NM_022970, NM_000141, NM_001144913, or NM_001144919 at the 5 'end of the nucleotide to the N' nucleotide end 3 to the exon 19 It may be a fusion gene with nucleotide sequences linked from exon 24 to the last exon.
  • the FGFR2-CIT fusion gene has a 151 th to 2115 th nucleotide sequence (SEQ ID NO: 18) of NM_001144914 at the 5 'end and a 2835 th-6140 th nucleotide sequence (SEQ ID NO: 24) of NM_007174 at the 3' end.
  • This linked fusion gene (SEQ ID NO: 29; fusion site: SEQ ID NO: 30) (see 23a and 23b).
  • the FGFR2-CIT fusion protein is a fusion protein in which the FGFR2 protein or fragment as described above at the N-terminus and the CIT protein or fragment as described above at the C-terminus are linked, for example, NM_001144914, NM_001144916, NM_001144916, NM_001144915, The nucleotide sequence from NM_001144917, NM_001144918, NM_022970, NM_000141, NM_001144913, or NM_001144919, the first exon to exon 19 and the amino acid sequence encoded by the fusion gene to which the nucleotide sequence from the exon 24 to the last exon of NM_007174 is linked to the 3 'end.
  • the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 29 (SEQ ID NO: 31; fusion region: SEQ ID NO: 32) or at least 90%, specifically 95% or more, more specifically 99 It may be a polypeptide molecule having at least% sequence homology.
  • the AXL gene encoding AXL receptor tyrosine kinase (AXL) protein may be from human and is located on chromosome 19 (q13.2) of human, and the AXL protein is encoded from the AXL gene.
  • the AXL protein or fragment of AXL protein is the N-terminal fusion partner of the AXL-MBIP fusion protein.
  • the AXL gene is GenBank accession no. It may have a nucleotide sequence provided in NM_021913, NM_001699 and the like, AXL protein may be a protein having an amino acid sequence encoded by NM_021913, NM_001699 and the like.
  • the fragment of the AXL protein is encoded by the nucleotide sequence from the first exon of the nucleotide sequence to the 244th nucleotide in exon 20 (a 41765458-41767670 base site based on the position ((+) strand) on chromosome 19). It may have an amino acid sequence.
  • the genes encoding fragments of the AXL protein and the AXL protein encoded therefrom are summarized in Tables 10 and 11 below:
  • the MBIP gene encoding the MBIP (MAP3K12 binding inhibitory protein 1) protein may be from human and is located on human chromosome 14 (q13.3), where the MBIP protein is encoded from the MBIP gene.
  • the MBIP protein or fragment of MBIP protein is the C-terminal fusion partner of the AXL-MBIP fusion protein.
  • the MBIP gene is GenBank accession no. It may have a nucleotide sequence provided in NM_016586, NM_001144891 and the like, MBIP protein may be a protein having an amino acid sequence encoded by NM_016586, NM_001144891 and the like.
  • the fragment of the MBIP protein may have an amino acid sequence encoded by exon 4 of the nucleotide sequence (36783718-36783814 base site based on the position ((-) strand) on chromosome 14) to the last nucleotide sequence.
  • genes encoding fragments of the MBIP protein and MBIP proteins encoded therefrom are summarized in Tables 12 and 13 below:
  • Table 12 Genes Encoding Fragments of MBIP Proteins MBIP gene (Accession No.) Coding Site-CDS of MBIP Protein Coding Sites of MBIP Protein Fragments: Exon Criteria Coding Sites of MBIP Protein Fragments: cDNA Criteria Break-point location on chromosome Break-point site sequence NM_016586 89-1123 (1035 bp) (SEQ ID NO: 39) Site from exon 4 to last exon 563-1123 (561 bp) (SEQ ID NO: 40) chr14: 36783814] (5 'terminus of exon 4) attgacagacgaata (SEQ ID NO: 41) NM_001144891 89-1120 (1032 bp) 563-1120 (558 bp)
  • the fusion gene (AXL-MBIP fusion gene) encoding the AXL protein or fragment thereof and the MBL protein or fragment thereof fused to the AXL protein (AXL-MBIP fusion gene) may be used as the AXL protein or fragment thereof as described above at the 5'-end.
  • the AXL-MBIP fusion gene has a nucleotide sequence from the first exon of NM_021913, NM_001699 to the 5 'end to the 244th nucleotide of Exon 20 and the nucleotides of the exon 4 to the last exon of NM_016586, NM_001144891 to the 3' end
  • the sequence may be a linked fusion gene.
  • the AXL-MBIP fusion gene has a nucleotide sequence of 191 to 2767th (SEQ ID NO: 34) of NM_021913 at the 5 'end and a 563th to 1123th nucleotide sequence of NM_016586 at the 3' end (SEQ ID NO: 40) may be linked to a fusion gene (SEQ ID NO: 45; fusion site: SEQ ID NO: 46).
  • the AXL-MBIP fusion protein is an AXL protein or fragment as described above at the N-terminus and a MBIP protein or fragment as described above at the C-terminus, for example, NM_021913, NM_001699, etc. at the 5 'end.
  • the APLP2 gene encoding APLP2 (amyloid beta (A4) precursor-like protein 2) protein may be from human and is located on human chromosome 11 (q24.3), which is a protein encoded therefrom.
  • the APLP2 protein or fragment of APLP2 protein is the N-terminal fusion partner of the APLP2-TNFSF11 fusion protein.
  • the APLP2 gene is GenBank accession no.
  • APLP2 protein may be a protein having an amino acid sequence encoded by any one of these nucleotide sequences.
  • the fragment of the APLP2 protein comprises an amino acid sequence encoded by the nucleotide sequence from the first exon of the nucleotide sequence to exon 12 (129999933-130000061 base site relative to the position ((+) strand) on chromosome 11). It may be to have.
  • the genes encoding fragments of the APLP2 protein and the APLP2 protein encoded therefrom are summarized in Tables 14 and 15 below:
  • Table 14 Genes Encoding Fragments of the APLP2 Protein APLP2 gene (Accession No.) Coding Site-CDS of the APLP2 Protein Coding site for APLP2 protein fragment: exon criteria Coding site for the APLP2 protein fragment: cDNA criteria Break-point location on chromosome Break-point site sequence NM_001642 158-2449 (2292 bp) (SEQ ID NO 49) First exon to exon 12 158-1741 (1584 bp) (SEQ ID NO: 50) chr11: 130000061] (3 'end of exon 12) gcggcccagatgaaatcccag (SEQ ID NO: 51) NM_001142276 158-2413 (2256 bp) 158-1741 (1584 bp) NM_001142278 158 ⁇ 1726 (1569 bp) 158 ⁇ 1054 (896 bp) NM_001142277 158-2245 (2088 bp) 158-1573 (
  • the TNFSF11 gene which encodes a TNFSF11 (tumor necrosis factor (ligand) superfamily, member 11) protein, may be of human origin and is located on human chromosome 13 (q14.11), which is a protein encoded therefrom.
  • the TNFSF11 protein or fragment of TNFSF11 protein is the C-terminal fusion partner of the APLP2-TNFSF11 fusion protein.
  • the TNFSF11 gene is GenBank accession no. It may have a nucleotide sequence provided in NM_033012, NM_003701, etc., TNFSF11 protein may be a protein having an amino acid sequence encoded by any one of these nucleotide sequences.
  • the fragment of the TNFSF11 protein may have an amino acid sequence encoded by the nucleotide sequence from exon 6 (43174888-43174933 base site based on the position ((+) strand) on chromosome 13) to the last exon of the nucleotide sequence.
  • the genes encoding fragments of the TNFSF11 protein and the TNFSF11 protein encoded therefrom are summarized in Tables 16 and 17 below:
  • Table 16 Genes Encoding Fragments of the TNFSF11 Protein TNFSF11 Gene (Accession No.) Coding Site-CDS of the TNFSF11 Protein Coding site for TNFSF11 protein fragment: exon criteria Coding site for TNFSF11 protein fragment: cDNA criteria Break-point location on chromosome Break-point site sequence NM_033012 530-1264 (735 bp) (SEQ ID NO 55) Site from exon 6 to last exon 698-1264 (567 bp) (SEQ ID NO: 56) chr13: [43174888 (5 'terminus of exon 6) gaattacaacatatcgttgga (SEQ ID NO: 57) NM_003701 150-1122 (973 bp) 537-2198 (1662 bp)
  • TNFSF11 Protein TNFSF11 Gene (Accession No.) Full size (aa) of TNFSF11 protein TNFSF11 protein fragment site Breakpoint site amino acid sequence NM_033012 244aa (SEQ ID NO: 58) 57-244aa (188aa) (SEQ ID NO: 59) ELQHIVG (SEQ ID NO: 60) NM_003701 315aa 130-315 (186aa)
  • the fusion gene encoding the APLP2-TNFSF11 fusion protein in which the APLP2 protein or a fragment thereof and the TNFSF11 protein or a fragment thereof is fused has an APLP2 protein or a fragment thereof as described above at the 5'-end.
  • the APLP2-TNFSF11 fusion gene has a nucleotide sequence from exon 12 to exon 12 at the first exon of NM_001642, NM_001142276, NM_001142278, NM_001142277, NR_024516, NR_024515, etc. It may be a fusion gene to which the nucleotide sequence is linked up to the last exon.
  • the APLP2-TNFSF11 fusion gene has a nucleotide sequence of 158th to 1741th of NM_001642 at the 5 'end (SEQ ID NO: 50) and a nucleotide sequence of 698th to 1264th of NM_033012 at the 3' end. 56) may be linked to a fusion gene (SEQ ID NO: 61; fusion site: SEQ ID NO: 62).
  • the APLP2-TNFSF11 fusion protein is a fusion protein in which the APLP2 protein or fragment as described above at the N-terminus and the TNFSF11 protein or fragment as described above at the C-terminus is linked, for example, NM_001642, NM_001142276, NM_001142278, Nucleotide sequence from exon 12 to exon 12 at the first exon of NM_001142277, NR_024516, NR_024515 and the like, and an amino acid sequence encoded by a fusion gene linked to the nucleotide sequence from exon 6 to the last exon such as NM_033012, NM_003701 at the 3 'end,
  • the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 61 (SEQ ID NO: 63; fusion site: SEQ ID NO: 64) or at least 90%, specifically 95% or more, more specifically 99% or more sequence with said sequence It may be a polypeptid
  • the MAP4K3 gene which encodes a mitogen-activated protein kinase kinase kinase3 (MAP4K3) protein, may be from human and is located on human chromosome 2 (p22.1), from which the MAP4K3 protein encoded has a total amino acid length of 894aa. Phosphorus protein.
  • the MAP4K3 protein or fragment of MAP4K3 protein is the N-terminal fusion partner of the MAP4K3-PRKCE fusion protein.
  • the MAP4K3 gene is GenBank accession no. It may have a nucleotide sequence provided to NM_003618, MAP4K3 protein may be a protein having an amino acid sequence encoded by NM_003618.
  • the fragment of MAP4K3 protein may comprise an amino acid sequence encoded by the nucleotide sequence of exon 1 (39664033-39664219 base site relative to the position ((-) strand) on chromosome 2) of NM_003618.
  • the genes encoding fragments of the MAP4K3 protein and the MAP4K3 protein encoded therefrom are summarized in Tables 18 and 19 below:
  • Table 18 Gene encoding a fragment of the MAP4K3 protein MAP4K3 gene (Accession No.) Coding Site-CDS of MAP4K3 Protein Coding site of MAP4K3 protein fragment: exon criteria Coding site of MAP4K3 protein fragment: cDNA criteria Break-point location on chromosome Break-point site sequence NM_003618 326-3010 (2685 bp) (SEQ ID NO: 65) Exon 1 site 326-421 (96 bp) (SEQ ID NO: 66) chr2: [39664033 (3 'terminus of exon 1) acctacggcgacgtctacaag (SEQ ID NO: 67)
  • the PRKCE gene encoding PRKCE (protein kinase C, epsilon) protein may be from human and is located on human chromosome 2 (p21), and the PRKCE protein encoded therefrom is a protein having a total amino acid length of 737aa.
  • the PRKCE protein or fragment of PRKCE protein is the C-terminal fusion partner of the MAP4K3-PRKCE fusion protein.
  • the PRKCE gene is GenBank accession no. It may have a nucleotide sequence provided to NM_005400, the PRKCE protein may be a protein having an amino acid sequence encoded by NM_005400.
  • the fragment of PRKCE protein may be an amino acid sequence encoded by the nucleotide sequence from exon 2 (46070139-46070202 base site based on the position ((+) strand) on chromosome 2) of NM_005400 to the last exon.
  • the genes encoding fragments of the PRKCE protein and the PRKCE protein encoded therefrom are summarized in Tables 20 and 21 below:
  • PRKCE gene (Accession No.) Coding Site-CDS of PRKCE Protein Coding site of PRKCE protein fragment: exon criteria Coding site of PRKCE protein fragment: cDNA criteria Break-point location on chromosome Break-point site sequence NM_005400 198-2411 (2214 bp) (SEQ ID NO: 71) Exon 2-site to last exon 546-2411 (1866 bp) (SEQ ID NO: 72 chr2: [46070139 (5 'terminus of exon 2) attgatctggagccagaaggaaga (SEQ ID NO: 73)
  • the fusion gene encoding the MAP4K3-PRKCE fusion protein in which the MAP4K3 protein or fragment thereof and the PRKCE protein or fragment thereof is fused has a MAP4K3 protein or a fragment thereof as described above at the 5'-end. It may comprise a polynucleotide molecule encoding and a polynucleotide molecule encoding a PRKCE protein or fragment thereof as described above at the 3'-end.
  • the MAP4K3-PRKCE fusion gene may be a fusion gene in which the nucleotide sequence of exon 1 of NM_003618 is connected to the 5 'end and the nucleotide sequence is linked from exon 2 to the last exon of NM_005400 at the 3' end. More specifically, the MAP4K3-PRKCE fusion gene has a nucleotide sequence 326 to 421 of NM_003618 at the 5 'end (SEQ ID NO: 66) and a nucleotide sequence 546 to 2411 of NM_005400 at the 3' end. 72) may be a linked fusion gene (SEQ ID NO: 77; fusion site: SEQ ID NO: 78).
  • the MAP4K3-PRKCE fusion protein is a fusion protein in which the MAP4K3 protein or fragment as described above at the N-terminus and the PRKCE protein or fragment as described above at the C-terminus is linked to, for example, the nucleotide of exon 1 of NM_003618 at the 5 'end.
  • the amino acid sequence encoded by the fusion gene linked from the exon 2 to the last exon of NM_005400 at the 3 'end of the sequence and in one embodiment, the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 77 (SEQ ID NO: No. 79; a fusion site: SEQ ID NO: 80) or a polypeptide molecule having sequence homology with at least 90%, in particular at least 95%, more specifically with at least 99%.
  • the BCAS3 gene encoding BCAS3 (breast carcinoma amplified sequence3) protein may be from human and is located on human chromosome 17 (q23.2), which is a protein encoded therefrom.
  • the BCAS3 protein or fragment of BCAS3 protein is the N-terminal fusion partner of the BCAS3-MAP3K3 fusion protein.
  • the BCAS3 gene is GenBank accession no. It may have a nucleotide sequence provided in NM_017679, NM_001099432, etc., BCAS3 protein may be a protein having an amino acid sequence encoded by any one of these nucleotide sequences.
  • the fragment of the BCAS3 protein may have an amino acid sequence encoded by the nucleotide sequence from the first exon of the nucleotide sequence to exon 23 (59161828-59161925 base site based on the position ((+) strand) on chromosome 17). And one nucleotide (g) that does not form a codon at the 3 'end of exon 23 may be present.
  • the genes encoding fragments of the BCAS3 protein and the BCAS3 protein encoded therefrom are summarized in Tables 22 and 23 below:
  • BCAS3 Gene (Accession No.) Coding Site-CDS of BCAS3 Protein Coding site of BCAS3 protein fragment: exon criteria Coding site for BCAS3 protein fragment: cDNA criteria Break-point location on chromosome Break-point site sequence NM_001099432 110-2896 (2787 bp) (SEQ ID NO: 81) Site from first exon to exon 23 110 ⁇ 2579 (2469bp + 1nt (c); 2470bp total) (SEQ ID NO 82) chr17: 59161925] (3 'end of exon 23) acagtgattgatgctgcctcag (SEQ ID NO: 83) NM_017679 110-2851 (2742 bp) 110-2534 (2454 bp)
  • the MAP3K3 gene which encodes a mitogen activated protein kinase kinase3 (MAP3K3) protein, may be from human and is located on human chromosome 17 (q23.3), which is a protein encoded therefrom.
  • the MAP3K3 protein or fragment of MAP3K3 protein is the C-terminal fusion partner of the BCAS3-MAP3K3 fusion protein.
  • the MAP3K3 gene is GenBank accession no. It may have a nucleotide sequence provided in NM_002401, NM_203351, etc., MAP3K3 protein may be a protein having an amino acid sequence encoded by any one of these nucleotide sequences.
  • the fragment of MAP3K3 protein may have an amino acid sequence encoded by the nucleotide sequence from exon 2 of the nucleotide sequence (61710041-61710162 base site based on the position ((+) strand) on chromosome 17) to the last exon. .
  • the first two nucleotides (ac) starting at the 5 'end of exon 2 may be in a codon-free form, and are further included in the fragment of the BCAS3 protein as described above upon fusion with the fragment of the BCAS3 protein. It is linked to one nucleotide (g) to form a codon to encode one amino acid (D).
  • Tables 24 and 25 summarized in Tables 24 and 25 below:
  • Table 24 Gene encoding a fragment of the MAP3K3 protein MAP3K3 gene (Accession No.) Coding Site-CDS of MAP3K3 Protein Coding site of MAP3K3 protein fragment: exon criteria Coding site of MAP3K3 protein fragment: cDNA criteria Break-point location on chromosome Break-point site sequence NM_002401 320-2200 (1881 bp) (SEQ ID NO 87) Site from exon 2 to last exon 324-2200 (2nt (ac) + 1875bp; 1877bp total) (SEQ ID NO: 88) chr17: 61710041] (5 'terminus of exon 2) acgaacaggaggcattgaactca (SEQ ID NO: 89) NM_203351 320-2293 (1974 bp) 324-2293 (1970 bp)
  • Table 25 Fragment of MAP3K3 Protein MAP3K3 gene (Accession No.) Full size (aa) of MAP3K3 protein MAP3K3 protein fragment site Breakpoint site amino acid sequence NM_002401 626aa (SEQ ID NO: 90) 3aa-626aa (2nt (ac) + 3aa-626aa; total 624aa) (amino acid sequence: SEQ ID NO: 91) 2nt (ac) + EQEALNS (amino acid sequence: SEQ ID NO: 92) NM_203351 657aa 3 ⁇ 655aa
  • the fusion gene (BCAS3-MAP3K3 fusion gene) in which the 'BCAS3 protein or fragment thereof and the MAP3K3 protein or fragment thereof is fused' (BCAS3-MAP3K3 fusion gene) has a BCAS3 protein or a fragment thereof as described above at the 5'-end. It may comprise a polynucleotide molecule encoding and a polynucleotide molecule encoding a MAP3K3 protein or fragment thereof as described above at the 3'-terminus.
  • the BCAS3-MAP3K3 fusion gene is a fusion sequence of nucleotide sequences from the first exon, such as NM_017679, NM_001099432, to exon 23, at the 5 'end, and exon 2 to the last exon, such as NM_002401, NM_203351, at the 3' end. May be a gene.
  • the BCAS3-MAP3K3 fusion gene is the nucleotide sequence of the 110th to 2579th nucleotide sequence of NM_001099432 (SEQ ID NO: 82) at the 5 'end and the 324th to 2200th nucleotide sequence of NM_002401 at the 3' end (SEQ ID NO: 88) may be a linked fusion gene (SEQ ID NO: 93; fusion site: SEQ ID NO: 94).
  • the BCAS3-MAP3K3 fusion protein is a fusion protein in which the BCAS3 protein or fragment as described above at the N-terminus and the MAP3K3 protein or fragment as described above at the C-terminus is linked, for example, NM_017679, NM_001099432, etc. at the 5 'end.
  • SEQ ID NO: 93 Amino acid sequence encoded by the nucleotide sequence (SEQ ID NO: 95; fusion site: SEQ ID NO: 96) or a polypeptide molecule having at least 90%, specifically 95% or more, more specifically 99% or more sequence homology with the sequence Can be.
  • KRAS gene encoding KRAS (Ki-ras2 Kirsten rat sarcoma viral oncogene homolog) protein may be from human and is located on human chromosome 12 (p12.1), which is a protein encoded therefrom.
  • KRAS protein or fragment of KRAS protein is the N-terminal fusion partner of KRAS-CDH13 fusion protein.
  • the KRAS gene is GenBank accession no. It may have a nucleotide sequence provided in NM_004985, NM_033360, etc.
  • KRAS protein may be a protein having an amino acid sequence encoded by any one of these nucleotide sequences.
  • the fragment of the KRAS protein may have an amino acid sequence encoded by the nucleotide sequence from the first exon of the nucleotide sequence to exon 4 (base region 25378548-25378707 based on the position ((-) strand) on chromosome 11). have.
  • genes encoding fragments of the KRAS protein and KRAS proteins encoded therefrom are summarized in Tables 26 and 27 below:
  • the CDH13 gene encoding CDH13 (cadherin 13, H-cadherin) protein may be from human and is located on human chromosome 16 (q23.3), which is a protein encoded therefrom.
  • the CDH13 protein or fragment of CDH13 protein is the C-terminal fusion partner of the KRAS-CDH13 fusion protein.
  • the CDH13 gene is GenBank accession no. It may have a nucleotide sequence provided in NM_001257, the CDH13 protein may be a protein having an amino acid sequence encoded by this nucleotide sequence.
  • the fragment of the CDH13 protein may have an amino acid sequence that is encoded by the nucleotide sequence from exon 5 (83158990-83159106 base site based on the position ((+) strand) on chromosome 16) to the last exon of the nucleotide sequence.
  • the genes encoding fragments of the CDH13 protein and the CDH13 protein encoded therefrom are summarized in Tables 28 and 29 below:
  • Table 28 Genes Encoding Fragments of the CDH13 Protein CDH13 gene (Accession No.) Coding Site-CDS of the CDH13 Protein Coding site of the CDH13 protein fragment: exon criteria Coding site for the CDH13 protein fragment: cDNA criteria Break-point location on chromosome Break-point site sequence NM_001257 300-2441 (2142 bp) (SEQ ID NO: 103) Site from exon 5 to last exon 666 ⁇ 2441 (1776 bp) (SEQ ID NO: 104) chr16: [83158990 (5 'terminus of exon 5) gatatatttaaatttgcaaga (SEQ ID NO: 105)
  • the fusion gene encoding the KRAS-CDH13 fusion protein in which the KRAS protein or fragment thereof and the CDH13 protein or fragment thereof are fused is a KRAS protein or fragment thereof as described above at the 5'-end. It may comprise a polynucleotide molecule encoding and a polynucleotide molecule encoding a CDH13 protein or fragment thereof as described above at the 3'-terminus.
  • the KRAS-CDH13 fusion gene may be a fusion gene having a nucleotide sequence of NM_004985, NM_033360, etc., exon 4 at the 5 'end, and a nucleotide sequence connected from exon 5 to the last exon of NM_001257 at the 3' end. have.
  • the KRAS-CDH13 fusion gene is the 182th to 631th nucleotide sequence (SEQ ID NO: 98) of NM_004985 at the 5 'end and the 666th to 2441th nucleotide sequence of NM_001257 at the 3' end (SEQ ID NO: 104) may be linked to a fusion gene (SEQ ID NO: 109; fusion site: SEQ ID NO: 110).
  • the KRAS-CDH13 fusion protein is a fusion protein in which the KRAS protein or fragment as described above at the N-terminus and the CDH13 protein or fragment as described above at the C-terminus are linked, for example, NM_004985, NM_033360 at the 5 'end, A nucleotide sequence from exon to exon 4 and an amino acid sequence encoded by a fusion gene linked to the nucleotide sequence from exon 5 to the last exon of NM_001257 at the 3 'end; in an embodiment, to the nucleotide sequence of SEQ ID NO: 109 Amino acid sequence (SEQ ID NO: 111; fusion site: SEQ ID NO: 112) or a polypeptide molecule having at least 90%, specifically 95%, more specifically 99% or more sequence homology with the sequence.
  • the ZFYVE9 gene which encodes a ZFYVE9 (zinc finger, FYVE domain containing 9) protein, may be from human and is located on chromosome 1 (p32.3) of human, and the ZFYVE9 protein is a protein encoded therefrom.
  • the ZFYVE9 protein or fragment of ZFYVE9 protein is the N-terminal fusion partner of the ZFYVE9-CGA fusion protein.
  • the ZFYVE9 gene is GenBank accession no. It may have a nucleotide sequence provided in NM_007324, NM_004799, etc., ZFYVE9 protein may be a protein having an amino acid sequence encoded by any one of these nucleotide sequences.
  • the fragment of the ZFYVE9 protein may have an amino acid sequence encoded by the nucleotide sequence from the first exon of the nucleotide sequence to exon 16 (52803444-52803606 base site relative to the position ((+) strand) on chromosome 1). And two nucleotides (gg) which do not form a codon at the 3 'end of exon 16.
  • the genes encoding fragments of the ZFYVE9 protein and the ZFYVE9 protein encoded therefrom are summarized in Tables 30 and 31 below:
  • Table 30 Gene encoding a fragment of ZFYVE9 protein ZFYVE9 gene (Accession No.) Coding Site-CDS of ZFYVE9 Protein Coding site of ZFYVE9 protein fragment: exon criteria Coding site of ZFYVE9 protein fragment: cDNA criteria Break-point location on chromosome Break-point site sequence NM_007324 173-4273 (4101 bp) (SEQ ID NO: 113) Sites from the first exon to exon 16 173 ⁇ 3828 (3654bp + 2nt (gg); 3656bp total) (SEQ ID NO: 114) chr1: 52803606] (3 'terminus of exon 16) gacaagaacgttagcaaggg (SEQ ID NO: 115) NM_004799 173-444 (4278 bp) 173-4005 (3833 bp)
  • the CGA gene which encodes a glycoprotein hormones (alpha polypeptide) protein, may be of human origin and is located on human chromosome 6 (q14.3), which is a protein encoded therefrom.
  • the CGA protein or fragment of CGA protein is the C-terminal fusion partner of the ZFYVE9-CGA fusion protein.
  • the CGA gene is GenBank accession no. It may have a nucleotide sequence provided to NM_000735, and the CGA protein may be a protein having an amino acid sequence encoded by the nucleotide sequence.
  • the fragment of the CGA protein may have an amino acid sequence encoded by the nucleotide sequence from exon 2 (the 87797831-87797925 base site based on the position ((-) strand) on chromosome 6) to the last exon of the nucleotide sequence. .
  • the first nucleotide (g) starting at the 5 'end of exon 2 may be in a codon-free form, and further included in the fragment of the ZFYVE9 protein as described above upon fusion with the fragment of the ZFYVE9 protein. It is linked to two nucleotides (gg) to form a codon (ggg) to encode one amino acid (G).
  • Tables 32 and 33 the genes encoding fragments of the CGA proteins and the CGA proteins encoded therefrom are summarized in Tables 32 and 33 below:
  • the fusion gene (ZFYVE9-CGA fusion gene) encoding the 'ZFYVE9 protein or fragment thereof and the CGA protein or fragment thereof fused thereto' (ZFYVE9-CGA fusion gene) is a ZFYVE9 protein or fragment thereof as described above at the 5'-end.
  • the ZFYVE9-CGA fusion gene comprises a nucleotide sequence from the first exon to exon 16 at the 5 'end of NM_007324, NM_004799, etc.
  • the sequence may be a linked fusion gene. More specifically, the ZFYVE9-CGA fusion gene has a nucleotide sequence of 173 th to 3828 th NM_007324 (SEQ ID NO: 114) at the 5 'end and a 136 th to 493 nucleotide sequence of NM_000735 at the 3' end (SEQ ID NO: 120) may be linked to a fusion gene (SEQ ID NO: 124; fusion site: SEQ ID NO: 125).
  • the ZFYVE9-CGA fusion protein is a fusion protein in which the ZFYVE9 protein or fragment as described above at the N-terminus and the CGA protein or fragment as described above at the C-terminus are linked, for example, NM_007324, NM_004799, etc. at the 5 'end.
  • Nucleotide sequence from exon to exon 16 and 5UTR (7bp) of NM_000735 at the 3 'end and may have an amino acid sequence encoded by a fusion gene linked from the second exon to the last exon, in an embodiment, Amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 124 (SEQ ID NO: 126; fusion site: SEQ ID NO: 127) or at least 90%, specifically 95% or more, more specifically 99% or more of sequence homology with the sequence It may be a polypeptide molecule.
  • the ERBB2IP gene which encodes the erBB2 interacting protein (ERBB2IP) protein, may be from human and is located on human chromosome 5 (q12.3), which is a protein encoded therefrom.
  • the ERBB2IP protein or fragment of ERBB2IP protein is the N-terminal fusion partner of the ERBB2IP-MAST4 fusion protein.
  • the ERBB2IP gene is GenBank accession no. It may have a nucleotide sequence provided in NM_018695, NM_001006600 and the like, the ERBB2IP protein may be a protein having an amino acid sequence encoded by any one of these nucleotide sequences.
  • the fragment of ERBB2IP protein may have an amino acid sequence encoded by the nucleotide sequence from the first exon of the nucleotide sequence to exon 26 (65372703-65372777 base sites based on the position ((+) strand) on chromosome 5). have.
  • the genes encoding fragments of the ERBB2IP protein and the ERBB2IP protein encoded therefrom are summarized in Tables 34 and 35 below:
  • Table 34 Gene encoding a fragment of the ERBB2IP protein ERBB2IP gene (Accession No.) Coding Site-CDS of the ERBB2IP Protein Coding site of ERBB2IP protein fragment: exon criteria Coding site of ERBB2IP protein fragment: cDNA criteria Break-point location on chromosome Break-point site sequence NM_001006600 311-4219 (3909 bp) (SEQ ID NO: 128) Site from first exon to exon 26 311-4111 (3801 bp) (SEQ ID NO: 129) chr5: 65372777] (3 'end of exon 26) cagccaggtgataaaattattcag (SEQ ID NO: 130) NM_018695 311-4442 (4116 bp) 311-4318 (4008 bp)
  • the MAST4 gene which encodes a microtubule associated serine / threonine kinase family member4 (MAST4) protein, may be from human and is located on human chromosome 5 (q12.3), which is a protein encoded therefrom.
  • the MAST4 protein or fragment of MAST4 protein is the C-terminal fusion partner of the ERBB2IP-MAST4 fusion protein.
  • the MAST4 gene is GenBank accession no. It may have a nucleotide sequence provided in NM_001164664, NM_015183, etc., MAST4 protein may be a protein having an amino acid sequence encoded by any one of these nucleotide sequences.
  • the fragment of the MAST4 protein may have an amino acid sequence encoded by the nucleotide sequence from exon 13 (66400194-66400403 base region based on the position ((+) strand) on chromosome 5) to the last exon of the nucleotide sequence.
  • the genes encoding fragments of the MAST4 protein and the MAST4 protein encoded therefrom are summarized in Tables 36 and 37 below:
  • the fusion gene (ERBB2IP-MAST4 fusion gene) encoding the ERBB2IP protein or fragment thereof and the ASTBB2IP-MAST4 fusion protein in which the MAST4 protein or the fragment thereof is fused may have an ERBB2IP protein or a fragment thereof as described above at the 5'-end. It may comprise a polynucleotide molecule encoding and a polynucleotide molecule encoding a MAST4 protein or a fragment thereof as described above at the 3'-terminus.
  • the ERBB2IP-MAST4 fusion gene is a fusion sequence of nucleotide sequences from the first exon, such as NM_018695, NM_001006600, to exon 26 at the 5 'end, and exon 13 to the last exon from NM_001164664, NM_015183, etc. at the 3' end. May be a gene.
  • the ERBB2IP-MAST4 fusion gene has a nucleotide sequence of 311 th to 4111 th (SEQ ID NO: 129) of NM_001006600 at the 5 'end and a 1455 th to 8180 th nucleotide sequence of NM_001164664 at the 3' end. 135) may be linked to a fusion gene (SEQ ID NO: 140; fusion site: SEQ ID NO: 141).
  • the ERBB2IP-MAST4 fusion protein is a fusion protein in which the ERBB2IP protein or fragment as described above at the N-terminus and the MAST4 protein or fragment as described above at the C-terminus is connected, for example, NM_018695, NM_001006600, etc. at the 5 'end.
  • a nucleotide sequence from exon to exon 26 and an amino acid sequence encoded by a fusion gene linked to an nucleotide sequence from exon 13 to the last exon such as NM_001164664, NM_015183, etc.
  • SEQ ID NO: 140 Be an amino acid sequence encoded by the nucleotide sequence (SEQ ID NO: 142; fusion site: SEQ ID NO: 143) or a polypeptide molecule having at least 90%, specifically 95% or more, more specifically 99% or more sequence homology with the sequence Can be.
  • the TPD52L1 gene encoding the TPD52L1 (tumor protein D52-like1) protein may be from human and is located on chromosome 6 (q22.31) of human, and the TPD52L1 protein is a protein encoded therefrom.
  • the TPD52L1 protein or fragment of TPD52L1 protein is the N-terminal fusion partner of the TPD52L1-TRMT11 fusion protein.
  • the TPD52L1 gene is GenBank accession no.
  • the TPD52L1 protein may be a protein having an amino acid sequence encoded by any one of these nucleotide sequences.
  • the fragment of the TPD52L1 protein may have an amino acid sequence encoded by the nucleotide sequence from the first exon of the nucleotide sequence to exon 5 (the 125569428-125569529 base site based on the position ((+) strand) on chromosome 6). And two nucleotides (ag) which do not form a codon at the 3 'end of exon 5 may be present.
  • the genes encoding fragments of the TPD52L1 protein and the TPD52L1 protein encoded therefrom are summarized in Tables 38 and 39 below:
  • Table 38 Gene encoding a fragment of the TPD52L1 protein TPD52L1 Gene (Accession No.) Coding Site-CDS of the TPD52L1 Protein Coding site of the TPD52L1 protein fragment: exon criteria Coding site of the TPD52L1 protein fragment: cDNA criteria Break-point location on chromosome Break-point site sequence NM_001003395 328-855 (528 bp) (SEQ ID NO: 144) Site from first exon to exon 5 328 ⁇ 626 (297bp + 2nt (c); 299bp total) (SEQ ID NO: 145) chr6: 125569529] (3 'terminus of exon 5) tcagcaagaagttcggagacatgag (SEQ ID NO: 146) NM_001003396 220 ⁇ 654 (435bp) 220-605 (386 bp) NM_001003397 220-615 (396 bp) 220-605 (386
  • TPD52L1 Protein TPD52L1 Gene (Accession No.) Full size (aa) of TPD52L1 protein TPD52L1 protein fragment site Breakpoint site amino acid sequence NM_001003395 175aa (SEQ ID NO: 147) 1-99aa + 2nt (ag) (amino acid sequence: SEQ ID NO: 148) SKKFGDM + 2nt (ag) (amino acid sequence: SEQ ID NO: 149) NM_001003396 144aa 1 to 128aa NM_001003397 131aa 1 to 128aa NM_003287 204aa 1 to 128aa
  • the TRMT11 gene encoding the TRMT11 (tRNA methyl transferase11 homolog) protein may be from human and is located on human chromosome 6 (q22.32), which is a protein encoded therefrom.
  • the TRMT11 protein or fragment of TRMT11 protein is the C-terminal fusion partner of the TPD52L1-TRMT11 fusion protein.
  • the TRMT11 gene is GenBank accession no. It may have a nucleotide sequence provided in NM_001031712, TRMT11 protein may be a protein having an amino acid sequence encoded by any one of these nucleotide sequences.
  • the fragment of TRMT11 protein may have an amino acid sequence encoded by the nucleotide sequence from exon 12 of the nucleotide sequence (126342306-126342426 base region based on the position ((+) strand) on chromosome 6) to the last exon. .
  • one nucleotide (a) starting at the 5 'end of exon 12 may be in a codon-free form, and further included in the fragment of the TPD52L1 protein as described above upon fusion with the fragment of the TPD52L1 protein. It is linked to two nucleotides (ag) to form a codon (aga) can encode one amino acid (R).
  • Tables 40 and 41 summarized in Tables 40 and 41 below:
  • Table 40 Gene encoding a fragment of TRMT11 protein TRMT11 gene (Accession No.) Coding Site-CDS of the TRMT11 Protein Coding site of the TRMT11 protein fragment: exon criteria Coding site of the TRMT11 protein fragment: cDNA criteria Break-point location on chromosome Break-point site sequence NM_001031712 122-1513 (1392 bp) (SEQ ID NO: 150) Site from exon 12 to last exon 1261-1513 (1nt (a) + 252bp; 1877bp total) (SEQ ID NO: 151) chr6: [126342306 (5 'end of exon 12) atacactgaagagatggtgcct (SEQ ID NO: 152)
  • TRMT11 Protein TRMT11 gene (Accession No.) Full size (aa) of TRMT11 protein TRMT11 protein fragment site Breakpoint site amino acid sequence NM_001031712 463aa (SEQ ID NO: 153) 1 nt (a) + 381aa-463aa (total 83aa) (amino acid sequence: SEQ ID NO: 154) 1 nt (a) + YTEEMVP (amino acid sequence: SEQ ID NO: 155)
  • the fusion gene (TPD52L1-TRMT11 fusion gene) encoding the 'TPD52L1 protein or fragment thereof and the TRMT11 protein or fragment thereof' is fused to the TPD52L1 protein or fragment thereof as described above at the 5'-end.
  • the TPD52L1-TRMT11 fusion gene has a nucleotide sequence linked to an exon 12 of NM_003287, NM_001003396, NM_001003397, NM_001003397, NM_001003395, etc.
  • the TPD52L1-TRMT11 fusion gene has a nucleotide sequence 328 to 626 of NM_001003395 at the 5 'end (SEQ ID NO: 145) and a nucleotide sequence 1261 to 1513 of NM_001031712 at the 3' end. 151) may be a linked fusion gene (SEQ ID NO: 156; fusion site: SEQ ID NO: 157).
  • the TPD52L1-TRMT11 fusion protein is a fusion protein to which the TPD52L1 protein or fragment as described above at the N-terminus and the TRMT11 protein or fragment as described above at the C-terminus, such as NM_003287, NM_001003396, NM_001003397, Nucleotide sequence from exon 5 to exon 5 in the first exon, such as NM_001003395, and the nucleotide sequence from exon 12 to last exon of NM_001031712 at the 3 'end thereof, and may have an amino acid sequence encoded by a fusion gene linked thereto, in an embodiment, SEQ ID NO: 156 An amino acid sequence encoded by the nucleotide sequence of (SEQ ID NO: 158; fusion site: SEQ ID NO: 159) or a polypeptide molecule having at least 90%, specifically 95% or more, more specifically 99% or more sequence homology with the sequence Can be.
  • the TXNRD1 gene encoding the TXNRD1 (thioredoxin reductase1) protein may be from human and is located on human chromosome 12 (q23.3), which is the protein encoded therefrom.
  • the TXNRD1 protein or fragment of TXNRD1 protein is the N-terminal fusion partner of the TXNRD1-GPR133 fusion protein.
  • the TXNRD1 gene is GenBank accession no.
  • TXNRD1 protein may be a protein having an amino acid sequence encoded by any one of these nucleotide sequences.
  • the fragment of the TXNRD1 protein may have an amino acid sequence encoded by the nucleotide sequence from the first exon of the nucleotide sequence to exon 17 (104732917-104733051 base site relative to the position ((+) strand) on chromosome 12). have.
  • the genes encoding fragments of the TXNRD1 protein and the TXNRD1 protein encoded therefrom are summarized in Tables 42 and 43 below:
  • Table 42 Gene encoding a fragment of TXNRD1 protein TXNRD1 gene (Accession No.) Coding Site-CDS of the TXNRD1 Protein Coding site of TXNRD1 protein fragment: exon criteria Coding site of TXNRD1 protein fragment: cDNA criteria Break-point location on chromosome Break-point site sequence NM_003330 656-2311 (1656 bp) (SEQ ID NO: 160) Site from first exon to exon 17 656-2224 (1587 bp) (SEQ ID NO: 161) chr12: 104733051] (3 'end of exon 17) aatccaccctgtctgtgcagag (SEQ ID NO: 162) NM_001093771 25-1974 (1950 bp) 258-1905 (1881 bp) NM_182729 527-2074 (1548 bp) 527-2005 (1479 bp) NM_182743 465-1964 (1500 bp) 465
  • Table 43 Fragment of TXNRD1 Protein TXNRD1 gene (Accession No.) Full size (aa) of ERBB2IP protein ERBB2IP protein fragment site Breakpoint site amino acid sequence NM_003330 551aa (SEQ ID NO: 163) 1-529aa (SEQ ID NO: 164) IHPVCAE (SEQ ID NO: 165) NM_001093771 649aa 1-627aa NM_182729 499aa 1-477aa NM_182743 499aa 1-477aa NM_182742 499aa 1-477aaa
  • the GPR133 gene which encodes a G protein-coupled receptor133 (GPR133) protein, may be from human and is located on human chromosome 12 (q24.33), which is a protein encoded therefrom.
  • the GPR133 protein or fragment of GPR133 protein is the C-terminal fusion partner of the TXNRD1-GPR133 fusion protein.
  • the GPR133 gene is GenBank accession no. It may have a nucleotide sequence provided in NM_198827, and the GPR133 protein may be a protein having an amino acid sequence encoded by any one of these nucleotide sequences.
  • the fragment of the GPR133 protein may have an amino acid sequence encoded by the nucleotide sequence from exon 14 (the 131561346-131561419 base site based on the position ((+) strand) on chromosome 12) to the last exon of the nucleotide sequence.
  • the genes encoding fragments of the GPR133 protein and the GPR133 protein encoded therefrom are summarized in Tables 44 and 45 below:
  • the fusion gene encoding the TXNRD1 protein or fragment thereof and the TXNRD1-GPR133 fusion protein in which the GPR133 protein or fragment thereof is fused is a TXNRD1 protein or a fragment thereof as described above at the 5'-end. It may comprise a polynucleotide molecule encoding and a polynucleotide molecule encoding a GPR133 protein or fragment thereof as described above at the 3'-end.
  • the TXNRD1-GPR133 fusion gene has a nucleotide sequence from the first exon such as NM_003330, NM_001093771, NM_182729, NM_182743, NM_182742 to the 5 'end, and the nucleotide sequence from exon 14 to the last exon of NM_198827 at the 3' end. May be a linked fusion gene.
  • the TXNRD1-GPR133 fusion gene has a 656 to 2242 nucleotide sequence (SEQ ID NO: 161) of NM_003330 at the 5 'end and 2033 to 3184 nucleotide sequence of NM_198827 at the 3' end (SEQ ID NO: 167) may be a linked fusion gene (SEQ ID NO: 172; fusion site: SEQ ID NO: 173).
  • the TXNRD1-GPR133 fusion protein is a fusion protein in which the TXNRD1 protein or fragment as described above at the N-terminus and the GPR133 protein or fragment as described above at the C-terminus are linked, for example, NM_003330, NM_001093771, NM_182729, Nucleotide sequence from exon 17 to exon 17 in the first exon of NM_182743, NM_182742, etc., and an amino acid sequence encoded by a fusion gene linked to the nucleotide sequence from exon 14 to last exon of NM_198827 at the 3 'end, in an embodiment, the sequence An amino acid sequence encoded by the nucleotide sequence of No. 172 (SEQ ID NO.® fusion site: SEQ ID NO. 175) or a poly having at least 90%, specifically 95% or more, more specifically 99% or more sequence homology with the sequence It may be a peptide molecule.
  • the first exon and the last exon means the first exon and the last exon, respectively, in the base sequence of the given accession number irrespective of the exon number, the exon number is the sequence information of the NCBI follow the number given in.
  • the expression rate of the PDGFRA gene or fragments thereof is significantly increased, and it is confirmed that this phenomenon is specifically observed in cancer patients.
  • another example of the present invention provides a polynucleotide molecule (SCAF11-PDGFRA fusion gene) to which the 5UTR region of the SCAF11 gene and the PDGFRA gene or fragment thereof are fused, and the use of the polynucleotide molecule as a cancer diagnostic marker.
  • the SCAF11 gene encoding SCAF11 (SR-related CTD-associated factor 11) protein may be from human and is located on human chromosome 12 (q12).
  • the 5UTR region of SCAF11 is the 5 'terminal fusion partner of the SCAF11-PDGFRA fusion gene.
  • the SCAF11 gene is GenBank accession no.
  • NM_004719 May have a nucleotide sequence provided to NM_004719, wherein the 5UTR region of SCAF11 is the nucleotide sequence from 1st to 266th of the nucleotide sequences provided to NM_004719 (corresponds to exon 1; chromosome position ((-) strand) -chr12 : 46384136-46384401; chromosome breakpoint-chr12: [46384136; SEQ ID NO: 176; fusion site-SEQ ID NO: 177).
  • the PDGFRA gene which encodes a platelet-derived growth factor receptor (alpha polypeptide) protein, may be of human origin and is located on human chromosome 4 (q12).
  • the PDGFRA gene or gene fragment is the 3 'terminal fusion partner of the SCAF11-PDGFRA fusion gene.
  • the PDGFRA gene is GenBank accession no.
  • the fragment of the PDGFRA fusion gene includes the CDS site (nucleotide sequence from 332rd to 3601th; total length 3270 bp) of NM_006206, at the 5 'end of the CDS site It may further comprise a 12bp 5UTR region (nucleotide sequence from 120 to 331 of NM_006206), which is exon 2 (chromosome position ((+) strand) -chr4: 55124924-55124984; chromosome on NM_006206); breakpoint-chr12: 120180269] to the last exon) (SEQ ID NO: 178; fusion site-SEQ ID NO: 179).
  • the SCAF11-PDGFRA fusion gene may be one having a nucleotide sequence of SEQ ID NO: 180 (fusion site: SEQ ID NO: 181).
  • nucleotide sequences determined by sequencing the DNA molecules described herein can be determined using an automated DNA sequencer (eg, Model 373, manufactured by Applied Biosystems, Inc.), and the nucleotide sequence determined All amino acid sequences encoded by were determined using an automated peptide sequencer.
  • the nucleotide sequence determined by this automated approach may contain some errors compared to the actual sequence.
  • nucleotide sequences determined automatically are typically at least about 90%, specifically at least about 95%, more specifically at least about 99%, more specifically at least about 99.9% of the sequence of actual nucleotide sequences of the sequenced DNA molecules. It may have homology.
  • One insertion or deletion in a nucleotide determined in comparison to the actual sequence may comprise a frame shift in nucleotide sequence translation such that the encoded amino acid sequence is completely different from the actual amino acid sequence. Can be.
  • the fusion proteins and / or fusion genes according to the invention have been found to be specifically found or expressed in patients with solid cancers, in particular lung cancers, in particular non-small cell cancers (NSCLCs) such as lung adenocarcinoma, and thus the fusion proteins and / or encoding them Fusion genes and / or SCAF11-PDGFRA fusion genes are useful as diagnostic markers of solid cancers, specifically non-small cell cancers (NSCLC) such as lung cancers, especially lung adenocarcinoma.
  • NSCLC non-small cell cancers
  • another example of the present invention is a molecule that specifically binds to the fusion protein, a fusion gene encoding the fusion protein, SCAF11-PDGFRA fusion gene and / or mRNA (transcript) corresponding to the fusion gene It provides a pharmaceutical composition for diagnosing cancer comprising a substance that acts (eg binds).
  • a substance which interacts with the fusion protein is a substance for detecting whether the fusion protein is expressed (or present), and an antibody that specifically binds to the amino acid sequence of the fusion protein or a break point of the fusion protein, It may be selected from the group consisting of aptamer and the like.
  • the fusion gene encoding the fusion protein, SCAF11-PDGFRA fusion gene, or a substance that interacts with the mRNA corresponding to these fusion gene may be the fusion gene or a nucleic acid molecule capable of hybridizing with the mRNA.
  • the nucleic acid molecule may comprise an antisense oligonucleotide (eg, siRNA, specifically hybridizable with the fusion gene in the biological sample, the fusion site of the fusion gene, or an mRNA (expression transcript) corresponding to the fusion gene or fusion site).
  • a fusion gene encoding said fusion protein, a SCAF11-PDGFRA fusion gene, or a nucleic acid molecule hybridizable with an mRNA molecule corresponding to these fusion genes comprises 50 to 250 contiguous regions comprising a fusion site within said fusion gene.
  • 20 to 100 adjacent to both ends of the polynucleotide fragment specifically 25 to 50 base sequence or 20 complementary to the sequence so as to amplify a polynucleotide fragment consisting of 100 to 200 bases
  • Primer pairs of length from 100 to 100 bp, or from 25 to 50 bp.
  • the term 'hybridizable' means that the detection target has a nucleotide sequence that is completely complementary to the target sequence to be detected or has a complementary sequence of 80% or more (eg 80-100%), specifically 90% or more (eg 90-100%). It means that the specific binding to the gene or mRNA.
  • primer pairs that can hybridize to each fusion gene are illustrated in Table 46 below.
  • the substance that specifically interacts with the fusion protein or fusion gene or mRNA is one or more selected from the group consisting of free radicals, radio-isotopes, fluorescent dyes, chromogenic substrates, enzymes, bacteriophages, coenzymes, etc.
  • An immunochemical labeling substance can be attached or used with the labeling substance.
  • Another example is information on cancer diagnosis comprising detecting the fusion protein, a fusion gene encoding the fusion protein, a SCAF11-PDGFRA fusion gene, and / or mRNA corresponding to the fusion gene in a biological sample obtained from a patient. Provides a way to provide.
  • Detecting the fusion protein, fusion gene, and / or mRNA in the biological sample comprises: i) the fusion protein, a fusion gene encoding the fusion protein, a SCAF11-PDGFRA fusion gene, and the fusion gene in the biological sample. Treating (adding) and reacting a substance that interacts with at least one selected from the group consisting of corresponding mRNAs; And ii) detecting the obtained reactant.
  • the method may further include preparing a biological sample before step i), and preparing the biological sample may include obtaining (separating) the biological sample from the patient.
  • the interacting substance is a compound, antibody, aptamer, and the fusion gene and / or mRNA (all or part; for example) that specifically binds to the fusion protein (all or part; such as a fusion site).
  • the fusion protein all or part; such as a fusion site.
  • the reactant is a complex formed by interaction (binding) of at least one selected from the group consisting of the fusion protein, fusion gene, and mRNA obtained in step i) and a substance interacting with it.
  • the reactant is detected in the step of detecting the reactant, it may be determined that the fusion protein, the fusion gene, and / or the mRNA are present.
  • the patient is cancer (solid cancer), specifically lung cancer, more specifically non-small cell lung cancer (NSCLC), especially lung cancer patients.
  • cancer solid cancer
  • lung cancer more specifically non-small cell lung cancer (NSCLC), especially lung cancer patients.
  • Detection of the fusion protein, fusion gene, and / or mRNA can be carried out by conventional protein or gene detection methods.
  • the detection of the fusion protein may be performed using a substance that interacts with the fusion protein, such as a substance that specifically binds to the fusion protein (eg, an antibody, aptamer, or compound).
  • a substance that specifically binds to the fusion protein eg, an antibody, aptamer, or compound.
  • Aptamers i.e. immunochromatography, immunohistochemical staining, enzyme linked immunosorbent assay (ELISA), radioimmunoassay to detect complex formation, i.e. can be detected by radioimmunoassay (RIA), enzyme immunoassay (EIA), fluorescence immunoassay (FIA), luminescence immunoassay (LIA), Western blotting FACS, and the like.
  • RIA radioimmunoassay
  • EIA enzyme immunoassay
  • FIA fluorescence immunoassay
  • LIA luminescence immunoassay
  • Immunoassay methods can be performed by conventional protein expression detection assays.
  • Useful immunoassays can be homologous or heterologous immunoassays.
  • the immunological response often involves a fusion protein specific reagent (eg, a fusion protein specific antibody), its labeled analyte, and / or a biological sample of interest.
  • the signal resulting from the label is modified directly or indirectly for binding of the antibody to the labeled analyte. Both immunological response and detection of its amount are carried out in homogeneous solution.
  • the immunochemical labels that can be used may be one or more selected from the group consisting of free radicals, radio-isotopes, fluorescent dyes, enzymes, bacteriophages, coenzymes, and the like.
  • Antibodies useful in the practice of the methods described herein may be attached to solid supports (eg, wells, beads, plates or slides made of materials such as latex or polystyrene) suitable for diagnostic analysis by known techniques such as precipitation.
  • Solid supports eg, wells, beads, plates or slides made of materials such as latex or polystyrene
  • Antibodies or other fusion protein binding reagents may be selected from the group consisting of radiolabels (eg 35 S, 125 I, 131 I, etc.), enzyme labels (eg horseradish peroxidase, alkaline phosphate, according to known techniques). Iodine, etc.), and fluorescent labels (e.g., horsein, etc.).
  • Cell-based assays such as flow cytometry (FC), immunohistochemistry (IHC), or immunofluorescence (IF) are clinically suitable for such an assay format and kinase polypeptides in fusion proteins in vivo.
  • Particularly preferred is the practice of the methods of the present invention as it allows for the detection of expression and the extraction of the extracts, thereby avoiding the risk of artificial changes in activity which results in the manipulation of cells obtained from a tumor sample, for example.
  • the methods of the present invention devise a cell-based assay, immuno-histochemistry (IHC), or immunofluorescence (IF) analysis format, such as flow cytometry (FC).
  • Flow cytometry can be an assay employed to determine kinase polypeptide expression in fusion proteins in mammalian tumors prior to, during and / or after treatment of a targeted drug that inhibits kinase activity in the fusion protein.
  • a targeted drug that inhibits kinase activity in the fusion protein.
  • tumor cells derived from bone marrow samples can be analyzed by flow cytometry for fusion protein expression and / or activation, as well as markers for identifying cancer cell types, if desired.
  • Immunohistochemistry (IHC) staining is the expression of the kinase protein in the fusion protein in mammalian cancers (eg, solid cancers such as NSCLC) before, during, and / or after treatment with a targeted drug that inhibits kinase activity in the fusion protein. And / or assays employed to determine activation status.
  • mammalian cancers eg, solid cancers such as NSCLC
  • Immunofluorescence (IF) analysis is performed to determine the expression and / or activation status of kinase polypeptides in fusion proteins in mammalian cancer before, during, and / or after treatment with targeted drugs that inhibit kinase activity in the fusion proteins. It may be an adopted method.
  • ELISA enzyme-linked immunosorbent assay
  • RIA radio-immunoassay
  • FACS fluorescence-activated cell sorting
  • the fusion protein specific reagent comprises an isotopically labeled phosphopeptide (AQUA peptide) in a sequence corresponding to the peptide sequence comprising the fusion protein or fusion junction as described above. can do.
  • detection of the fusion gene and / or its corresponding mRNA can be accomplished using conventional nucleic acid detection using agents that interact with the fusion gene or mRNA, such as hybridizable nucleic acid molecules (eg, probes, aptamers, primers, etc.).
  • agents that interact with the fusion gene or mRNA such as hybridizable nucleic acid molecules (eg, probes, aptamers, primers, etc.).
  • Methods such as polymerase chain reaction (PCR), fluorescent in situ hybridization (FISH), UV spectrometry, chromatography, Warburg-Christian, Schmidt-Thannhauser-Schneider, etc., but are not limited thereto. It is not.
  • the detection of the fusion gene and / or its corresponding mRNA is carried out through whole-transcriptome (RNA) or whole-genome through massively parallel sequencing techniques. DNA) sequencing.
  • Reagents (interacting materials) specific for the fusion gene or mRNA useful for detecting the nucleic acid molecule are siRNA, oligonucleotides or DNA that can directly hybridize and detect the fusion or truncated polypeptide expressing transcripts in a biological sample. It may be a probe.
  • the patient may be a human, including a human, a mammal, including a primate such as a monkey, a rodent such as a mouse and a rat, specifically a human.
  • the biological sample may be cells (eg, lung cells, etc.), tissues (eg, lung tissues, etc.), body fluids (eg, blood, etc.) isolated from the patient. More specifically, biological samples useful in the present invention can be obtained from a mammal in which the cancer (solid cancer or non-solid cancer), which is characterized by the expression of the fusion protein, is present or developed.
  • the mammal is a human and the human can be a patient for treatment of a cancer such as, for example, NSCLC.
  • the human patient may be a patient currently being treated or considering treatment with a therapeutic agent that inhibits kinase in the fusion protein to be detected.
  • Suitable biological samples for use in the present invention may be those comprising cells, tissues or extracts thereof derived from (or isolated from) mammalian cancer.
  • Fusion proteins that specifically express in cancer patients of the present invention can be used as novel cancer therapeutic targets.
  • another example of the present invention is selected from the group consisting of an inhibitor of the fusion protein, an inhibitor of the SCAF11-PDGFRA fusion gene, an inhibitor of the fusion gene encoding the fusion protein, and an inhibitor of the mRNA corresponding to the fusion gene. It provides a pharmaceutical composition for preventing and / or treating cancer comprising at least one species as an active ingredient.
  • Another example is a pharmaceutically effective amount selected from the group consisting of an inhibitor of the fusion protein, an inhibitor of the SCAF11-PDGFRA fusion gene, an inhibitor of the fusion gene encoding the fusion protein, and an inhibitor of the mRNA corresponding to the fusion gene.
  • Provided are methods for preventing and / or treating cancer comprising administering to a patient in need thereof.
  • Another example includes at least one selected from the group consisting of an inhibitor of the fusion protein, an inhibitor of the SCAF11-PDGFRA fusion gene, an inhibitor of the fusion gene encoding the fusion protein, and an inhibitor of an mRNA corresponding to the fusion gene. It provides a use for the prevention and / or treatment of cancer of the composition.
  • the patient may be a human, including a human, a mammal, including a primate such as a monkey, a rodent such as a mouse and a rat, specifically a human.
  • the inhibitor may be administered orally or parenterally.
  • parenteral administration it can be administered by intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, endothelial administration, topical administration, intranasal administration, pulmonary administration or rectal administration.
  • pharmaceutically effective amount refers to an amount in which a drug can produce a pharmaceutically meaningful effect.
  • the pharmaceutically effective amount of an inhibitor for a single dose depends on factors such as the formulation method, mode of administration, age, weight, sex, morbidity, food, time of administration, interval of administration, route of administration, rate of excretion and response to the patient. It can be prescribed in various ways.
  • An inhibitor of the fusion protein is a substance that binds to the fusion protein and loses or decreases its function, and an antibody, aptamer, or a conventional kinase inhibitor (for a fusion gene including tyrosine kinase) to the fusion protein: CCDC6 -ROS1, SCAF11-PDGFRA, FGFR2-CIT, AXL-MBIP, MAP4K3-PRKCE, BCAS3-MAP3K3, ERBB2IP-MAST4), may be one or more selected from the group consisting of signal transduction inhibitors.
  • An inhibitor of a fusion gene or a corresponding mRNA encoding the fusion protein is a substance that binds to the DNA molecule and prevents the expression of the fusion protein, and siRNA, shRNA, microRNA, and pressure that specifically bind to the DNA molecule. It may be one or more selected from the group consisting of tamers and the like.
  • the cancer diagnosis composition, a method for providing information for diagnosing cancer, and a cancer to be diagnosed or treated for a composition for preventing and / or treating cancer may be all types of solid cancers.
  • the solid cancer may be lung cancer, liver cancer, colon cancer, pancreatic cancer, gastric cancer, breast cancer, ovarian cancer, kidney cancer, thyroid cancer, esophageal cancer, prostate cancer, brain cancer, or the like.
  • the solid cancer may be lung cancer, and more specifically, small cell lung cancer (SCLC), or lung adenocarcinoma, squamous cell lung carcinoma, or large cell lung cancer.
  • SCLC small cell lung cancer
  • NSCLC non-small cell lung cancer
  • carcinoma for example, lung cancer.
  • Another example provides an anticancer screening method using the fusion protein.
  • the screening method In one embodiment, the screening method,
  • the candidate material is determined to be an anticancer agent. It may be characterized as.
  • the expression level of the fusion protein may be measured by measuring the level of the fusion protein, or by measuring the level of the fusion gene encoding the fusion protein or the mRNA corresponding to the fusion gene.
  • the anticancer agent screening method further comprises measuring a degree of expression of the fusion protein and / or fusion gene in the cell prior to treatment of the candidate substance, prior to treating the candidate substance, after treatment with the candidate substance in the same cell.
  • the candidate substance may be determined as an anticancer agent.
  • the anti-cancer agent screening method comprises preparing cells expressing the fusion protein and / or the fusion gene, treating some of these cells with candidate compounds, and treating some cells and candidate substances treated with the candidate compounds.
  • the candidate may be determined as an anticancer agent.
  • the cell used in the screening method is a cell derived from a cancer in which one or more of the above-described fusion proteins is expressed and / or activated (e.g., a cancer in which the anticancer agent to be screened shows anticancer activity), the extract of the cell Or cultured the cells in a conventional manner.
  • Cells expressing the fusion protein and / or fusion gene may be cancer cells as described above, in particular solid cancer cells, specifically lung cancer cells, more specifically lung adenocarcinoma cells.
  • the expression level of the fusion protein is measured by immunochromatography, immunohistochemical staining, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), enzymes, which are conventional protein assays. It may be performed by immunoassay (EIA), fluorescence immunoassay (FIA), luminescence immunoassay (LIA), Western blotting, FACS, but is not limited thereto. .
  • the level of the fusion gene or mRNA can be measured by conventional gene quantification methods, such as PCR, FISH, UV spectroscopy, chromatography, Warburg-Christian method, Schmidt-Thannhauser-Schneider method, but is not limited thereto. .
  • the candidate substance includes all natural or synthetic compounds, and may be one or more selected from the group consisting of general compounds, DNA, RNA, proteins, and the like.
  • a biological sample comprising mammalian xenograft derived cells can be employed.
  • Preferred xenografts may be small mammals such as human tumor cell samples expressing fusion proteins or mice having the cells.
  • cells in which such translocation and / or fusion protein do not occur can be employed as a control.
  • control sample is derived from normal cells (eg normal cells around the tumor) of the same tissue that do not have fusion protein expression as described above, or from certain cancers (eg NSCLC) where the fusion protein is not expressed. It may include cancer cells.
  • the types of cancer to be treated of the anticancer agent developed by the screening method are as described above.
  • fusion proteins specifically expressed in lung cancers in particular lung adenocarcinoma, and / or DNA molecules / mRNAs encoding the same provided herein are useful as lung cancer diagnostic markers and even therapeutic targets.
  • paired-end 101bp-long reads were generated from 164 samples (87 cancer tissue samples and 77 corresponding normal tissue samples; Supplementary Table 2). On average, RNA sequencing throughputs were 9.77 and 7.38 Gbp for cancer and normal tissue, respectively. In total-exome sequencing of 76 normal tissues, 32.96? Read depth per paired-normal tissue was obtained for the targeting site.
  • Table 48 shows the cleavage point (3'-terminal cleavage point based on the transcript), the amino acid sequence corresponding to the cleavage point, and the exon in which the cleavage point is located, each gene (including a variant). ) Not shown.
  • RNA Donor protein sequence near breakpoint Donor exon number
  • Table 49 shows the cleavage point (5′-terminal cleavage point based on the transcript), the amino acid sequence corresponding to the cleavage point, and the exon in which the cleavage point is located. ) Not shown.
  • RNA Acceptor protein sequence near breakpoint Acceptor exon number
  • 2 chr10 [43612032 EDPKWEF RET (NM_020630, + strand), exon 12 (chr10: 43612032-43612179; RET (NM_020975, + strand), exon12 (chr10: 43612032-43612179; 2 chr10: [43612032 EDPKWEF RET (NM_020630, + strand), exon 12 (chr10: 43612032-43612179; RET (NM_020975, + strand), exon12 (chr10: 43612032-43612179; 2 chr10: [43612032 EDPKWEF RET (NM_020630, + strand), exon 12 (chr10: 43612032-43612179; RET (NM_020975, + strand), exon12 (chr10: 43612032-43612179; 2 chr10: [43612032 EDPKWEF RET (NM_
  • RNeasy Mini Kit (Qiagen) was used to extract RNA from tumor samples. DNA was extracted using DNeasy tissue kit (Qiagen). For RT-PCR, the first strand cDNA was synthesized from 2.5 mg total RNA in a SuperScript TM III first strand synthesis system (Invitrogen) with oligo (dT) 20. Each fusion gene was then amplified using the corresponding primer pairs (see Table 50 above). Gene amplification was performed by PCR using each primer pair and Taq DNA polymerase high fidelity (Invitrogen).
  • PCR and Sanger sequencing primers for detecting genomic deletions are as follows: 5′-AACAAGGGTACAACCTGAAGGA-3 ′ and 5′-TCAAGGAAGTATCGTGAGGTGA-3 ′.
  • Primers for fusion transcripts are as follows: 5'-AACAAGGGTACAACCTGAAGGA-3 'and 5'-TCAAGGAAGTATCGTGAGGTGA-3'. All Sanger sequencing tests are conducted by Macrogen Inc. It was performed according to the manual (http://www.macrogen.com).
  • fusion proteins proposed in the present invention promote growth and survival in cell lines or tumors expressing such fusion proteins
  • the cells were treated with inhibitors of kinase or other domains in each fusion protein. ?
  • Cell number of cells expressing the fusion protein was counted and cell growth inhibition assay was performed by CellTiter 96 AQueous Original Solution Cell Proliferation Assay (Promega) as suggested by the manufacturer. Briefly, 1000 to 5000 cells were seeded on pratt-bottom 96-well plates and grown in complete medium with 10% FBS. After 24 hours, the cell medium was replaced with 100 ⁇ l complete growth medium with 10% FBS containing varying concentrations of inhibitory agents for each antagonistic protein and further incubated for 72 hours. Each drug concentration was applied to three identical wells of cells. At the end of the culture, 20 ⁇ l of CellTiter 96 AQueous original solution was added to each well and the plate was incubated for 1-4 hours.
  • Absorbance was read at 490 nm using a microplate reader. Growth inhibition can be expressed as the mean ⁇ SD value of absorbance read from the treated cells relative to the treated cells. This analysis was repeated at least three times. Such assays confirm that fusion proteins drive the growth and survival of a subset of human NSCLC tumors in which they are expressed, and such cells can be inhibited using targeted inhibitors to inhibit the activity of kinase or other domains in the fusion protein. You will see that it exists.
  • NIH 3T3 cells By expressing the fusion protein by transforming NIH 3T3 cells with the construct containing the coding cDNA of each fusion protein, it was confirmed whether the expression of the fusion protein proposed in the present invention can transform normal cells into the cancer phenotype. Briefly, cells were maintained in RPMI-1640 medium (Invitrogen) with 10% Fetal Bovine Serum (FBS) (Sigma) and 1.0 ng / ml IL-3 (R & D Systems). Generation and transfection of retroviral supernatants was performed as previously known. NIH3T3 cells were transduced into retroviral supernatants containing pMXs-puro / fusion protein expression vectors and selected for puromycin (2ug / ml).
  • FBS Fetal Bovine Serum

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Urology & Nephrology (AREA)
  • Cell Biology (AREA)
  • Hematology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Toxicology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)

Abstract

La présente invention se rapporte à une utilisation d'une protéine de fusion comprenant le récepteur tyrosine kinase 1 (ROS1) en tant que marqueur de diagnostic du cancer et/ou d'une cible de traitement, à une protéine de fusion comprenant ROS1, à une composition de diagnostic du cancer comprenant un matériel qui interagit avec la protéine de fusion, à un procédé de fourniture d'informations pour le diagnostic du cancer en utilisant celle-ci, à une composition de prévention et/ou de traitement du cancer, comprenant un inhibiteur de la protéine de fusion, et à un procédé de criblage d'un agent de traitement du cancer à l'aide de la protéine de fusion.
PCT/KR2013/008071 2012-09-07 2013-09-06 Protéine de fusion comprenant ros1 et composition de traitement du cancer la comprenant WO2014038888A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020120099614A KR20140033282A (ko) 2012-09-07 2012-09-07 Ｒｏｓ1을 포함하는 융합 단백질 및 이를 포함하는 암 진단용 조성물
KR10-2012-0099614 2012-09-07

Publications (1)

Publication Number Publication Date
WO2014038888A1 true WO2014038888A1 (fr) 2014-03-13

Family

ID=50237420

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2013/008071 WO2014038888A1 (fr) 2012-09-07 2013-09-06 Protéine de fusion comprenant ros1 et composition de traitement du cancer la comprenant

Country Status (2)

Country Link
KR (1) KR20140033282A (fr)
WO (1) WO2014038888A1 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102167739B1 (ko) 2018-10-31 2020-10-19 한국과학기술연구원 Alk 또는 ros-1 인산화 효소 억제제 스크리닝을 위한 방법, 조성물 및 키트 및 방법

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
JU, YOUNG SEOK ET AL.: "A transforming KIF5B and RET gene fusion in lung adenocarcinoma revealed from whole-genome and transcriptome sequencing", GENOME RESEARCH, vol. 22, 3, 22 December 2011 (2011-12-22), pages 436 - 445 *
KENGO, TAKEUCHI ET AL.: "RET, ROS and ALK fusions in lung cancer", NATURE MEDICINE, vol. 18, no. 3, 12 February 2012 (2012-02-12), pages 378 - 381 *
SEO, JEONG-SUN ET AL.: "The transcriptional landscape and mutational profile of lung adenocarcinoma", GENOME RESEARCH, vol. 22, no. 11, 13 September 2012 (2012-09-13), pages 2109 - 2119 *
SOUNG, YOUNG HWA ET AL.: "Mutational analysis of EGFR and K-RAS genes in lung adenocarcinomas", VIRCHOWS ARCHIV, vol. 446, no. 5, 2005, pages 483 - 488 *
YAN, LIU ET AL.: "Identification of genes differentially expressed in human primary lung squamous cell carcinoma", LUNG CANCER, vol. 56, no. 3, 2007, pages 307 - 317 *

Also Published As

Publication number Publication date
KR20140033282A (ko) 2014-03-18

Similar Documents

Publication Publication Date Title
KR102106962B1 (ko) 신규 fgfr3 융합체
US7122373B1 (en) Human genes and gene expression products V
US20160333418A1 (en) Activin Inhibitor Response Prediction and Uses for Treatment
WO2016036172A1 (fr) Biomarqueur pour prédire la sensibilité à un inhibiteur de protéine kinase et utilisation de celui-ci
US20090191548A1 (en) Methods and nucleic acids for the analysis of gene expression associated with tissue classification
US9127078B2 (en) Methods and compositions using splicing regulatory proteins involved in tumor suppression
WO2016018088A1 (fr) Nouveau biomarqueur permettant de prédire la sensibilité à l'inhibiteur de met et son utilisation
WO2012014795A1 (fr) Nouveau procédé de détection de corps fusionnés ret
WO2014038890A1 (fr) Protéine de fusion comprenant axl et composition pour le traitement du cancer la comprenant
LEE et al. Functional characterization of WT1 binding sites within the human vitamin D receptor gene promoter
Brenner et al. Translocations in epithelial cancers
Abdel‐Rahman et al. Somatic FGF9 mutations in colorectal and endometrial carcinomas associated with membranous β‐catenin
WO2015108328A1 (fr) Nouveau gène de fusion ntrk1 comme marqueur du cancer colorectal et application associée
EP1953243B1 (fr) Polynucléotides liés au cancer du colon
WO2014038888A1 (fr) Protéine de fusion comprenant ros1 et composition de traitement du cancer la comprenant
WO2014038887A1 (fr) Protéine de fusion comprenant fgfr2 et composition de traitement du cancer la comprenant
WO2014038884A1 (fr) Protéine de fusion et composition pour diagnostiquer le cancer la comprenant
US20170334966A1 (en) Anti-tumor antibody-tumor suppressor fusion protein compositions and methods of use for the treatment of cancer
WO2023219447A1 (fr) Composition pour diagnostiquer un cancer de l'ovaire comprenant un agent pour détecter un miarn dérivé de vésicule extracellulaire
Charest The ROS1 receptor family
Vaidya Role of DNA methylation in WNT5A promoter B expression in osteosarcoma cells
Tognon et al. Expression of the ETV6-NTRK3 gene fusion in human secretory breast carcinoma
Gherardi Myc-mediated control of gene transcription in cancer cells
WO2001070982A2 (fr) Regulateurs de brca-1 et procedes d'utilisation
Oikawa et al. Suppression of Lck protooncogene expression in murine somatic cell hybrids between T lymphoma cells and fibroblasts

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13834792

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13834792

Country of ref document: EP

Kind code of ref document: A1