WO2014036387A2 - Methods for diagnosis and treatment of cancer - Google Patents

Methods for diagnosis and treatment of cancer Download PDF

Info

Publication number
WO2014036387A2
WO2014036387A2 PCT/US2013/057495 US2013057495W WO2014036387A2 WO 2014036387 A2 WO2014036387 A2 WO 2014036387A2 US 2013057495 W US2013057495 W US 2013057495W WO 2014036387 A2 WO2014036387 A2 WO 2014036387A2
Authority
WO
WIPO (PCT)
Prior art keywords
ntrkl
gene fusion
mprip
mprip gene
level
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2013/057495
Other languages
English (en)
French (fr)
Other versions
WO2014036387A3 (en
Inventor
Robert C. DOEBELE
Marileila Varella Garcia
Anh T. LE
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Colorado Boulder
Original Assignee
University of Colorado Boulder
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Colorado Boulder filed Critical University of Colorado Boulder
Priority to US14/423,867 priority Critical patent/US20150218652A1/en
Priority to CA2882759A priority patent/CA2882759C/en
Priority to EP13832208.6A priority patent/EP2890815B1/en
Priority to JP2015530089A priority patent/JP6223451B2/ja
Publication of WO2014036387A2 publication Critical patent/WO2014036387A2/en
Publication of WO2014036387A3 publication Critical patent/WO2014036387A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/5758Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites
    • G01N33/5759Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites involving compounds localised on the membrane of tumour or cancer cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/106Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90Enzymes; Proenzymes
    • G01N2333/91Transferases (2.)
    • G01N2333/912Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • G01N2333/91205Phosphotransferases in general
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/52Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis

Definitions

  • the present invention generally relates to markers, methods and assay kits for the identification of lung cancer patients predicted to respond to specific cancer therapies.
  • NSCLC non-small cell lung cancer
  • ALK anaplastic lymphoma kinase gene
  • EML4 echinoderm microtubule-associated protein- like 4
  • Crizotinib a tyrosine kinase inhibitor (TKI) with multiple targets
  • TKI tyrosine kinase inhibitor
  • ALK+ ALK positive
  • BA break-apart
  • ROS1 is another receptor tyrosine kinase (RTK) recently found to be activated by gene fusions in NSCLC.
  • RET Rearranged during Transfection
  • RET is a well known RTK, with an oncogenic role in papillary and follicular thyroid carcinoma through activation by gene fusions (RET-PTC).
  • RET-PTC gene fusions
  • Patients whose tumors harbor this fusion respond well to vandetanib, an oral TKI that targets VEGFR, EGFR and RET.
  • a total of 33 patients were reported harboring KIF5B-RET fusions involving 7 different breakpoints.
  • the present invention is based on the discovery of a novel gene fusion comprising the NTRKl gene that is indicative of lung cancer and also indicative of which patients may respond to cancer therapy comprising therapeutic administration of tyrosine kinase inhibitors.
  • the invention comprises a method for determining if a lung cancer patient is predicted to respond to the administration of a chemotherapeutic regimen.
  • the method comprises detecting in a sample of tumor cells from the patient the presence or absence of a marker, wherein the marker comprises a gene fusion comprising a NTRK1-MPRIP gene fusion (NTRKl encodes the TRKA protein), and wherein the presence or absence of the marker is indicative of whether the cancer patient will respond to the administration of the chemotherapeutic regimen.
  • the chemotherapeutic regimen may include administration of one or more of the following: a tyrosine kinase inhibitor, a HSP90 inhibitor (or other chaperone inhibitor), an inhibitor that targets tyrosine kinase downstream signalling cascade, or combinations thereof.
  • a tyrosine kinase inhibitor e.g., a tyrosine kinase inhibitor, a HSP90 inhibitor (or other chaperone inhibitor), an inhibitor that targets tyrosine kinase downstream signalling cascade, or combinations thereof.
  • HSP90 inhibitor or other chaperone inhibitor
  • the tyrosine kinase inhibitor may be a TrkA inhibitor, examples of which include, but are not limited to, crizotinib (PF-02340166), ponatinib (AP24534), dovitinib (TK-258), CEP-701, or rebastinib (DCC-2036).
  • HSP90 inhibitors include, but are not limited to, geldanamycin, herbimycin, 17-AAG, PU24FC1, STA-9090, IPI-504, and AUY-922.
  • inhibitors that target tyrosine kinase receptor downstream signalling cascade include, without limitation, elumetinib (AZD6244) and MK2206.
  • a level of the marker is determined and compared to a standard level or reference range.
  • the standard level or reference range is determined according to a statistical procedure for risk prediction.
  • the presence of the marker may be determined by detecting the presence of a polynucleotide or a polypeptide.
  • the method may comprise detecting the presence of the polypeptide using a reagent that specifically binds to the polypeptide or a fragment thereof.
  • the reagent may be an antibody, an antibody derivative, or an antibody fragment.
  • the presence of the marker may be determined by obtaining RNA from the sample; generating cDNA from the RNA; amplifying the cDNA with primers specific for the marker; and determining from the sequence of the amplified cDNA the presence of absence of the marker in the sample.
  • the presence of the marker may be determined by Fluorescent In Situ Hybridization (FISH).
  • the methods of the present invention may further comprise comparing the expression level of the marker in the sample to a control level of the marker selected from the group consisting of: a) a control level of the marker that has been correlated with beneficial response to the administration of a chemotherapeutic regimen including one or more kinase inhibitor(s); and a control level of the marker that has been correlated with lack of beneficial response to the administration of a chemotherapeutic regimen including one or more kinase inhibitor(s); and b)selecting the patient as being predicted to respond to the administration of a chemotherapeutic regimen including one or more kinase inhibitor(s), if the expression level of the marker in the sample is statistically similar to, or greater than, the control level of expression of the marker that has been correlated with sensitivity to the administration of a chemotherapeutic regimen including one or more kinase inhibitor(s), or c) selecting the patient as being predicted to not respond to the administration of a chemotherapeutic regimen including one or more
  • the methods may further comprise comparing the expression level of the marker in the sample to a level of the marker in a second patient predicted to not respond to the administration of a chemotherapeutic regimen including one or more kinase inhibitor(s), and, selecting the patient as being predicted to respond to the administration of a chemotherapeutic regimen including one or more kinase inhibitor(s), if the expression level of the marker in the sample is greater than the level of expression of the marker in the second patient, or, selecting the patient as being predicted to not respond to the administration of a chemotherapeutic regimen including one or more kinase inhibitor(s), if the level of the marker in the sample is less than or equal to the level of expression of the marker in the second patient.
  • the patient is human.
  • the present invention includes an assay system for predicting patient response or outcome to tyrosine kinase anti-cancer therapy comprising a means to detect at least one of: a) the presence of a gene fusion comprising a NTRK1-MPRIP gene fusion; b) the level of expression of a gene transcript encoded by a NTRK1-MPRIP gene fusion; c) the presence of a protein encoded by a NTRK1-MPRIP gene fusion; d) the level of a protein encoded by a NTRK1-MPRIP gene fusion; and, e) the activity of a protein encoded by a NTRK1-MPRIP gene fusion.
  • the means to detect comprises nucleic acid probes comprising at least 10 to 50 contiguous nucleic acids of NTRK1 gene, or complementary nucleic acid sequences thereof. In some embodiments, the means to detect comprises binding ligands that specifically detect polypeptides encoded by a NTRK1-MPRIP gene fusion. In some embodiments, a surface of the assay system comprises a chip, array, or fluidity card.
  • the assay system further comprises: a control selected from the group consisting of: information containing a predetermined control level of a gene transcript encoded by a NTRK1-MPRIP gene fusion that has been correlated with response to the administration of a chemotherapeutic regimen including one or more kinase inhibitor(s); and information containing a predetermined control level of a gene transcript encoded by a NTRK1-MPRIP gene fusion that has been correlated with a lack of response to the administration of a chemotherapeutic regimen including one or more kinase inhibitor(s).
  • a control selected from the group consisting of: information containing a predetermined control level of a gene transcript encoded by a NTRK1-MPRIP gene fusion that has been correlated with response to the administration of a chemotherapeutic regimen including one or more kinase inhibitor(s).
  • the present invention includes a method of diagnosing a specific type of lung cancer in a subject, comprising detecting in a sample of cells from the subject the presence of a NTRK1-MPRIP gene fusion marker, wherein the presence of the marker is indicative of whether the subject has the specific type of lung cancer.
  • the presence of the gene fusion marker is detected by RT-PCR or FISH.
  • the presence of the gene fusion marker is detected by detecting the polypeptide encoded by the gene fusion marker.
  • the polypeptide is detected by using a reagent that specifically binds to the polypeptide or a fragment thereof.
  • Figure 1 shows the chromosomal and exon maps of MPRIP gene.
  • Figure 2 shows the chromosomal and exon maps of NTRK1 gene.
  • Figure 3 shows the arrangement and data confirming NTRK1 gene fusions in lung cancer samples.
  • Figure 3A is a schematic of genomic rearrangement from tumor samples harboring
  • NTRK1 -MPRIP shows RT-PCR demonstrating mRNA expression of the novel fusion transcripts.
  • RNA extracted from formalin-fixed paraffin-embedded tumor sample harboring the NTRK1 -MPRIP was subject to RT-PCR followed by agarose gel electrophoresis and DNA sequencing. The following abbreviates are used: MPRIP (M), CD74 (C), NTRKl (N), and exon (ex). Sanger sequencing chromatograms were obtained of RT-PCR product of RNA isolated from tumor samples with NTRKl -MPRIP fusion.
  • SEQ ID NO: 1 is the complete cDNA sequence of NTRKl -MPRIP fusion (M21 ;N14). The cDNA was cloned from a frozen tumor sample from the patient in which this fusion was first identified. Capital letters represent nucleotides contained within the open reading frame.
  • Figure 4 shows the RT-PCR primer read sequences for detection of NTRKl -MPRIP gene fusion.
  • Figure 4A shows the forward read sequence with MPRIP CC3F1 primer.
  • Figure 4B shows the reverse read sequence with NTRKl Y490R1 primer.
  • Figure 5 shows the design of the NTRK1-MPRIP fusion FISH probes.
  • Figure 6 shows the design of the 5'-3' NTRK1 Break-Apart FISH probe set aligned against the NTRK1 encoding region of chromosome lq23.1.
  • Figures 7A and 7B show FISH images obtained from the normal cell line GM09948 using the NTRK1-MPRIP gene fusion probes, providing single clone validation in a normal cell line ( Diploid,2N).
  • Figure 7A Clone RP1 1-1038N13 (3'NTRK1) and RP11- 1251 16 (5'MPRIP).
  • Figure 7B Clone RP1 1-1059C21 (3'NTRKl) and Rpl 1-796J19 (5'MPRIP).
  • Figures 8A and 8B show FISH images obtained from tissue sections that are negative for NTRK1-MPRIP gene fusion using the NTRK1-MPRIP gene fusion probes.
  • Figure 8A shows specimen S- 12-047486 showing low copy number for both genes.
  • Figure 8B shows specimen S- 12-047098, showing high copy number for 3' NTRK1 and Mid/low copy number for 5' MPRIP.
  • Figures 9A and 9B show FISH images obtained from tissue sections that are positive for NTRK1 -MPRIP gene fusion using the NTRK1 -MPRIP gene fusion probes.
  • Figure 9A showing low copy number for both genes with approximately one red/green fusion (positive pattern) per tumor cell.
  • Figure 9B showing gene amplification of the fused red/green with mid/low copy number of single reds and single greens per tu or cell.
  • Figure 10 shows the testing of NTRK1 break-apart FISH probe.
  • Figure 1 1a shows cell line GM09948 with a normal karyotype showing metaphase spread and interphase nuclei
  • Figure l ib shows KM 12 cells which harbor a TPM3-NTRK1 gene fusion showing clear separation of the 5' and 3' signals indicating a rearrangement of the NTRKl gene.
  • Figure 1 lc shows a break-apart FISH analysis of NTRKl-MPRIP samples showing clear separation of 5' and 3' signals corresponding to the NTRKl gene.
  • Figure l id shows break-apart FISH analysis of a tumor sample without an NTRKl gene rearrangement showing close approximation of the green/red signals (indicated by arrow).
  • Figure 1 1 shows FISH images obtained from tissue sections that are positive for NTRKl gene rearrangement using the NTRKl break-apart probes.
  • Cells show both the 'positive' pattern of split and the 'normal' pattern of fused signals.
  • Figure 12A and B show immunoblot analyses of cell lysates from 293T cells expressing
  • TRKA Expression of TRKA (with HA tag) or empty vector demonstrates expression of a ⁇ 1 15-120kD protein detected by an HA-specific antibody (left, Cell Signaling) and a TRKA- specific antibody (right, Santa Cruz, SC-1 18).
  • Figure 12B Immunoprecipation using an HA- specific antibody (Cell Signaling) followed by immunoblot using the same antibody (left) or a phosphotyrosine specific antibody (right, Miilipore, 4G10) following treatment with 1 ⁇ of the indicated inhibitors or DMSO (control) for 5 hours.
  • Figure 12C shows the expression of NTRKl- MPRIP yields a chimeric protein that is autophosphorylated.
  • FIG. 13D is a schematic demonstrating fusion break-point and critical domains of predicted fusion protein products.
  • Figure 13 A shows immunoblot analyses of downstream signalling of TRKA following treatment with tyrosine kinase inhibitors.
  • SDS-PAGE of 293T cell lysates with expression of TRKA-HA or empty vector in the presence or absence of NGF (10 minutes) and the presence or absence of the indicated tyrosine kinase inhibitors at 1 ⁇ for 5 hours.
  • Membranes were probed with antibodies to TRKA phosphotyrosine 490, 674, and 675 (Cell Signaling), total TRKA (anti- HA, Cell Signaling), AKT phosphoserine 473 (Cell Signaling), total AKT (Cell Signaling), phosphorylated ERK p42/44 (Cell Signaling), total ERK p42/44 (Cell Signaling), and gamma- tubulin (Santa Cruz, SC-8035).
  • Figure 13B shows the expression of NTRKI-MPRIP induces activation of downstream MAPK, AKT, and STAT3 pathways.
  • TRKA (NTRKl) fusions are autophosphorylated and activate key downstream signaling pathways.
  • Figure 14 demonstrates that NTRKl gene fusions support cellular proliferation of Ba/F3 cells in the absence of IL-3.
  • Figure 15 demonstrates that NTRKl fusions support anchorage independent growth.
  • Representative images (n 4) from anchorage independent growth assays of NIH3T3 cells expressing EV, RIP-TRKA-kinase dead (KD), or RIP-TRKA in soft agar.
  • Figure 16 shows NTRKI-MPRIP fusion proteins induce tumorigenesis.
  • NIH3T3 cells expressing NTRKI-MPRIP (“RIP-TRKA”), NTRKI-MPRIP kinase dead (“RIP-TRKA-Kinase Dead”), EML4-ALK or Empty Vector were injected into the flanks of nude mice and observed for tumor growth. The number of mice with tumors compared to the total number mice injected are indicated.
  • FIG 17 shows RNAi knockdown of NTRKl inhibits cell proliferation in a cell line harboring TPM3-NTRK1.
  • KM 12 cells were transfected with siRNAs targeting NTRKl and then harvested 48hr later. Cell lysates were analyzed by immunoblot to detect TRKA, pERKl/2 and ERK1/2.
  • Figure 18 shows drug inhibition of activation of TRKA and downstream signaling.
  • Ba/F3 cells expressing NTRK1 -MPRIP (RIP-TRKA) or empty vector (EV) were lysed after 5h of treatment with the indicated doses of drugs (ARRY-470, crizotinib, CEP-701, ARRY-772, or ARRY-523) or DMSO control (C).
  • Figure 19 shows that drug treatment inhibits NTRK1 fusion-mediated Ba/F3 cell proliferation and shows the treatment of index patient with crizotinib.
  • Figure 19(a) Values represent the mean ⁇ SEM.
  • Ba/F3 cells expressing NTRK1- MPRIP demonstrate inhibition of proliferation by the pan-TRK inhibitors, ARRY-470, -523, and - 772 and the multi-kinase inhibitor, CEP-701, but not the EGFR inhibitor, gefitinib.
  • Figure 20 shows the drug treatment of Ba/F3 cells in the presence of IL-3.
  • Ba/F3 cells expressing empty vector were grown in the presence of IL-3 and treated with a range of doses of ARRY-470, CEP-701, crizotinib, or gefitinib.
  • Figure 21 shows the expression and drug inhibition of NTRK1 fusions in NIH3T3 cells.
  • NIH3T3 cells expressing RIP-TRKA were treated with the indicated doses of drugs for 5h prior to cell lysis and immunoblot analysis of pTRKA, TRKA, pAKT, AKT, pERKl/2, ERK1/2, pSTAT3, and STAT3 as indicated.
  • Figure 22 shows the inhibition of anchorage-independent growth by drugs with TRKA activity.
  • Figure 22b The total colony area for each plate was quantified using MetaMorph software and plotted for each condition. Values represent the mean ⁇ SEM.
  • Figure 23 shows the short term cell culture from index patient showing the NTRK1- MPRIP fusion.
  • Colorado University Thoracic Oncology (CUTO) 3 cells were derived from a pleural effusion from the index patient harboring the NTRK1 -MPRIP gene fusion.
  • CUTO Colorado University Thoracic Oncology
  • Figure 24 shows drug treatment of KM12 cells.
  • Figure 25 shows that drug treatment of KM 12 cells inhibits proliferation. Proliferation of KM 12 cells treated with the indicated drugs and doses were assayed for cell proliferation by MTS assay. KM 12 cells are inhibited by ARRY-470, CEP-701, and crizotinib, but not gefitinib.
  • Figure 26 shows that TRKA inhibition results in the accumulation of KM 12 cells in Gl phase.
  • Figure 27 shows that drug treatment with TRKA inhibitors induces apoptosis in KM 12 cells.
  • Figure 27B TRKA inhibitors induce cleavage of PARP-1.
  • KM 12 cells were treated for 24h with the indicated drugs and doses. Cells were lysed, separated by SDS-PAGE and subject to immunoblot analysis with the indicated antibodies.
  • Figure 28 shows histopathology from index patient harboring NTRK1-MPRIP
  • Figure 28(b) Cell block of fine needle aspirate from the same procedure showing tumor cells.
  • Figure 29 shows the results of treatment when the index patient (NTRK1 -MPRIP) consented to treatment with crizotinib 250mg PO BID (off-protocol, off-label) given lack of other therapeutic options.
  • Figure 29A CT scan of the chest before and after 28d of crizotinib
  • Figure 29B serial CA125 tumor marker levels during crizotinib treatment.
  • Figure 30 shows the signal configuration "Dot,” which is the typical round and compact signal and comparison with other signals.
  • the present inventors have discovered that fusion of the MPRIP and NTRK1 genes is indicative of the presence of a specific type of lung cancer. This gene fusion is also indicative of patient clinical response to treatment with tyrosine kinase inhibitors. This gene fusion, and the levels of the protein encoded by this gene fusion, along with clinical parameters can be used as biological markers to diagnose a specific type of lung cancer and to assess cancer patient response to treatment with tyrosine kinase inhibitors.
  • a biological marker is "a characteristic that is objectively measured and evaluated as an indicator of normal biologic processes, pathogenic processes, or pharmacological responses to therapeutic interventions."
  • NIH Marker Definitions Working Group (1998).
  • Biological markers can also include patterns or ensembles of characteristics indicative of particular biological processes ("panel of markers"). The marker measurement can be increased or decreased to indicate a particular biological event or process. In addition, if a marker measurement typically changes in the absence of a particular biological process, a constant measurement can indicate occurrence of that process.
  • Marker measurements may be of the absolute values (e.g., the molar concentration of a molecule in a biological sample) or relative values (e.g., the relative concentration of two molecules in a biological sample).
  • the quotient or product of two or more measurements also may be used as a marker. For example, some physicians use the total blood cholesterol as a marker of the risk of developing coronary artery disease, while others use the ratio of total cholesterol to HDL cholesterol.
  • the markers may be used for diagnostic, prognostic, therapeutic, drug screening and patient stratification purposes (e.g., to group patients into a number of "subsets" for evaluation), as well as other purposes described herein, including evaluation of the effectiveness of a potential cancer therapeutic.
  • the term “marker” includes polypeptide markers and polynucleotide markers. For clarity of disclosure, aspects of the invention will be described with respect to “polypeptide markers” and “polynucleotide markers.” However, statements made herein with respect to “polypeptide markers” are intended to apply to other polypeptides of the invention. Likewise, statements made herein with respect to “polynucleotide” markers are intended to apply to other polynucleotides of the invention, respectively.
  • a polynucleotide described as encoding a "polypeptide marker” is intended to include a polynucleotide that encodes: a polypeptide marker, a polypeptide that has substantial sequence identity to a polypeptide marker, modified polypeptide markers, fragments of a polypeptide marker, precursors of a polypeptide marker and successors of a polypeptide marker, and molecules that comprise a polypeptide marker, homologous polypeptide, a modified polypeptide marker or a fragment, precursor or successor of a polypeptide marker (e.g., a fusion protein).
  • a polypeptide marker e.g., a fusion protein
  • polypeptide refers to a polymer of amino acid residues that has at least 5 contiguous amino acid residues, e.g., 5, 6, 7, 8, 9, 10, 1 1 or 12 or more amino acids long, including each integer up to the full length of the polypeptide.
  • a polypeptide may be composed of two or more polypeptide chains.
  • a polypeptide includes a protein, a peptide, an oligopeptide, and an amino acid.
  • a polypeptide can be linear or branched.
  • a polypeptide can comprise modified amino acid residues, amino acid analogs or non-naturally occurring amino acid residues and can be interrupted by non-amino acid residues.
  • amino acid polymers that have been modified, whether naturally or by intervention, e.g., formation of a disulfide bond, glycosylation, lipidation, methylation, acetylation, phosphorylation, or by manipulation, such as conjugation with a labeling component.
  • antibodies produced by a subject in response to overexpressed polypeptide markers are also included.
  • a "fragment" of a polypeptide refers to a single amino acid or a plurality of amino acid residues comprising an amino acid sequence that has at least 5 contiguous amino acid residues, at least 10 contiguous amino acid residues, at least 20 contiguous amino acid residues or at least 30 contiguous amino acid residues of a sequence of the polypeptide.
  • a "fragment" of polynucleotide refers to a single nucleic acid or to a polymer of nucleic acid residues comprising a nucleic acid sequence that has at least 15 contiguous nucleic acid residues, at least 30 contiguous nucleic acid residues, at least 60 contiguous nucleic acid residues, or at least 90% of a sequence of the polynucleotide.
  • the fragment is an antigenic fragment, and the size of the fragment will depend upon factors such as whether the epitope recognized by an antibody is a linear epitope or a conformational epitope. Thus, some antigenic fragments will consist of longer segments while others will consist of shorter segments, (e.g. 5, 6, 7, 8, 9, 10, 1 1 or 12 or more amino acids long, including each integer up to the full length of the polypeptide). Those skilled in the art are well versed in methods for selecting antigenic fragments of proteins.
  • a polypeptide marker is a member of a biological pathway.
  • the term "precursor” or “successor” refers to molecules that precede or follow the polypeptide marker or polynucleotide marker in the biological pathway.
  • the present invention can include additional precursor or successor members of the biological pathway. Such identification of biological pathways and their members is within the skill of one in the art.
  • the term “polynucleotide” refers to a single nucleotide or a polymer of nucleic acid residues of any length.
  • the polynucleotide may contain deoxyribonucleotides, ribonucleotides, and/or their analogs and may be double-stranded or single stranded.
  • a polynucleotide can comprise modified nucleic acids (e.g., methylated), nucleic acid analogs or non-naturally occurring nucleic acids and can be interrupted by non-nucleic acid residues.
  • a polynucleotide includes a gene, a gene fragment, cDNA, isolated DNA, mRNA, tRNA, rRNA, isolated RNA of any sequence, recombinant polynucleotides, primers, probes, plasmids, and vectors. Included within the definition are nucleic acid polymers modified either naturally, or by intervention.
  • a component e.g., a marker
  • a component is referred to as “differentially expressed” in one sample as compared to another sample when the method used for detecting the component provides a different level or activity when applied to the two samples.
  • a component is referred to as "increased" in the first sample if the method for detecting the component indicates that the level or activity of the component is higher in the first sample than in the second sample (or if the component is detectable in the first sample but not in the second sample).
  • a component is referred to as "decreased" in the first sample if the method for detecting the component indicates that the level or activity of the component is lower in the first sample than in the second sample (or if the component is detectable in the second sample but not in the first sample).
  • marker is referred to as "increased” or “decreased” in a sample (or set of samples) obtained from a lung cancer subject (or a subject who is suspected of having lung cancer, or is at risk of developing lung cancer) if the level or activity of the marker is higher or lower, respectively, compared to the level of the marker in a sample (or set of samples) obtained from a non-lung cancer subject, or a reference value or range.
  • the novel gene fusion marker of the present invention was identified as follows: the presence of an oncogene driver gene abnormality was investigated in a non-smoker patient with lung adenocarcinoma. The patient showed no evidence of known mutations, gene amplifications or gene fusions associated with lung cancer. In order to pursue other possible gene targets, genomic DNA from a tumor biopsy sample was analyzed by targeted next generation sequencing, which identified the presence of a novel NTRK1 gene fusion. The gene fusion marker was determined to be a NTRK1 -MP RIP gene fusion.
  • the NTRK1 gene encodes the TRKA receptor tyrosine kinase.
  • the NTRK1 gene has been isolated from a number of species such as human, chimpanzee, dog, cow, mouse, rat, chicken and zebrafish and the sequence determined. All these gene sequences are known to one skilled in the art and are intended to be encompassed in the present invention. Gene fusions involving NTRK1 have previously been reported in papillary thyroid cancer, but have not been reported in lung cancer or other malignancies.
  • the MPRIP gene encodes the Myosin phosphatase Rho-interacting Protein.
  • the MPRIP gene has been isolated from a number of species such as human, chimpanzee, dog, cow, mouse, rat, chicken, zebrafish and C. elegans and the sequence determined. All these gene sequences are known to one skilled in the art and are intended to be encompassed in the present invention.
  • Customized RT-PCR assays including novel primers, were developed to detect the mRNA transcript of the NTRKl-MPRIP gene fusion.
  • the RT-PCR successfully amplified a small product containing sequences from both MPRIP and NTRKl, confirming expression of a novel gene fusion that included exon 1-21 of MPRIP and exons 14-20 of NTRKl.
  • Novel FISH assays were also developed to detect the presence of the NTRKl-MPRIP gene fusion in clinical specimens. (See Examples 2 and 3.)
  • FISH probes that would detect other NTRKl gene fusions, regardless of the specific 5' gene fusion partner, were also developed. (See Examples 2 and 4.)
  • NTRKl fusion genes are of significant biologic interest. Gene fusions involving NTRKl have previously been reported in papillary thyroid cancer, but have not been reported in lung cancer or other malignancies. Thus, the NTRKl fusion gene serves as a novel diagnostic marker of cancer. NTRKl gene encodes the TRKA receptor tyrosine kinase. The presence of the gene fusion was examined in tumor samples obtained from various cancer models, including lung and colorectal cancers, and the sensitivity of the tumor to tyrosine kinase inhibitors was investigated. The objective was to use this gene fusion marker to identify a clinically relevant marker of cancer patient response to tyrosine kinase inhibitor treatment. The methods used are detailed in the Examples section of this disclosure.
  • tyrosine kinase inhibitors that are currently in various stages of clinical development including, without limitation, crizotinib, ponatinib, dovitinib, rebastinib, CEP-701, AZD-7451, ARRY-470, ARRY-523, and ARRY-772 as well as other tyrosine kinase inhibitor compounds known in the art that are predicted to inhibit TRKA or oncogenic fusion proteins that contain the TRKA kinase domain, such as NTRKl fusion proteins.
  • Data presented in Example 5 demonstrates that small molecule tyrosine kinase inhibitors inhibit activated TRKA.
  • the marker may also be studied in more detail and/or be used as target for the discovery of other modulators of disease or therapeutic agents.
  • the NTRKl gene fusion markers including the NTRKl-MPRIP gene fusion marker, are indicators of cancer patient response to tyrosine kinase inhibitors. Accordingly, in one aspect, the invention provides a marker, the presence or expression level of which is indicative of cancer patient response to tyrosine kinase inhibitors.
  • the gene fusion markers of the present invention can serve as indicators of cancer patient response to other targeted cancer therapies such as administration of HSP90 inhibitors (or other chaperone inhibitors) or agents that target downstream signalling cascades.
  • HSP90 inhibitors include well known in the art and are commercially available. All such inhibitors are encompassed in the present invention.
  • HSP90 inhibitors include without limitation geldanamycin, herbimycin, 17-AAG, PU24FC1, STA-9090, IPI-504, and AUY-922.
  • agents that target downstream signalling cascades include selumetinib (AZD-6244) and MK2206.
  • the presence of the marker may be detected by detecting a polynucleotide.
  • the polynucleotide may be a probe that specifically hybridizes with the NTRKl gene sequences and identifies a chromosomal rearrangement involving the NTRKl gene.
  • the polynucleotide may be a primer that specifically binds and amplifies a polynucleotide sequence that is indicative of the presence of the gene fusion involving a NTRKl gene, including the NTRKl -MPRIP gene fusion marker.
  • the magnitude of the variation depends to some extent on the reproducibility of the separation means and the specificity and sensitivity of the detection means used to make the measurement.
  • the method and technique used to measure the markers is sensitive and reproducible.
  • the presence of the gene fusion marker may also be detected by detecting a polynucleotide.
  • Polypeptides corresponding to the NTRKl gene fusion markers may include a fragment, precursor, successor or modified version of the protein encoded by the NTRKl- gene fusion markers.
  • the invention includes a molecule that comprises a fragment, precursor, successor or modified polypeptide encoded by the NTRKl- gene fusion markers.
  • Another embodiment of the present invention relates to an assay system including a plurality of antibodies, or antigen binding fragments thereof, or aptamers for the detection of the expression of the NTRKl gene fusion markers of the invention.
  • the plurality of antibodies, or antigen binding fragments thereof, or aptamers selectively bind to proteins encoded by the NTRKl gene fusion markers.
  • the terms "patient,” “subject,” “a subject who has cancer” and “cancer patient” are intended to refer to subjects who have been diagnosed with a cancer or are suspected of having cancer.
  • the terms "non-subject” and “a subject who does not have cancer” are intended to refer to a subject who has not been diagnosed with cancer, or who is cancer- free as a result of surgery to remove one or more tumors.
  • a non-cancer subject may be healthy and have no other disease, or they may have a disease other than cancer.
  • the NTRKl gene has been found to be conserved in a number of species such as chimpanzee, dog, cow, mouse, rat, chicken, and zebrafish and their sequences are known.
  • the patient or subject may be a mammal.
  • the patient or subject is human.
  • Polypeptides encoded by the NTRKl gene fusion may be isolated by any suitable method known in the art.
  • Native polypeptides encoded by the NTRKl gene fusion can be purified from natural sources by standard methods known in the art (e.g., chromatography, centrifugation, differential solubility, immunoassay).
  • the polypeptides may be isolated from a tumor sample.
  • the polypeptides may be isolated from a sample by contacting the sample with substrate-bound antibodies or aptamers that specifically bind to the marker.
  • the present invention also includes polynucleotides related to the gene fusion markers of the present invention.
  • the invention provides polynucleotides that comprise the NTRKl gene fusion markers of the invention. These may be referred to as polynucleotide markers.
  • the polynucleotide markers may be genomic DNA, cDNA, or mRNA transcripts.
  • the invention provides polynucleotides that have substantial sequence similarity to a polynucleotide that comprises the NTRKl gene fusion markers or variants thereof, including the NTRKl - gene fusion markers.
  • the polypeptides encoded by the NTRKl gene fusion markers i.e. polypeptide markers may be used as surrogate markers of the NTRKl -MPRIP gene fusion.
  • polypeptide markers may be used as surrogate markers of the NTRKl -MPRIP gene fusion.
  • the presence or level or activity of the polypeptides may be interrogated (e.g., to identify cancer patients expected to respond to tyrosine kinase inhibitors).
  • Polynucleotide markers comprising the gene fusion markers may be isolated by any suitable method known in the art.
  • Native polynucleotide markers may be purified from natural sources by standard methods known in the art (e.g., chromatography, centrifugation, differential solubility, immunoassay).
  • a polynucleotide marker may be isolated from a mixture by contacting the mixture with substrate bound probes that are complementary to the polynucleotide marker under hybridization conditions.
  • polynucleotide markers comprising the NTRKl gene fusion may be synthesized by any suitable chemical or recombinant method known in the art.
  • the makers can be synthesized using the methods and techniques of organic chemistry.
  • a polynucleotide marker can be produced by polymerase chain reaction (PCR).
  • the present invention also encompasses molecules which specifically bind the polypeptide or polynucleotide markers of the present invention.
  • the invention provides molecules that specifically bind to a polypeptide marker or a polynucleotide marker.
  • specifically binding refers to the interaction between binding pairs (e.g., an antibody and an antigen or aptamer and its target). In some embodiments, the interaction has an affinity constant of at most 10 ⁇ 6 moles/liter, at most 10 ⁇ 7 moles/liter, or at most 10 ⁇ 8 moles/liter. In other embodiments, the phrase "specifically binds" refers to the specific binding of one protein to another ⁇ e.g.
  • an antibody, fragment thereof, or binding partner to an antigen wherein the level of binding, as measured by any standard assay (e.g., an immunoassay), is statistically significantly higher than the background control for the assay.
  • controls typically include a reaction well/tube that contain antibody or antigen binding fragment alone (i.e. , in the absence of antigen), wherein an amount of reactivity (e.g., non-specific binding to the well) by the antibody or antigen binding fragment thereof in the absence of the antigen is considered to be background. Binding can be measured using a variety of methods standard in the art including enzyme immunoassays (e.g. , ELISA), immunoblot assays, etc.).
  • the binding molecules include antibodies, aptamers and antibody fragments.
  • antibody refers to an immunoglobulin molecule capable of binding an epitope present on an antigen.
  • the term is intended to encompasses not only intact immunoglobulin molecules such as monoclonal and polyclonal antibodies, but also bi-specific antibodies, humanized antibodies, chimeric antibodies, anti-idiopathic (anti-ID) antibodies, single-chain antibodies, Fab fragments, F(ab') fragments, fusion proteins and any modifications of the foregoing that comprise an antigen recognition site of the required specificity.
  • an aptamer is a non-naturally occurring nucleic acid having a desirable action on a target.
  • a desirable action includes, but is not limited to, binding of the target, catalytically changing the target, reacting with the target in a way which modifies/alters the target or the functional activity of the target, covalently attaching to the target as in a suicide inhibitor, facilitating the reaction between the target and another molecule.
  • the action is specific binding affinity for a target molecule, such target molecule being a three dimensional chemical structure other than a polynucleotide that binds to the nucleic acid ligand through a mechanism which predominantly depends on Watson/Crick base pairing or triple helix binding, wherein the nucleic acid ligand is not a nucleic acid having the known physiological function of being bound by the target molecule.
  • antibodies that specifically bind polypeptide markers polynucleotide markers of the invention already may be known and/or available for purchase from commercial sources.
  • the antibodies of the invention may be prepared by any suitable means known in the art.
  • antibodies may be prepared by immunizing an animal host with a marker or an immunogenic fragment thereof (conjugated to a carrier, if necessary).
  • Adjuvants e.g., Freund's adjuvant
  • Sera containing polyclonal antibodies with high affinity for the antigenic determinant can then be isolated from the immunized animal and purified.
  • antibody-producing tissue from the immunized host can be harvested and a cellular homogenate prepared from the organ can be fused to cultured cancer cells.
  • Hybrid cells which produce monoclonal antibodies specific for a marker can be selected.
  • the antibodies of the invention can be produced by chemical synthesis or by recombinant expression.
  • a polynucleotide that encodes the antibody can be used to construct an expression vector for the production of the antibody.
  • the antibodies of the present invention can also be generated using various phage display methods known in the art.
  • Antibodies or aptamers that specifically bind markers of the invention can be used, for example, in methods for detecting protein products encoded by the NTRK1 gene fusion markers of the invention.
  • antibodies or aptamers against a polypeptide marker or polynucleotide marker of the invention can be used to assay a tissue sample (e.g., a thin cortical slice) for the markers.
  • the antibodies or aptamers can specifically bind to the marker, if any, present in the tissue sections and allow the localization of the marker in the tissue.
  • antibodies or aptamers labelled with a radioisotope may be used for in vivo imaging or treatment applications.
  • the present invention also provides methods of detecting the NTRK1 gene fusion markers of the present invention.
  • the practice of the present invention employs, unless otherwise indicated, conventional methods of analytical biochemistry, microbiology, molecular biology and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. (See, e.g., Sambrook, J. et al. Molecular Cloning: A Laboratory Manual. 3rd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2000; DNA Cloning: A Practical Approach, Vol. I & II (D. Glover, ed.); Oligonucleotide Synthesis (N.
  • the markers of the invention may be detected by any method known to those of skill in the art, including without limitation LC-MS, GC-MS, immunoassays, hybridization and enzyme assays.
  • the detection may be quantitative or qualitative.
  • a wide variety of conventional techniques are available, including mass spectrometry, chromatographic separations, 2-D gel separations, binding assays (e.g., immunoassays), competitive inhibition assays, and so on.
  • Any effective method in the art for measuring the presence/absence, level or activity of a polypeptide or polynucleotide is included in the invention. It is within the ability of one of ordinary skill in the art to determine which method would be most appropriate for measuring a specific marker.
  • an ELISA assay may be best suited for use in a physician's office while a measurement requiring more sophisticated instrumentation may be best suited for use in a clinical laboratory. Regardless of the method selected, it is important that the measurements be reproducible.
  • quantification can be based on derivatization in combination with isotopic labelling, referred to as isotope coded affinity tags ("ICAT").
  • ICAT isotope coded affinity tags
  • a specific amino acid in two samples is differentially and isotopically labelled and subsequently separated from peptide background by solid phase capture, wash and release.
  • the intensities of the molecules from the two sources with different isotopic labels can then be accurately quantified with respect to one another.
  • Quantification can also be based on the isotope dilution method by spiking in an isotopically labelled peptide or protein analogous to those being measured.
  • quantification can also be determined without isotopic standards using the direct intensity of the analyte comparing with another measurement of a standard in a similar matrix.
  • one- and two-dimensional gels have been used to separate proteins and quantify gels spots by silver staining, fluorescence or radioactive labelling. These differently stained spots have been detected using mass spectrometry, and identified by tandem mass spectrometry techniques.
  • a number of the assays discussed above employ a reagent that specifically binds to a NTRKl gene fusion marker of the invention.
  • Any molecule that is capable of specifically binding to the NTRKl gene fusion markers of the invention is included within the invention.
  • the binding molecules are antibodies or antibody fragments.
  • the binding molecules are non-antibody species, such as aptamers or nucleotide probes.
  • the binding molecules may be identified and produced by any method accepted in the art. Methods for identifying and producing antibodies and antibody fragments specific for an analyte are well known.
  • the markers of the invention also may be detected or measured using a number of chemical derivatization or reaction techniques known in the art. Reagents for use in such techniques are known in the art, and are commercially available for certain classes of target molecules.
  • Measurement of the relative amount of an RNA or protein marker of the invention may be by any method known in the art (see, e.g., Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989; and Current Protocols in Molecular Biology, eds. Ausubel et al. John Wiley & Sons: 1992).
  • RNA detection include RNA extraction from a cell or tissue sample, followed by hybridization of a labelled probe (e.g., a complementary polynucleotide) specific for the target RNA to the extracted RNA, and detection of the probe (e.g., Northern blotting).
  • a labelled probe e.g., a complementary polynucleotide
  • detection of the probe e.g., Northern blotting
  • protein detection include protein extraction from a cell or tissue sample, followed by hybridization of a labelled probe (e.g., an antibody) specific for the target protein to the protein sample, and detection of the probe.
  • the label group can be a radioisotope, a fluorescent compound, an enzyme, or an enzyme co-factor.
  • Detection of specific protein and polynucleotides may also be assessed by gel electrophoresis, column chromatography, direct sequencing, or quantitative PCR (in the case of polynucleotides) among many other techniques well known to those skilled in the art.
  • Detection of the presence or number of copies of all or a part of a marker gene of the invention may be performed using any method known in the art. Typically, it is convenient to assess the presence and/or quantity of a DNA or cDNA by Southern analysis, in which total DNA from a cell or tissue sample is extracted, is hybridized with a labelled probe (e.g., a complementary DNA molecule), and the probe is detected.
  • the label group can be a radioisotope, a fluorescent compound, an enzyme, or an enzyme co-factor.
  • Other useful methods of DNA detection and/or quantification include direct sequencing, gel electrophoresis, column chromatography, and quantitative PCR, as is known by one skilled in the art.
  • High stringency hybridization and washing conditions refer to conditions which permit isolation of nucleic acid molecules having at least about 80% nucleic acid sequence identity with the nucleic acid molecule being used to probe in the hybridization reaction (i.e., conditions permitting about 20% or less mismatch of nucleotides).
  • Very high stringency hybridization and washing conditions refer to conditions which permit isolation of nucleic acid molecules having at least about 90% nucleic acid sequence identity with the nucleic acid molecule being used to probe in the hybridization reaction (i.e., conditions permitting about 10% or less mismatch of nucleotides).
  • One of skill in the art can calculate the appropriate hybridization and wash conditions to achieve these particular levels of nucleotide mismatch. Such conditions will vary, depending on whether DNA:RNA or DNA:DNA hybrids are being formed. Calculated melting temperatures for DNA:DNA hybrids are 10°C less than for DNA:RNA hybrids.
  • stringent hybridization conditions for DNA:DNA hybrids include hybridization at an ionic strength of 6X SSC (0.9 M Na + ) at a temperature of between about 20°C and about 35°C (lower stringency), more preferably, between about 28°C and about 40°C (more stringent), and even more preferably, between about 35°C and about 45°C (even more stringent), with appropriate wash conditions.
  • 6X SSC 0.9 M Na +
  • stringent hybridization conditions for DNA:RNA hybrids include hybridization at an ionic strength of 6X SSC (0.9 M Na + ) at a temperature of between about 30°C and about 45°C, more preferably, between about 38°C and about 50°C, and even more preferably, between about 45°C and about 55°C, with similarly stringent wash conditions.
  • 6X SSC 0.9 M Na +
  • T m can be calculated empirically as set forth in Sambrook et al., supra, pages 9.31 to 9.62.
  • the wash conditions should be as stringent as possible, and should be appropriate for the chosen hybridization conditions.
  • hybridization conditions can include a combination of salt and temperature conditions that are approximately 20- 25°C below the calculated T m of a particular hybrid
  • wash conditions typically include a combination of salt and temperature conditions that are approximately 12-20°C below the calculated T m of the particular hybrid.
  • hybridization conditions suitable for use with DNA:DNA hybrids includes a 2-24 hour hybridization in 6X SSC (50% formamide) at about 42°C, followed by washing steps that include one or more washes at room temperature in about 2X SSC, followed by additional washes at higher temperatures and lower ionic strength (e.g., at least one wash as about 37°C in about 0.1X-0.5X SSC, followed by at least one wash at about 68°C in about 0.1X-0.5X SSC).
  • 6X SSC 50% formamide
  • a chemotherapeutic drug or drug combination can be evaluated or re-evaluated in light of the assay results of the present invention.
  • the tyrosine kinase inhibitor drug(s) can be administered differently to different subject populations, depending on the presence of the NTRK1-MPRIP gene fusion markers of the invention in tumor samples from the subjects tested. Results from the different drug regimens can also be compared with each other directly.
  • the assay results may indicate the desirability of one drug regimen over another, or indicate that a specific drug regimen should or should not be administered to a cancer patient.
  • the finding of the presence of the NTRK1-MPRIP gene fusion markers of the invention is indicative of a good prognosis for response to treatment with chemotherapeutic agents comprising tyrosine kinase inhibitors ("tyrosine kinase inhibitor chemotherapeutic agents").
  • chemotherapeutic agents comprising tyrosine kinase inhibitors
  • the absence of the NTRK1-MPRIP gene fusion markers of the invention in a cancer patient is indicative of a poor prognosis for response to treatment with tyrosine kinase inhibitor chemotherapeutic agents, and may further recommend not administering tyrosine kinase inhibitor chemotherapeutic agent drug regimens.
  • the invention provides a kit for identifying cancer patients predicted to respond or not respond to tyrosine kinase inhibitor drugs, based on the presence or absence of NTRK1 -MPRIP gene fusion markers of the disclosure.
  • kits of the invention may comprise one or more of the following: an antibody, wherein the antibody specifically binds with a polypeptide marker, a labelled binding partner to the antibody, a solid phase upon which is immobilized the antibody or its binding partner, a polynucleotide probe that can hybridize to a polynucleotide marker, pairs of primers that under appropriate reaction conditions can prime amplification of at least a portion of a gene fusion polynucleotide marker (e.g., by PCR), instructions on how to use the kit, and a label or insert indicating regulatory approval for diagnostic or therapeutic use.
  • an antibody wherein the antibody specifically binds with a polypeptide marker, a labelled binding partner to the antibody, a solid phase upon which is immobilized the antibody or its binding partner
  • a polynucleotide probe that can hybridize to a polynucleotide marker
  • pairs of primers that under appropriate reaction conditions can prime amplification of at least a portion of a gene fusion
  • the invention further includes polynucleotide or polypeptide microarrays comprising polypeptides of the invention, polynucleotides of the invention, or molecules, such as antibodies, which specifically bind to the polypeptides or polynucleotides of the present invention.
  • standard techniques of microarray technology are utilized to assess expression of the polypeptides markers and/or identify biological constituents that bind such polypeptides.
  • Protein microarray technology is well known to those of ordinary skill in the art and is based on, but not limited to, obtaining an array of identified peptides or proteins on a fixed substrate, binding target molecules or biological constituents to the peptides, and evaluating such binding.
  • Polynucleotide arrays, particularly arrays that bind polypeptides of the invention also can be used for diagnostic applications, such as for identifying subjects that have a condition characterized by expression of polypeptide markers, e.g., cancer.
  • the assay systems of the present invention can include a means for detecting in a sample of tumor cells the presence of the NTRKl gene fusion markers of the invention, and/or a level of expression of the NTRK1-MPRIP gene fusion markers of the invention, and/or a level of protein product of the NTRKl -MP RIP gene fusion markers of the invention.
  • the assay system preferably also includes one or more controls.
  • the controls may include: (i) a control sample for detecting sensitivity to tyrosine kinase inhibitor chemotherapeutics; (ii) a control sample for detecting resistance to tyrosine kinase inhibitor chemotherapeutics; (iii) information containing a predetermined control level of markers to be measured with regard to tyrosine kinase inhibitor sensitivity or resistance ⁇ e.g., a predetermined control level of a marker of the NTRKl gene fusion of the present invention that has been correlated with sensitivity to tyrosine kinase inhibitor chemotherapeutics or resistance to tyrosine kinase inhibitor chemotherapeutics).
  • a means for detecting the NTRKl gene fusion markers of the disclosure can generally be any type of reagent that can include, but are not limited to, polynucleotides, hybridization probes, PCR primers, antibodies and antigen binding fragments thereof, peptides, binding partners, aptamers, enzymes, and small molecules. Additional reagents useful for performing an assay using such means for detection can also be included, such as reagents for performing immunohistochemistry, Fluorescent in situ Hybridization (FISH) or a preferred binding assay.
  • FISH Fluorescent in situ Hybridization
  • the means for detecting of the assay system of the present invention can be conjugated to a detectable tag or detectable label.
  • a detectable tag can be any suitable tag which allows for detection of the reagents used to detect the gene or protein of interest and includes, but is not limited to, any composition or label detectable by spectroscopic, photochemical, electrical, optical or chemical means.
  • Useful labels in the present invention include: biotin for staining with labeled streptavidin conjugate, magnetic beads (e.g., DYNABEADSTM), fluorescent dyes (e.g., fluorescein, texas red,
  • radiolabels e.g., H, I, S, C, or P
  • enzymes e.g., horse radish peroxidase, alkaline phosphatase and others commonly used in an
  • ELISA ELISA
  • colorimetric labels such as colloidal gold or colored glass or plastic (e.g., polystyrene, polypropylene, latex, etc.) beads.
  • a substrate suitable for immobilization of a means for detecting includes any solid support, such as any solid organic, biopolymer or inorganic support that can form a bond with the means for detecting without significantly affecting the activity and/or ability of the detection means to detect the desired target molecule.
  • exemplary organic solid supports include polymers such as polystyrene, nylon, phenol-formaldehyde resins, and acrylic copolymers (e.g., polyacrylamide).
  • the kit can also include suitable reagents for the detection of the reagent and/or for the labeling of positive or negative controls, wash solutions, dilution buffers and the like.
  • the assay system can also include a set of written instructions for using the system and interpreting the results.
  • the assay system can also include a means for detecting a control marker that is characteristic of the cell type being sampled can generally be any type of reagent that can be used in a method of detecting the presence of a known marker (at the nucleic acid or protein level) in a sample, such as by a method for detecting the presence of a marker described previously herein.
  • the means is characterized in that it identifies a specific marker of the cell type being analyzed that positively identifies the cell type. For example, in a lung tumor assay, it is desirable to screen lung cancer cells for the level of the marker expression and/or biological activity.
  • the means for detecting a control marker identifies a marker that is characteristic of, for example, a lung cell, so that the cell is distinguished from other cell types, such as a connective tissue or inflammatory cell.
  • a means increases the accuracy and specificity of the assay of the present invention.
  • Such a means for detecting a control marker include, but are not limited to: a probe that hybridizes under stringent hybridization conditions to a nucleic acid molecule encoding a protein marker; PCR primers which amplify such a nucleic acid molecule; an aptamer that specifically binds to a conformationally-distinct site on the target molecule; and/or an antibody, antigen binding fragment thereof, or antigen binding peptide that selectively binds to the control marker in the sample.
  • Nucleic acid and amino acid sequences for many cell markers are known in the art and can be used to produce such reagents for detection.
  • the assay systems and methods of the present invention can be used not only to identify patients that are predicted to be responsive to tyrosine kinase inhibitor chemotherapeutic agents, but also to identify treatments that can improve the responsiveness of cancer cells which are resistant to tyrosine kinase inhibitor chemotherapeutic agents, and to develop adjuvant treatments that enhance the response of cancer patients to tyrosine kinase inhibitor chemotherapeutic agent(s).
  • Example 1 This example illustrates the RT-PCR assay performed for detecting the presence of NTRK1 -MP RIP fusion gene.
  • RNA extraction of a formalin-fixed, paraffin-embedded (FFPE) tumor section sample a gene specific RT-PCR method was used to identify the NTRK1 -MPRIP fusion gene.
  • the resulting RT-PCR reaction generated an approximately 280bp fragment (see Figure 3B) that upon sequencing confirmed the presence of a novel in-frame NTRKl-MPRIP fusion gene in which exon 21 of MPRIP is fused to exon 14 of NTRKl.
  • the primer sequences for RT PCR and cloning are as follows:
  • Primer Name Primer Sequence (5' to 3')
  • MPRIP CC1F1 ACACACGAGCTGACCTCTCTGC (SEQ ID NO: 3)
  • MPRIP CC2F1 GTGCCTGGAGAATGCCCATCTG (SEQ ID NO:4)
  • MPRIP CC3F1 GCGAAGGCTAAGGCTGACTGTG (SEQ ID NO:5)
  • NTRK1Y490R1 CGGCGCTTGATGTGGTGAAC (SEQ ID NO: 8)
  • NTRKl stopRl TATTCCGGCTAACCACTCCCAG (SEQ ID NO: 9)
  • NTRKl stopR2 CCTAGCCCAGGACATCCAGG (SEQ ID NO: 10)
  • RNA extraction from FFPE and Frozen tissues RNA from FFPE was processed using the RECOVERALLTM Total Nucleic Acid Isolation Kit [Ambion (Austin, Tx)]. Sections were initially deparaffinized in xylene and washed with 100% ethanol prior to the Protease K digest. After Protease K digest samples were processed for RNA isolation per manufacture instructions.
  • NTRKl-MPRIP RT-PCR To identify the fusion breakpoint of MPRIP to NTRKl from the RNA sample, RT-PCR was carried out using the SUPERSCRIPTTM III First-Strand Synthesis System (Invitrogen) with a NTRKl primer located in exon 15 of NTRKl (NTRK Y490R1). For first strand synthesis, RNA, dNTPs and NTRKl Y490F1 primer were initially denatured at 65°C for 5 mins and then placed on ice for 2 mins.
  • SUPERSCRIPTTM III reserve transcriptase, RNasin, DTT and reaction buffer was then added to the denatured samples and first strand synthesis was carried out in a PCR machine under the following conditions: 55°C, lOmins; 50°C 120mins; 70°C, 15mins; 4°C hold.
  • the duplexed RNA was removed by an RNase H digest at 37°C for 20mins.
  • RT-PCR was then performed to amplify NTRKl-MPRIP fusion using the same NTRKl reverse primer, NTRKl Y490R1 and a primer to MPRIP located in its 3 rd coil-coiled domain (MPRIP CC3F1).
  • PCR conditions for detecting the NTRKl fusion initial denaturation at 95°C for 5mins; 40 cycles of PCR (95°C for 30 sec, annealing at 58°C for 30 sec, and 30 sec extension at 72°C).
  • PCR products were resolved on a 1.5% agarose gel and the fragments were treated with EXOSAPITTM (Affymetrix) to remove reaction primers and unincorporated dNTPs.
  • EXOSAPITTM Affymetrix
  • the RT-PCR products were sequenced by the University of Colorado Cancer Center DNA Sequencing and Analysis Core using the same forward and reverse primer in the RT-PCR reaction.
  • the reference sequences used for exon alignment are NCBI Reference Sequences: NM_002529.3 (NTRKl) and NM_015134.3 (MPRIP).
  • Example 2 This example illustrates the design of FISH gene fusion probe sets to detect chromosomal rearrangements involving the NTRKl and MPRIP genes generated by the t(l ; 17) (q23.1;pl 1.2) translocation and the break apart probe sets to detect chromosomal rearrangements involving the 5' and 3' ends of the NTRKl gene mapping at lq23.1.
  • the FISH NTRKl-MPRIP fusion probes and NTRKl break apart probe sets were developed and validated as described below.
  • Probe Development Clone selection, PCR verification, DNA extraction, amplification, and labelling:
  • NTRKl -MPRIP fusion probe set four BAC clones were selected: two for the 3' NTRKl probe (labeled with SpectrumRed, SR), recognizing sequences at and downstream (3') the exon 20 of the NTRKl gene (RPl 1-1038N 13 and RPl 1-1059C21), and two for the 5' MPRIP probe (labeled with SpectrumGreen, SG), recognizing sequences at and upstream (5') of the exon 29 of the MPRIP gene (RPl 1-796 J 19, and RPl 1- 125116).
  • BAC clones were purchased from BACPAC Resources (CHORI, Oakland CA). To verify that the BAC clones encompassed the regions of interest, the specific primers were designed and synthesized by Integrated DNA Technologies. The glycerol stabs were plated on agar plates containing selected antibiotic and 10 single-cell colonies from each BAC clone were selected for PCR verification. Two PCR- validated single colonies per BAC clone had aliquots frozen in glycerol stocks at -86°C.
  • Mini-cultures of 1 or 2 validated single-cell colonies from each BAC clone were grown in antibiotic-containing LB medium, and genomic DNA was extracted and purified using QIAAMPTM DNA Mini Kit from Qiagen.
  • the purified genomic DNAs from each BAC clone were subject to whole genomic amplification using the REPLI-g Midi Kit from Qiagen.
  • Amplified human DNA from each BAC clone was labeled in 1 ⁇ g aliquots with SpectrumRed conjugated dUTPs (all 3' NTRKl probe clones), and SpectrumGreen conjugated dUTPs (all 5' MPRIP probe clones and all 5' NTRKl probe clones), using the Vysis Nick translation kit (Cat# 32-801300), according to the manufacturer's instructions. Each reaction was then treated according to the planned use in validation assays for single clones or combos.
  • Labeled DNAs were co-precipitated with herring sperm DNA as carrier (1 :50) and human Cot-1 DNA (1 : 10) for blocking repetitive sequences and each pellet was diluted in 10 ⁇ of TDENHYBTM-2 hybridization buffer from Insitus Biotechnologies for a final concentration of 100 ng/ ⁇ .
  • Typical fluorescent signals are seen as a round and compact spot, named "dot" (see Figure 30).
  • Atypical signal patterns may be seen in nuclei due to technical variations, probe quality and chromatin stretching.
  • the fusion 5 ' MPRIP- 3 ' NTRK1 and the break-apart 5 ' NTRK1- 3 ' NTRK1 probe sets are designed for differentiation between normal and rearranged genes in tumor cells, any atypical configuration of the signals or the relationship (signal pattern) between both probes in a set should be evaluated in detail in normal specimens.
  • split is a divided signal, usually in 2 or 3 fragments; patchy is a diffuse signal with irregular presentation and multiple tiny spots; stringy is an elongated fibrous-like signal. All four of these signal configurations were presented in cell suspension assays. For signal scoring, one dot was counted as 1 signal; a signal with split, patchy or stringy configuration was also counted as 1, even if it consists of 2 or more small spots.
  • Example 3 This example illustrates that the FISH fusion probe set for the detection of the MPRIP/NTRK1 gene fusion works efficiently both in cell suspensions and FFPE specimens.
  • FISH assay All FISH assays in cell suspensions were performed according to standard protocol. Briefly, the slides were treated in a solution of 70% acetic acid for 20-30 sec, incubated in 0.008% pepsin/0.01 M HCL at 37°C for 3-5 min, fixed in 1% formaldehyde solution for 10 min and dehydrated in graded ethanol series. Probe mix was applied to the selected 12 mm 2 diameter hybridization areas, which were covered with glass cover slips and sealed with rubber cement. DNA co-denaturation was performed for 8 minutes in an 85°C dry oven and hybridization was allowed to occur in a moist chamber at 37°C for 40 hours.
  • Post-hybridization washes were performed with 2xSSC/0.3% NP-40 at 72°C for 2 min, and 2xSSC for 2 min at room temperature, and dehydrated in graded ethanol series. Chromatin was counterstained with DAPI (0 ⁇ g/ml in Vectashield Mounting Medium, Vector Laboratories).
  • FISH assays in FFPE specimens were also performed according to standard lab protocols. Specimens were incubated at 56°C for 4 h, dewaxed in CitriSolv, dehydrated and air-dried, then slides were soaked in 2xSSC at 75°C for 13-14 min and digested in 0.6 mg/ml proteinase K at c for 14-16 min. After dehydration, the fusion probe set 5 ' MPRIP- 3 ' NTRKl which contained lOOng of each of the 4 BAC clones in 4.5 ⁇ of hybridization buffer was applied to selected 1 13 mm 2 hybridization areas and hybridization was allowed to occur for -40 h in a humidified chamber at 37°C. Post-hybridization washes were performed as described above for the cell line.
  • Chromosome Mapping The quality of the preparations and the intensity of the fluorescence signal were excellent in all slides. Chromosomal mapping was investigated in 25 karyotypically normal metaphase spreads and all of the individual BAC clones mapped correctly: the BAC clones RP1 1-1038N13 and RP1 1-1059C21 for 3' NTRKl mapped at lq23.1, the BAC clones RP1 1-796J19, and RP1 1-125116 for 5' MPRIP mapped at 17p 1 1.2 and the BAC clones RPl l-71 1018/ RP11-891L18 for 5' NTRKl also mapped at lq23.1.
  • the GM09948 cell line had about 99% of the cells with diploid (2N) and 1% of the cells with tetraploid (4N) chromosome content. These cells had, respectively, 2 and 4 copies of each of the clones tested. See Figures 7 and 8.
  • Example 4 This example illustrates that the FISH break apart probe set for the detection of the 5 NTRKl 73 NTRKl gene rearrangement works efficiently both in cell suspensions and FFPE specimens.
  • the 5 NTRKl 73 NTRKl Break Apart probe set was validated in the cell line GM09948 (normal karyotype 46,XY) by using the two 3' NTRKl probes and the two 5' NTRKl probes, (Clones RP1 1-1038N13/RP11- 1059C21+ RP1 1-71 1018/ RP1 1-891 LI 8), because using only one clone of each set will generate split signals, using the same methodology as described above for gene fusion probes.
  • Figures 10a- lOd show the results.
  • 5' NTRKl (green signal) is the proximal end of the gene with respect to the centromere and 3 'NTRKl (red signal) is the distal end of the gene with respect to the centromere. Both probes mapped correctly at lq23.1.
  • the 5 NTRKl 73 NTRKl Break Apart probe set was tested in the GM09948 cell line and specimen S12-6988 Bl as described in Example 3. Analysis was performed on epifluorescence microscope using single interference filters sets for green (FITC), red (Texas red) and blue (DAPI). For each interference filter, monochromatic images were acquired and merged using Cyto Vision (Leica Microsystems Inc).
  • Example 5 This example demonstrates that activated TRKA (the protein product of the NTRKl gene) can be inhibited by several small molecule tyrosine kinase inhibitors.
  • Gene fusion events lead to activation of the kinase domain encoded in the 3' end of the fusion gene by leading to increased expression via the promoter of the 5' gene in the fusion and often by inducing dimerization through domains (such as coiled-coil domains) encoded within the 5' gene fusion partner.
  • This enhanced dimerization leads to constitutive activation of the kinase domain, in this case the kinase domain of TRKA.
  • TRKA small molecular tyrosine kinase inhibitors inhibit TRKA
  • the NTRKl gene was cloned into pCDH-MCS l-EFl-puro with the addition of a hemagglutinin (HA) tag at the 3' (C- terminal) end.
  • HA hemagglutinin
  • This vector was transiently transfected into 293T cells which demonstrated expression of TRKA compared to the empty vector control using an antibody to both HA (Cell Signaling, C29F4) and TRKA (Santa Cruz, C-1 18) in immunoblot analysis (Figure 12A).
  • Figure 12A shows expression of an approximate 1 15- 120kD protein detected by an HA-specific antibody (left, Cell Signaling) and a TRKA-specific antibody (right, Santa Cruz, SC-1 18).
  • Immunoprecipation of TRKA using the HA-specific antibody followed by immunobloting with an anti-phosphotyrosine antibody (Millipore, 4G10) demonstrated significant phosphorylation of TRKA in the DMSO-treated (control) sample ( Figure 12B).
  • Phosphorylation of TRKA was significantly reduced after treatment of cells with 1 ⁇ of either K252A, crizotinib, or CEP-701 (all purchased from Selleck Chemical) for 5 hours, indicating inhibition of TRKA activity.
  • Figure 12B shows immunoprecipation using an HA-specific antibody (Cell Signaling) followed by immunoblot using the same antibody (left) or a phosphotyrosine specific antibody (right) following treatment with 1 ⁇ of the indicated inhibitors or DMSO (control) for 5 hours.
  • Figure 12C shows that expression of NTRKl -MPRIP yields a chimeric protein that is autophosphorylated.
  • EV empty vector
  • CUTO-3 early passage cells in culture
  • TRKA nerve growth factor
  • Figure 13 shows SDS-PAGE of 293T cell lysates with expression of TRKA-HA or empty vector in the presence or absence of NGF (10 minutes) and the presence or absence of the indicated tyrosine kinase inhibitors at 1 ⁇ for 5 hours.
  • Membranes were probed with antibodies to TRKA phosphotyrosine 490, 674, and 675 (Cell Signaling), total TRKA (anti- HA, Cell Signaling), AKT phosphoserine 473 (Cell Signaling), total AKT (Cell Signaling), phosphorylated ERK p42/44 (Cell Signaling), total ERK p42/44 (Cell Signaling), and tubulin (Santa Cruz, SC-8035).
  • Nikiforov YE Nikiforova MN. Molecular genetics and diagnosis of thyroid cancer. Nat Rev Endocrinol 201 1;7:569-80.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Pathology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Oncology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Hospice & Palliative Care (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Biomedical Technology (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/US2013/057495 2012-08-31 2013-08-30 Methods for diagnosis and treatment of cancer Ceased WO2014036387A2 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
US14/423,867 US20150218652A1 (en) 2012-08-31 2013-08-30 Methods for diagnosis and treatment of cancer
CA2882759A CA2882759C (en) 2012-08-31 2013-08-30 Detection of the ntrk1-mprip gene fusion for cancer diagnosis
EP13832208.6A EP2890815B1 (en) 2012-08-31 2013-08-30 Methods for diagnosis and treatment of cancer
JP2015530089A JP6223451B2 (ja) 2012-08-31 2013-08-30 がんの診断及び治療方法

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201261696002P 2012-08-31 2012-08-31
US61/696,002 2012-08-31
US201361827514P 2013-05-24 2013-05-24
US61/827,514 2013-05-24

Publications (2)

Publication Number Publication Date
WO2014036387A2 true WO2014036387A2 (en) 2014-03-06
WO2014036387A3 WO2014036387A3 (en) 2014-05-08

Family

ID=50184648

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2013/057495 Ceased WO2014036387A2 (en) 2012-08-31 2013-08-30 Methods for diagnosis and treatment of cancer

Country Status (5)

Country Link
US (1) US20150218652A1 (enExample)
EP (1) EP2890815B1 (enExample)
JP (1) JP6223451B2 (enExample)
CA (1) CA2882759C (enExample)
WO (1) WO2014036387A2 (enExample)

Cited By (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9127013B2 (en) 2008-10-22 2015-09-08 Array Biopharma, Inc. Method of treatment using substituted pyrazolo[1,5-a] pyrimidine compounds
WO2015184443A1 (en) * 2014-05-30 2015-12-03 The Regents Of The University Of Colorado Activating ntrk1 gene fusions predictive of kinase inhibitor therapy
US9227975B2 (en) 2008-09-22 2016-01-05 Array Biopharma, Inc. Method of treatment using substituted imidazo[1,2B]pyridazine compounds
US9493476B2 (en) 2010-05-20 2016-11-15 Array Biopharma, Inc. Macrocyclic compounds as trk kinase inhibitors
WO2017035354A1 (en) * 2015-08-26 2017-03-02 Blueprint Medicines Corporation Compounds and compositions useful for treating disorders related to ntrk
US9682979B2 (en) 2009-07-09 2017-06-20 Array Biopharma, Inc. Substituted pyrazolo [1,5-A] pyrimidine compounds as TRK kinase inhibitors
US9782414B2 (en) 2014-11-16 2017-10-10 Array Biopharma, Inc. Crystalline form of (S)-N-(5-((R)-2-(2,5-difluorophenyl)-pyrrolidin-1-yl)-pyrazolo[1,5-A]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide hydrogen sulfate
AU2013337277B2 (en) * 2012-11-05 2018-03-08 Foundation Medicine, Inc. Novel NTRK1 fusion molecules and uses thereof
US10000814B2 (en) 2011-10-21 2018-06-19 Foundation Medicine, Inc. ALK and NTRK1 fusion molecules and uses thereof
US10045991B2 (en) 2016-04-04 2018-08-14 Loxo Oncology, Inc. Methods of treating pediatric cancers
US10137127B2 (en) 2016-04-04 2018-11-27 Loxo Oncology, Inc. Liquid formulations of (S)-N-(5-((R)-2-(2,5-difluorophenyl)-pyrrolidin-1-yl)-pyrazolo[1,5-A]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide
US10370727B2 (en) 2015-10-26 2019-08-06 Loxo Oncology, Inc. Point mutations in TRK inhibitor-resistant cancer and methods relating to the same
US10370379B2 (en) 2015-11-19 2019-08-06 Blueprint Medicines Corporation Compounds and compositions useful for treating disorders related to NTRK
US10688100B2 (en) 2017-03-16 2020-06-23 Array Biopharma Inc. Macrocylic compounds as ROS1 kinase inhibitors
US10966966B2 (en) 2019-08-12 2021-04-06 Deciphera Pharmaceuticals, Llc Methods of treating gastrointestinal stromal tumors
US10980804B2 (en) 2013-01-18 2021-04-20 Foundation Medicine, Inc. Methods of treating cholangiocarcinoma
US11091486B2 (en) 2016-10-26 2021-08-17 Array Biopharma, Inc Process for the preparation of pyrazolo[1,5-a]pyrimidines and salts thereof
US11185535B2 (en) 2019-12-30 2021-11-30 Deciphera Pharmaceuticals, Llc Amorphous kinase inhibitor formulations and methods of use thereof
US11214571B2 (en) 2016-05-18 2022-01-04 Array Biopharma Inc. Process for the preparation of (S)-N-(5-((R)-2-(2,5-difluorophenyl)pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide and salts thereof
US11230589B2 (en) 2012-11-05 2022-01-25 Foundation Medicine, Inc. Fusion molecules and uses thereof
US11266635B2 (en) 2019-08-12 2022-03-08 Deciphera Pharmaceuticals, Llc Methods of treating gastrointestinal stromal tumors
US11395818B2 (en) 2019-12-30 2022-07-26 Deciphera Pharmaceuticals, Llc Compositions of 1-(4-bromo-5-(1-ethyl-7-(methylamino)-2-oxo-1,2-dihydro-1,6-naphthyridin-3-yl)-2-fluorophenyl)-3-phenylurea
US11779572B1 (en) 2022-09-02 2023-10-10 Deciphera Pharmaceuticals, Llc Methods of treating gastrointestinal stromal tumors
US11986463B2 (en) 2018-01-31 2024-05-21 Deciphera Pharmaceuticals, Llc Combination therapy for the treatment of gastrointestinal stromal tumor
US12102620B2 (en) 2018-01-31 2024-10-01 Deciphera Pharmaceuticals, Llc Combination therapy for the treatment of mastocytosis
US12509456B2 (en) 2019-03-11 2025-12-30 Deciphera Pharmaceuticals, Llc Solid state forms of ripretinib
US12616683B2 (en) 2024-04-10 2026-05-05 Deciphera Pharmaceuticals, Llc Combination therapy for the treatment of gastrointestinal stromal tumors

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA3108236A1 (en) * 2018-08-07 2020-02-13 In3Bio Ltd. Methods and compositions for inhibition of egf/egfr pathway in combination with anaplastic lymphoma kinase inhibitors
CN109988836B (zh) * 2019-03-18 2022-06-07 厦门艾德生物技术研究中心有限公司 一种检测ntrk融合的fish探针组及其应用
US12441707B2 (en) 2019-12-30 2025-10-14 Tyra Biosciences, Inc. Indazole compounds
EP4114967A4 (en) * 2020-02-28 2025-01-29 Advanced Cell Diagnostics, Inc. METHODS FOR DETECTING NTRK GENE FUSION USING RNA IN SITU HYBRIDIZATION

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7122655B2 (en) * 2002-11-15 2006-10-17 New England Medical Center Hospital, Inc. Compositions involving M-RIP, and related methods for screening for anti-hypertensive agents, and uses thereof
PT2450437T (pt) * 2006-04-14 2017-08-25 Cell Signaling Technology Inc Defeitos de genes e cinase alk mutante em tumores sólidos humanos
CA2663286A1 (en) * 2006-09-15 2008-03-20 The Governors Of The University Of Alberta Automatedfishanalysis,circulating microfluidic chip, and method for immobilizing cells to a microfluidic chip
AU2009253675A1 (en) * 2008-05-28 2009-12-03 Genomedx Biosciences, Inc. Systems and methods for expression-based discrimination of distinct clinical disease states in prostate cancer
AU2010248782B2 (en) * 2009-05-15 2015-06-11 Insight Genetics, Inc. Methods and compositions relating to fusions of ALK for diagnosing and treating cancer
AU2010319322A1 (en) * 2009-11-13 2012-05-31 Infinity Pharmaceuticals, Inc. Compositions, kits, and methods for identification, assessment, prevention, and therapy of cancer
WO2013059740A1 (en) * 2011-10-21 2013-04-25 Foundation Medicine, Inc. Novel alk and ntrk1 fusion molecules and uses thereof
EP2914621B1 (en) * 2012-11-05 2023-06-07 Foundation Medicine, Inc. Novel ntrk1 fusion molecules and uses thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
None
See also references of EP2890815A4

Cited By (105)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9796723B2 (en) 2008-09-22 2017-10-24 Array Biopharma, Inc. Method of treatment using substituted imidazo[1,2b]pyridazine compounds
US10590139B2 (en) 2008-09-22 2020-03-17 Array Biopharma Inc. Method of treatment using substituted imidazo[1,2b]pyridazine compounds
US9227975B2 (en) 2008-09-22 2016-01-05 Array Biopharma, Inc. Method of treatment using substituted imidazo[1,2B]pyridazine compounds
US10011604B2 (en) 2008-09-22 2018-07-03 Array Biopharma, Inc. Method of treatment using substituted imidazo[1,2b]pyridazine compounds
US9795611B2 (en) 2008-09-22 2017-10-24 Array Biopharma, Inc. Method of treatment using substituted imidazo[1,2b]pyridazine compounds
US9127013B2 (en) 2008-10-22 2015-09-08 Array Biopharma, Inc. Method of treatment using substituted pyrazolo[1,5-a] pyrimidine compounds
US11267818B2 (en) 2008-10-22 2022-03-08 Array Biopharma Inc. Method of treatment using substituted pyrazolo[1,5-a] pyrimidine compounds
US10047097B2 (en) 2008-10-22 2018-08-14 Array Biopharma Inc. Method of treatment using substituted pyrazolo[1,5-a] pyrimidine compounds
US9447104B2 (en) 2008-10-22 2016-09-20 Array Biopharma, Inc. Method of treatment using substituted pyrazolo[1,5-a]pyrimidine compounds
US10005783B2 (en) 2008-10-22 2018-06-26 Array Biopharma Inc. Method of treatment using substituted pyrazolo[1,5-a] pyrimidine compounds
US10774085B2 (en) 2008-10-22 2020-09-15 Array Biopharma Inc. Method of treatment using substituted pyrazolo[1,5-A] pyrimidine compounds
US9676783B2 (en) 2008-10-22 2017-06-13 Array Biopharma, Inc. Method of treatment using substituted pyrazolo[1,5-A] pyrimidine compounds
US9782415B2 (en) 2009-07-09 2017-10-10 Array Biopharma, Inc. Substituted pyrazolo[1,5-a]pyrimidine compounds as Trk kinase inhibitors
US10758542B2 (en) 2009-07-09 2020-09-01 Array Biopharma Inc. Substituted pyrazolo[l,5-a]pyrimidine compounds as Trk kinase inhibitors
US9682979B2 (en) 2009-07-09 2017-06-20 Array Biopharma, Inc. Substituted pyrazolo [1,5-A] pyrimidine compounds as TRK kinase inhibitors
US9796724B2 (en) 2009-07-09 2017-10-24 Array Biopharma, Inc. Substituted pyrazolo[1,5-a]pyrimidine compounds as Trk kinase inhibitors
US10251889B2 (en) 2009-07-09 2019-04-09 Array BioPharm Inc. Substituted pyrazolo[1,5-a]pyrimidine compounds as Trk kinase inhibitors
US10647730B2 (en) 2010-05-20 2020-05-12 Array Biopharma Inc. Macrocyclic compounds as TRK kinase inhibitors
US9902741B2 (en) 2010-05-20 2018-02-27 Array Biopharma Inc. Macrocyclic compounds as TRK kinase inhibitors
US9750744B2 (en) 2010-05-20 2017-09-05 Array Biopharma, Inc. Macrocyclic compounds as Trk kinase inhibitors
US9718822B2 (en) 2010-05-20 2017-08-01 Array Biopharma, Inc. Macrocyclic compounds as Trk kinase inhibitors
US9840519B2 (en) 2010-05-20 2017-12-12 Array Biopharma, Inc. Macrocyclic compounds as TRK kinase inhibitors
US9493476B2 (en) 2010-05-20 2016-11-15 Array Biopharma, Inc. Macrocyclic compounds as trk kinase inhibitors
US10000814B2 (en) 2011-10-21 2018-06-19 Foundation Medicine, Inc. ALK and NTRK1 fusion molecules and uses thereof
US12522873B2 (en) 2011-10-21 2026-01-13 Foundation Medicine, Inc. ALK and NTRK1 fusion molecules and uses thereof
US11098368B2 (en) 2011-10-21 2021-08-24 Foundation Medicine, Inc. ALK and NTRK1 fusion molecules and uses thereof
EP2914621B1 (en) * 2012-11-05 2023-06-07 Foundation Medicine, Inc. Novel ntrk1 fusion molecules and uses thereof
AU2013337277B2 (en) * 2012-11-05 2018-03-08 Foundation Medicine, Inc. Novel NTRK1 fusion molecules and uses thereof
US12378302B2 (en) 2012-11-05 2025-08-05 Foundation Medicine, Inc. Fusion molecules and uses thereof
US11230589B2 (en) 2012-11-05 2022-01-25 Foundation Medicine, Inc. Fusion molecules and uses thereof
AU2020202544B2 (en) * 2012-11-05 2022-06-02 Foundation Medicine, Inc. Novel NTRK1 fusion molecules and uses thereof
US11578372B2 (en) 2012-11-05 2023-02-14 Foundation Medicine, Inc. NTRK1 fusion molecules and uses thereof
US12274699B2 (en) 2013-01-18 2025-04-15 Foundation Medicine, Inc. Methods of treating cholangiocarcinoma
US10980804B2 (en) 2013-01-18 2021-04-20 Foundation Medicine, Inc. Methods of treating cholangiocarcinoma
US11771698B2 (en) 2013-01-18 2023-10-03 Foundation Medicine, Inc. Methods of treating cholangiocarcinoma
WO2015184443A1 (en) * 2014-05-30 2015-12-03 The Regents Of The University Of Colorado Activating ntrk1 gene fusions predictive of kinase inhibitor therapy
US9782414B2 (en) 2014-11-16 2017-10-10 Array Biopharma, Inc. Crystalline form of (S)-N-(5-((R)-2-(2,5-difluorophenyl)-pyrrolidin-1-yl)-pyrazolo[1,5-A]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide hydrogen sulfate
US10285993B2 (en) 2014-11-16 2019-05-14 Array Biopharma Inc. Crystalline form of (S)-N-(5-((R)-2-(2,5-difluorophenyl)-pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide hydrogen sulfate
US10172861B2 (en) 2014-11-16 2019-01-08 Array Biopharma Inc. Crystalline form of (S)-N-(5-((R)-2-(2,5-difluorophenyl)-pyrrolidin-1-yl)-pyrazolo[1,5-A]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide hydrogen sulfate
US10813936B2 (en) 2014-11-16 2020-10-27 Array Biopharma, Inc. Crystalline form of (S)-N-(5-((R)-2-(2,5-difluorophenyl)-pyrrolidin-1-YL)-pyrazolo[1,5-A]pyrimidin-3-YL)-3-hydroxypyrrolidine-1-carboxamide hydrogen sulfate
US10799505B2 (en) 2014-11-16 2020-10-13 Array Biopharma, Inc. Crystalline form of (S)-N-(5-((R)-2-(2,5-difluorophenyl)-pyrrolidin-1-yl)-pyrazolo[1,5-A]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide hydrogen sulfate
CN108137607A (zh) * 2015-08-26 2018-06-08 蓝图药品公司 适用于治疗与ntrk相关的病症的化合物和组合物
US11046697B2 (en) 2015-08-26 2021-06-29 Blueprint Medicines Corporation Compounds and compositions useful for treating disorders related to NTRK
WO2017035354A1 (en) * 2015-08-26 2017-03-02 Blueprint Medicines Corporation Compounds and compositions useful for treating disorders related to ntrk
US10017512B2 (en) 2015-08-26 2018-07-10 Blueprint Medicines Corporation Compounds and compositions useful for treating disorders related to NTRK
JP2018528200A (ja) * 2015-08-26 2018-09-27 ブループリント メディシンズ コーポレイション Ntrk関連障害の治療に有用な化合物および組成物
US10378068B2 (en) 2015-10-26 2019-08-13 Loxo Oncology, Inc. Point mutations in TRK inhibitor-resistant cancer and methods relating to the same
US10724102B2 (en) 2015-10-26 2020-07-28 Loxo Oncology, Inc. Point mutations in TRK inhibitor-resistant cancer and methods relating to the same
US10907215B2 (en) 2015-10-26 2021-02-02 Loxo Oncology, Inc. Point mutations in TRK inhibitor-resistant cancer and methods relating to the same
US10370727B2 (en) 2015-10-26 2019-08-06 Loxo Oncology, Inc. Point mutations in TRK inhibitor-resistant cancer and methods relating to the same
US10655186B2 (en) 2015-10-26 2020-05-19 Loxo Oncology, Inc. Point mutations in TRK inhibitor-resistant cancer and methods relating to the same
US10370379B2 (en) 2015-11-19 2019-08-06 Blueprint Medicines Corporation Compounds and compositions useful for treating disorders related to NTRK
US11059827B2 (en) 2015-11-19 2021-07-13 Blueprint Medicines Corporation Compounds and compositions useful for treating disorders related to NTRK
US11191766B2 (en) 2016-04-04 2021-12-07 Loxo Oncology, Inc. Methods of treating pediatric cancers
US10045991B2 (en) 2016-04-04 2018-08-14 Loxo Oncology, Inc. Methods of treating pediatric cancers
US10137127B2 (en) 2016-04-04 2018-11-27 Loxo Oncology, Inc. Liquid formulations of (S)-N-(5-((R)-2-(2,5-difluorophenyl)-pyrrolidin-1-yl)-pyrazolo[1,5-A]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide
US10588908B2 (en) 2016-04-04 2020-03-17 Loxo Oncology, Inc. Methods of treating pediatric cancers
US11484535B2 (en) 2016-04-04 2022-11-01 Loxo Oncology, Inc. Liquid formulations of (S)-N-(5-((R)-2-(2,5-difluorophenyl)-pyrrolidin-1-yl)-pyrazolo[1,5-a] pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide
US10668072B2 (en) 2016-04-04 2020-06-02 Loxo Oncology, Inc. Liquid formulations of (S)-N-(5-((R)-2-(2,5-difluorophenyl)-pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide
US11214571B2 (en) 2016-05-18 2022-01-04 Array Biopharma Inc. Process for the preparation of (S)-N-(5-((R)-2-(2,5-difluorophenyl)pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide and salts thereof
US11091486B2 (en) 2016-10-26 2021-08-17 Array Biopharma, Inc Process for the preparation of pyrazolo[1,5-a]pyrimidines and salts thereof
US10688100B2 (en) 2017-03-16 2020-06-23 Array Biopharma Inc. Macrocylic compounds as ROS1 kinase inhibitors
US10966985B2 (en) 2017-03-16 2021-04-06 Array Biopharma Inc. Macrocyclic compounds as ROS1 kinase inhibitors
US12102620B2 (en) 2018-01-31 2024-10-01 Deciphera Pharmaceuticals, Llc Combination therapy for the treatment of mastocytosis
US11986463B2 (en) 2018-01-31 2024-05-21 Deciphera Pharmaceuticals, Llc Combination therapy for the treatment of gastrointestinal stromal tumor
US12509456B2 (en) 2019-03-11 2025-12-30 Deciphera Pharmaceuticals, Llc Solid state forms of ripretinib
US12059410B2 (en) 2019-08-12 2024-08-13 Deciphera Pharmaceuticals, Llc Methods of treating gastrointestinal stromal tumors
US11969414B2 (en) 2019-08-12 2024-04-30 Deciphera Pharmaceuticals, Llc Methods of treating gastrointestinal stromal tumors
US10966966B2 (en) 2019-08-12 2021-04-06 Deciphera Pharmaceuticals, Llc Methods of treating gastrointestinal stromal tumors
US11266635B2 (en) 2019-08-12 2022-03-08 Deciphera Pharmaceuticals, Llc Methods of treating gastrointestinal stromal tumors
US11344536B1 (en) 2019-08-12 2022-05-31 Deciphera Pharmaceuticals, Llc Methods of treating gastrointestinal stromal tumors
US11534432B2 (en) 2019-08-12 2022-12-27 Deciphera Pharmaceuticals, Llc Methods of treating gastrointestinal stromal tumors
US12318373B2 (en) 2019-08-12 2025-06-03 Deciphera Pharmaceuticals, Llc Methods of treating gastrointestinal stromal tumors
US12295944B2 (en) 2019-08-12 2025-05-13 Deciphera Pharmaceuticals, Llc Methods of treating gastrointestinal stromal tumors
US11426390B2 (en) 2019-08-12 2022-08-30 Deciphera Pharmaceuticals, Llc Methods of treating gastrointestinal stromal tumors
US11813251B2 (en) 2019-08-12 2023-11-14 Deciphera Pharmaceuticals, Llc Methods of treating gastrointestinal stromal tumors
US11576904B2 (en) 2019-08-12 2023-02-14 Deciphera Pharmaceuticals, Llc Methods of treating gastrointestinal stromal tumors
US12059411B2 (en) 2019-08-12 2024-08-13 Deciphera Pharmaceuticals, Llc Methods of treating gastrointestinal stromal tumors
US11433056B1 (en) 2019-08-12 2022-09-06 Deciphera Pharmaceuticals, Llc Methods of treating gastrointestinal stromal tumors
US12023325B2 (en) 2019-08-12 2024-07-02 Deciphera Pharmaceuticals, Llc Methods of treating gastrointestinal stromal tumors
US12023327B2 (en) 2019-08-12 2024-07-02 Deciphera Pharmaceuticals, Llc Methods of treating gastrointestinal stromal tumors
US12023326B2 (en) 2019-08-12 2024-07-02 Deciphera Pharmaceuticals, Llc Methods of treating gastrointestinal stromal tumors
US11529336B2 (en) 2019-08-12 2022-12-20 Deciphera Pharmaceuticals, Llc Methods of treating gastrointestinal stromal tumors
US11844788B1 (en) 2019-12-30 2023-12-19 Deciphera Pharmaceuticals, Llc Compositions of 1-(4-bromo-5-(1-ethyl-7-(methylamino)-2-oxo-1,2-dihydro-1,6-naphthyridin-3-yl)-2-fluoropheyl)-3-phenylurea
US12213968B2 (en) 2019-12-30 2025-02-04 Deciphera Pharmaceuticals, Llc Compositions of 1-(4-bromo-5-(1-ethyl-7-(methylamino)-2-oxo-1,2-dihydro-1,6-naphthyridin-3-yl)-2-fluoropheyl)-3-phenylurea
US11918564B1 (en) 2019-12-30 2024-03-05 Deciphera Pharmaceuticals, Llc Compositions of 1-(4-bromo-5-(1-ethyl-7-(methylamino)-2-oxo-1,2-dihydro-1,6-naphthyridin-3-yl)-2-fluoropheyl)-3-phenylurea
US11911370B1 (en) 2019-12-30 2024-02-27 Deciphera Pharmaceuticals, Llc Compositions of 1-(4-bromo-5-(1-ethyl-7-(methylamino)-2-oxo-1,2-dihydro-1,6-naphthyridin-3-yl)-2-fluoropheyl)-3-phenylurea
US11903933B2 (en) 2019-12-30 2024-02-20 Deciphera Pharmaceuticals, Llc Compositions of 1-(4-bromo-5-(1-ethyl-7-(methylamino)-2-oxo-1,2-dihydro-1,6-naphthyridin-3-yl)-2-fluoropheyl)-3-phenylurea
US12023328B2 (en) 2019-12-30 2024-07-02 Deciphera Pharmaceuticals, Llc Compositions of 1-(4-bromo-5-(1-ethyl-7-(methylamino)-2-oxo-1,2-dihydro-1,6-naphthyridin-3-yl)-2-fluoropheyl)-3-phenylurea
US11896585B2 (en) 2019-12-30 2024-02-13 Deciphera Pharmaceuticals, Llc Compositions of 1-(4-bromo-5-(1-ethyl-7-(methylamino)-2-oxo-1,2-dihydro-1,6-naphthyridin-3-yl)-2-fluorophenyl)-3-phenylurea
US11850241B1 (en) 2019-12-30 2023-12-26 Deciphera Pharmaceuticals, Llc Compositions of 1-(4-bromo-5-(1-ethyl-7-(methylamino)-2-oxo-1,2-dihydro-1,6-naphthyridin-3-yl)-2-fluoropheyl)-3-phenylurea
US11850240B1 (en) 2019-12-30 2023-12-26 Deciphera Pharmaceuticals, Llc Compositions of 1-(4-bromo-5-(1-ethyl-7-(methylamino)-2-oxo-1,2-dihydro-1,6-naphthyridin-3-yl)-2-fluoropheyl)-3-phenylurea
US12064422B2 (en) 2019-12-30 2024-08-20 Deciphera Pharmaceuticals, Llc Compositions of 1-(4-bromo-5-(1-ethyl-7-(methylamino)-2-oxo-1,2-dihydro-1,6-naphthyridin-3-yl)-2-fluoropheyl)-3-phenylurea
US11801237B2 (en) 2019-12-30 2023-10-31 Deciphera Pharmaceuticals, Llc Amorphous kinase inhibitor formulations and methods of use thereof
US11969415B1 (en) 2019-12-30 2024-04-30 Deciphera Pharmaceuticals, Llc (methylamino)-2-oxo-1,2-dihydro-1,6-naphthyridin-3-yl)-2-fluoropheyl)-3-phenylurea
US12213967B2 (en) 2019-12-30 2025-02-04 Deciphera Pharmaceuticals, Llc Compositions of 1-(4-bromo-5-(1-ethyl-7-(methylamino)-2-oxo-1,2-dihydro-1,6-naphthyridin-3-yl)-2-fluoropheyl)-3-phenylurea
US12226406B2 (en) 2019-12-30 2025-02-18 Deciphera Pharmaceuticals, Llc Compositions of 1-(4-bromo-5-(1-ethyl-7-(methylamino)-2-oxo-1,2-dihydro-1,6-naphthyridin-3-yl)-2-fluoropheyl)-3-phenylurea
US11395818B2 (en) 2019-12-30 2022-07-26 Deciphera Pharmaceuticals, Llc Compositions of 1-(4-bromo-5-(1-ethyl-7-(methylamino)-2-oxo-1,2-dihydro-1,6-naphthyridin-3-yl)-2-fluorophenyl)-3-phenylurea
US11793795B2 (en) 2019-12-30 2023-10-24 Deciphera Pharmaceuticals, Llc Compositions of 1-(4-bromo-5-(1-ethyl-7-(methylamino)-2-oxo-1,2-dihydro-1,6-naphthyridin-3-yl)-2-fluorophenyl)-3-phenylurea
US11185535B2 (en) 2019-12-30 2021-11-30 Deciphera Pharmaceuticals, Llc Amorphous kinase inhibitor formulations and methods of use thereof
US12318374B2 (en) 2019-12-30 2025-06-03 Deciphera Pharmaceuticals, Llc Compositions of 1-(4-bromo-5-(1-ethyl-7-(methylamino)-2-oxo-1,2-dihydro-1,6-naphthyridin-3-yl)-2-fluoropheyl)-3-phenylurea
US11576903B2 (en) 2019-12-30 2023-02-14 Deciphera Pharmaceuticals, Llc Amorphous kinase inhibitor formulations and methods of use thereof
US11612591B2 (en) 2019-12-30 2023-03-28 Deciphera Pharmaceuticals, Llc Compositions of 1-(4-bromo-5-(1-ethyl-7-(methylamino)-2-oxo-1,2-dihydro-1,6-naphthyridin-3-yl)-2-fluorophenyl)-3-phenylurea
US11779572B1 (en) 2022-09-02 2023-10-10 Deciphera Pharmaceuticals, Llc Methods of treating gastrointestinal stromal tumors
US12616683B2 (en) 2024-04-10 2026-05-05 Deciphera Pharmaceuticals, Llc Combination therapy for the treatment of gastrointestinal stromal tumors

Also Published As

Publication number Publication date
CA2882759C (en) 2018-11-20
US20150218652A1 (en) 2015-08-06
CA2882759A1 (en) 2014-03-06
JP6223451B2 (ja) 2017-11-01
EP2890815A2 (en) 2015-07-08
EP2890815B1 (en) 2019-03-20
EP2890815A4 (en) 2016-05-11
WO2014036387A3 (en) 2014-05-08
JP2015528295A (ja) 2015-09-28

Similar Documents

Publication Publication Date Title
CA2882759C (en) Detection of the ntrk1-mprip gene fusion for cancer diagnosis
US9216172B2 (en) Method for determining effectiveness of cancer treatment by assessing the presence of a KIF5B-RET chimeric gene
Lee et al. Comprehensive analysis of RET and ROS1 rearrangement in lung adenocarcinoma
US20170114415A1 (en) Activating ntrk1 gene fusions predictive of kinase inhibitor therapy
DK2456889T3 (en) Markers of endometrial cancer
HK1254906A1 (zh) 测定癌症对表皮生长因子受体靶向性治疗反应性的方法
JPWO2015012397A1 (ja) Ntrk3融合体の検出法
JP2012085556A (ja) 乳がんの診断方法
CN106662543B (zh) 肺癌患者中的非侵入性基因突变检测
WO2009150256A1 (en) Markers for predicting response and survival in anti-egfr treated patients
CN105980555A (zh) 作为胃癌的责任因子的新型融合基因
Zhang et al. Oncogenic Neuregulin 1 gene (NRG1) fusions in cancer: A potential new therapeutic opportunities
JP2006523456A (ja) 分子細胞遺伝学的方法を用いる癌連鎖遺伝子および治療標的の確認
US20080305493A1 (en) Determining Cancer-Linked Genes and Therapeutic Targets Using Molecular Cytogenetic Methods
JP2009050189A (ja) 抗癌剤の有効性予測方法
EP2304051A1 (en) Human mena isoforms serve as markers of epithelial to mesenchymal transition and sensitivity to egfr inhibition in human cancer cells
KR20110106244A (ko) 간세포암종의 예후 진단용 단일 염기 다형성
KR102788019B1 (ko) 췌장암의 진단용 조성물
JP7150018B2 (ja) 新規なcip2aバリアント及びその使用
EP2601528B1 (en) Novel methods for predicting the responsiveness of a patient affected with a tumor to a treatment with a tyrosine kinase inhibitor
KR20240157611A (ko) 전이성 유방암의 항암제 치료 반응성 및 예후 예측용 신규한 바이오마커 및 이의 용도
KR101492024B1 (ko) 전이성 뇌종양 진단용 마커
JP5467256B2 (ja) 消化器癌検出用血清腫瘍マーカー、消化器癌検出キット、および消化器癌検出方法
JP2003528630A (ja) ヒト遺伝子および発現産物
WO2009145924A2 (en) Methods and materials for identifying patients at heightened risk for developing her2+ related brain tumors

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13832208

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 2882759

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 14423867

Country of ref document: US

ENP Entry into the national phase

Ref document number: 2015530089

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2013832208

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2882759

Country of ref document: CA