WO2014020043A1 - Combinations for the treatment of cancer - Google Patents

Combinations for the treatment of cancer Download PDF

Info

Publication number
WO2014020043A1
WO2014020043A1 PCT/EP2013/066038 EP2013066038W WO2014020043A1 WO 2014020043 A1 WO2014020043 A1 WO 2014020043A1 EP 2013066038 W EP2013066038 W EP 2013066038W WO 2014020043 A1 WO2014020043 A1 WO 2014020043A1
Authority
WO
WIPO (PCT)
Prior art keywords
amino
phenyl
triazolo
pyridin
fluorophenyl
Prior art date
Application number
PCT/EP2013/066038
Other languages
French (fr)
Inventor
Gerhard Siemeister
Benjamin Bader
Antje Wengner
Dominik Mumberg
Volker Schulze
Guido Kroemer
Ilio VITALE
Mohamed JEMAÀ
Original Assignee
Bayer Pharma Aktiengesellschaft
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bayer Pharma Aktiengesellschaft filed Critical Bayer Pharma Aktiengesellschaft
Publication of WO2014020043A1 publication Critical patent/WO2014020043A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/045—Hydroxy compounds, e.g. alcohols; Salts thereof, e.g. alcoholates
    • A61K31/047—Hydroxy compounds, e.g. alcohols; Salts thereof, e.g. alcoholates having two or more hydroxy groups, e.g. sorbitol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • A61K31/403—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil condensed with carbocyclic rings, e.g. carbazole
    • A61K31/404—Indoles, e.g. pindolol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/4196—1,2,4-Triazoles
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/4353—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/437—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a five-membered ring having nitrogen as a ring hetero atom, e.g. indolizine, beta-carboline
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/63—Compounds containing para-N-benzenesulfonyl-N-groups, e.g. sulfanilamide, p-nitrobenzenesulfonyl hydrazide
    • A61K31/635—Compounds containing para-N-benzenesulfonyl-N-groups, e.g. sulfanilamide, p-nitrobenzenesulfonyl hydrazide having a heterocyclic ring, e.g. sulfadiazine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A61K38/1761—Apoptosis related proteins, e.g. Apoptotic protease-activating factor-1 (APAF-1), Bax, Bax-inhibitory protein(s)(BI; bax-I), Myeloid cell leukemia associated protein (MCL-1), Inhibitor of apoptosis [IAP] or Bcl-2

Definitions

  • the present invention relates to combinations of at least two compounds A and B, compound A being an inhibitor of Mps-1 kinase, and compound B being an inhibitor of an anti-apoptotic protein of the Bcl-2 family.
  • Another aspect of the present invention relates to the use of such combinations as described supra for the preparation of a medicament for the treatment or prophylaxis of a disease, particurlarly for the treatment of cancer.
  • Another aspect of the present invention relates to the use of an anti- apoptotic protein from the Bcl-2 family as a sensitizer of cells to Mps-1 inhibitors.
  • kits comprising a combination of: - one or more compounds A, as defined supra, or a physiologically acceptable salt, solvate, hydrate or stereoisomer thereof ;
  • the components may be administered independnently of one another by the oral, intravenous, topical, local installations, intraperitoneal or nasal route.
  • Another aspect of the present invention relates to the use of the ratio of pro- apoptotic and anti-apoptotic proteins from the Bcl-2 family in a biological sample as a biomarker for a Mps-1 kinase inhibitor treatment.
  • Mps-1 Monopolar Spindle 1 kinase (also known as Tyrosine Threonine Kinase, TTK).
  • Mps-1 is a dual specificity Ser/Thr kinase which plays a key role in the activation of the mitotic checkpoint (also known as spindle checkpoint, spindle assembly checkpoint, SAC) thereby ensuring proper chromosome segregation during mitosis [Abrieu A et al. , Cell, 2001 , 106, 83-93]. Every dividing cell has to ensure equal separation of the replicated chromosomes into the two daughter cells.
  • mitotic checkpoint also known as spindle checkpoint, spindle assembly checkpoint, SAC
  • chromosomes Upon entry into mitosis, chromosomes are attached at their kinetochores to the microtubules of the spindle apparatus.
  • the mitotic checkpoint is a surveillance mechanism that is active as long as unattached kinetochores are present and prevents mitotic cells from entering anaphase and thereby completing cell division with unattached chromosomes [Suijkerbuijk SJ and Kops GJ, Biochemica et Biophysica Acta, 2008, 1786, 24-31 ; Musacchio A and Salmon ED, Nat Rev Mol Cell Biol. , 2007, 8, 379-93] . Once all kinetochores are attached in a correct amphitelic, i.e.
  • the mitotic checkpoint consists of a complex network of a number of essential proteins, including members of the MAD (mitotic arrest deficient, MAD 1 -3) and Bub (Budding uninhibited by benzimidazole, Bub 1 -3) families, the motor protein CENP-E, Mps-1 kinase as well as other components, many of these being over-expressed in proliferating cells (e.g. cancer cells) and tissues [Yuan B et al. , Clinical Cancer Research, 2006, 12, 405-10].
  • Mps-1 kinase activity in mitotic checkpoint signalling has been shown by shRNA-silencing, chemical genetics as well as chemical inhibitors of Mps-1 kinase [Jelluma N et al. , PLos ONE, 2008, 3, e2415; Jones MH et al. , Current Biology, 2005, 1 5, 160-65; Dorer RK et al. , Current Biology, 2005, 1 5, 1070-76; Schmidt M et al. , EMBO Reports, 2005, 6, 866-72].
  • mitotic checkpoint abrogation through pharmacological inhibition of Mps-1 kinase or other components of the mitotic checkpoint represents a new approach for the treatment of proliferative disorders including solid tumours such as carcinomas and sarcomas and leukaemias and lymphoid malignancies or other disorders associated with uncontrolled cellular proliferation.
  • Established anti mitotic drugs such as vinca alkaloids, taxanes or epothilones activate the SAC inducing a mitotic arrest either by stabilising or destabilising microtubule dynamics. This arrest prevents separation of sister chromatids to form the two daughter cells. Prolonged arrest in mitosis forces a cell either into mitotic exit without cytokinesis or into mitotic catastrophe leading to cell death.
  • inhibitors of Mps-1 induce a SAC inactivation that accelerates progression of cells through mitosis resulting in severe chromosomal missegregation and finally in cell death.
  • Mps-1 inhibitors should be of therapeutic value for the treatment of proliferative disorders associated with enhanced uncontrolled proliferative cellular processes such as, for example, cancer, inflammation, arthritis, viral diseases, neurodegenerative diseases such as Alzheimer's disease, cardiovascular diseases, or fungal diseases in a warm blooded animal such as man. Therefore, inhibitors of Mps-1 represent valuable compounds that should complement therapeutic options either as single agents or in combination with other drugs.
  • WO 2009/024824 A1 discloses 2-Anilinopurin-8-ones as inhibitors of Mps-1 for the treatment of proliferate disorders.
  • WO 2010/124826 A1 discloses substituted imidazoquinoxaline compounds as inhibitors of Mps-1 kinase.
  • WO 201 1 /026579 A1 discloses substituted aminoquinoxalines as Mps- 1 inhibitors.
  • Preferred compounds for the inhibition of Mps-1 in a combination according to the present invention are the substituted triazolopyridine compounds of formula (I) as defined hereinafter.
  • Substituted triazolopyridine compounds have been disclosed for the treatment or prophylaxis of different diseases:
  • WO 2008/025821 A1 relates to triazole derivatives as kinase inhibitors, especially inhibitors of ITK or PI3K, for the treatment or prophylaxis of immunological, inflammatory or allergic disorders.
  • Said triazole derivatives are exemplified as possessing an amide, urea or aliphatic amine substituent in position 2.
  • WO 2009/047514 A1 relates to [1 ,2,4]-triazolo-[1 ,5-a]-pyridine and [1 ,2,4]- triazolo-[1 ,5-c]-pyrimidine compounds which inhibit AXL receptor tyrosine kinase function, and to the treatment of diseases and conditions that are mediated by AXL receptor tyrosine kinase, that are ameliorated by the inhibition of AXL receptor tyrosine kinase function etc. , including proliferative conditions such as cancer, etc.. Said compounds are exemplified as possessing a substituent in the 5-position and a substituent in the 2-position.
  • WO 20 ⁇ 9/010530 A1 discloses bicyclic heterorayl compounds and their use as phosphatidylinositol (PI) 3-kinase. Among other compounds also substituted triazolopyridines are mentioned.
  • WO 2009/027283 A1 discloses triazolopyridine compounds and their use as ASK (apoptosis signal-regulating kinase) inhibitors for the treatment of autoimmune diseases and neurodegenerative diseases.
  • WO 2010/092041 A1 relates to [1 ,2,4]-triazolo- [1 , 5-a]-pyridines, which are said to be useful as selective kinase inhibitors, to methods for producing such compounds and methods for treating or ameliorating kinase-mediated disorder.
  • Said triazole derivatives are exemplified as possessing a 2-chloro-5- hydroxyphenyl substituent in the 6- position of the [1 ,2,4]-triazolo- [1 , 5-a]- pyridine.
  • WO 201 1 /064328 A1 relate to [1 ,2,4]-triazolo- [1 , 5-a]-pyridines, methods for preparing said [1 ,2,4]-triazolo- [1 , 5-a]-pyridines, and their use for inhibition of Mps- 1 kinase.
  • Another component of the combinations of the present invention is a compound B which is an inhibitor of an anti-apoptotic protein of the Bcl-2 family.
  • Bcl-2 (B-cell lymphoma 2) is the founding member of the Bcl-2 family of apoptosis regulator proteins encoded by the BCL2 gene (Bakhashi et al. , Cell 1985, 41 , 899ff; Cleary et al. , Proc. Natl. Acad. Sci. USA, 1985, 82, 7439ff).
  • the Bd-2 family is defined by the presence of up to four conserved "Bd-2 homology" (BH) domains designated BH1 , BH2, BH3, and BH4, all of which include a-helical segments (Chittenden et al. , EMBO 1995, 14, 5589ff; Wang et al. Genes Dev.
  • Anti-apoptotic proteins such as Bcl-2, Bcl- XL, and Mcl-1 , display sequence conservation in all BH domains.
  • Pro-apoptotic proteins are divided into "multidomain” members (e.g. BAK, BAX), which possess homology in the BH1 , BH2, and BH3 domains, and the "BH3-domain only” members (e.g. BID, BAD, BIM, BIK, NOXA, PUMA), that contain sequence homology exclusively in the BH3 amphipathic a-helical segment.
  • BCL-2 family members have the capacity to form homo- and heterodimers, suggesting that competitive binding and the ratio between pro- and anti-apoptotic protein levels dictates susceptibility to death stimuli.
  • Anti-apoptotic proteins function to protect cells from pro-apoptotic excess, i.e. , excessive programmed cell death.
  • Additional "security” measures include regulating transcription of pro- apoptotic proteins and maintaining them as inactive conformers, requiring either proteolytic activation, dephosphorylation, or ligand-induced conformational change to activate pro-death functions.
  • death signals received at the plasma membrane trigger apoptosis via a mitochondrial pathway (US8198405 B2).
  • the mitochondria can serve as a gatekeeper of cell death by sequestering cytochrome c, a critical component of a cytosolic complex which activates caspase 9, leading to fatal downstream proteolytic events.
  • Multidomain proteins such as BCI-2/BCI-XL and BAK /BAX play dueling roles of guardian and executioner at the mitochondrial membrane, with their activities further regulated by upstream BH3-only members of the Bcl-2 family.
  • BID is a member of the "BH3- domain only" subset of pro-apoptotic proteins, and transmits death signals received at the plasma membrane to effector pro-apoptotic proteins at the mitochondrial membrane.
  • BID has the unique capability of interacting with both pro- and anti-apoptotic proteins, and upon activation by caspase 8, triggers cytochrome c release and mitochondrial apoptosis.
  • Deletion and mutagenesis studies determined that the amphipathic a-helical BH3 segment of pro-apoptotic family members functions as a death domain and thus represents a critical structural motif for interacting with multidomain apoptotic proteins.
  • Structural studies have demonstrated that the BH3 helix interacts with anti-apoptotic proteins by inserting into a hydrophobic groove formed by the interface of BH1 , 2 and 3 domains.
  • Activated BID can be bound and sequested by anti-apoptotic proteins (e.g. , Bcl-2 and BCI-XL) and can trigger activation of the pro-apoptotic proteins BAX and BAK, leading to cytochrome c release and a mitochondrial apoptosis program.
  • Inhibitors of anti-apoptotic Bcl-2 proteins have been disclosed in prior art (e.g. US 8, 188,077 B2).
  • the present invention covers combinations of at least two compounds A and B, compound A being an inhibitor of Mps-1 kinase, and compound B being an inhibitor of an anti- apoptotic protein of the Bcl-2 family.
  • kits comprising :
  • component A one or more Mps-1 kinase inhibitors, or a physiologically acceptable salt, solvate, hydrate or stereoisomer thereof
  • component B one or more inhibitors of an anti-apoptotic protein from the Bcl-2 family, or a physiologically acceptable salt, solvate, hydrate or stereoisomer thereof
  • component C one or more further pharmaceutical agents ; in which optionally either or both of said components A and B in any of the above-mentioned combinations are in the form of a pharmaceutical formulation which is ready for use to be administered simultaneously, concurrently, separately or sequentially.
  • the components may be administered independnently of one another by the oral, intravenous, topical, local installations, intraperitoneal or nasal route.
  • the present invention covers the combinations as described supra for the treatment or prophylaxis of a disease.
  • the present invention covers the use of such combinations as described supra for the preparation of a medicament for the treatment or prophylaxis of of a disease.
  • the present invention covers an anti- apoptotic protein from the Bcl-2 family for the use as a sensitizer of cells to Mps-1 inhibitors. In accordance with another aspect, the present invention covers the use of an anti-apoptotic protein from the Bcl-2 family as a sensitizer of cells to Mps-1 inhibitors.
  • the present invention relates to the use of the ratio of pro-apoptotic and anti-apoptotic proteins from the Bcl-2 family in a biological sample as a biomarker for a Mps-1 kinase inhibitor treatment.
  • halogen atom or "halo-” is to be understood as meaning a fluorine, chlorine, bromine or iodine atom.
  • G -C6-alkyl is to be understood as preferably meaning a linear or branched, saturated, monovalent hydrocarbon group having 1 , 2, 3, 4, 5 or 6 carbon atoms, e.g.
  • said group has 1 , 2, 3 or 4 carbon atoms ("G-C4-alkyl”), e.g. a methyl, ethyl, propyl, butyl, iso-propyl, iso-butyl, sec-butyl, tert-butyl group, more particularly 1 , 2 or 3 carbon atoms (“G -C3-alkyl”), e.g. a methyl, ethyl, n- propyl- or iso-propyl group.
  • G-C4-alkyl e.g. a methyl, ethyl, propyl, butyl, iso-propyl, iso-butyl, sec-butyl, tert-butyl group, more particularly 1 , 2 or 3 carbon atoms
  • G -C3-alkyl e.g. a methyl, ethyl, n- propyl- or iso-propyl group.
  • halo-G -C6-alkyl is to be understood as preferably meaning a linear or branched, saturated, monovalent hydrocarbon group in which the term "G - Ce-alkyl” is defined supra, and in which one or more of the hydrogen atoms is replaced, in identically or differently, by a halogen atom. Particularly, said halogen atom is F.
  • Said halo-G -Ce-alkyl group is, for example, -CF3, -CHF2, -CH2F, -CF2CF3, or -CH2CF3.
  • G -Ce-alkoxy is to be understood as preferably meaning a linear or branched, saturated, monovalent group of formula 0- (G -C6-alkyl), in which the term “G -C6-alkyl” is defined supra, e.g. a methoxy, ethoxy, n-propoxy, iso-propoxy, n-butoxy, iso-butoxy, tert-butoxy, sec-butoxy, pentoxy, iso- pentoxy, or n-hexoxy group, or an isomer thereof.
  • halo-G -C6-alkoxy is to be understood as preferably meaning a linear or branched, saturated, monovalent G -C6-alkoxy group, as defined supra, in which one or more of the hydrogen atoms is replaced, in identically or differently, by a halogen atom.
  • said halogen atom is F.
  • Said halo-CrC6-alkoxy group is, for example, -OCF3, -OCHF2, -OCH2F, -OCF2CF3, or -
  • CrC6-alkoxy-Ci -C6-alkyl is to be understood as preferably meaning a linear or branched, saturated, monovalent G-Ce-alkyl group, as defined supra, in which one or more of the hydrogen atoms is replaced, in identically or differently, by a G-C6-alkoxy group, as defined supra, e.g.
  • halo-CrC6-alkoxy-Ci-C6-alkyl is to be understood as preferably meaning a linear or branched, saturated, monovalent G-C6-alkoxy-CrC6-alkyl group, as defined supra, in which one or more of the hydrogen atoms is replaced, in identically or differently, by a halogen atom.
  • said halogen atom is F.
  • Said halo-CrC6-alkoxy-G-C6-alkyl group is, for example, CH2CH2OCF3, -CH2CH2OCHF2, -CH2CH2OCH2F, -CH2CH2OCF2CF3, or
  • C2-C6-alkenyl is to be understood as preferably meaning a linear or branched, monovalent hydrocarbon group, which contains one or more double bonds, and which has 2, 3, 4, 5 or 6 carbon atoms, particularly 2 or 3 carbon atoms (“C2-C3-alkenyl”), it being understood that in the case in which said alkenyl group contains more than one double bond, then said double bonds may be isolated from, or conjugated with, each other.
  • Said alkenyl group is, for example, a vinyl, allyl, (E)-2-methylvinyl, (Z)-2-methylvinyl, homoallyl, (E)-but-2-enyl, (Z)-but-2-enyl, (E)-buM -enyl, (Z)-buM -enyl, pent-4-enyl, (E)- pent-3-enyl, (Z)-pent-3-enyl, (E)-pent-2-enyl, (Z)-pent-2-enyl, (E)-penM -enyl, (Z)-penM -enyl, hex-5-enyl, (E)-hex-4-enyl, (Z)-hex-4-enyl, (E)-hex-3-enyl, (Z)-hex-3-enyl, (E)-hex-2-enyl, (Z)-hex-2-enyl, (E)
  • C2-C6-alkynyl is to be understood as preferably meaning a linear or branched, monovalent hydrocarbon group which contains one or more triple bonds, and which contains 2, 3, 4, 5 or 6 carbon atoms, particularly 2 or 3 carbon atoms ("C2-Cralkynyl").
  • Said C2-C6-alkynyl group is, for example, ethynyl, prop-1 -ynyl, prop-2-ynyl, but-Tynyl, but-2-ynyl, but-3-ynyl, pent-1 - ynyl, pent-2-ynyl, pent-3-ynyl, pent-4-ynyl, hex-1 -ynyl, hex-2-inyl, hex-3-inyl, hex-4-ynyl, hex-5-ynyl, 1 -methylprop-2-ynyl, 2-methylbut-3-ynyl, 1 - methylbut-3-ynyl, 1 -methylbut-2-ynyl, 3-methylbut-1 -ynyl, 1 -ethylprop-2- ynyl, 3-methylpent-4-ynyl, 2-methylpent-4-ynyl, 1 -methyl
  • alkynyl group is ethynyl, prop- 1 -ynyl, or prop-2-inyl.
  • C:rC6-cycloalkyl is to be understood as preferably meaning a saturated, monovalent, mono-, or bicyclic hydrocarbon ring which contains 3, 4, 5 or 6 carbon atoms.
  • Said C3-C&-cycloalkyl group is for example, a monocyclic hydrocarbon ring, e.g. a cyclopropyl, cyclobutyl, cyclopentyl, or cyciohexyi or a bicyclic hydrocarbon ring.
  • Said cycioaikyl ring can optionally contain one or more double bonds e.g.
  • cycloalkenyl such as a cyclopropenyl, cyclobutenyl, cyclopentenyl or cyclohexenyl group, wherein the bond between said ring with the rest of the molecule may be to any carbon atom of said ring, be it saturated or unsaturated.
  • heterocyclic ring as used in the term “4-, 5- or 6- membered heterocyclic ring”, or “4- to 6-membered heterocyclic ring” or “4- to 5- membered heterocyclic ring”, for example, as used in the definition of compounds of general formula (I) as defined herein, is to be understood as meaning a saturated or partially unsaturated, monocyclic nitrogen atom- containing ring, said nitrogen atom being the point of attachment of said heterocyclic ring with the rest of the molecule.
  • said nitrogen atom-containing ring can be partially unsaturated, i.e. it can contain one or more double bonds, such as, without being limited thereto, a 2,5-dihydro-1 H-pyrrolyl ring, for example.
  • Said heterocycloalkyl ring is for example, a monocyclic heterocycloalkyl ring such as an oxyranyl, oxetanyl, aziridinyl, azetidinyl, tetrahydrofuranyl, pyrrolidinyl, imidazolidinyl, pyrazolidinyl, pyrrolinyl, tetrahydropyranyl, piperidinyl, morpholinyl, dithianyl, thiomorpholinyl, piperazinyl, trithianyl, or chinuclidinyl group.
  • said heterocycloalkyl ring can contain one or more double bonds, e.g.
  • 4H-pyranyl 2H-pyranyl, 3H-diazirinyl, 2 , 5 - di hyd ro - 1 H - pyr rolyl , [1 ,3]dioxolyl, 4H- [1 ,3,4]thiadiazinyl, 2,5-dihydrofuranyl, 2,3-dihydrofuranyl, 2,5-dihydrothiophenyl, 2,3-dihydrothiophenyl, 4,5-dihydro-1 ,3-oxazolyl, 4,4- dimethyl-4,5-dihydro-1 ,3-oxazolyl , or 4H -[1 ,4]thiazinyl group, or, it may be benzo fused.
  • aryl is to be understood as preferably meaning a monovalent, aromatic or partially aromatic, mono-, or bi- or tricyclic hydrocarbon ring having 6, 7, 8, 9, 10, 1 1 , 12, 13 or 14 carbon atoms (a "Ce-Cu-aryl” group), particularly a ring having 6 carbon atoms (a "C6-aryl” group), e.g. a phenyl group, or a biphenyl group, or a ring having 9 carbon atoms (a "Craryl” group), e.g. an indanyi or indenyl group, or a ring having 10 carbon atoms (a "Cio-aryl” group), e.g.
  • heteroaryi is understood as preferably meaning a monovalent, aromatic, mono- or bicyciic aromatic ring system having 5, 6, 7, 8, 9, 10, 1 1 , 12, 13 or 14 ring atoms (a "5- to 14-membered heteroaryi” group), particularly 5 or 6 or 9 or 10 atoms, and which contains at least one heteroatom which may be identical or different, said heteroatom being such as oxygen, nitrogen or sulfur, and can be monocyclic, bicyciic, or tricyclic, and in addition in each case can be benzocondensed.
  • heteroaryi is selected from thienyl, furanyl, pyr rolyl, oxazolyl, thiazolyl, imidazolyl, pyrazolyl, isoxazolyl, isothiazolyl, oxadiazolyl, triazolyl, thiadiazolyl, thia-4H-pyrazolyl etc. , and benzo derivatives thereof, such as, for example, benzofuranyl, benzothienyl, benzoxazolyl, benzisoxazolyl, benzimidazolyl, benzotriazolyl, indazolyl, indolyl, isoindolyl, etc.
  • pyridyl pyridazinyl, pyrimidinyl, pyrazinyl, triazinyl, etc.
  • benzo derivatives thereof such as, for example, quinolinyl, quinazolinyl, isoquinolinyl, etc. ; or azocinyl, indolizinyl, purinyl, etc.
  • heteroaryl is selected from pyridyl, benzofuranyl, benzisoxazolyl, indazolyl, quinazolinyl, thienyl, quinolinyl, benzothienyl, pyrazolyl, or furanyl.
  • alkylene is understood as preferably meaning an optionally substituted hydrocarbon chain (or “tether”) having 1 , 2, 3, 4, 5, 6, 7 or 8 carbon atoms, i.e. an optionally substituted CH2- ("methylene” or “single membered tether” or, for example -C(CH;s)2-), -CH2-CH2- ("ethylene”, “dimethylene”, or “two-membered tether", for example C(CHi)2-C(CH;j)2-), - CH2-CH2-CH2- ("propylene”, “trimethylene”, or "three-membered tether", for example CH 2 -C(H)(CH 3 )-CH2- , -CH2-C(CH 3 )2-CH 2 -), -CH2-CH2-CH2-CH2- ("butylene", “tetramethylene”, or "four-membered tether"), -CH2-CH2-CH2- CH2-CH2- ("pentylene”, "pentamethylene” or "five-member
  • C1 -C6 as used throughout this text, e.g. in the context of the definition of "C C 6 -alkyl", “G -G-haloalkyl", “G -G-alkoxy”, or “G -G- haloalkoxy” is to be understood as meaning an a Iky I group having a finite number of carbon atoms of 1 to 6, i.e. 1 , 2, 3, 4, 5, or 6 carbon atoms. It is to be understood further that said term “G -G” is to be interpreted as any subrange comprised therein, e.g. G -G , C2-C5 , C3-C4 .
  • G - , G - ; particularly G -C2 .
  • C1 -C5 , G -G more particularly G - ; in the case of "G -G-haloalkyl” or "G -C6-haloalkoxy" even more particularly G -G.
  • C2-C6 as used throughout this text, e.g.
  • G-Ce-alkenyl and "d-Ce-alkynyl”
  • C2-C6 is to be interpreted as any sub-range comprised therein, e.g. C 2 -Cb . C3-C5 , CrO . C2-C3 , C2-C4 , C2-C5 ; particularly C 2 - C 3 .
  • C3-C6 as used throughout this text, e.g. in the context of the definition of "C3-C6-cycloalkyl”, is to be understood as meaning a cycloalkyl group having a finite number of carbon atoms of 3 to 6, i.e. 3, 4, 5 or 6 carbon atoms. It is to be understood further that said term “C3-C6” is to be interpreted as any sub-range comprised therein, e.g. C3-C0 , C4- C5 , C3-C5 , C3-C4 , C 4 -C 6 , C5-C6 ; particularly C3-C6.
  • a leaving group refers to an atom or a group of atoms that is displaced in a chemical reaction as stable species taking with it the bonding electrons.
  • a leaving group is selected from the group comprising: halo, in particular chloro, bromo or iodo, methanesulfonyloxy, p-toluenesulfonyloxy, trifluoromethanesulfonyloxy, nonafluorobutanesulfonyloxy, (4-bromo-benzene)sulfonyloxy, (4-nitro- benzene)sulfonyloxy, (2-nitro-benzene)-sulfonyloxy, (4-isopropyl- benzene)sulfonyloxy, (2,4,6-tri-isopropyl-benzene)-sulfonyloxy, (2,4,6-trimethyl-benzene)sulfony
  • R E is e.g. a G -C6-alkyl- or C3-C6-cycloalkyl- group.
  • protected amine is an amino group in which a protecting group is introduced by chemical modification of said amino group in order to obtain chemoselectivity in a subsequent chemical reaction. Protecting groups for amino groups are descibed for example in T.W. Greene and P.G.M. Wuts in Protective Groups in Organic Synthesis, 3 rd edition, Wiley 1999.
  • the term "one or more times”, e.g. in the definition of the substituents of the compounds of the general formulae of the present invention, is understood as meaning “one, two, three, four or five times, particularly one, two, three or four times, more particularly one, two or three times, even more particularly one or two times".
  • the plural form of the word compounds, salts, polymorphs, hydrates, solvates and the like is used herein, this is taken to mean also a single compound, salt, polymorph, isomer, hydrate, solvate or the like.
  • the compounds of this invention contain one or more asymmetric centre, depending upon the location and nature of the various substituents desired.
  • Asymmetric carbon atoms may be present in the (R) or (S) configuration. In certain instances, asymmetry may also be present due to restricted rotation about a given bond, for example, the central bond adjoining two substituted aromatic rings of the specified compounds. Substituents on a ring may also be present in either cis or trans form. It is intended that all such configurations are included within the scope of the present invention.
  • Preferred compounds are those which produce the more desirable biological activity.
  • Separated, pure or partially purified isomers and stereoisomers or racemic or diastereomeric mixtures of the compounds of this invention are also included within the scope of the present invention.
  • the purification and the separation of such materials can be accomplished by standard techniques known in the art.
  • the optical isomers can be obtained by resolution of the racemic mixtures according to conventional processes, for example, by the formation of diastereoisomeric salts using an optically active acid or base or formation of covalent diastereomers.
  • appropriate acids are tartaric, diacetyltartaric, ditoluoyltartaric and camphorsulfonic acid.
  • Mixtures of diastereoisomers can be separated into their individual diastereomers on the basis of their physical and/or chemical differences by methods known in the art, for example, by chromatography or fractional crystallisation.
  • the optically active bases or acids are then liberated from the separated diastereomeric salts.
  • a different process for separation of optical isomers involves the use of chiral chromatography (e.g. , chiral HPLC columns), with or without conventional derivatisation, optimally chosen to maximise the separation of the enantiomers.
  • Suitable chiral HPLC columns are manufactured by Diacel, e.g. , Chiracel OD and Chiracel OJ among many others, all routinely selectable.
  • Enzymatic separations, with or without derivatisation are also useful.
  • the optically active compounds of this invention can likewise be obtained by chiral syntheses utilizing optically active starting materials.
  • the invention also includes all suitable isotopic variations of a compound of the invention.
  • An isotopic variation of a compound of the invention is defined as one in which at least one atom is replaced by an atom having the same atomic number but an atomic mass different from the atomic mass usually or predominantly found in nature.
  • isotopes that can be incorporated into a compound of the invention include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulphur, fluorine, chlorine, bromine and iodine, such as 2 H (deuterium), H (tritium), 11 C, 13 C, 14 C, 15 N, 17 0, 18 0, 32 P, 3 P, 33 S, 34 S, 35 S, 36 S, 18 F, 36 Cl, 82 Br, 12 l, 1 4 l, 129 l and 1 1 l, respectively.
  • Certain isotopic variations of a compound of the invention for example, those in which one or more radioactive isotopes such as 3 H or 14 C are incorporated, are useful in drug and/or substrate tissue distribution studies.
  • Tritiated and carbon- 14, i.e. , 14 C, isotopes are particularly preferred for their ease of preparation and detectability. Further, substitution with isotopes such as deuterium may afford certain therapeutic advantages resulting from greater metabolic stability, for example, increased in vivo half-life or reduced dosage requirements and hence may be preferred in some circumstances.
  • Isotopic variations of a compound of the invention can generally be prepared by conventional procedures known by a person skilled in the art such as by the illustrative methods or by the preparations described in the examples hereafter using appropriate isotopic variations of suitable reagents.
  • the present invention includes all possible stereoisomers of the compounds of the present invention as single stereoisomers, or as any mixture of said stereoisomers, in any ratio.
  • Isolation of a single stereoisomer, e.g. a single enantiomer or a single diastereomer, of a compound of the present invention may be achieved by any suitable state of the art method, such as chromatography, especially chiral chromatography, for example.
  • the compounds of the present invention may exist as tautomers.
  • any compound of the present invention which contains a pyrazole moiety as a heteroaryl group for example can exist as a 1 H tautomer, or a 2H tautomer, or even a mixture in any amount of the two tautomers, or a triazole moiety for example can exist as a 1 H tautomer, a 2H tautomer, or a 4H tautomer, or even a mixture in any amount of said 1 H, 2H and 4H tautomers, viz. :
  • the present invention includes all possible tautomers of the compounds of the present invention as single tautomers, or as any mixture of said tautomers, in any ratio.
  • the present invention includes all possible crystalline forms, or polymorphs, of the compounds of the present invention, either as single polymorphs, or as a mixture of more than one polymorphs, in any ratio.
  • the present invention relates to combinations of at least two compounds A and B, compound A being an inhibitor of Mps-1 kinase, and compound B being an inhibitor of an anti- apoptotic protein of the Bcl-2 family.
  • compound A can be selected from inhibitors of Mps-1 kinase (or a prodrug thereof) specifically or generically disclosed e.g. in the following publications which are incorporated herein by reference:
  • the compound A being an inhibitor of Mps-1 kinase is selected from the group of compounds of general formula (I) :
  • R A2 independently represents halo-, hydroxy-, nitro-, G -C6-alkyl-,
  • R 3 represents a hydrogen atom, a halogen atom, a hydroxy-, amino-, cyano-, nitro-, C C4-alkyl-, halo-G-C4-alkyl-, G-Cralkoxy-,
  • R 4 represents a hydrogen atom, a halogen atom, a hydroxy-, amino-, cyano-, nitro-, G-C4-alkyl-, halo-C C4-alkyl-, G-C4-alkoxy-,
  • R 5 represents a hydrogen atom or a Ci-Cs-alkyl- group ;
  • R a represents a group selected from:
  • R b represents a group selected from:
  • R 8 -(C, -C6-alkoxy-C, -C6-alkyl)-0- , -0- ⁇ CH 2 ) n -C( 0)NR 8 R 7 , R 8 -0-,
  • R 6 represents a group selected from CrC6-cycloalkyl- , 3- to 10-membered heterocycloalkyl- , aryl- , heteroaryl- , -(CH 2 ) q -(CrC6-cycloalkyl),
  • Ci-C6-alkoxy-CrC6-alkyl- halo-Ci-C6-alkoxy-Ci -C6-alkyl- ,
  • R 7 represents a hydrogen atom, a C C6-alkyl- or a C3-C6-cycloalkyl- group
  • R 8 represents a hydrogen atom or a Ci-Ce-alkyl- or C;rC6-cycloalkyl- group, wherein said CrCe-alkyl- or C3-C6-cycloalkyl- group is optionally substituted , one or more times, identically or differently, with a substituent selected from:
  • R 7 and R 8 together with the molecular fragment they are attached to represent a 4- to 6-membered heterocyclic ring, which is optionally substituted, one or more times, identically of differently, with a halogen atom, a G-C3-alkyl-, halo-G-Cralkyl- or G-C3-alkoxy- group;
  • Q 1 represents a group selected from: N, CH, C-(CrC6-alkyl),
  • Q 2 represents a group selected from: N, CH, CR b ;
  • Q 3 represents a group selected from: N, CH, CR b ; n, m, p,
  • t represents an integer of 0, 1 or 2; or a tautomer, an N -oxide, a hydrate, a solvate, or a salt thereof, or a mixture of same.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R A1 represents
  • R 9 represents a group selected from: Ci -C -alkyl-
  • R 10 represents a group ; wherein * indicates the point of attachment of said group with the rest of the molecule ; wherein said group is optionally substituted, one or more times, identically or differently, with a halogen atom or a methyl- group.
  • R 9 represents a group selected from: C1 -C3- alkyl-, hydroxy-CrC 3 -alkyl-, -N(H)R 8 , N(H)(R 8 )-Ci-Cralkyl-.
  • R 9 represents a group selected from: C1 -C3- alkyl-, hydroxy-Ci-C ;i -alkyl-, -N ⁇ R 11 )R 11 , -CrC 2 -alkyl-N(R 11 )R 11 ; in which each R" indepedently represents a hydrogen atom or a methyl- group.
  • R 9 represents a group selected from: methyl-, hydroxy-C,-C 2 -alkyl-, -N(R 11 )R 11 , -C r C 2 -alkyl-N(R 11 )R 11 ; in which each R 11 indepedently represents a hydrogen atom or a methyl- group.
  • R 9 represents a group selected from: methyl-, HO-CH2- , H2N-CH2-, -NH2. In another preferred embodiment, R 9 represents a group selected from: methyl-, HO-CH 2 -, -NH 2 .
  • R 9 represents a methyl- group. In another preferred embodiment, R 9 represents a HO-CH2- group. In another preferred embodiment, R 9 represents a -NH2 group. In another preferred embodiment, R 10 represents a group ; wherein * indicates the point of attachment of said group with the rest of the molecule.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R A1 represents a group selected from:
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R A1 represents a group selected from:
  • compound A is selected from the group of compounds of general formula (I), supra, wherein each R A2 independently represents halo-, G -Ce-alkyl- or G -Ce-alkoxy-.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein each R A2 independently represents halo-, G -C i-alkyl- or G -G-alkoxy-.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein t represents 1 and R A2 represents halo-, G -Ce-alkyl- or G -C6-alkoxy-.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein t represents 1 and R A2 represents halo-, G-Cralkyl- or G -C -alkoxy-.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein Q 1 represents a group selected from: CH, C- (G -C6-alkyl), C- (G -C6-alkoxy), C-halo.
  • Q 1 represents CH .
  • Q 2 represents CH.
  • Q 3 represents CH or N.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein Q 1 and Q 2 represent CH, and Q 3 represents CH or N.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein Q 1 and Q 2 and Q 3 represent CH.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R 2 is selected from the group consisting of:
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R 3 represents a hydrogen atom, halo-, a hydroxy-, d-C ⁇ alkyl-, halo-CrC 4 -alkyl- or
  • R 3 represents a hydrogen atom.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R 4 represents a hydrogen atom, halo-, a G -C6-alkyl-, halo-CrCe-alkyl- or CrCe-alkoxy- group.
  • R 4 represents a hydrogen atom.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R 3 and R 4 represent a hydrogen atom.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R 5 represents a hydrogen atom or a methyl- group.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R 5 represents a hydrogen atom.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R 3 and R 4 and R 5 represent a hydrogen atom.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R a represents a group selected from: halo-, nitro-, G-Ce-alkyl-, halo-G-Ce-alkyl-, G-C6-alkoxy-, halo-CrC6-alkoxy-, hydroxy-Ci -C6-alkyl- , Ci-C6-alkoxy-CrC6-alkyl-,
  • R 5a represents a group selected from: halo-, Ci-Ce-alkyl-, G-C6-alkoxy-, halo-Ci -C6-alkoxy-, hydroxy- G-Ce-alkyl
  • R a is selected from: halo-, G-Ce-alkyl-, G-Ce-alkoxy-,
  • R a is selected from: F-, methyl-, methoxy-, ethoxy-, n-propoxy-, iso-propoxy-, cyclopropyl-O-, cyclopropyl-CH2-0-, CH3-O-CH2CH2- 0-, CHF2-O-, CF3-O-, CF3CH2-O-.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R 5a represents a G -Ce- alkoxy- group.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R 5a represents a G -C3- alkoxy- group.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R a represents a halo-G -C6- alkoxy- group.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R a represents a halo-G -Cr alkoxy- group.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R a represents a group selected from: G-C3-alkoxy-, halo-G -G-alkoxy-, Ci -Cs-alkyl-.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R a represents a group selected from: G-C2-alkoxy-, halo-G -C2-alkoxy-, G -C2-alkyl-.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein 5a represents a group selected from: G -G-alkoxy-, halo-G-Cralkoxy-.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R 5a represents a group selected from: G -C2-alkoxy-, halo-G-G-alkoxy-.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R a represents a methoxy- or ethoxy- group which is optionally substituted, one or more times, identically or differently, with a halogen atom.
  • R a represents a methoxy- or ethoxy- group which is optionally substituted, one or more times, identically or differently, with a halogen atom.
  • the preferred halogen atom is F.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R a represents a group selected from: methoxy-, ethoxy-, F3C-CH2-O-.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R a represents a group selected from: methoxy-, F3C-CH2-O-.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R b represents a group selected from: halo-, hydroxy-, cyano-, nitro-, G -C6-alkyl-, halo-G -C6-alkyl-, G -C6-alkoxy-, halo-G -Ce-alkoxy-, hydroxy-G -Ce-alkyl-,
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R b represents a group selected from: halo-, cyano-, nitro-, G -Ce-alkyl-, halo-CrC6-alkyl-,
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R b represents a
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R b represents a
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R b represents a
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R b represents a group.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R b represents
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R b represents a group; in which R 7 represents a methyl- group. In another preferred embodiment, compound A is selected from the group of compounds of general formula (I) , supra, wherein R b represents
  • R 8 represents a hydrogen atom or a G -C ralkyl- or Cr C6-cycloalkyl- group, wherein said d -Cralkyl- or CrCe-cycloalkyl- group is optionally substituted, one or more times, with a halogen atom.
  • the preferred halogen atom is F.
  • compound A is selected from the group of compounds of general formula (I) , supra, wherein R b represents
  • R 8 represents a hydrogen atom or a Ci -Cj-alkyl- group, wherein said G -Cralkyl- group is optionally substituted, one or more times, with a halogen atom.
  • the preferred halogen atom is F.
  • compound A is selected from the group of compounds of general formula (I) , supra, wherein R b represents
  • R 8 represents a group selected from: -CH 3 , -CF 3 , -C2H5,
  • compound A is selected from the group of compounds of general formula (I) , supra, wherein R b represents
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R b represents
  • R 7 and R 8 together with the N atom they are attached to represent a 4-memberered heterocyclic ring, which is optionally substituted, one or more times, identically or differently, with a halogen atom, a C1 -C3- alkyl- or a halo-d-Cralkyl- group.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R b represents
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R b represents
  • R 7 and R 8 together with the N atom they are attached to represent a 4-memberered heterocyclic ring, which is optionally substituted, one or more times, with a fluorine atom.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R b represents
  • R 7 and R 8 together with the molecular fragment they are attached to represent a 4- to 6-memberered heterocyclic ring, which is optionally substituted, one or more times, identically or differently, with a halogen atom, a C -Cs-aLkyi- or a halo-G-Cs-alkyl- group.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R b represents
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R b is selected from: H C-
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R 6 represents a group selected from: CrC6-cycloalkyl-, 3- to 10-membered heterocycloalkyl-, aryl-, heteroaryl-, -(CH2) q - (C3-C6-cycloalkyl), -(CH 2 ) q -(3- to 10-membered heterocycloalkyl), -(CH2) q -aryl, or -(Chhjq-heteroaryl;
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R 6 represents a group selected from: -CH2-(CrC6-cycloalkyl) or -CH2-aryl; wherein said group is optionally substituted, one or more times, identically or differently, with a substituent selected from: halo-, G-Ce-alkyl-, halo-G-Ce-alkyl-, halo-G-Ce- alkoxy-.
  • the C rC6-cycloalkyl- group preferably is a cyclopropyl- group; the aryl- group is preferably a phenyl- group.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R 6 represents a group selected from: -(CH2)-phenyl, -(CH2)-cyclopropyl;
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R 7 represents a hydrogen atom or a G-C6-alkyl- group.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R 7 represents a G-C3-alkyl- group.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R 7 represents a methyl- group.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R 7 represents a hydrogen atom, or a CrC6-cycloalkyl- group.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R 8 represents a hydrogen atom or a G-C6-alkyl- group, wherein said G-Ce-alkyl-group is optionally substituted, one or more times, identically or differently, with a substituent selected from:
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R 8 represents a hydrogen atom or CrCe-cycloalkyl- group, wherein said CrC6-cycloalkyl- group is optionally substituted, one or more times, identically or differently, with a substituent selected from:
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R 8 represents a hydrogen atom or a G-Ce-alkyl- group, wherein said CrC6-alkyl-group is optionally substituted, one or more times, identically or differently, with a substituent selected from:
  • Ci-C 3 -alkyl- Ci-C 3 -alkyl-, G-C 3 -alkoxy-, halo-C C 3 -alkoxy-.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R 8 represents a hydrogen atom or C -C6-cycloalkyl- group, wherein said CrCe-cycloalkyl- group is optionally substituted, one or more times, identically or differently, with a substituent selected from: halo-, G-C3-alkyl-, G-C3-alkoxy-, halo-G-C3-alkoxy-.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R 8 represents a hydrogen atom or a G-Ce-alkyl- group, wherein said G-C6-alkyl-group is optionally substituted with a halogen atom.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R 8 represents a hydrogen atom or a G-Cralkyl- group, wherein said G-Cralkyl- group is optionally substituted, one or more times, with a halogen atom.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein R 7 and R 8 together with the molecular fragment they are attached to represent a 4- to 6-membered heterocyclic ring, which is optionally substituted, one or more times, identically of differently, with a halogen atom, a G-C -alkyl-, halo-G-C3-alkyl- or Ci-C3-alkoxy- group.
  • compound A is selected from the group of compounds of general formula (I), supra, wherein n represents an integer of 0, 1 or 2. Preferably, n represent 0 or 1 .
  • t an integer of 0 or 1 .
  • t 0.
  • the molecular weight of a compound very often has an influence on the bioavailability; see e.g. Lipinski 3 ⁇ 4 s Rule of five (Lipinski, C.A. ; Lombardo, F.; Dominy, B.W.; Feeney, P.J. ; Adv. Drug Deliver. Rev. 1997, 23, 3).
  • compound A is selected from the group of compounds of general formula (I), supra, wherein the molecular weight is less than 655.
  • the molecular weight of the compound of formula (I), supra is less than 630, more preferably less than 600, most preferably less than 590.
  • compound B can be selected from inhibitors of an anti-apoptotic protein of the Bcl-2 family specifically or generically disclosed e.g. in the following publications which are incorporated herein by reference: US 8, 188,077 B2; C. Bodur and H. Basaga, Bcl-2 Inhibitors: Emerging Drugs in Cancer Therapy, Current Medicinal Chemistry, 2012, 19, 1804-1820; Mohammad, R. M., et al. Preclinical studies of TW-37, a new nonpeptidic small-molecule inhibitor of Bcl-2, in diffuse large cell lymphoma xenograft model reveal drug action on both Bcl-2 and Mcl- 1 . Clin. Cancer Res. 13, 2226-2235, 2007.
  • Compound B can be selected from the group of compounds consisting of:
  • B717/LIC-101 complex (Nippon Shinyaku Co. Ltd.), bcl-2 inhibiting siRNA/LIC- 24 liposome complex (Nippon Shinyaku Co. Ltd. ), beclanorsen (Santaris Pharma A/S), VMD-8018 (VM Discovery Inc.), oblimersen (Genta Inc.), apogossypol (Sanford-Burnham Medical Research Institute), 1 133719 (Kirin Brewery Co.
  • PNT-100 ProNAi Therapeutics Inc.
  • HG-1 1 13 Human Genome Sciences Inc.
  • S-44563 Servier
  • ABT-731 Abbott Laboratories
  • modified HA14-1 compounds GL Pharmaceutical Inc.
  • ONT-701 Sanford- Burnham Medical Research Institute
  • gossypol derivatives INERM
  • BP-100- 1 .02 Bio-Path Holdings Inc.
  • obatociax Gamin X Pharmaceuticals Inc.
  • navitoclax Abbott Laboratories
  • AT- 101 Universality of Michigan
  • compound B is selected from the group consisting of: Obatociax (GX-1 5-070), Navitoclax (ABT-263), TW-37, B717/LIC-101 complex, beclanorsen, VMD-8018, oblimersen, apogossypol, 1 133719, PNT-100, HG- 1 1 13, S-44563, ABT-731 , ONT-701 , BP-100- 1 .02, AT- 101 .
  • the present invention relates to a combination of any component A mentioned herein with any component B mentioned herein, optionally with any component C mentioned herein.
  • the present invention relates to a combination of a component A with a component B, optionally with a component C, as mentioned in the Examples Section herein.
  • the present invention relates to : a kit comprising :
  • component A one or more Mps-1 kinase inhibitors, or a physiologically acceptable salt, solvate, hydrate or stereoisomer thereof
  • component B one or more inhibitors of an anti-apoptotic protein from the Bcl-2 family, or a physiologically acceptable salt, solvate, hydrate or stereoisomer thereof
  • component C one or more further pharmaceutical agents ; in which optionally either or both of said components A and B in any of the above-mentioned combinations are in the form of a pharmaceutical formulation which is ready for use to be administered simultaneously, concurrently, separately or sequentially.
  • the components may be administered independnently of one another by the oral, intravenous, topical, local installations, intraperitoneal or nasal route.
  • Either or both of components A and B of any of the combinations of the present invention may be in a useful form, such as pharmaceutically acceptable salts, co-precipitates, metabolites, hydrates, solvates and prodrugs of all the compounds of examples.
  • pharmaceutically acceptable salt refers to a relatively non-toxic, inorganic or organic acid addition salt of a compound of the present invention. For example, see S. M. Berge, et al. "Pharmaceutical Salts, " J. Pharm. Sci. 1977, 66, 1 -19.
  • Pharmaceutically acceptable salts include those obtained by reacting the main compound, functioning as a base, with an inorganic or organic acid to form a salt, for example, salts of hydrochloric acid, sulfuric acid, phosphoric acid, methane sulfonic acid, camphor sulfonic acid, oxalic acid, maleic acid, succinic acid and citric acid.
  • Pharmaceutically acceptable salts also include those in which the main compound functions as an acid and is reacted with an appropriate base to form, e.g. , sodium, potassium, calcium, magnesium, ammonium, and chorine salts.
  • acid addition salts of the claimed compounds may be prepared by reaction of the compounds with the appropriate inorganic or organic acid via any of a number of known methods.
  • alkali and alkaline earth metal salts of acidic compounds of the invention are prepared by reacting the compounds of the invention with the appropriate base via a variety of known methods.
  • Representative salts of the compounds of this invention include the conventional non-toxic salts and the quaternary ammonium salts which are formed, for example, from inorganic or organic acids or bases by means well known in the art.
  • such acid addition salts include acetate, adipate, alginate, ascorbate, aspartate, benzoate, benzenesulfonate, bisulfate, butyrate, citrate, camphorate, camphorsulfonate, cinnamate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, fumarate, glucoheptanoate, glycerophosphate, hemisulfate, heptanoate, hexanoate, chloride, bromide, iodide, 2-hydroxyethanesulfonate, itaconate, lactate, maleate, mandelate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oxalate, pamoate, pectinate, persulfate, 3- phenylpropionate, pic
  • Base salts include alkali metal salts such as potassium and sodium salts, alkaline earth metal salts such as calcium and magnesium salts, and ammonium salts with organic bases such as dicyclohexylamine and N-methyl- D-glucamine. Additionally, basic nitrogen containing groups may be quaternized with such agents as lower alkyl halides such as methyl, ethyl, propyl, or butyl chlorides, bromides and iodides; dialkyl sulfates like dimethyl, diethyl, dibutyl sulfate, or diamyl sulfates, long chain halides such as decyl, lauryl, myristyl and strearyl chlorides, bromides and iodides, aralkyl halides like benzyl and phenethyl bromides and others.
  • lower alkyl halides such as methyl, ethyl, propyl, or butyl chlorides,
  • a solvate for the purpose of this invention is a complex of a solvent and a compound of the invention in the solid state.
  • Exemplary solvates would include, but are not limited to, complexes of a compound of the invention with ethanol or methanol. Hydrates are a specific form of solvate wherein the solvent is water.
  • Compositions of this invention may be tableted with conventional tablet bases such as lactose, sucrose and cornstarch in combination with binders such as acacia, corn starch or gelatin, disintegrating agents intended to assist the break-up and dissolution of the tablet following administration such as potato starch, alginic acid, corn starch, and guar gum, gum tragacanth, acacia, lubricants intended to improve the flow of tablet granulation and to prevent the adhesion of tablet material to the surfaces of the tablet dies and punches, for example talc, stearic acid, or magnesium, calcium or zinc stearate, dyes, coloring agents, and flavoring agents such as peppermint, oil of wintergreen, or cherry flavoring, intended to enhance the aesthetic qualities of the tablets and make them more acceptable to the patient.
  • binders such as acacia, corn starch or gelatin
  • disintegrating agents intended to assist the break-up and dissolution of the tablet following administration such as potato starch, alginic acid, corn
  • Suitable excipients for use in oral liquid dosage forms include dicalcium phosphate and diluents such as water and alcohols, for example, ethanol, benzyl alcohol, and polyethylene alcohols, either with or without the addition of a pharmaceutically acceptable surfactant, suspending agent or emulsifying agent.
  • Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. For instance tablets, pills or capsules may be coated with shellac, sugar or both.
  • Dispersible powders and granules are suitable for the preparation of an aqueous suspension. They provide the active ingredient in admixture with a dispersing or wetting agent, a suspending agent and one or more preservatives. Suitable dispersing or wetting agents and suspending agents are exemplified by those already mentioned above. Additional excipients, for example those sweetening, flavoring and coloring agents described above, may also be present.
  • the pharmaceutical compositions of this invention may also be in the form of oil-in-water emulsions.
  • the oily phase may be a vegetable oil such as liquid paraffin or a mixture of vegetable oils.
  • Suitable emulsifying agents may be (1 ) naturally occurring gums such as gum acacia and gum tragacanth, (2) naturally occurring phosphatides such as soy bean and lecithin, (3) esters or partial esters derived form fatty acids and hexitol anhydrides, for example, sorbitan monooleate, (4) condensation products of said partial esters with ethylene oxide, for example, polyoxyethylene sorbitan monooleate.
  • the emulsions may also contain sweetening and flavoring agents.
  • Oily suspensions may be formulated by suspending the active ingredient in a vegetable oil such as, for example, arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin.
  • the oily suspensions may contain a thickening agent such as, for example, beeswax, hard paraffin, or cetyl alcohol.
  • the suspensions may also contain one or more preservatives, for example, ethyl or n-propyl p- hydroxybenzoate ; one or more coloring agents; one or more flavoring agents; and one or more sweetening agents such as sucrose or saccharin.
  • Syrups and elixirs may be formulated with sweetening agents such as, for example, glycerol, propylene glycol, sorbitol or sucrose. Such formulations may also contain a demulcent, and preservative, such as methyl and propyl parabens and flavoring and coloring agents.
  • sweetening agents such as, for example, glycerol, propylene glycol, sorbitol or sucrose.
  • Such formulations may also contain a demulcent, and preservative, such as methyl and propyl parabens and flavoring and coloring agents.
  • the combinations of this invention may also be administered parenterally, that is, subcutaneously, intravenously, intraocularly, intrasynovially, intramuscularly, or interperitoneally, as injectable dosages of the compound in preferably a physiologically acceptable diluent with a pharmaceutical carrier which can be a sterile liquid or mixture of liquids such as water, saline, aqueous dextrose and related sugar solutions, an alcohol such as ethanol, isopropanol, or hexadecyl alcohol, glycols such as propylene glycol or polyethylene glycol, glycerol ketals such as 2,2-dimethyl-1 ,1 -dioxolane-4- methanol, ethers such as polyethylene glycol) 400, an oil, a fatty acid, a fatty acid ester or, a fatty acid glyceride, or an acetylated fatty acid glyceride, with or without the addition of a pharmaceutically acceptable surfact
  • Suitable fatty acids include oleic acid, stearic acid, isostearic acid and myristic acid.
  • Suitable fatty acid esters are, for example, ethyl oleate and isopropyl myristate.
  • Suitable soaps include fatty acid alkali metal, ammonium, and triethanolamine salts and suitable detergents include cationic detergents, for example dimethyl dialkyl ammonium halides, a Iky I pyridinium halides, and alkylamine acetates; anionic detergents, for example, alkyl, aryl, and olefin sulfonates, alkyl, olefin, ether, and monogiyceride sulfates, and sulfosuccinates; non-ionic detergents, for example, fatty amine oxides, fatty acid alkanolamides, and poly(oxyethylene- oxypropylene)s or ethylene oxide or propylene oxide copolymers; and amphoteric detergents, for example, alkyl-beta-aminopropionates, and 2- alkylimidazoline quaternary ammonium salts, as well as mixtures.
  • suitable detergents include cationic detergent
  • compositions of this invention will typically contain from about 0.5% to about 25% by weight of the active ingredient in solution. Preservatives and buffers may also be used advantageously. In order to minimize or eliminate irritation at the site of injection, such compositions may contain a non-ionic surfactant having a hydrophile-lipophile balance (HLB) preferably of from about 12 to about 17. The quantity of surfactant in such formulation preferably ranges from about 5% to about 15% by weight.
  • the surfactant can be a single component having the above HLB or can be a mixture of two or more components having the desired HLB.
  • surfactants used in parenteral formulations are the class of polyethylene sorbitan fatty acid esters, for example, sorbitan monooleate and the high molecular weight adducts of ethylene oxide with a hydrophobic base, formed by the condensation of propylene oxide with propylene glycol.
  • compositions may be in the form of sterile injectable aqueous suspensions.
  • suspensions may be formulated according to known methods using suitable dispersing or wetting agents and suspending agents such as, for example, sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethyl-cellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia; dispersing or wetting agents which may be a naturally occurring phosphatide such as lecithin, a condensation product of an alkylene oxide with a fatty acid, for example, polyoxyethylene stearate, a condensation product of ethylene oxide with a long chain aliphatic alcohol, for example, heptadeca-ethyleneoxycetanol, a condensation product of ethylene oxide with a partial ester derived form a fatty acid and a hexitol such as polyoxyethylene sorbitol monooleate, or a condensation product of an ethylene oxide with a partial ester derived from a
  • the sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent.
  • Diluents and solvents that may be employed are, for example, water, Ringer's solution, isotonic sodium chloride solutions and isotonic glucose solutions.
  • sterile fixed oils are conventionally employed as solvents or suspending media.
  • any bland, fixed oil may be employed including synthetic mono- or diglycerides.
  • fatty acids such as oleic acid can be used in the preparation of injectables.
  • composition of the invention may also be administered in the form of suppositories for rectal administration of the drug.
  • These compositions can be prepared by mixing the drug with a suitable non-irritation excipient which is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug.
  • suitable non-irritation excipient which is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug.
  • suitable non-irritation excipient which is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug.
  • Such materials are, for example, cocoa butter and polyethylene glycol.
  • transdermal delivery devices Such transdermal patches may be used to provide continuous or discontinuous infusion of the compounds of the present invention in controlled amounts.
  • the construction and use of transdermal patches for the delivery of pharmaceutical agents is well known in the art (see, e.g., US Patent No. 5,023,252, issued June 1 1 , 1991 , incorporated herein by reference).
  • patches may be constructed for continuous, pulsatile, or on demand delivery of pharmaceutical agents.
  • Controlled release formulations for parenteral administration include liposomal, polymeric microsphere and polymeric gel formulations that are known in the art.
  • a mechanical delivery device It may be desirable or necessary to introduce the pharmaceutical composition to the patient via a mechanical delivery device.
  • the construction and use of mechanical delivery devices for the delivery of pharmaceutical agents is well known in the art.
  • Direct techniques for, for example, administering a drug directly to the brain usually involve placement of a drug delivery catheter into the patient's ventricular system to bypass the blood-brain barrier.
  • One such implantable delivery system, used for the transport of agents to specific anatomical regions of the body is described in US Patent No. 5,01 1 ,472, issued April 30, 1991 .
  • compositions of the invention can also contain other conventional pharmaceutically acceptable compounding ingredients, generally referred to as carriers or diluents, as necessary or desired.
  • Conventional procedures for preparing such compositions in appropriate dosage forms can be utilized. Such ingredients and procedures include those described in the following references, each of which is incorporated herein by reference: Powell, M.F. et al, "Compendium of Excipients for Parenteral Formulations” PDA Journal of Pharmaceutical Science ft Technology 1998, 52(5), 238-31 1 ; Strickley, R.G “Parenteral Formulations of Small Molecule Therapeutics Marketed in the United States (1999)-Part-1 " PDA Journal of Pharmaceutical Science & Technology 1999, 53(6), 324-349; and Nema, S.
  • compositions for its intended route of administration include: acidifying agents (examples include but are not limited to acetic acid, citric acid, fumaric acid, hydrochloric acid, nitric acid); alkalinizing agents (examples include but are not limited to ammonia solution, ammonium carbonate, diethanolamine, monoethanolamine, potassium hydroxide, sodium borate, sodium carbonate, sodium hydroxide, triethanolamine, trolamine); adsorbents (examples include but are not limited to powdered cellulose and activated charcoal); aerosol propellants (examples include but are not limited to carbon dioxide, CC Fz, F2CIC-CCIF2 and CCIF3) air displacement agents (examples include but are not limited to nitrogen and argon); antifungal preservatives
  • clarifying agents include but are not limited to bentonite
  • emulsifying agents include but are not limited to acacia, cetomacrogol, cetyl alcohol, glyceryl monostearate, lecithin, sorbitan monooleate, polyoxyethylene 50 monostearate
  • encapsulating agents include but are not limited to gelatin and cellulose acetate phthalate
  • flavorants include but are not limited to anise oil, cinnamon oil, cocoa, menthol, orange oil, peppermint oil and vanillin
  • humectants include but are not limited to glycerol, propylene glycol and sorbitol
  • levigating agents include but are not
  • ointment bases examples include but are not limited to lanolin, hydrophilic ointment, polyethylene glycol ointment, petrolatum, hydrophilic petrolatum, white ointment, yellow ointment, and rose water ointment
  • penetration enhancers transdermal delivery
  • examples include but are not limited to monohydroxy or polyhydroxy alcohols, mono-or polyvalent alcohols, saturated or unsaturated fatty alcohols, saturated or unsaturated fatty esters, saturated or unsaturated dicarboxylic acids, essential oils, phosphatidyl derivatives, cephalin, terpenes, amides, ethers, ketones and ureas
  • plasticizers examples include but are not limited to diethyl phthalate and glycerol
  • solvents examples include but are not limited to ethanol, corn oil, cottonseed oil, glycerol, isopropanol, mineral oil, oleic acid,
  • compositions according to the present invention can be illustrated as follows:
  • Sterile IV Solution A 5 mg/mL solution of the desired compound of this invention can be made using sterile, injectable water, and the pH is adjusted if necessary. The solution is diluted for administration to 1 2 mg/mL with sterile 5% dextrose and is administered as an IV infusion over about 60 minutes.
  • Lyophilized powder for IV administration A sterile preparation can be prepared with (i) 100 - 1000 mg of the desired compound of this invention as a lypholized powder, (ii) 32- 327 mg/mL sodium citrate, and (iii) 300 - 3000 mg Dextran 40.
  • the formulation is reconstituted with sterile, injectable saline or dextrose 5% to a concentration of 10 to 20 mg/mL, which is further diluted with saline or dextrose 5% to 0.2 - 0.4 mg/mL, and is administered either IV bolus or by IV infusion over 1 5 60 minutes.
  • Intramuscular suspension The following solution or suspension can be prepared, for intramuscular injection:
  • Hard Shell Capsules A large number of unit capsules are prepared by filling standard two-piece hard galantine capsules each with 100 mg of powdered active ingredient, 1 50 mg of lactose, 50 mg of cellulose and 6 mg of magnesium stearate.
  • Soft Gelatin Capsules A mixture of active ingredient in a digestible oil such as soybean oil, cottonseed oil or olive oil is prepared and injected by means of a positive displacement pump into molten gelatin to form soft gelatin capsules containing 100 mg of the active ingredient. The capsules are washed and dried. The active ingredient can be dissolved in a mixture of polyethylene glycol, glycerin and sorbitol to prepare a water miscible medicine mix.
  • Tablets A large number of tablets are prepared by conventional procedures so that the dosage unit is 100 mg of active ingredient, 0.2 mg. of colloidal silicon dioxide, 5 mg of magnesium stearate, 275 mg of microcrystalline cellulose, 1 1 mg. of starch, and 98.8 mg of lactose. Appropriate aqueous and non-aqueous coatings may be applied to increase palatability, improve elegance and stability or delay absorption.
  • Immediate Release Tablets/Capsules These are solid oral dosage forms made by conventional and novel processes. These units are taken orally without water for immediate dissolution and delivery of the medication.
  • the active ingredient is mixed in a liquid containing ingredient such as sugar, gelatin, pectin and sweeteners. These liquids are solidified into solid tablets or caplets by freeze drying and solid state extraction techniques.
  • the drug compounds may be compressed with viscoelastic and thermoelastic sugars and polymers or effervescent components to produce porous matrices intended for immediate release, without the need of water.
  • the combinations of the present invention may be used for the treatment or prophylaxis of diseases of uncontrolled cell growth, proliferation and/or survival, inappropriate cellular immune responses, or inappropriate cellular inflammatory responses, or diseases which are accompanied with uncontrolled cell growth, proliferation and/or survival, inappropriate cellular immune responses, or inappropriate cellular inflammatory responses, particularly in which the uncontrolled cell growth, proliferation and/or survival, inappropriate cellular immune responses, or inappropriate cellular inflammatory responses, such as, for example, haematological tumours, solid tumours, and/or metastases thereof, e.g.
  • leukaemias and myelodysplastic syndrome including leukaemias and myelodysplastic syndrome, malignant lymphomas, head and neck tumours including brain tumours and brain metastases, tumours of the thorax including non-small cell and small cell lung tumours, gastrointestinal tumours, endocrine tumours, mammary and other gynaecological tumours, urological tumours including renal, bladder and prostate tumours, skin tumours, and sarcomas, and/or metastases thereof.
  • inappropriate within the context of the present invention, in particular in the context of "inappropriate cellular immune responses, or inappropriate cellular inflammatory responses", as used herein, is to be understood as preferably meaning a response which is less than, or greater than normal, and which is associated with, responsible for, or results in, the pathology of said diseases.
  • Combinations of the present invention might be utilized to inhibit, block, reduce, decrease, etc. , cell proliferation and/or cell division, and/or produce apoptosis.
  • This method comprises administering to a mammal in need thereof, including a human, an amount of a compound A and an amount of compound B of this invention, or a pharmaceutically acceptable salt, isomer, polymorph, metabolite, hydrate, solvate or ester thereof ; etc. which is effective to treat the disorder.
  • Hyper- proliferative disorders include but are not limited, e.g. , psoriasis, keloids, and other hyperplasias affecting the skin, benign prostate hyperplasia (BPH) , solid tumors, such as cancers of the breast, respiratory tract, brain, reproductive organs, digestive tract, urinary tract, eye, liver, skin, head and neck, thyroid, parathyroid and their distant metastases.
  • Those disorders also include lymphomas, sarcomas, and leukemias.
  • breast cancer examples include, but are not limited to invasive ductal carcinoma, invasive lobular carcinoma, ductal carcinoma in situ, and lobular carcinoma in situ.
  • cancers of the respiratory tract include, but are not limited to small-cell and non-small-cell lung carcinoma, as well as bronchial adenoma and pleuropulmonary blastoma.
  • brain cancers include, but are not limited to brain stem and hypophtalmic glioma, cerebellar and cerebral astrocytoma, medulloblastoma, ependymoma, as well as neuroectodermal and pineal tumor.
  • Tumors of the male reproductive organs include, but are not limited to prostate and testicular cancer.
  • Tumors of the female reproductive organs include, but are not limited to endometrial, cervical, ovarian, vaginal, and vulvar cancer, as well as sarcoma of the uterus.
  • Tumors of the digestive tract include, but are not limited to anal, colon, colorectal, esophageal, gallbladder, gastric, pancreatic, rectal, small- intestine, and salivary gland cancers.
  • Tumors of the urinary tract include, but are not limited to bladder, penile, kidney, renal pelvis, ureter, urethral and human papillary renal cancers.
  • Eye cancers include, but are not limited to intraocular melanoma and retinoblastoma.
  • liver cancers include, but are not limited to hepatocellular carcinoma (liver cell carcinomas with or without fibrolamellar variant), cholangiocarcinoma (intrahepatic bile duct carcinoma), and mixed hepatocellular cholangiocarcinoma.
  • Skin cancers include, but are not limited to squamous cell carcinoma, Kaposi's sarcoma, malignant melanoma, Merkel cell skin cancer, and non-melanoma skin cancer.
  • Head-and-neck cancers include, but are not limited to laryngeal, hypopharyngeal, nasopharyngeal, oropharyngeal cancer, lip and oral cavity cancer and squamous cell.
  • Lymphomas include, but are not limited to AIDS- related lymphoma, non-Hodgkin's lymphoma, cutaneous T-cell lymphoma, Burkitt lymphoma, Hodgkin's disease, and lymphoma of the central nervous system.
  • Sarcomas include, but are not limited to sarcoma of the soft tissue, osteosarcoma, malignant fibrous histiocytoma, lymphosarcoma, and rhabdomyosarcoma.
  • Leukemias include, but are not limited to acute myeloid leukemia, acute lymphoblastic leukemia, chronic lymphocytic leukemia, chronic myelogenous leukemia, and hairy cell leukemia.
  • treating or “treatment” as stated throughout this document is used conventionally, e.g., the management or care of a subject for the purpose of combating, alleviating, reducing, relieving, improving the condition of, etc. , of a disease or disorder, such as a carcinoma.
  • Combinations of the present invention might be used for the treatment of disorders associated with aberrant mitogen extracellular kinase activity, including, but not limited to stroke, heart failure, hepatomegaly, cardiomegaly, diabetes, Alzheimer's disease, cystic fibrosis, symptoms of xenograft rejections, septic shock or asthma.
  • aberrant kinase activity or "aberrant tyrosine kinase activity, " includes any abnormal expression or activity of the gene encoding the kinase or of the polypeptide it encodes. Examples of such aberrant activity, include, but are not limited to, over- expression of the gene or polypeptide ; gene amplification ; mutations which produce constitutively-active or hyperactive kinase activity ; gene mutations, deletions, substitutions, additions, etc.
  • the present invention also provides for methods of inhibiting a kinase activity, especially of mitogen extracellular kinase, comprising administering an effective amount of a combination of the present invention, including salts, polymorphs, metabolites, hydrates, solvates, prodrugs (e.g. : esters) thereof, and diastereoisomeric forms thereof.
  • Kinase activity can be inhibited in cells (e.g., in vitro), or in the cells of a mammalian subject, especially a human patient in need of treatment.
  • Combinations of the present invention might also be used for treating disorders and diseases associated with excessive and/or abnormal angiogenesis.
  • Inappropriate and ectopic expression of angiogenesis can be deleterious to an organism.
  • a number of pathological conditions are associated with the growth of extraneous blood vessels. These include, e.g. , diabetic retinopathy, ischemic retinal-vein occlusion, and retinopathy of prematurity [Aiello et al. New Engl. J. Med. 1994, 331 , 1480 ; Peer et al. Lab. Invest. 1995, 72, 638], age-related macular degeneration [AMD ; see, Lopez et al. Invest. Opththalmol. Vis. Sci.
  • neovascular glaucoma neovascular glaucoma, psoriasis, retrolental fibroplasias, angiofibroma, inflammation, rheumatoid arthritis (RA), restenosis, in-stent restenosis, vascular graft restenosis, etc.
  • RA rheumatoid arthritis
  • restenosis in-stent restenosis
  • vascular graft restenosis etc.
  • the increased blood supply associated with cancerous and neoplastic tissue encourages growth, leading to rapid tumor enlargement and metastasis.
  • the growth of new blood and lymph vessels in a tumor provides an escape route for renegade cells, encouraging metastasis and the consequence spread of the cancer.
  • combinations of the present invention can be utilized to treat and/or prevent any of the aforementioned angiogenesis disorders, e.g., by inhibiting and/or reducing blood vessel formation ; by inhibiting, blocking, reducing, decreasing, etc. endothelial cell proliferation or other types involved in angiogenesis, as well as causing cell death or apoptosis of such cell types.
  • the effective dosage of the compounds of this invention can readily be determined for treatment of each desired indication.
  • the amount of the active ingredients to be administered in the treatment of one of these conditions can vary widely according to such considerations as the particular compound and dosage unit employed, the mode of administration, the period of treatment, the age and sex of the patient treated, and the nature and extent of the condition treated.
  • the total amount of the active ingredients to be administered will generally range from about 0.001 mg/kg to about 200 mg/kg body weight per day, and preferably from about 0.01 mg/kg to about 20 mg/kg body weight per day.
  • Clinically useful dosing schedules of a compound will range from one to three times a day dosing to once every four weeks dosing.
  • "drug holidays" in which a patient is not dosed with a drug for a certain period of time may be beneficial to the overall balance between pharmacological effect and tolerability.
  • a unit dosage may contain from about 0.5 mg to about 1500 mg of active ingredient, and can be administered one or more times per day or less than once a day.
  • the average daily dosage for administration by injection will preferably be from 0.01 to 200 mg/kg of total body weight.
  • the average daily rectal dosage regimen will preferably be from 0.01 to 200 mg/kg of total body weight.
  • the average daily vaginal dosage regimen will preferably be from 0.01 to 200 mg/kg of total body weight.
  • the average daily topical dosage regimen will preferably be from 0.1 to 200 mg administered between one to four times daily.
  • the transdermal concentration will preferably be that required to maintain a daily dose of from 0.01 to 200 mg/kg.
  • the average daily inhalation dosage regimen will preferably be from 0.01 to 100 mg/kg of total body weight.
  • the specific initial and continuing dosage regimen for each patient will vary according to the nature and severity of the condition as determined by the attending diagnostician, the activity of the specific compounds employed, the age and general condition of the patient, time of administration, route of administration, rate of excretion of the drug, drug combinations, and the like.
  • the desired mode of treatment and number of doses of a compound of the present invention or a pharmaceutically acceptable salt or ester or composition thereof can be ascertained by those skilled in the art using conventional treatment tests.
  • the combinations of the present invention can be used in particular in therapy and prevention, i.e. prophylaxis, of tumour growth and metastases, especially in solid tumours of all indications and stages with or without pre-treatment of the tumour growth.
  • component A and component B of this invention can be administered as the sole pharmaceutical agent or in combination with one or more further pharmaceutical agents where the resulting combination of components A, B and C causes no unacceptable adverse effects.
  • the combinations of components A and B of this invention can be combined with component C, i.e.
  • one or more further pharmaceutical agents such as known anti-angiogenesis, anti-hyper-proliferative, antiinflammatory, analgesic, immunoregulatory, diuretic, antiarrhytmic, anti- hypercholsterolemia, anti-dyslipidemia, anti-diabetic or antiviral agents, and the like, as well as with admixtures and combinations thereof.
  • Component C can be one or more pharmaceutical agents such as aldesleukin, alendronic acid, alfaferone, alitretinoin, allopurinol, aloprim, aloxi, altretamine, aminoglutethimide, amifostine, amrubicin, amsacrine, anastrozole, anzmet, aranesp, arglabin, arsenic trioxide, aromasin, 5- azacytidine, azathioprine, BCG or tice BCG, bestatin, betamethasone acetate, betamethasone sodium phosphate, bexarotene, bleomycin sulfate, broxuridine, bortezomib, busulfan, calcitonin, campath, capecitabine, carboplatin, casodex, cefesone, celmoleukin, cerubidine, chlorambucil, cisplatin, cladribine, cladribine
  • said component C can be one or more further pharmaceutical agents selected from gemcitabine, paclitaxel, cisplatin, carboplatin, sodium butyrate, 5-FU, doxirubicin, tamoxifen, etoposide, trastumazab, gefitinib, intron A, rapamycin, 17-AAG, U0126, insulin, an insulin derivative, a PPAR ligand, a sulfonylurea drug, an a-glucosidase inhibitor, a biguanide, a PTP-1 B inhibitor, a DPP-IV inhibitor, a 1 1 -beta-HSD inhibitor, GLP-1 , a GLP-1 derivative, GIP, a GIP derivative, PACAP, a PACAP derivative, secretin or a secretin derivative.
  • gemcitabine gemcitabine, paclitaxel, cisplatin, carboplatin, sodium butyrate, 5-FU, doxirubicin, tamoxif
  • Optional anti-hyper-proliferative agents which can be added as component C to the combination of components A and B of the present invention include but are not limited to compounds listed on the cancer chemotherapy drug regimens in the 1 1 th Edition of the Merck Index, (1996), which is hereby incorporated by reference, such as asparaginase, bleomycin, carboplatin, carmustine, chlorambucil, cisplatin, colaspase, cyclophosphamide, cytarabine, dacarbazine, dactinomycin, daunorubicin, doxorubicin (adriamycine), epirubicin, etoposide, 5-fluorouracil, hexamethylmelamine, hydroxyurea, ifosfamide, irinotecan, leucovorin, lomustine, mechlorethamine, 6- mercaptopurine, mesna, methotrexate, mitomycin C, mitoxantron
  • anti-hyper-proliferative agents suitable for use as component C with the combination of components A and B of the present invention include but are not limited to those compounds acknowledged to be used in the treatment of neoplastic diseases in Goodman and Gil man's The Pharmacological Basis of Therapeutics (Ninth Edition), editor Molinoff et al. , publ.
  • anti-hyper-proliferative agents suitable for use as component C with the combination of components A and B of the present invention include but are not limited to other anti-cancer agents such as epothilone and its derivatives, irinotecan, raloxifen and topotecan.
  • cytotoxic and/or cytostatic agents as component C in combination with a combination of components A and B of the present invention will serve to: (1 ) yield better efficacy in reducing the growth of a tumor or even eliminate the tumor as compared to administration of either agent alone,
  • the present invention relates to the use of the ratio of pro-apoptotic and anti-apoptotic proteins from the Bcl-2 family in a biological sample as a biomarker for a Mps- 1 kinase inhibitor treatment.
  • the ratio of pro- and anti-apoptotic proteins from the Bcl-2 family in a biological sample may constitute a potential biomarker to predict the cytotoxic potential of Mps-1 kinase inhibitors.
  • the probability of success of a monotherapy with an Mps-1 kinase inhibitor is expected to be higher in the case of the organism showing the higher ratio of pro- and anti-apoptotic proteins from the Bcl-2 family.
  • the probability of success of a combination therapy with an Mps-1 kinase inhibitor and an inhibitor of anti-apoptotic proteins from the Bcl-2 family is expected to be higher in case of the organism showing a lower ratio of pro- and anti-apoptotic proteins from the Bcl-2 family.
  • Substituted [1 ,2,4]-triazolo-[1 ,5-o]-pyridines as being the preferred compounds A of the present invention were synthesized according to the methods described in WO2013/087579, WO2012/ 143329, and WO201 1 /063908 which are incorporated herein by reference.
  • the compound BAY 3 was prepared according to the method described in WO2012/080230 which is incorporated herein by reference.
  • ExampleOI .1 1 4- ⁇ [6-(4- ⁇ [(4- fluorophenyl)acetyl]amino ⁇ phenyl)[1 ,2,4]triazolo[1 ,5-a]- pyridin-2-yl]amino ⁇ -N-(2-hydroxyethyl)-3-(2,2,2- trifluoroethoxy)benzamide
  • ExampleOI .12 4- ⁇ [6-(4- ⁇ [(4- fluorophenyl)acetyl]amino ⁇ phenyl)[1 ,2,4]triazolo[1 ,5-a]- pyridin-2-yl]amino ⁇ -N-(2-hydroxy-2-methylpropyl)-3- methoxybenzamide
  • ExampleOI .13 4- ⁇ [6-(4- ⁇ [ ⁇ 4- fluorophenyl)acetyl]amino ⁇ phenyl)[1 ,2,4]triazolo[1 ,5-a]- pyridin-2-yl]amino ⁇ -N-(1 -hydroxy-2-methylpropan-2-yl)-3- methoxybenzamide
  • ExampleOI .1 5 2-(4-fluorophenyl)-N-[4-(2- ⁇ [2-methoxy-4- (methylsulfonyl)phenyl]amino ⁇ [1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)phenyl]acetamide
  • ExampleOI .16 3-ethoxy-N-ethyl-4- ⁇ [6-(4- ⁇ [(4-fluorophenyl)- acetyl]amino ⁇ phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2- yl]amino ⁇ benzamide
  • ExampleOI .20 4- ⁇ [6-(4- ⁇ [(4- fluorophenyl)acetyl]amino ⁇ phenyl)[1 ,2,4]triazolo[1 ,5- ⁇ ]- pyridin-2-yl]amino ⁇ -3-methoxy-N-methyl-N-[2-
  • ExampleOI .24 3-(cyclopropylmethoxy)-N,N-diethyl-4- ⁇ [6-(4- ⁇ [(4- fluorophenyl)acetyl]amino ⁇ phenyl)[1 ,2,4]triazolo[1 ,5- a]pyridin-2-yl]amino ⁇ benzamide
  • ExampleOI .25 N,N-diethyl-4- ⁇ [6-(4- ⁇ [(4-fluorophenyl)acetyl]amino ⁇ phenyl)- [1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl]amino ⁇ -3- isopropoxybenzamide
  • ExampleOI .27 4- ⁇ [6-(4- ⁇ [(4- fluorophenyl)acetyl]amino ⁇ phenyl)[1 ,2,4]triazolo[1 ,5-a]- pyridin-2-yl]amino ⁇ -3-(2,2,2-trifluoroethoxy)-N-(2,2,2- trifluoroethyl)benzamide
  • ExampleOI .29 4- ⁇ [6-(4- ⁇ [(4- fluorophenyl)acetyl]amino ⁇ phenyl)[1 ,2,4]triazolo[1 ,5-a]- pyridin-2-yl]amino ⁇ -N-(2-hydroxy-2-methylpropyl)-3-(2,2,2- trifluoroethoxy)benzamide
  • ExampleOI .30 4- ⁇ [6-(4- ⁇ [(4- fluorophenyl)acetyl]amino ⁇ pheny[)[1 ,2,4]triazolo[1 ,5-a]- pyridin-2-yl]amino ⁇ -3-methoxy-N-methylbenzamide
  • ExampleOI .31 4- ⁇ [6-(4- ⁇ [(4- fluorophenyl)acetyl]amino ⁇ phenyl)[1 ,2,4]triazolo[1 ,5-a]- pyridin-2-yl]amino ⁇ -3-methoxy-N-(2,2,2- trifluoroethyl)benzamide
  • Example02.1 4-[(6- ⁇ 4-[(4- fluorobenzyl)carbamoyl]phenyl ⁇ [1 ,2,4]triazolo[1 ,5-a]pyridin-2- yl)amino]-N-(2-hydroxyethyl)-3-methoxybenzamide
  • Example02.2 3-ethoxy-4-[(6- ⁇ 4-[(4- fluorobenzyl)carbamoyl]phenyl ⁇ [1 ,2,4]triazolo[1 ,5-a]pyridin-2- yl)amino]-N-(2-hydroxyethyl)benzamide
  • Example02.3 3-ethoxy-4-[(6- ⁇ 4-[(4- fluorobenzyl)carbamoyl]phenyl ⁇ [1 ,2,4]triazolo[1 ,5-a]pyridin-2- yl)amino]-N-(1 -hydroxy-2-methylpropan-2-yl)benzamide
  • Example02.4 4-[(6- ⁇ 4-[(4- fluorobenzyl)carbamoyl]phenyl ⁇ [1 ,2,4]triazolo[1 ,5-a]pyridin-2- yl)amino]-N-(2-hydroxyethyl)-3-(2,2,2- trifluoroethoxy)benzamide
  • Example02.6 N-(4-fluorobenzyl)-4-(2- ⁇ [2-methoxy-4- (methylsulfonyl)phenyl]amino ⁇ [1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)benzamide
  • Example02.7 3-ethoxy-4- [(6- ⁇ 4- [(4- fluorobenzyl)carbamoyl]phenyl ⁇ [1 ,2,4]triazolo[1 , 5-o]pyridin-2- yl)amino]-N-(2-hydroxy-2-methylpropyl)benzamide
  • Example02.8 4- [(6- ⁇ 4- [(4- fluorobenzyl)carbamoyl]phenyl ⁇ [1 ,2,4]triazolo[1 , 5-a]pyridin-2- yl)amino]-N-(1 -hydroxy-2-methylpropan-2-yl)-3- methoxybenzamide
  • Example02.1 1 4- [(6- ⁇ 4- [(4- fluorobenzyl)carbamoyl]phenyl ⁇ [1 ,2,4]triazolo[1 ,5-a]pyridin-2- yl)amino]-3-methoxy-N-methyl-N- [2-
  • Example02.12 3-ethoxy-4- [(6- ⁇ 4- [(4- fluorobenzyl)carbamoyl]phenyl ⁇ [1 ,2,4]triazolo[1 , 5-a]pyridin-2- yl)amino]-N-(2-hydroxyethyl)-N-methylbenzamide
  • Example02.1 3 4- [(6- ⁇ 4- [(4- fluorobenzyl)carbamoyl]phenyl ⁇ [1 ,2,4]triazolo[1 , 5-a]pyridin-2- yl)amino]-3-methoxy-N-methylbenzamide
  • Example02.14 N-teri-butyl-4- [(6- ⁇ 4-[(4- fluorobenzyl)carbamoyl]phenyl ⁇ [1 ,2,4]triazolo[1 , 5-a]pyndin-2- yl)amino]-3-methoxybenzamide
  • Example02.15 4-[(6- ⁇ 4-[(4- fluorobenzyl)carbamoyl]phenyl ⁇ [1 ,2,4]triazolo[1 ,5-o]pyridin-2- yl)amino]-3-methoxy-N-[2-(methylsulfonyl)ethyl]benzamide
  • Example02.16 4- ⁇ 2-[(2,4-dimethoxyphenyl)amino][1 ,2,4]triazolo[1 ,5- a]pyridin-6-yl ⁇ -N-(4-fluorobenzyl)benzamide
  • Example02.17 4-[(6- ⁇ 4-[(4- fluorobenzyl)carbamoyl]phenyl ⁇ [1 ,2,4]triazolo[1 ,5-a]pyridin-2- yl)amino]-3-methoxy-N-(2,2,2-trifluoroethyl)benzamide
  • Example02.18 4-[(6- ⁇ 4-[(4- fluorobenzyl)carbamoyl]phenyl ⁇ [1 ,2,4]triazolo[1 ,5-a]pyridin-2- yl)amino]-N-(1 -hydroxy-2-methylpropan-2-yl)-3-(2,2,2- trifluoroethoxy)benzamide
  • Example02.22 4-[(6- ⁇ 4-[(4- fluorobenzyl)carbamoyl]phenyl ⁇ [1 ,2,4]triazolo[1 ,5-a]pyridin-2- yl)amino]-N-(2-hydroxy-2-methylpropyl)-3-(2,2,2- trifluoroethoxy)benzamide
  • Example02.23 4-[(6- ⁇ 4-[(4- fluorobenzyl)carbamoyl]phenyl ⁇ [1 ,2,4]triazolo[1 ,5-a]pyridin-2- yl)amino]-3-(2,2,2-trifluoroethoxy)-/V-(2,2,2- trifluoroethyl)benzamide
  • Example02.24 4-(2- ⁇ [4-(dimethylamino)-2- methy[pheny[]amino ⁇ [1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl)-N-(4- fluorobenzyl)benzamide
  • Example04.2 N-(4-fluorobenzyl)-2-methyl-4-(2- ⁇ [4-(methylsulfonyl)-2- (2,2,2-trifluoroethoxy)phenyl]amino ⁇ [1 ,2,4]triazolo[1 ,5- a]pyridin-6-yl)benzamide
  • Example05.1 2-chloro-N-(4-fluorobenzyl)-4-[2-( ⁇ 4-[(1 - hydroxy- 2- methylpropan-2-yl)carbamoyl]-2- methoxyphenyl ⁇ amino)[1 ,2,4]triazolo[1 , 5-a]pyridin-6-yl]- benzamide
  • Example08.1 N-(4-fluorobenzyl)-4-[2-( ⁇ 4-[(1 -hydroxy-2-methylpropan-2- yl)carbamoyl]-2-methoxyphenyl ⁇ amino)[1 ,2,4]triazolo[1 ,5- a]pyridin-6-yl]-2-methoxybenzamide
  • Example09.1 N-(4-fluorobenzyl)-2-methoxy-4-(2- ⁇ [2-methoxy-4-
  • Examplel .04 4- ⁇ [6-(4- ⁇ [ ⁇ 2R)-2-(4-fluorophenyl)propanoyl]- amino ⁇ phenyl)[1 ,2,4]triazolo[1 ,5-o]pyridin-2-yl]amino ⁇ -3- methoxy-N-(2,2,2-trifluoroethyl)benzamide
  • Examplel .06 4- ⁇ [6-(4- ⁇ [(2/?)-2-(4- fluorophenyl)propanoyl]amino ⁇ phenyl)[1 ,2,4]triazolo[1 ,5-o]- pyridin-2-yl]amino ⁇ -3-(2,2,2-trifluoroethoxy)benzamide
  • Examplel .09 (2/?)-2-(4-fluorophenyl)-N-[4-(2- ⁇ [2-methoxy-4-(2-oxo-1 ,3- oxazolidin-3-yl)phenyl]amino ⁇ [1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)phenyl]propanamide
  • Examplel .10 (-)-2-(4-fluorophenyl)-3-hydroxy-N-[4-(2- ⁇ [4-(methylsulfonyl)- 2-(2,2,2-trifluoroethoxy)phenyl]amino ⁇ [1 ,2,4]triazolo[1 ,5- a]pyridin-6-yl)phenyl]propanamide
  • Examplel .12 4- ⁇ [6-(4- ⁇ [(2R)-2-(4- fluorophenyl)propanoyl]amino ⁇ phenyl)[1 ,2,4]triazolo[1 ,5- a]pyridin-2-yl]amino ⁇ -3-methoxy-N,N-dimethylbenzamide
  • Examplel .18 (2S)-N- ⁇ 4-[2-( ⁇ 4-[(3-fluoroazetidin-1 -yl)carbonyl]-2-(2,2,2- trifluoroethoxy)phenyl ⁇ amino)[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl]phenyl ⁇ -2-(4-fluorophenyl)-3-hydroxypropanamide
  • Examplel .19 (2R)-2-amino-2-(4-fluorophenyl)-N-[4-(2- ⁇ [4-(met ylsulfonyl)-
  • Examplel 1 N-(2,4-difluorobenzyl)-4-(2- ⁇ [2-methoxy-4- (methylsulfonyl)phenyl]amino ⁇ [1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)benzamide
  • Example12.01 4- ⁇ [6-(4- ⁇ [(4-fluorophenyl)- acetyl]amino ⁇ phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl]amino ⁇ - 3-methoxy-N-(2-methoxyethyl)benzamide
  • Examplel 2.02 4- ⁇ [6-(4- ⁇ [(4-fluorophenyl)- acetyl]amino ⁇ phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl]amino ⁇ - 3-methoxy-N,N-dimethylbenzamide
  • Examplel 2.03 4- ⁇ [6-(4- ⁇ [(4-fluorophenyl)- acetyl]amino ⁇ phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl]amino ⁇ -
  • Examplel 2.04 4- ⁇ [6- ⁇ 4- ⁇ [(4-fluorophenyl)- acetyl]amino ⁇ phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl]amino ⁇ - 3-methoxybenzamide
  • Example12.1 4- ⁇ [6-(4- ⁇ [(4-fluorophenyl)- acetyl]amino ⁇ phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl]amino ⁇ - N-(3-fluoropropyl)-3-methoxybenzamide
  • Example12.21 4- ⁇ [6-(4- ⁇ [(4-fluorophenyl)- acetyl]amino ⁇ phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl]amino ⁇ - N-[2-(methylsulfonyl)ethyl]-3-(2,2,2- trifluoroethoxy)benzamide
  • Example12.22 4- ⁇ [6-(4- ⁇ [(4-fluorophenyl)- acetyl]amino ⁇ phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl]amino ⁇ - N-(1 -hydroxy-2-methylpropan-2-yl)-3-(2,2,2-trifluoroethoxy)- benzamide
  • Example12.25 4- ⁇ [6-(4- ⁇ [(4-fluorophenyl)- acetyl]amino ⁇ phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl]amino ⁇ - 3-(trifluoromethoxy)benzamide
  • Example! 2.26 N-[4-(2- ⁇ [2-(difluoromethoxy)-4-(propan-2- ylsulfonyl)phenyl]amino ⁇ [1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)phenyl]-2-(4-fluorophenyl)acetamide
  • Example12.31 4- ⁇ [6-(4- ⁇ [(4-fluorophenyl)- acetyl]amino ⁇ phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl]amino ⁇ - N,N,3-trimethylbenzamide
  • Example12.34 2-(4-fluorophenyl)-N- ⁇ 4-[2-( ⁇ 2-methyl-4-[(methyl- sulfonyl)amino]phenyl ⁇ amino)[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl]phenyl ⁇ acetamide
  • Exam pie 12.35 2-(4-fluorophenyl)-N-(4- ⁇ 2-[(4-methoxy-2-methyl- phenyl)amino][1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl ⁇ - pheny[)acetamide
  • Example12.45 4-[(6- ⁇ 4-[(4-fluorobenzyl)carbamoyl]phenyl ⁇ [1 ,2,4] tri- azolo[1 ,5-a]pyridin-2-yl)amino]-N-(2-fluoroethyl)-3- methoxybenzamide
  • Example12.50 4-[(6- ⁇ 4-[(4-fluorobenzyl)carbamoyl]phenyl ⁇ [1 ,2,4] tri- azolo[1 ,5-a]pyridin-2-yl)amino]-N-(3-fluoropropyl)-3- methoxybenzamide
  • Example12.52 4- ⁇ 2- ⁇ [4-(iert-butylsulfamoyl)-2-methoxyphenyl]amino ⁇ [1 ,2,4]- triazolo[1 ,5-a]pyridin-6-yl)-N-(4-fluorobenzyl)benzamide
  • Example! 2.53 4- ⁇ 2-[(4- ⁇ [ethyl(1 -hydroxy-2-methylpropan-2-yl)amino]- methyl ⁇ -2-methoxyphenyl)amino][1 ,2,4]triazolo[1 ,5-o]pyridin- 6-yl ⁇ -N-(4-fluorobenzyl)benzamide
  • Example12.59 4-[(6- ⁇ 4-[(4-fluorobenzyl)carbamoyl]phenyl ⁇ [1 ,2,4]tri- azolo[1 ,5-a]pyridin-2-yl)amino]-N-(2-fluoroethyl)-3-(2,2,2- trifluoroethoxy)benzamide
  • Example12.61 4- ⁇ 2- ⁇ [2-(difluoromethoxy)-4-(ethylsulfonyl)phenyl]- amino ⁇ [1 ,2,4]triazolo[1 ,5-o]pyridin-6-yl)-N-(4- fluorobenzyl)benzamide
  • Example! 2.62 4-(2- ⁇ [2-(difluoromethoxy)-4-(propan-2-ylsulfonyl)- phenyl]amino ⁇ [1 ,2,4]triazolo[1 ,5-o]pyridin-6-yl)-N-(4- fluorobenzyl)benzamide
  • Example12.63 4-(2- ⁇ [2-(difluoromethoxy)-4-fluorophenyl]amino ⁇ - [1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl)-N-(4-fluoro- benzyl)benzamide
  • Example12.66 4-[(6- ⁇ 4-[(4-fluorobenzyl)carbamoyl]phenyl ⁇ [1 ,2,4] tri- azolo[1 ,5-o]pyridin-2-yl)amino]-3-methyl-N-(2,2,2- trifluoroethyl)benzamide
  • Cultivated tumor cells (MCF7, hormone dependent human mammary carcinoma cells, ATCC HTB22; NCI-H460, human non-small cell lung carcinoma cells, ATCC HTB-177; DU 145, hormone-independent human prostate carcinoma cells, ATCC HTB-81 ; HeLa- aTu, human cervical carcinoma cells, EPO-GmbH, Berlin; HeLa-MaTu-ADR, multidrug-resistant human cervical carcinoma cells, EPO-GmbH, Berlin; HeLa human cervical tumor cells, ATCC CCL-2; B16F10 mouse melanoma cells, ATCC CRL-6475) were plated at a density of 5000 cells/well (MCF7, DU145, HeLa-MaTu-ADR), 3000 cells/well (NCI-H460, HeLa-MaTu, HeLa), or 1000 cells/well (B16F10) in a 96-well multititer plate in 200 ⁇ of their respective growth medium supplemented 10% fetal calf
  • the cells of one plate were stained with crystal violet (see below), while the medium of the other plates was replaced by fresh culture medium (200 ⁇ ), to which the test substances were added in various concentrations (0 ⁇ , as well as in the range of 0.01 -30 ⁇ ; the final concentration of the solvent dimethyl sulfoxide was 0.5%).
  • the cells were incubated for 4 days in the presence of test substances.
  • Cell proliferation was determined by staining the cells with crystal violet: the cells were fixed by adding 20 ⁇ /measuring point of an 1 1% glutaric aldehyde solution for 15 minutes at room temperature. After three washing cycles of the fixed cells with water, the plates were dried at room temperature.
  • the compounds A of the present invention are characterized by an ICso determined in a HeLa-MaTu-ADR cell proliferation assay (as described above) that is lower than 10 ⁇ .
  • the IC50 of preferred compounds A is even lower than 2.0 ⁇ .
  • the ICso of more preferred compounds A is even lower than 500 nM.
  • the IC3 ⁇ 4) of even more preferred compounds A is even lower than 250 nM.
  • the ICso of most preferred compounds A is even lower than 200 nM.
  • the compounds A of the present invention are characterized by the following iCso values, determined in a HeLa cell proliferation assay (as described above):
  • the human kinase Mps-1 phosphorylates a biotinylated substrate peptide. Detection of the phosphorylated product is achieved by time-resolved fluorescence resonance energy transfer (TR-FRET) from Europium-labelled anti-phospho-Serine/Threonine antibody as donor to streptavidin labelled with cross-linked allophycocyanin (SA-XLent) as acceptor. Compounds are tested for their inhibition of the kinase activity.
  • TR-FRET time-resolved fluorescence resonance energy transfer
  • N-terminally GST-tagged human full length recombinant Mps-1 kinase (purchased from !nvitrogen, Karslruhe, Germany, cat. no PV4071 ) was used.
  • As substrate for the kinase reaction a biotinylated peptide of the amino-acid sequence PWDPDDADITEILG (C-terminus in amide form, purchased from Biosynthan GmbH, Berlin) was used.
  • nl of a 100-fold concentrated solution of the test compound in DMSO was pipetted into a black low volume 384well microtiter plate (Greiner Bio-One, Frickenhausen, Germany), 2 ⁇ of a solution of Mps-1 in assay buffer [0.1 mM sodium -ortho-vanadate, 10 mM MgCU, 2 mM DTT, 25 mM Hepes pH 7.7, 0.05% BSA, 0.001% Pluronic F-127] were added and the mixture was incubated for 15 min at 22' C to allow pre-binding of the test compounds to Mps-1 before the start of the kinase reaction.
  • assay buffer [0.1 mM sodium -ortho-vanadate, 10 mM MgCU, 2 mM DTT, 25 mM Hepes pH 7.7, 0.05% BSA, 0.001% Pluronic F-127] were added and the mixture was incubated for 15 min at 22' C to allow pre-binding of
  • the concentration of Mps-1 in the assay was adjusted to the activity of the enzyme lot and was chosen appropriate to have the assay in the linear range, typical enzyme concentrations were in the range of about 1 nM (final cone, in the 5 ⁇ assay volume).
  • the reaction was stopped by the addition of 3 ⁇ of a solution of HTRF detection reagents (100 mM Hepes pH 7.4, 0.1% BSA, 40 mM EDTA, 140 nM Streptavidin-XLent [# 61GSTXLB, Fa. Cis Biointernational, Marcoule, France], 1.5 nM anti-phospho(Ser/Thr)-Europium-antibody [#AD0180, PerkinElmer LAS, Rodgau-Jugesheim, Germany].
  • HTRF detection reagents 100 mM Hepes pH 7.4, 0.1% BSA, 40 mM EDTA, 140 nM Streptavidin-XLent [# 61GSTXLB, Fa. Cis Biointernational, Marcoule, France]
  • 1.5 nM anti-phospho(Ser/Thr)-Europium-antibody [#AD0180, PerkinElmer LAS, Rodgau-Jugesheim, Germany].
  • the resulting mixture was incubated 1 h at 22' C to allow the binding of the phosphorylated peptide to the anti-phospho(Ser/Thr)-Europium-antibody. Subsequently the amount of phosphorylated substrate was evaluated by measurement of the resonance energy transfer from the Europium-labelled anti-phospho(Ser/Thr) antibody to the Streptavidin-XLent. Therefore, the fluorescence emissions at 620 nm and 665 nm after excitation at 350 nm was measured in a Viewlux TR-FRET reader (PerkinElmer LAS, Rodgau-Jugesheim, Germany).
  • the "blank-corrected normalized ratio" (a Viewlux specific readout, similar to the traditional ratio of the emissions at 665 nm and at 622 nm, in which blank and Eu-donor crosstalk are subtracted from the 665 nm signal before the ratio is calculated) was taken as the measure for the amount of phosphorylated substrate.
  • Test compounds were tested on the same microtiter plate at 10 different concentrations in the range of 20 ⁇ to 1 nM (20 ⁇ , 6.7 ⁇ , 2.2 ⁇ , 0.74 ⁇ , 0.25 ⁇ , 82 nM, 27 nM, 9.2 nM, 3.1 nM and 1 nM, dilution series prepared before the assay at the level of the 100fold cone, stock solutions by serial 1 :3 dilutions) in duplicate values for each concentration and ICbo values were calculated by a 4 parameter fit using an inhouse software.
  • Specified compounds A of the present invention are characterized by the following ICso values, determined in Mps-1 kinase assays (as described above):
  • Example02.20 ⁇ 1.0 1.7
  • Example02.21 ⁇ 1.0 2.4
  • Examplel 1.01 ⁇ 1.0 11
  • the spindle assembly checkpoint assures the proper segregation of chromosomes during mitosis. Upon entry into mitosis, chromosomes begin to condensate which is accompanied by the phosphorylation of histone H3 on serine 10. Dephosphorylation of histone H3 on serine 10 begins in anaphase and ends at early telophase. Accordingly, phosphorylation of histone H3 on serine 10 can be utilized as a marker of cells in mitosis.
  • Nocodazole is a microtubule destabilizing substance. Thus, nocodazole interferes with microtubule dynamics and mobilises the spindle assembly checkpoint.
  • the cells arrest in mitosis at G2/M transition and exhibit phosphorylated histone H3 on serine 10.
  • An inhibition of the spindle assembly checkpoint by Mps-1 inhibitors overrides the mitotic blockage in the presence of nocodazole, and the cells complete mitosis prematurely. This alteration is detected by the decrease of cells with phosphorylation of histone H3 on serine 10. This decline is used as a marker to determine the capability of compounds of the present invention to induce a mitotic breakthrough.
  • Cultivated cells of the human cervical tumor cell line HeLa were plated at a density of 2500 cells/well in a 384-well microtiter plate in 20 ⁇ Dulbeco's Medium (w/o phenol red, w/o sodium pyruvate, w 1000 mg/ml glucose, w pyridoxine) supplemented with 1% (v/v) glutamine, 1% (v/v) penicillin, 1% (v/v) streptomycin and 10% (v/v) fetal calf serum. After incubation overnight at 37 C, 10 ⁇ /well nocodazole at a final concentration of 0.1 Mg/ml were added to cells.
  • test compounds solubilised in dimethyl sulfoxide (DMSO) were added at various concentrations (0 ⁇ , as well as in the range of 0.005 ⁇ 10 ⁇ ; the final concentration of the solvent DMSO was 0.5% (v/v)). Cells were incubated for 4 h at 37 C in the presence of test compounds.
  • DMSO dimethyl sulfoxide
  • cells were fixed in 4% (v/v) paraformaldehyde in phosphate buffered saline (PBS) at 4 C overnight then permeabilised in 0.1% (v/v) Triton XTM 100 in PBS at room temperature for 20 min and blocked in 0.5% (v/v) bovine serum albumin (BSA) in PBS at room temperature for 15 min. After washing with PBS, 20 ⁇ /well antibody solution (anti-phospho-histone H3 clone 3H10, FITC; Upstate, Cat# 16-222; 1 :200 dilution) was added to cells, which were incubated for 2 h at room temperature.
  • PBS phosphate buffered saline
  • HOECHST 33342 dye solution 5 g/ml was added to cells and cells were incubated 12 min at room temperature in the dark. Cells were washed twice with PBS then covered with PBS and stored at 4 C until analysis. Images were acquired with a Perkin Elmer OPERATM High- Content Analysis reader. Images were analyzed with image analysis software MetaXpressTM from Molecular devices utilizing the Cell Cycle application module. In this assay both labels HOECHST 33342 and phosphorylated Histone H3 on serine 10 were measured. HOECHST 33342 labels DNA and is used to count cell number.
  • the staining of phosphorylated Histone H3 on serine 10 determines the number of mitotic cells. Inhibition of Mps-1 decreases the number of mitotic cells in the presence of nocodazole indicating an inappropriate mitotic progression.
  • the raw assay data were further analysed by four parameter logistic regression analysis to determine the ICso value for each tested compound.
  • the hydrolytic stability assay investigates the stability of a compound in an aqueous buffer system.
  • Standard solution stability assay is run in 0.05 M Phosphate buffer at pH 7.4 (pH of blood plasma) at 37 C.
  • any relevant pH as pH 2 to simulate the acidic condition of the Gl tract in the following experiment
  • Compounds are incubated in relevant solution at 37 C and analyzed by HPLC immediately after incubation and after 1 , 2 and 24 hrs.
  • Degredation rate (decay in %) is calculated by relating peak areas after 1 , 2 and 24 hrs to the time zero injection.
  • ICM half maximal inhibitory concentration
  • test compounds in vitro were determined by incubating them at 1 ⁇ with a suspension liver microsomes in 100 mM phosphate buffer, pH7.4 (NaH 2 P0 4 x H 2 0 + Na 2 HP0 4 x 2H 2 0) at a protein concentration of 0.5 mg/mL and at 37 C.
  • the reaction was activated by adding a co-factor mix containing 1 .2 mg NADP, 3 !U glucose-6-phosphate dehydrogenase, 14.6 mg glucose-6-phosphate and 4.9 mg MgC in phosphate buffer, pH 7.4.
  • Organic solvent in the incubations was limited to ⁇ 0.2 % dimethylsulfoxide (DMSO) and ⁇ 1% methanol.
  • DMSO dimethylsulfoxide
  • the microsomal suspensions were continuously shaken and aliquots were taken at 2, 8, 16, 30, 45 and 60 min, to which equal volumes of cold methanol were immediately added. Samples were frozen at -20 C over night, subsequently centrifuged for 15 minutes at 3000 rpm and the supernatant was analyzed with an Agilent 1200 HPLC-system with LCMS/MS detection. The half-life of a test compound was determined from the concentration-time plot. From the half-life the intrinsic clearances were calculated. Together with the additional parameters liver blood flow, specific liver weight and microsomal protein content the hepatic in vivo blood clearance (CL) and the maximal oral bioavailability (F ma x) were calculated for the different species.
  • CL hepatic in vivo blood clearance
  • F ma x maximal oral bioavailability
  • phase-l metabolism of microsomes is reflected, e.g. typically oxidoreductive reactions by cytochrome P450 enzymes and flavin mono-oxygenases (FMO) and hydrolytic reactions by esterases (esters and amides).
  • FMO flavin mono-oxygenases
  • Specified compounds A of the present invention are characterized by the values of maximum oral bioavailability (F m ax) in rat, dog and humans (determined by means of liver microsomes as described above) shown in the table below:
  • the compounds A of the present invention are characterized by the following attributes:
  • the IC50 determined in an Mps-1 kinase assay with a concentration of 10 ⁇ ATP (as described above) is lower than or equal to 1 nM.
  • the IC50 determined in an Mps-1 kinase assay with a concentration of 2 mM ATP (as described above) is lower than 10 nM.
  • the IC50 of preferred compounds is even lower than 5 nM.
  • the IC50 of more preferred compounds is even lower than 3 nM.
  • the IC3 ⁇ 4 of most preferred compounds is even lower than 2 nM.
  • the maximum oral bioavailability (F ma x) in rat (determined by means of rat liver microsomes as described above) is higher than 50 %.
  • the F ma x of preferred compounds is even higher than 70 %.
  • the Fmax of more preferred compounds is even higher than 80 %.
  • the maximum oral bioavailability (Fmax) in dog is higher than 45 %.
  • the F ma x of preferred compounds is even higher than 52 %.
  • the F ma x of more preferred compounds is even higher than 70 %.
  • the maximum oral bioavailability (Fmax) in human is higher than 45 3 ⁇ 4.
  • the Fmax of preferred compounds is even higher than 60 %.
  • the F ma x of more preferred compounds is even higher than 85 %.
  • the IC3 ⁇ 4) determined in a HeLa cell proliferation assay is lower than 600 nM.
  • the IC3 ⁇ 4 of preferred compounds is even lower than 400 nM.
  • the ICso of more preferred compounds is even lower than 200 nM.
  • the ICso of most preferred compounds is even lower than 100 nM.
  • Bax mouse embryonic fibroblasts MEFs cells were routinely maintained in DMEM medium supplemented with 10% fetal calf serum (FCS), 10 mM HEPES buffer, 100 units/mL penicillin G sodium, 100 g/mL streptomycin sulfate and non essential amino acids. Cells were seeded onto the appropriate supports (6-, 12-, 24- or 96-well plates) 24 h before the beginning of experiments.
  • FCS fetal calf serum
  • pan-caspase inhibitor Z-VAD-fmk N-benzyloxycarbonyl-Val-Ala- Asp.fluoromethylketone
  • Z-VAD-fmk N-benzyloxycarbonyl-Val-Ala- Asp.fluoromethylketone
  • C/ ' s- diammineplatinum(ll) dichloride (cisplatin, CDDP) and anthra [1 ,9-cd] pyrazole-6 (2H)-one (SP600125) were purchased from Sigma-Aldrich (St Louis, MO, USA).
  • the Bcl-2 inhibitor ABT-737 was purchased from Selleckchem.com and a stock solution of 100 mM in DMSO was prepared.
  • samples were incubated for at least 2 h at 4 C before cytofluorometric analysis.
  • EdU assay cells were incubated with 10 ⁇ EdU for 30 min at 37 C, fixed, permeabilized and stained with the fluorescent dye azide (Click-iTTM reaction cocktail, from Invitrogen) and PI, according to the manufacturer's instructions. Cytofluorometric acquisitions were performed by means of a FACSCalibur (BD Biosciences, San Diego, CA, USA) or a FACScan (BD Biosciences) cytofluorometer equipped with a 70 m nozzle or with a Gallios cytofluorometer (Beckman Coulter, Miami, FL, USA).
  • siRNA duplexes for the downregulation of AURKA (SIHK0142) were purchased from Sigma-Aldrich and siRNAs for the downregulation of BAK1 and BAX (Hs_BAK1_5 and Hs_BAX_10 HP Validated siRNAs, respectively) from Qiagen (Hilden, Germany).
  • Cells pre-seeded in 12-well plates were transfected with siRNAs at 30-40% confluence by means of the HiPerFect ⁇ transfection reagent (Qiagen), as previously described. After 48 or 72 h, transfection efficiency was determined by immunoblotting.
  • MPS1 5' GCACGUGACUACUUUCAAA 3' (Xu et al 2009) p14ARF 5' GCUUCCUAGAAGACCAGGU 3' (Ma and Pederson 2007) p15INK4 5' GGGAUAUUUAGGAGUGUGU 3' (Chen et al 2006) p16INK4 5' CGCACCGAAUAGUUACGGU 3' (Gabriely et al 201 1 ) p21 5' CUUCGACUUUGUCACCGAG 3' (Spierings et al 2004) ⁇ 38 ⁇ 5' GCAAGAAACUAUAUUCAG 3' (Gao et al 2004) p53 5' GACUCCAGUGGUAAUCUAC 3' (Brummelkamp et al 2002) p63 5' CCAUGAGCUGAGCCGUGAA 3' (Lee et al 2006) p73 5' ACGUCCAUGCUGGAAUCCG 3' (Toscano
  • siRNAs that target cell cycle or cell death-relevant genes/proteins were transfected with 36 distinct siRNAs that target cell cycle or cell death-relevant genes/proteins.
  • three siRNAs that deplete one of the three anti-apoptotic multidomain proteins of the Bcl-2 family were found to be particularly efficient in sensitizing the cells to BAY 2 or BAY 3-induced killing (Fig. 1 A).
  • siRNAs targeting either of the two pro-apoptotic multidomain proteins of the Bcl-2 family (Bax, Bak) avoided the loss of cellular viability induced by BAY 2 or BAY 3 (Fig. 1A).
  • BAY 2 and 3 induced the release of cytochrome c from mitochondria to cytosol, preceding the activation of caspase-3 (Fig. 1 E), and inhibition of caspases by Z-VAD-fmk reduced killing by BAY 2 or BAY 3 (Fig. 1 F).
  • Fig 1A Human colorectal carcinoma HCT1 16 cells transfected with a control siRNA (siUNR) or with a panel of validated siRNAs directed against the reported proteins were treated 24h later with 1 ⁇ BAY 2 or BAY 3 for additional 48 h. Thereafter apoptosis-associated parameters were assessed by co-staining with DiOC6(3)/P! and cytofluorimetric analyses.
  • the figure reports the unsupervised hierarchical clustering of the effects of the siRNA screen on the response to the drugs.
  • Green and red boxes depict siRNA-mediated cytoprotection ( ⁇ ⁇ 0) and chemosensitization ( ⁇ > 0), respectively.
  • ⁇ represents the difference between the percentage of death in cell transfected with the reported siRNAs then left untreated or treated with BAY 2 or BAY 3 and the percentage of apoptosis in siUNR-transfected cells in the same condition.
  • Figs. 1 B -1 D HCT1 16 cells or immortalized MEFs with the illustrated genetic background, as well as WT HCT1 16 pre-exposed for 3h to the BCI-2/BCI-XL inhibitor ABT-737, were kept in control conditions or incubated for 72 h with BAY 2 or BAY 3 at the depicted dose (usually 1 ⁇ ). Thereafter, cell were collected and analyzed by DiOC6(3)/PI co-staining.
  • Bub l is required for kinetochore localization of BubRl, Cenp-E, Cenp-F and Mad 2, and chromosome congression. Journal of cell science 117: 1577- 1589.
  • RPA2 is a direct downstream target for ATR to regulate the S-phase checkpoint.

Abstract

The present invention relates to combinations of at least two compounds A and B, compound A being an inhibitor of Mps-1 kinase, and compound B being an inhibitor of an anti-apoptotic protein of the Bcl-2 family. Another aspect of the present invention relates to the use of such combinations as described supra for the preparation of a medicament for the treatment or prophylaxis of a disease, particurlarly for the treatment of cancer. Another aspect of the present invention relates to the use of an anti-apoptotic protein from the Bcl-2 family as a sensitizer of cells to Mps-1 inhibitors. Another aspect of the present invention relates to the use of the ratio of pro-apoptotic and anti-apoptotic proteins from the Bcl-2 family in a biological sample as a biomarker for a Mps-1 kinase inhibitor treatment.

Description

Combinations for the treatment of cancer
The present invention relates to combinations of at least two compounds A and B, compound A being an inhibitor of Mps-1 kinase, and compound B being an inhibitor of an anti-apoptotic protein of the Bcl-2 family.
Another aspect of the present invention relates to the use of such combinations as described supra for the preparation of a medicament for the treatment or prophylaxis of a disease, particurlarly for the treatment of cancer. Another aspect of the present invention relates to the use of an anti- apoptotic protein from the Bcl-2 family as a sensitizer of cells to Mps-1 inhibitors.
Further, the present invention relates to a kit comprising a combination of: - one or more compounds A, as defined supra, or a physiologically acceptable salt, solvate, hydrate or stereoisomer thereof ;
one or more compounds B, as defined supra, or a physiologically acceptable salt, solvate, hydrate or stereoisomer thereof ; and
one or more pharmaceutical agents C;
in which optionally either or both of said compounds A and B are in the form of a pharmaceutical formulation which is ready for use to be administered simultaneously, concurrently, separately or sequentially.
The components may be administered independnently of one another by the oral, intravenous, topical, local installations, intraperitoneal or nasal route.
Another aspect of the present invention relates to the use of the ratio of pro- apoptotic and anti-apoptotic proteins from the Bcl-2 family in a biological sample as a biomarker for a Mps-1 kinase inhibitor treatment. BACKGROUND OF THE INVENTION
One component of the combinations of the present invention is a compound A which is an inhibitor of Mps-1 (Monopolar Spindle 1 ) kinase (also known as Tyrosine Threonine Kinase, TTK). Mps-1 is a dual specificity Ser/Thr kinase which plays a key role in the activation of the mitotic checkpoint (also known as spindle checkpoint, spindle assembly checkpoint, SAC) thereby ensuring proper chromosome segregation during mitosis [Abrieu A et al. , Cell, 2001 , 106, 83-93]. Every dividing cell has to ensure equal separation of the replicated chromosomes into the two daughter cells. Upon entry into mitosis, chromosomes are attached at their kinetochores to the microtubules of the spindle apparatus. The mitotic checkpoint is a surveillance mechanism that is active as long as unattached kinetochores are present and prevents mitotic cells from entering anaphase and thereby completing cell division with unattached chromosomes [Suijkerbuijk SJ and Kops GJ, Biochemica et Biophysica Acta, 2008, 1786, 24-31 ; Musacchio A and Salmon ED, Nat Rev Mol Cell Biol. , 2007, 8, 379-93] . Once all kinetochores are attached in a correct amphitelic, i.e. bipolar, fashion with the mitotic spindle, the checkpoint is satisfied and the cell enters anaphase and proceeds through mitosis. The mitotic checkpoint consists of a complex network of a number of essential proteins, including members of the MAD (mitotic arrest deficient, MAD 1 -3) and Bub (Budding uninhibited by benzimidazole, Bub 1 -3) families, the motor protein CENP-E, Mps-1 kinase as well as other components, many of these being over-expressed in proliferating cells (e.g. cancer cells) and tissues [Yuan B et al. , Clinical Cancer Research, 2006, 12, 405-10]. The essential role of Mps-1 kinase activity in mitotic checkpoint signalling has been shown by shRNA-silencing, chemical genetics as well as chemical inhibitors of Mps-1 kinase [Jelluma N et al. , PLos ONE, 2008, 3, e2415; Jones MH et al. , Current Biology, 2005, 1 5, 160-65; Dorer RK et al. , Current Biology, 2005, 1 5, 1070-76; Schmidt M et al. , EMBO Reports, 2005, 6, 866-72]. There is ample evidence linking reduced but incomplete mitotic checkpoint function with aneuploidy and tumorigenesis [Weaver BA and Cleveland DW, Cancer Research, 2007, 67, 10103-5; King RW, Biochimica et Biophysica Acta, 2008, 1786, 4-14]. In contrast, complete inhibition of the mitotic checkpoint has been recognised to result in severe chromosome missegregation and induction of apoptosis in tumour cells [Kops GJ et al. , Nature Reviews Cancer, 2005, 5, 773-85; Schmidt M and Medema RH, Cell Cycle, 2006, 5, 159-63; Schmidt M and Bastians H, Drug Resistance Updates, 2007, 10, 162-81 ], Therefore, mitotic checkpoint abrogation through pharmacological inhibition of Mps-1 kinase or other components of the mitotic checkpoint represents a new approach for the treatment of proliferative disorders including solid tumours such as carcinomas and sarcomas and leukaemias and lymphoid malignancies or other disorders associated with uncontrolled cellular proliferation.
Established anti mitotic drugs such as vinca alkaloids, taxanes or epothilones activate the SAC inducing a mitotic arrest either by stabilising or destabilising microtubule dynamics. This arrest prevents separation of sister chromatids to form the two daughter cells. Prolonged arrest in mitosis forces a cell either into mitotic exit without cytokinesis or into mitotic catastrophe leading to cell death.
In contrast, inhibitors of Mps-1 induce a SAC inactivation that accelerates progression of cells through mitosis resulting in severe chromosomal missegregation and finally in cell death.
These findings suggest that Mps-1 inhibitors should be of therapeutic value for the treatment of proliferative disorders associated with enhanced uncontrolled proliferative cellular processes such as, for example, cancer, inflammation, arthritis, viral diseases, neurodegenerative diseases such as Alzheimer's disease, cardiovascular diseases, or fungal diseases in a warm blooded animal such as man. Therefore, inhibitors of Mps-1 represent valuable compounds that should complement therapeutic options either as single agents or in combination with other drugs.
Different compounds have been disclosed in prior art which show an inhibitory effect on Mps-1 kinase:
WO 2009/024824 A1 discloses 2-Anilinopurin-8-ones as inhibitors of Mps-1 for the treatment of proliferate disorders. WO 2010/124826 A1 discloses substituted imidazoquinoxaline compounds as inhibitors of Mps-1 kinase. WO 201 1 /026579 A1 discloses substituted aminoquinoxalines as Mps- 1 inhibitors.
Preferred compounds for the inhibition of Mps-1 in a combination according to the present invention are the substituted triazolopyridine compounds of formula (I) as defined hereinafter. Substituted triazolopyridine compounds have been disclosed for the treatment or prophylaxis of different diseases:
WO 2008/025821 A1 relates to triazole derivatives as kinase inhibitors, especially inhibitors of ITK or PI3K, for the treatment or prophylaxis of immunological, inflammatory or allergic disorders. Said triazole derivatives are exemplified as possessing an amide, urea or aliphatic amine substituent in position 2.
WO 2009/047514 A1 relates to [1 ,2,4]-triazolo-[1 ,5-a]-pyridine and [1 ,2,4]- triazolo-[1 ,5-c]-pyrimidine compounds which inhibit AXL receptor tyrosine kinase function, and to the treatment of diseases and conditions that are mediated by AXL receptor tyrosine kinase, that are ameliorated by the inhibition of AXL receptor tyrosine kinase function etc. , including proliferative conditions such as cancer, etc.. Said compounds are exemplified as possessing a substituent in the 5-position and a substituent in the 2-position. WO 20Ό9/010530 A1 discloses bicyclic heterorayl compounds and their use as phosphatidylinositol (PI) 3-kinase. Among other compounds also substituted triazolopyridines are mentioned.
WO 2009/027283 A1 discloses triazolopyridine compounds and their use as ASK (apoptosis signal-regulating kinase) inhibitors for the treatment of autoimmune diseases and neurodegenerative diseases.
WO 2010/092041 A1 relates to [1 ,2,4]-triazolo- [1 , 5-a]-pyridines, which are said to be useful as selective kinase inhibitors, to methods for producing such compounds and methods for treating or ameliorating kinase-mediated disorder. Said triazole derivatives are exemplified as possessing a 2-chloro-5- hydroxyphenyl substituent in the 6- position of the [1 ,2,4]-triazolo- [1 , 5-a]- pyridine. WO 201 1 /064328 A1 , WO 201 1 /063907 A1 , WO 201 1 /063908 A1 , and WO 201 1 / 1 57688 A1 relate to [1 ,2,4]-triazolo- [1 , 5-a]-pyridines, methods for preparing said [1 ,2,4]-triazolo- [1 , 5-a]-pyridines, and their use for inhibition of Mps- 1 kinase. Another component of the combinations of the present invention is a compound B which is an inhibitor of an anti-apoptotic protein of the Bcl-2 family. Bcl-2 (B-cell lymphoma 2) is the founding member of the Bcl-2 family of apoptosis regulator proteins encoded by the BCL2 gene (Bakhashi et al. , Cell 1985, 41 , 899ff; Cleary et al. , Proc. Natl. Acad. Sci. USA, 1985, 82, 7439ff). The Bd-2 family is defined by the presence of up to four conserved "Bd-2 homology" (BH) domains designated BH1 , BH2, BH3, and BH4, all of which include a-helical segments (Chittenden et al. , EMBO 1995, 14, 5589ff; Wang et al. Genes Dev. 1996, 10, 2859ff). Anti-apoptotic proteins, such as Bcl-2, Bcl- XL, and Mcl-1 , display sequence conservation in all BH domains. Pro-apoptotic proteins are divided into "multidomain" members (e.g. BAK, BAX), which possess homology in the BH1 , BH2, and BH3 domains, and the "BH3-domain only" members (e.g. BID, BAD, BIM, BIK, NOXA, PUMA), that contain sequence homology exclusively in the BH3 amphipathic a-helical segment. BCL-2 family members have the capacity to form homo- and heterodimers, suggesting that competitive binding and the ratio between pro- and anti-apoptotic protein levels dictates susceptibility to death stimuli. Anti-apoptotic proteins function to protect cells from pro-apoptotic excess, i.e. , excessive programmed cell death. Additional "security" measures include regulating transcription of pro- apoptotic proteins and maintaining them as inactive conformers, requiring either proteolytic activation, dephosphorylation, or ligand-induced conformational change to activate pro-death functions. In certain cell types, death signals received at the plasma membrane trigger apoptosis via a mitochondrial pathway (US8198405 B2). The mitochondria can serve as a gatekeeper of cell death by sequestering cytochrome c, a critical component of a cytosolic complex which activates caspase 9, leading to fatal downstream proteolytic events. Multidomain proteins such as BCI-2/BCI-XL and BAK /BAX play dueling roles of guardian and executioner at the mitochondrial membrane, with their activities further regulated by upstream BH3-only members of the Bcl-2 family. For example, BID is a member of the "BH3- domain only" subset of pro-apoptotic proteins, and transmits death signals received at the plasma membrane to effector pro-apoptotic proteins at the mitochondrial membrane. BID has the unique capability of interacting with both pro- and anti-apoptotic proteins, and upon activation by caspase 8, triggers cytochrome c release and mitochondrial apoptosis. Deletion and mutagenesis studies determined that the amphipathic a-helical BH3 segment of pro-apoptotic family members functions as a death domain and thus represents a critical structural motif for interacting with multidomain apoptotic proteins. Structural studies have demonstrated that the BH3 helix interacts with anti-apoptotic proteins by inserting into a hydrophobic groove formed by the interface of BH1 , 2 and 3 domains. Activated BID can be bound and sequested by anti-apoptotic proteins (e.g. , Bcl-2 and BCI-XL) and can trigger activation of the pro-apoptotic proteins BAX and BAK, leading to cytochrome c release and a mitochondrial apoptosis program.
Inhibitors of anti-apoptotic Bcl-2 proteins have been disclosed in prior art (e.g. US 8, 188,077 B2).
However, the state of the art neither discloses the combinations of the present invention comprising an inhibitor of Mps-1 kinase and an inhibitor of an anti-apoptotic protein of the Bcl-2 family nor the use of an anti-apoptotic protein from the Bcl-2 family as a sensitizer of cells to Mps-1 inhibitors.
SUMMARY of the INVENTION
Surprisingly it was observed that the depletion or pharmacological inhibition of an anti-apoptotic protein of the Bcl-2 family sensitized tumor cells to Mps-1 inhibitors.
Therefore, in accordance with a first aspect, the present invention covers combinations of at least two compounds A and B, compound A being an inhibitor of Mps-1 kinase, and compound B being an inhibitor of an anti- apoptotic protein of the Bcl-2 family.
The combinations of at least two compounds A and B, as decribed and defined herein, are also referred to as "combinations of the present invention"; a compound A, as decribed and defined herein, is also referred to as "compound A of the the present invention" and a compound B, as decribed and defined herein, is also referred to as "compound B of the the present invention", respectively. Compounds A and B jointly are also referred to as "compounds of the present invention".
Further, the present invention relates to : a kit comprising :
- a combination of : component A : one or more Mps-1 kinase inhibitors, or a physiologically acceptable salt, solvate, hydrate or stereoisomer thereof ; component B : one or more inhibitors of an anti-apoptotic protein from the Bcl-2 family, or a physiologically acceptable salt, solvate, hydrate or stereoisomer thereof ; and, optionally, component C : one or more further pharmaceutical agents ; in which optionally either or both of said components A and B in any of the above-mentioned combinations are in the form of a pharmaceutical formulation which is ready for use to be administered simultaneously, concurrently, separately or sequentially. The components may be administered independnently of one another by the oral, intravenous, topical, local installations, intraperitoneal or nasal route.
In accordance with another aspect, the present invention covers the combinations as described supra for the treatment or prophylaxis of a disease.
In accordance with another aspect, the present invention covers the use of such combinations as described supra for the preparation of a medicament for the treatment or prophylaxis of of a disease.
In accordance with another aspect, the present invention covers an anti- apoptotic protein from the Bcl-2 family for the use as a sensitizer of cells to Mps-1 inhibitors. In accordance with another aspect, the present invention covers the use of an anti-apoptotic protein from the Bcl-2 family as a sensitizer of cells to Mps-1 inhibitors.
Further, the present invention relates to the use of the ratio of pro-apoptotic and anti-apoptotic proteins from the Bcl-2 family in a biological sample as a biomarker for a Mps-1 kinase inhibitor treatment.
DETAILLED DESCRIPTION of the INVENTION
The terms as mentioned in the present text have preferably the following meanings :
The term "halogen atom" or "halo-" is to be understood as meaning a fluorine, chlorine, bromine or iodine atom. The term "G -C6-alkyl" is to be understood as preferably meaning a linear or branched, saturated, monovalent hydrocarbon group having 1 , 2, 3, 4, 5 or 6 carbon atoms, e.g. a methyl, ethyl, propyl, butyl, pentyl, hexyl, iso-propyl, iso-butyl, sec -butyl, tert-butyl, iso-pentyl, 2-methylbutyl, 1 -methylbutyl, 1 - ethylpropyl, 1 ,2-dimethylpropyl, neo-pentyl, 1 , 1 -dimethylpropyl, 4- methylpentyl, 3-methylpentyl, 2-methylpentyl, 1 -methylpentyl, 2-ethylbutyl, 1 -ethylbutyl, 3,3-dimethylbutyl, 2,2-dimethylbutyl, 1 , 1 -dimethylbutyl, 2,3- dimethylbutyl, 1 ,3-dimethylbutyl, or 1 ,2-dimethylbutyl group, or an isomer thereof. Particularly, said group has 1 , 2, 3 or 4 carbon atoms ("G-C4-alkyl"), e.g. a methyl, ethyl, propyl, butyl, iso-propyl, iso-butyl, sec-butyl, tert-butyl group, more particularly 1 , 2 or 3 carbon atoms ("G -C3-alkyl"), e.g. a methyl, ethyl, n- propyl- or iso-propyl group. The term "halo-G -C6-alkyl" is to be understood as preferably meaning a linear or branched, saturated, monovalent hydrocarbon group in which the term "G - Ce-alkyl" is defined supra, and in which one or more of the hydrogen atoms is replaced, in identically or differently, by a halogen atom. Particularly, said halogen atom is F. Said halo-G -Ce-alkyl group is, for example, -CF3, -CHF2, -CH2F, -CF2CF3, or -CH2CF3.
The term "G -Ce-alkoxy" is to be understood as preferably meaning a linear or branched, saturated, monovalent group of formula 0- (G -C6-alkyl), in which the term "G -C6-alkyl" is defined supra, e.g. a methoxy, ethoxy, n-propoxy, iso-propoxy, n-butoxy, iso-butoxy, tert-butoxy, sec-butoxy, pentoxy, iso- pentoxy, or n-hexoxy group, or an isomer thereof.
The term "halo-G -C6-alkoxy" is to be understood as preferably meaning a linear or branched, saturated, monovalent G -C6-alkoxy group, as defined supra, in which one or more of the hydrogen atoms is replaced, in identically or differently, by a halogen atom. Particularly, said halogen atom is F. Said halo-CrC6-alkoxy group is, for example, -OCF3, -OCHF2, -OCH2F, -OCF2CF3, or -
The term "CrC6-alkoxy-Ci -C6-alkyl" is to be understood as preferably meaning a linear or branched, saturated, monovalent G-Ce-alkyl group, as defined supra, in which one or more of the hydrogen atoms is replaced, in identically or differently, by a G-C6-alkoxy group, as defined supra, e.g. methoxyalkyl, ethoxyalkyl, propyloxyalkyl, iso-propoxyalkyl, butoxyalkyl, iso-butoxyalkyl, tert-butoxyalkyl, sec -butoxyalkyl, pentyloxyalkyl, iso-pentyloxyalkyl, hexyloxyalkyl group, or an isomer thereof.
The term "halo-CrC6-alkoxy-Ci-C6-alkyl" is to be understood as preferably meaning a linear or branched, saturated, monovalent G-C6-alkoxy-CrC6-alkyl group, as defined supra, in which one or more of the hydrogen atoms is replaced, in identically or differently, by a halogen atom. Particularly, said halogen atom is F. Said halo-CrC6-alkoxy-G-C6-alkyl group is, for example, CH2CH2OCF3, -CH2CH2OCHF2, -CH2CH2OCH2F, -CH2CH2OCF2CF3, or
Figure imgf000012_0001
The term "C2-C6-alkenyl" is to be understood as preferably meaning a linear or branched, monovalent hydrocarbon group, which contains one or more double bonds, and which has 2, 3, 4, 5 or 6 carbon atoms, particularly 2 or 3 carbon atoms ("C2-C3-alkenyl"), it being understood that in the case in which said alkenyl group contains more than one double bond, then said double bonds may be isolated from, or conjugated with, each other. Said alkenyl group is, for example, a vinyl, allyl, (E)-2-methylvinyl, (Z)-2-methylvinyl, homoallyl, (E)-but-2-enyl, (Z)-but-2-enyl, (E)-buM -enyl, (Z)-buM -enyl, pent-4-enyl, (E)- pent-3-enyl, (Z)-pent-3-enyl, (E)-pent-2-enyl, (Z)-pent-2-enyl, (E)-penM -enyl, (Z)-penM -enyl, hex-5-enyl, (E)-hex-4-enyl, (Z)-hex-4-enyl, (E)-hex-3-enyl, (Z)- hex-3-enyl, (E)-hex-2-enyl, (Z)-hex-2-enyl, (E)-hex-1 -enyl, (Z)-hex-l -enyl, isopropenyi, 2-methylprop-2-enyl, 1 -methylprop-2-enyl, 2-methylprop-1 -enyl, (E)-1 -methylprop-1 -enyl, (Z)-1 -methylprop-1 -enyl, 3-methylbut-3-enyl, 2- methylbut-3-enyl, 1 -methylbut-3-enyl, 3-methylbut-2-enyl, (E)-2-methylbut-2- enyl, (Z)-2-methylbut-2-enyl, (E)-1 -methylbut-2-enyl, (Z)-1 -methylbut-2-enyl, (E)-3-methylbut-1 -enyl, (Z)-3-methylbut-1 -enyl, (E)-2-methylbut-1 -enyl, (Z)-2- methylbut-1 -enyl, (E)-1 -methylbut-1 -enyl, (Z)-1 -methylbut-1 -enyl, 1 , 1 - dimethylprop-2-enyl, 1 -ethylprop-1 -enyl, 1 -propylvinyi, 1 -isopropylvinyl, 4- methylpent-4-enyl, 3-methylpent-4-enyl, 2-methylpent-4-enyl, 1 -methylpent- 4-enyl, 4-methylpent-3-enyl, (E)-3-methylpent-3-enyl, (Z)-3-methylpent-3- enyl, (E)-2-methylpent-3-enyl, (Z)-2-methylpent-3-enyl, (E)-1 -methylpent-3- enyl, (Z)-1 -methylpent-3-enyl, (E)-4-methylpent-2-enyl, (Z)-4-methylpent-2- enyl, (E)-3-methylpent-2-enyl, (Z)-3-methylpent-2-enyl, (E)-2-methylpent-2- enyl, (Z)-2-methylpent-2-enyl, (E)-1 -methylpent-2-enyl, (Z)-1 -methylpent-2- enyl, (E)-4-methylpent-1 -enyl, (Z)-4-methylpent-1 -enyl, (E)-3-methylpent-1 - enyl, (Z)-3-methylpent-1 -enyl, (E)-2-methylpent-1 -enyl, (Z)-2-methylpent-1 - enyl, (E)-1 -methylpent-1 -enyl, (Z)-1 -methyl pent-1 -enyl, 3-ethylbut-3-enyl, 2- ethylbut-3-enyl, 1 -ethylbut-3-enyl, (E)-3-ethylbut-2-enyl, (Z)-3-ethylbut-2- enyl, (E)-2-ethylbut-2-enyl, (Z)-2-ethylbut-2-enyl, (E)-1 -ethylbut-2-enyl, (Z)-1 - ethylbut-2-enyl, (E)-3-ethylbut-1 -enyl, (Z)-3-ethylbut-1 -enyl, 2-ethylbut-1 - enyl, (E)-1 -ethylbut-1 -enyl, (Z)-1 -ethylbut-1 -enyl, 2-propylprop-2-enyl, 1 - propylprop-2-enyl, 2-isopropylprop-2-enyl, 1 -isopropylprop-2-enyl, (E)-2- propylprop-1 -enyl, (Z)-2-propylprop-1 -enyl, (E)-1 -propylprop-1 -enyl, (Z)-1 - propylprop-1 -enyl, (E)-2-isopropylprop-1 -enyl, (Z)-2-isopropylprop-1 -enyl, (E)- 1 -isopropylprop-1 -enyl, (Z)-1 -isopropylprop-1 -enyl, (E)-3,3-dimethylprop-1 - enyl, (Z)-3,3-dimethylprop-1 -enyl, 1 -(1 ,1 -dimethylethyl)ethenyl, buta-1 ,3- dienyl, penta-1 ,4-dienyl, hexa-1 ,5-dienyl, or methylhexadienyl group. Particularly, said group is vinyl or allyl. The term "C2-C6-alkynyl" is to be understood as preferably meaning a linear or branched, monovalent hydrocarbon group which contains one or more triple bonds, and which contains 2, 3, 4, 5 or 6 carbon atoms, particularly 2 or 3 carbon atoms ("C2-Cralkynyl"). Said C2-C6-alkynyl group is, for example, ethynyl, prop-1 -ynyl, prop-2-ynyl, but-Tynyl, but-2-ynyl, but-3-ynyl, pent-1 - ynyl, pent-2-ynyl, pent-3-ynyl, pent-4-ynyl, hex-1 -ynyl, hex-2-inyl, hex-3-inyl, hex-4-ynyl, hex-5-ynyl, 1 -methylprop-2-ynyl, 2-methylbut-3-ynyl, 1 - methylbut-3-ynyl, 1 -methylbut-2-ynyl, 3-methylbut-1 -ynyl, 1 -ethylprop-2- ynyl, 3-methylpent-4-ynyl, 2-methylpent-4-ynyl, 1 -methylpent-4-ynyl, 2- methylpent-3-ynyl, 1 -methylpent-3-ynyl, 4-methylpent-2-ynyl, 1 -methylpent- 2-ynyl, 4-methylpent-1 -ynyl, 3-methylpent-1 -ynyl, 2-ethylbut-3-ynyl, 1 -ethyl - but-3-ynyl, 1 -ethylbut-2-ynyl, 1 -propylprop-2-ynyl, 1 -isopropylprop-2-ynyl,
2.2- dimethylbut-3-inyl, 1 , 1 -dimethylbut-3-ynyl, 1 , 1 -dimethylbut-2-ynyl, or
3.3- dimethylbut-1 -ynyl group. Particularly, said alkynyl group is ethynyl, prop- 1 -ynyl, or prop-2-inyl.
The term "C:rC6-cycloalkyl" is to be understood as preferably meaning a saturated, monovalent, mono-, or bicyclic hydrocarbon ring which contains 3, 4, 5 or 6 carbon atoms. Said C3-C&-cycloalkyl group is for example, a monocyclic hydrocarbon ring, e.g. a cyclopropyl, cyclobutyl, cyclopentyl, or cyciohexyi or a bicyclic hydrocarbon ring. Said cycioaikyl ring can optionally contain one or more double bonds e.g. cycloalkenyl, such as a cyclopropenyl, cyclobutenyl, cyclopentenyl or cyclohexenyl group, wherein the bond between said ring with the rest of the molecule may be to any carbon atom of said ring, be it saturated or unsaturated.
The term "heterocyclic ring", as used in the term "4-, 5- or 6- membered heterocyclic ring", or "4- to 6-membered heterocyclic ring" or "4- to 5- membered heterocyclic ring", for example, as used in the definition of compounds of general formula (I) as defined herein, is to be understood as meaning a saturated or partially unsaturated, monocyclic nitrogen atom- containing ring, said nitrogen atom being the point of attachment of said heterocyclic ring with the rest of the molecule. Said nitrogen atom-containing ring optionally further contains 1 or 2 heteroatom-containing groups selected from 0 and C(=0). Particularly, without being limited thereto, said nitrogen atom-containing ring can be a 4-membered ring, such as an azetidinyl ring, for example, or a 5-membered ring, such as a pyrrolidinyl ring or oxazolidinonyi ring, for example, or a 6-membered ring, such as a piperidinyl or morpholinyl ring, for example ; it being reiterated that any of the above-mentioned nitrogen atom-containing rings can further contain 1 or 2 heteroatom- containing groups selected from O and C(=0).
As mentioned supra, said nitrogen atom-containing ring can be partially unsaturated, i.e. it can contain one or more double bonds, such as, without being limited thereto, a 2,5-dihydro-1 H-pyrrolyl ring, for example.
The term "3- to 10-membered heterocycloalkyl" is to be understood as preferably meaning a saturated or partially unsaturated, monovalent, mono- or bicyclic hydrocarbon ring which contains 2, 3, 4, 5, 6, 7, 8, or 9 carbon atoms, and one or more heteroatom-containing groups selected from C(=0), O, S, S(=0), S(=0)2, NH, NR" , wherein R" represents a G-C6-alkyl, C3-C6- cycloalkyl,
Figure imgf000015_0001
Particularly, said ring can contain 2, 3, 4, or 5 carbon atoms, and one or more of the above- mentioned heteroatom-containing groups (a "3- to 6-membered heterocycloalkyl"), more particularly said ring can contain 4 or 5 carbon atoms, and one or more of the above-mentioned heteroatom-containing groups (a "5- to 6-membered heterocycloalkyl"). Said heterocycloalkyl ring is for example, a monocyclic heterocycloalkyl ring such as an oxyranyl, oxetanyl, aziridinyl, azetidinyl, tetrahydrofuranyl, pyrrolidinyl, imidazolidinyl, pyrazolidinyl, pyrrolinyl, tetrahydropyranyl, piperidinyl, morpholinyl, dithianyl, thiomorpholinyl, piperazinyl, trithianyl, or chinuclidinyl group. Optionally, said heterocycloalkyl ring can contain one or more double bonds, e.g. 4H-pyranyl, 2H-pyranyl, 3H-diazirinyl, 2 , 5 - di hyd ro - 1 H - pyr rolyl , [1 ,3]dioxolyl, 4H- [1 ,3,4]thiadiazinyl, 2,5-dihydrofuranyl, 2,3-dihydrofuranyl, 2,5-dihydrothiophenyl, 2,3-dihydrothiophenyl, 4,5-dihydro-1 ,3-oxazolyl, 4,4- dimethyl-4,5-dihydro-1 ,3-oxazolyl , or 4H -[1 ,4]thiazinyl group, or, it may be benzo fused.
The term "aryl" is to be understood as preferably meaning a monovalent, aromatic or partially aromatic, mono-, or bi- or tricyclic hydrocarbon ring having 6, 7, 8, 9, 10, 1 1 , 12, 13 or 14 carbon atoms (a "Ce-Cu-aryl" group), particularly a ring having 6 carbon atoms (a "C6-aryl" group), e.g. a phenyl group, or a biphenyl group, or a ring having 9 carbon atoms (a "Craryl" group), e.g. an indanyi or indenyl group, or a ring having 10 carbon atoms (a "Cio-aryl" group), e.g. a tetralinyl, dihydronaphthyl, or naphthyl group, or a ring having 13 carbon atoms, (a "Cn-aryl" group), e.g. a fluorenyl group, or a ring having 14 carbon atoms, (a "Cn-aryl" group), e.g. an anthranyl group.
The term "heteroaryi" is understood as preferably meaning a monovalent, aromatic, mono- or bicyciic aromatic ring system having 5, 6, 7, 8, 9, 10, 1 1 , 12, 13 or 14 ring atoms (a "5- to 14-membered heteroaryi" group), particularly 5 or 6 or 9 or 10 atoms, and which contains at least one heteroatom which may be identical or different, said heteroatom being such as oxygen, nitrogen or sulfur, and can be monocyclic, bicyciic, or tricyclic, and in addition in each case can be benzocondensed. Particularly, heteroaryi is selected from thienyl, furanyl, pyr rolyl, oxazolyl, thiazolyl, imidazolyl, pyrazolyl, isoxazolyl, isothiazolyl, oxadiazolyl, triazolyl, thiadiazolyl, thia-4H-pyrazolyl etc. , and benzo derivatives thereof, such as, for example, benzofuranyl, benzothienyl, benzoxazolyl, benzisoxazolyl, benzimidazolyl, benzotriazolyl, indazolyl, indolyl, isoindolyl, etc. ; or pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, triazinyl, etc. , and benzo derivatives thereof, such as, for example, quinolinyl, quinazolinyl, isoquinolinyl, etc. ; or azocinyl, indolizinyl, purinyl, etc. , and benzo derivatives thereof; or cinnolinyl, phthalazinyl, quinazolinyl, quinoxaiinyi, naphthpyridinyl, pteridinyl, carbazoiyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyi, xanthenyl, or oxepinyi, etc. More particularly, heteroaryl is selected from pyridyl, benzofuranyl, benzisoxazolyl, indazolyl, quinazolinyl, thienyl, quinolinyl, benzothienyl, pyrazolyl, or furanyl.
The term "alkylene" is understood as preferably meaning an optionally substituted hydrocarbon chain (or "tether") having 1 , 2, 3, 4, 5, 6, 7 or 8 carbon atoms, i.e. an optionally substituted CH2- ("methylene" or "single membered tether" or, for example -C(CH;s)2-), -CH2-CH2- ("ethylene", "dimethylene", or "two-membered tether", for example C(CHi)2-C(CH;j)2-), - CH2-CH2-CH2- ("propylene", "trimethylene", or "three-membered tether", for example CH2-C(H)(CH3)-CH2- , -CH2-C(CH3)2-CH2-), -CH2-CH2-CH2-CH2- ("butylene", "tetramethylene", or "four-membered tether"), -CH2-CH2-CH2- CH2-CH2- ("pentylene", "pentamethylene" or "five-membered ether"), or - CH2-CH2-CH2-CH2-CH2-CH2- ("hexylene", "hexamethylene", or six-membered tether") group. Particularly, said alkylene tether has 1 , 2, 3, 4, or 5 carbon atoms, more particularly 1 or 2 carbon atoms.
The term "C1 -C6", as used throughout this text, e.g. in the context of the definition of "C C6-alkyl", "G -G-haloalkyl", "G -G-alkoxy", or "G -G- haloalkoxy" is to be understood as meaning an a Iky I group having a finite number of carbon atoms of 1 to 6, i.e. 1 , 2, 3, 4, 5, or 6 carbon atoms. It is to be understood further that said term "G -G" is to be interpreted as any subrange comprised therein, e.g. G -G , C2-C5 , C3-C4 . G -C2 , G -C3 , G -C4 . G - , G - ; particularly G -C2 . G -C3 . C1 -G . C1 -C5 , G -G : more particularly G - ; in the case of "G -G-haloalkyl" or "G -C6-haloalkoxy" even more particularly G -G. Similarly, as used herein, the term "C2-C6", as used throughout this text, e.g. in the context of the definitions of "G-Ce-alkenyl" and "d-Ce-alkynyl", is to be understood as meaning an alkenyl group or an alkynyl group having a finite number of carbon atoms of 2 to 6, i. e. 2, 3, 4, 5, or 6 carbon atoms. It is to be understood further that said term "C2-C6" is to be interpreted as any sub-range comprised therein, e.g. C2-Cb . C3-C5 , CrO . C2-C3 , C2-C4 , C2-C5 ; particularly C2- C3.
Further, as used herein, the term "C3-C6", as used throughout this text, e.g. in the context of the definition of "C3-C6-cycloalkyl", is to be understood as meaning a cycloalkyl group having a finite number of carbon atoms of 3 to 6, i.e. 3, 4, 5 or 6 carbon atoms. It is to be understood further that said term "C3-C6" is to be interpreted as any sub-range comprised therein, e.g. C3-C0 , C4- C5 , C3-C5 , C3-C4 , C4-C6, C5-C6 ; particularly C3-C6.
As used herein, the term "leaving group" refers to an atom or a group of atoms that is displaced in a chemical reaction as stable species taking with it the bonding electrons. Preferably, a leaving group is selected from the group comprising: halo, in particular chloro, bromo or iodo, methanesulfonyloxy, p-toluenesulfonyloxy, trifluoromethanesulfonyloxy, nonafluorobutanesulfonyloxy, (4-bromo-benzene)sulfonyloxy, (4-nitro- benzene)sulfonyloxy, (2-nitro-benzene)-sulfonyloxy, (4-isopropyl- benzene)sulfonyloxy, (2,4,6-tri-isopropyl-benzene)-sulfonyloxy, (2,4,6-trimethyl-benzene)sulfonyloxy, (4-tertbutyl-benzene)sulfonyloxy, benzenesulfonyloxy, and (4-methoxy-benzene)sulfonyloxy.
As used herein, the term "carboxylic acid ester" refers to a group of the formula C(=0)ORE in which RE is e.g. a G -C6-alkyl- or C3-C6-cycloalkyl- group. As used herein, the term "protected amine" is an amino group in which a protecting group is introduced by chemical modification of said amino group in order to obtain chemoselectivity in a subsequent chemical reaction. Protecting groups for amino groups are descibed for example in T.W. Greene and P.G.M. Wuts in Protective Groups in Organic Synthesis, 3rd edition, Wiley 1999.
Particularly, the term "protected amine" refers to a group of the formula N(H)PG2 in which PG2 refers to a protecting group for amino groups e.g. a Boc group as descibed for example in T.W. Greene and P.G.M. Wuts in Protective Groups in Organic Synthesis, 3rd edition, Wiley 1999 (Boc = tert- butyloxycarbonyl).
As used herein, the term "PG1 " refers to a protecting group for hydroxy groups e.g. a TMS group or TBDPS group as decribed for example in T.W. Greene and P.G.M. Wuts in Protective Groups in Organic Synthesis, 3rd edition, Wiley 1999 (TMS = trimethylsilyl, TBDPS = tert-butyldiphenylsilyl).
As used herein, the term "one or more times", e.g. in the definition of the substituents of the compounds of the general formulae of the present invention, is understood as meaning "one, two, three, four or five times, particularly one, two, three or four times, more particularly one, two or three times, even more particularly one or two times". Where the plural form of the word compounds, salts, polymorphs, hydrates, solvates and the like, is used herein, this is taken to mean also a single compound, salt, polymorph, isomer, hydrate, solvate or the like.
The compounds of this invention contain one or more asymmetric centre, depending upon the location and nature of the various substituents desired. Asymmetric carbon atoms may be present in the (R) or (S) configuration. In certain instances, asymmetry may also be present due to restricted rotation about a given bond, for example, the central bond adjoining two substituted aromatic rings of the specified compounds. Substituents on a ring may also be present in either cis or trans form. It is intended that all such configurations are included within the scope of the present invention.
Preferred compounds are those which produce the more desirable biological activity. Separated, pure or partially purified isomers and stereoisomers or racemic or diastereomeric mixtures of the compounds of this invention are also included within the scope of the present invention. The purification and the separation of such materials can be accomplished by standard techniques known in the art.
The optical isomers can be obtained by resolution of the racemic mixtures according to conventional processes, for example, by the formation of diastereoisomeric salts using an optically active acid or base or formation of covalent diastereomers. Examples of appropriate acids are tartaric, diacetyltartaric, ditoluoyltartaric and camphorsulfonic acid. Mixtures of diastereoisomers can be separated into their individual diastereomers on the basis of their physical and/or chemical differences by methods known in the art, for example, by chromatography or fractional crystallisation. The optically active bases or acids are then liberated from the separated diastereomeric salts. A different process for separation of optical isomers involves the use of chiral chromatography (e.g. , chiral HPLC columns), with or without conventional derivatisation, optimally chosen to maximise the separation of the enantiomers. Suitable chiral HPLC columns are manufactured by Diacel, e.g. , Chiracel OD and Chiracel OJ among many others, all routinely selectable. Enzymatic separations, with or without derivatisation, are also useful. The optically active compounds of this invention can likewise be obtained by chiral syntheses utilizing optically active starting materials. In order to limit different types of isomers from each other reference is made to lUPAC Rules Section E (Pure Appl Chem 45, 1 1 -30, 1976).
The invention also includes all suitable isotopic variations of a compound of the invention. An isotopic variation of a compound of the invention is defined as one in which at least one atom is replaced by an atom having the same atomic number but an atomic mass different from the atomic mass usually or predominantly found in nature. Examples of isotopes that can be incorporated into a compound of the invention include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulphur, fluorine, chlorine, bromine and iodine, such as 2H (deuterium), H (tritium), 11C, 13C, 14C, 15N, 170, 180, 32P, 3 P, 33S, 34S, 35S, 36S, 18F, 36Cl, 82Br, 12 l, 1 4l, 129l and 1 1l, respectively. Certain isotopic variations of a compound of the invention, for example, those in which one or more radioactive isotopes such as 3H or 14C are incorporated, are useful in drug and/or substrate tissue distribution studies. Tritiated and carbon- 14, i.e. , 14C, isotopes are particularly preferred for their ease of preparation and detectability. Further, substitution with isotopes such as deuterium may afford certain therapeutic advantages resulting from greater metabolic stability, for example, increased in vivo half-life or reduced dosage requirements and hence may be preferred in some circumstances. Isotopic variations of a compound of the invention can generally be prepared by conventional procedures known by a person skilled in the art such as by the illustrative methods or by the preparations described in the examples hereafter using appropriate isotopic variations of suitable reagents. The present invention includes all possible stereoisomers of the compounds of the present invention as single stereoisomers, or as any mixture of said stereoisomers, in any ratio. Isolation of a single stereoisomer, e.g. a single enantiomer or a single diastereomer, of a compound of the present invention may be achieved by any suitable state of the art method, such as chromatography, especially chiral chromatography, for example.
Further, the compounds of the present invention may exist as tautomers. For example, any compound of the present invention which contains a pyrazole moiety as a heteroaryl group for example can exist as a 1 H tautomer, or a 2H tautomer, or even a mixture in any amount of the two tautomers, or a triazole moiety for example can exist as a 1 H tautomer, a 2H tautomer, or a 4H tautomer, or even a mixture in any amount of said 1 H, 2H and 4H tautomers, viz. :
Figure imgf000022_0001
1 H-tautomer 2H-tautomer 4H-tauiomer_
The present invention includes all possible tautomers of the compounds of the present invention as single tautomers, or as any mixture of said tautomers, in any ratio.
Furthermore, the present invention includes all possible crystalline forms, or polymorphs, of the compounds of the present invention, either as single polymorphs, or as a mixture of more than one polymorphs, in any ratio.
In accordance with a first aspect, the present invention relates to combinations of at least two compounds A and B, compound A being an inhibitor of Mps-1 kinase, and compound B being an inhibitor of an anti- apoptotic protein of the Bcl-2 family.
The synergistic behavior of a combination of the present invention is demonstrated herein with the structurally different Mps-1 inhibitors BAY 2 and BAY 3:
Figure imgf000023_0001
BAY 2 BAY 3
This makes it evident, that principially any Mps-1 inhibitor can be used in a combination of the present invention.
So, compound A can be selected from inhibitors of Mps-1 kinase (or a prodrug thereof) specifically or generically disclosed e.g. in the following publications which are incorporated herein by reference:
WO201 1 /1 13862A, WO201 1 /1 51259A, WO2012/032031 A, WO201 1 /063908A, WO201 1 /064328A, WO201 1 /063907A, WO201 1 / 157688A, WO2012/080229A, WO2012/080228A, WO2012/080234A, WO2012/080230A, WO2012/080236A, WO2009/1 56315A, WO2012/013557A, WO2009/02482A WO2010/1 1 1406A, WO201 1 /013729A1 , WO2013/087579, WO2012/143329, Ken-ichi Kusakabe et al. : Diaminopyridine-Based Potent and Selective Mps1 Kinase Inhibitors Binding to an Unusual Flipped-Peptide Conformation, ACS Med. Chem. Lett. 2012, 3,
560-564;
or contained in the following patent applications which are incorporated herein by reference: EP13171508.8, EP13171039.4, EP13170978.4, EP13171 171 .5.
Preferably, the compound A being an inhibitor of Mps-1 kinase is selected from the group of compounds of general formula (I) :
Figure imgf000024_0001
in which :
represents a group selected from:
-N(H)C(=0)R6, -C(=0)N(H)R6 ; each
RA2 independently represents halo-, hydroxy-, nitro-, G -C6-alkyl-,
CrC6-alkoxy-, hydroxy-C,-C6-alkyl-, -N(H)C(=0)R8, -N(H)C(=0)NR8R7,
-C(=0)N(H)R8 or -N(H)S(=0)2R8; represents a
Figure imgf000024_0002
group; wherein * indicates the point of attachment of said group with the rest of the molecule;
R3 represents a hydrogen atom, a halogen atom, a hydroxy-, amino-, cyano-, nitro-, C C4-alkyl-, halo-G-C4-alkyl-, G-Cralkoxy-,
halo-CrCt-alkoxy-, hydroxy-Ci -C4-alkyl- , CrC4-alkoxy-CrC4-alkyl-,
halo-Ci-C4-alkoxy-C C4-alkyl-, C2-C6-alkenyl-, d-Ca-alkynyl-,
halo-d-Ce-alkenyl-, halo-C2-C6-alkynyl-, C3-C6-cycloalkyl-, or
a halo-CrC6-cycloalkyl- group;
R4 represents a hydrogen atom, a halogen atom, a hydroxy-, amino-, cyano-, nitro-, G-C4-alkyl-, halo-C C4-alkyl-, G-C4-alkoxy-,
halo-Ci-C4-alkoxy-, hydroxy-Ci -C4-alkyl- , Ci-C4-alkoxy-Ci-C4-alkyl-,
halo-Ci-C4-alkoxy-C C4-alkyl-, d-Ce-alkenyl-, C2-C6-alkynyl-,
halo-d-Ce-alkenyl-, halo-C2-C6-alkynyl-, CrC6-cycloalkyl-, or
a halo-CrC6-cycloalkyl- group;
R5 represents a hydrogen atom or a Ci-Cs-alkyl- group ; Ra represents a group selected from:
cyano-, halo-, nitro-, G-C6-alkyl-, halo-d-Ce-alkyl-, CrC6-alkoxy-,
halo-G-Ce-alkoxy-, hydroxy-Ci -C6-alkyl- , G-C6-alkoxy-Ci-C6-alkyl-,
halo-Ci-C6-alkoxy-Ci-C6-alkyl-, R8-(Ci-C6-alkoxy)-, R8-0-, NR8R7,
R8-S-, R8-5(=0)-, R8-S(=0)2-, (C3-C6-cycloalkyl)-(CH2)n-0-;
Rb represents a group selected from:
hydrogen, halo-, hydroxy-, cyano-, nitro-, G-C6-alkyl-, halo-Ci-C6-alkyl-, Ci-C6-alkoxy-, halo-G-Ce-alkoxy-, hydroxy-CrCe-alkyl-,
Ci-C6-alkoxy-Ci-C6-alkyl-, halo-Ci-C6-alkoxy-Ci-C6-alkyl-,
R8-(CrC6-alkyl)-, R8-(CH2)n(CHOH){CH2)m-, R8-(Ci-C6-alkoxy)-, R8-(CH2)n(CHOH)(CH2)P-0- , R8-(Ci-C6-alkoxy-Ci-C6-alkyl)- ,
R8-(C, -C6-alkoxy-C, -C6-alkyl)-0- , -0-{CH2)n-C(=0)NR8R7, R8-0-,
-C(=0)R8, -C(=0)0-R8, -0C(=0)-R8, -N(H)C(=0)R8, -N(R7)C(=0)R8,
-N(R7)C(=0)OR8, -N(H)C(=0)NR8R7, -N(R7)C(=0)NR8R7, NR8R7, NR7R7,
-C(=0)N(H)R8, -C(=0)NR8R7, R8-S-, R8-S(=0)-, R8-S{=0)2-, R7-S(=0)2-,
-N(H)S(=0)R8, -N(R7)S(=0)R8, -5(=0)N(H)R8, -S(=0)NR8R7, -N(H)S(=0)2R8,
-N(R7)S(=0)2R8, -5(=0)2N(H)R8, -S(=0)2NR8R7, -S(=0)(=NR8)R7,
-S(=0)(=NR7)R8, -N=S(=0)(R8)R7; R6 represents a group selected from CrC6-cycloalkyl- , 3- to 10-membered heterocycloalkyl- , aryl- , heteroaryl- , -(CH2)q-(CrC6-cycloalkyl),
■(CH2)Q-(3- to 10-membered heterocycloalkyl), - (CH2)a-aryl, or
-(CH2)q-heteroaryl,
wherein said group is optionally substituted , one or more times, identically or differently, with a substituent selected from:
halo- , hydroxy- , cyano- , nitro- , CrCe-alkyl-, halo-G -C6-alkyl- ,
C C6-alkoxy- , halo-CrC6-alkoxy- , hydroxy-Ci -C6-alkyl- ,
Ci-C6-alkoxy-CrC6-alkyl- , halo-Ci-C6-alkoxy-Ci -C6-alkyl- ,
-N(H)R8; -N(R7)R8, N(H)(R8)-Ci-C alkyl- , N{R7)(R8)-Ci-C3-alkyl- ;
R7 represents a hydrogen atom, a C C6-alkyl- or a C3-C6-cycloalkyl- group;
R8 represents a hydrogen atom or a Ci-Ce-alkyl- or C;rC6-cycloalkyl- group, wherein said CrCe-alkyl- or C3-C6-cycloalkyl- group is optionally substituted , one or more times, identically or differently, with a substituent selected from:
halo- , hydroxy- , Ci-Cs-alkyl- , d-C -alkoxy- , halo-G -C3-alkoxy- ;
or
R7 and R8 together with the molecular fragment they are attached to represent a 4- to 6-membered heterocyclic ring, which is optionally substituted, one or more times, identically of differently, with a halogen atom, a G-C3-alkyl-, halo-G-Cralkyl- or G-C3-alkoxy- group;
Q1 represents a group selected from: N, CH, C-(CrC6-alkyl),
C-(G-C6-alkoxy), C-halo;
Q2 represents a group selected from: N, CH, CR b;
Q3 represents a group selected from: N, CH, CR b; n, m, p,
represent, independently from each other, an integer of 0, 1 , 2 or 3; q represents an integer of 1 , 2 or 3; and
t represents an integer of 0, 1 or 2; or a tautomer, an N -oxide, a hydrate, a solvate, or a salt thereof, or a mixture of same.
In a preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein RA1 represents -C(=0)N(H)R6. In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein RA1 represents -N(H)C(=0)R6.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein RA1 represents
Figure imgf000028_0001
wherein * indicates the point of attachment of said group with the rest of the molecule ;
wherein R9 represents a group selected from: Ci -C -alkyl-,
hydroxy-C-Cralkyl-, -N(H)R8; -N(R7)R8, N(H)(R8)-C,-Cralkyl-,
N(R7)(R8)-CrC;ralkyl- ;
wherein R10 represents a
Figure imgf000028_0002
group ; wherein * indicates the point of attachment of said group with the rest of the molecule ; wherein said group is optionally substituted, one or more times, identically or differently, with a halogen atom or a methyl- group.
In another preferred embodiment, R9 represents a group selected from: C1 -C3- alkyl-, hydroxy-CrC3-alkyl-, -N(H)R8, N(H)(R8)-Ci-Cralkyl-.
In another preferred embodiment, R9 represents a group selected from: C1 -C3- alkyl-, hydroxy-Ci-C;i-alkyl-, -N{R11)R11, -CrC2-alkyl-N(R11)R11 ; in which each R" indepedently represents a hydrogen atom or a methyl- group. In another preferred embodiment, R9 represents a group selected from: methyl-, hydroxy-C,-C2-alkyl-, -N(R11)R11, -CrC2-alkyl-N(R11)R11; in which each R11 indepedently represents a hydrogen atom or a methyl- group.
In another preferred embodiment, R9 represents a group selected from: methyl-, HO-CH2- , H2N-CH2-, -NH2. In another preferred embodiment, R9 represents a group selected from: methyl-, HO-CH2-, -NH2.
In another preferred embodiment, R9 represents a methyl- group. In another preferred embodiment, R9 represents a HO-CH2- group. In another preferred embodiment, R9 represents a -NH2 group. In another preferred embodiment, R10 represents a
Figure imgf000029_0001
group ; wherein * indicates the point of attachment of said group with the rest of the molecule.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein RA1 represents a group selected from:
I
Figure imgf000030_0001
wherein * indicates the point of attachment of said groups with the rest of the molecule.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein RA1 represents a group selected from:
Figure imgf000030_0002
wherein * indicates the point of attachment of said groups with the rest of the molecule.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein each RA2 independently represents halo- , G -Ce-alkyl-, G-C6-alkoxy-, -N(H)C(=0)R8 or
-C(=0)N(H)R8.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein each RA2 independently represents halo-, G -Ce-alkyl- or G -Ce-alkoxy-.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein each RA2 independently represents halo-, G -C i-alkyl- or G -G-alkoxy-.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein t represents 1 and RA2 represents halo-, G -Ce-alkyl- or G -C6-alkoxy-.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein t represents 1 and RA2 represents halo-, G-Cralkyl- or G -C -alkoxy-. In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein Q1 represents a group selected from: CH, C- (G -C6-alkyl), C- (G -C6-alkoxy), C-halo. Preferably, Q1 represents CH . In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein Q2 represents a group selected from: N, CH , C-R c; wherein R c is selected from the groups consisting of: halo-, cyano-, G-Ce-alkyl-, G-C6-alkoxy-, -N(H)C(=0)R7,
-N(R7)C(=0)R7, -C(=0)N(H)R8, -C(=0)NR8R7, R8-S(=0)-, R8-S(=0)2-,
-S(=0)(=NR7)R8. Preferably, Q2 represents CH.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein Q3 represents a group selected from: N, CH , C-R c, wherein R c is selected from the groups consisting of: halo-, cyano-, G-C6-alkyl-, G-Ce-alkoxy-, -N(H)C(=0)R7,
-N(R7)C(=0)R7, -C(=0)N(H)R8, -C(=0)NR8R7, R8-S(=0)-, R8-S(=0)2-,
-S(=0)(=NR7)R8. Preferably, Q3 represents CH or N. In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein Q1 and Q2 represent CH, and Q3 represents CH or N.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein Q1 and Q2 and Q3 represent CH.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R2 is selected from the group consisting of:
Figure imgf000033_0001
Figure imgf000033_0002
wherein * indicates the point of attachment of said groups with the rest of the molecule.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R3 represents a hydrogen atom, halo-, a hydroxy-, d-C^alkyl-, halo-CrC4-alkyl- or
C C4-alkoxy- group. Preferably, R3 represents a hydrogen atom.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R4 represents a hydrogen atom, halo-, a G -C6-alkyl-, halo-CrCe-alkyl- or CrCe-alkoxy- group.
Preferably, R4 represents a hydrogen atom. In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R3 and R4 represent a hydrogen atom. In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R5 represents a hydrogen atom or a methyl- group.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R5 represents a hydrogen atom.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R3 and R4 and R5 represent a hydrogen atom.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R a represents a group selected from: halo-, nitro-, G-Ce-alkyl-, halo-G-Ce-alkyl-, G-C6-alkoxy-, halo-CrC6-alkoxy-, hydroxy-Ci -C6-alkyl- , Ci-C6-alkoxy-CrC6-alkyl-,
halo-Ci-C6-alkoxy-Ci -C6-alkyl-, R8-(Ci-C6-alkoxy)-, R8-0-, NR8R7,
R8-S-, R8-5(=0)-, R8-S(=0)z-, (CrC6-cycloalkyl) - (CH2)n-0-.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R5a represents a group selected from: halo-, Ci-Ce-alkyl-, G-C6-alkoxy-, halo-Ci -C6-alkoxy-, hydroxy- G-Ce-alkyl-, G-Ce-alkoxy-CrCe-alkyl-, halo-CrC6-alkoxy-C C6-alkyl-, R8-(CrC6- alkoxy)-, R8-0-, R8-S-, R8-S(=0)2-, (CrC6-cycloalkyl)-(CH2)n-0-.
Preferably, R a is selected from: halo-, G-Ce-alkyl-, G-Ce-alkoxy-,
halo-G-Ce-alkoxy-, G-Ce-alkoxy-CrCe-alkyl-, (C3 -C6-cycloalkyl)-(CH2)n-0-. More preferably, R a is selected from: F-, methyl-, methoxy-, ethoxy-, n-propoxy-, iso-propoxy-, cyclopropyl-O-, cyclopropyl-CH2-0-, CH3-O-CH2CH2- 0-, CHF2-O-, CF3-O-, CF3CH2-O-. In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R5a represents a G -Ce- alkoxy- group.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R5a represents a G -C3- alkoxy- group.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R a represents a halo-G -C6- alkoxy- group.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R a represents a halo-G -Cr alkoxy- group.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R a represents a group selected from: G-C3-alkoxy-, halo-G -G-alkoxy-, Ci -Cs-alkyl-. In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R a represents a group selected from: G-C2-alkoxy-, halo-G -C2-alkoxy-, G -C2-alkyl-. In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein 5a represents a group selected from: G -G-alkoxy-, halo-G-Cralkoxy-. In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R5a represents a group selected from: G -C2-alkoxy-, halo-G-G-alkoxy-.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R a represents a methoxy- or ethoxy- group which is optionally substituted, one or more times, identically or differently, with a halogen atom. The preferred halogen atom is F.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R a represents a group selected from: methoxy-, ethoxy-, F3C-CH2-O-.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R a represents a group selected from: methoxy-, F3C-CH2-O-.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R b represents a group selected from: halo-, hydroxy-, cyano-, nitro-, G -C6-alkyl-, halo-G -C6-alkyl-, G -C6-alkoxy-, halo-G -Ce-alkoxy-, hydroxy-G -Ce-alkyl-,
G -C6-alkoxy-G -C6-alkyl-, halo-CrC6-alkoxy-G -C6-alkyl-,
R8- (Ci-C6-alkyl)-, R8-(CH2)n(CHOH)(CH2)m-, R8- (G-C6-alkoxy)-,
R8-(CH2)n(CHOH)(CH2)P-0-, R8-(C, -C6-alkoxy-CrC6-alkyl)-,
R8- (Ci -C6-alkoxy-Ci -C6-alkyl)-0-, -0-(CH2)n-C(=0)NR8R7, R8-0-,
-C(=0)R8, -C(=0)0-R8, -OC(=0)-R8, -N(H)C(=0)R8, -N(R7)C(=0)R8, -N(R7)C(=0)OR8, -N(H)C(=0)NR8R7, -N(R7)C(=0)NR8R7, -NR8R7, -NR7R7,
-C(=0)N(H)R8, -C(=0)NR8R7, R8-S-, R8-S(=0)-, R8-5(=0)2-, R7-S(=0)2-,
-N(H)S(=0)R8, -N(R7)S(=0)R8, -S(=0)N(H)R8, -S(=0)NR8R7, -N(H)S(=0)2R8,
-N(R7)S(=0)2R8, -S(=0)2N(H)R8, -S(=0)2NR8R7, -S(=0)(=NR8)R7,
-S(=0)(=NR7)R8, -N=S(=0)(R8)R7.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R b represents a group selected from: halo-, cyano-, nitro-, G -Ce-alkyl-, halo-CrC6-alkyl-,
hydroxy-Ci -C6-alkyl-, C C6-alkoxy-, halo-G-Ce-alkoxy-, R8-0-, -C(=0)R8, -C(=0)0-R8, -N(H)C(=0)R8, -N(R7)C(=0)R8, -N(R7)C(=0)OR8, -N(H)5(=0)2R8, NR8R7, NR7R7, -C(=0)N(H)R8, -C(=0)NR8R7, R8-S(=0)-, R8-S(=0)2-,
R7-5(=0)2-, -S(=0)(=NR7)R8.
Preferably, R b is selected from: halo-, cyano-, NR7R7, G-Ce-alkoxy-, -N(H)C{=0)R8,-N(R7)C(=0)R8, -N(R7)C(=0)OR8, -C(=0)N(H)R8, -C(=0)NR8R7, R8-S(=0)-, R8-5(=0)r, R7-S(=0)2-, -S(=0)(=NR7)R8, hydroxy-C,-C6-alkyl-,
-N(H)S(=0)2R8.
More preferably, R b is selected from: fluoro-, cyano-, methoxy-, -CH2-OH, -C(OH)(CH3)2, -N(CH3)2, -C(=0)NH2, -C(=0)N(CH3)2, -C(=0)N(C2H5)2,
Figure imgf000037_0001
-C(=0)NH(CH2CH2OH), -C(=0)NH(CH2CH2F), -C(=0)NH(CH2CH2OCH3),
-C(=0)NH(CH2CH2OCH2CH3), -C(=0)NH(C(CH3)2CH2OH),
-C(=0)NH(CH2C(CH3)2OH), -C(=0)NH(CH2CF3), -S(=0)CH3, (CH )S(=0)2-, C2H5)5(=0)2-, -N(H)C(=0)CH3,
Figure imgf000037_0002
Figure imgf000038_0001
Figure imgf000038_0002
wherein * indicates the point of attachment of said group with the rest of the molecule.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R5b represents a group selected from: -C(=0)N(H)R8, -C(=0)NR8R7, R8-S(=0)-, R8-S(=0)2-,
-5(=0)(=NR7)R8.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R b represents a
-C(=0)N(H)R8 group. In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R b represents a -C(=0)NR8R7 group.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R5b represents a R8-S(=0)- group. In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R b represents a
Figure imgf000039_0001
group.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R b represents a
-S(=0)(=NR7)R8 group.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R b represents a
-C(=0)N(H)R7 group.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R b represents a
Figure imgf000039_0002
group.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R b represents
Figure imgf000039_0003
in which R7 represents a d-Cralkyl- group. In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R b represents a
Figure imgf000040_0001
group; in which R7 represents a methyl- group. In another preferred embodiment, compound A is selected from the group of compounds of general formula (I) , supra, wherein R b represents
-C(=0)N(H)R8; in which R8 represents a hydrogen atom or a G -C ralkyl- or Cr C6-cycloalkyl- group, wherein said d -Cralkyl- or CrCe-cycloalkyl- group is optionally substituted, one or more times, with a halogen atom. The preferred halogen atom is F.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I) , supra, wherein R b represents
-C(=0)N(H)R8; in which R8 represents a hydrogen atom or a Ci -Cj-alkyl- group, wherein said G -Cralkyl- group is optionally substituted, one or more times, with a halogen atom. The preferred halogen atom is F.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I) , supra, wherein R b represents
-C(=0)N(H)R8; in which R8 represents a group selected from: -CH3, -CF3, -C2H5,
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I) , supra, wherein R b represents
-C(=0)NR8R7; in which R7 and R8 together with the N atom they are attached to represent a 4- to 6-memberered heterocyclic ring, which is optionally substituted, one or more times, identically or differently, with a halogen atom, a G -Cralkyl- or a halo-G -Gj-alkyl- group. In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R b represents
-C(=0)NR8R7; in which R7 and R8 together with the N atom they are attached to represent a 4-memberered heterocyclic ring, which is optionally substituted, one or more times, identically or differently, with a halogen atom, a C1 -C3- alkyl- or a halo-d-Cralkyl- group.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R b represents
-C(=0)NR8R7; in which R7 and R8 together with the N atom they are attached to represent a 4- to 6-memberered heterocyclic ring, which is optionally substituted, one or more times, identically or differently, with a halogen atom. In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R b represents
-C(=0)NR8R7; in which R7 and R8 together with the N atom they are attached to represent a 4-memberered heterocyclic ring, which is optionally substituted, one or more times, with a fluorine atom.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R b represents
-N(R7)C(=0)OR8; in which R7 and R8 together with the molecular fragment they are attached to represent a 4- to 6-memberered heterocyclic ring, which is optionally substituted, one or more times, identically or differently, with a halogen atom, a C -Cs-aLkyi- or a halo-G-Cs-alkyl- group.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R5b represents -N(R7)C(=0)OR8; in which R7 and R8 together with the molecular fragment they are attached to represent a 5-memberered heterocyclic ring, which is optionally substituted, one or more times, identically or differently, with a halogen atom, a G-C ralkyl- or a halo-G-C 3-alkyl- group.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R b represents
-N(R7)C(=0)OR8; in which R7 and R8 together with the molecular fragment they are attached to represent a 5-memberered heterocyclic ring.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R b is selected from: H C-
Figure imgf000042_0001
wherein * indicates the point of attachment of said groups with the rest of the molecule.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R6 represents a group selected from: CrC6-cycloalkyl-, 3- to 10-membered heterocycloalkyl-, aryl-, heteroaryl-, -(CH2)q- (C3-C6-cycloalkyl), -(CH2)q-(3- to 10-membered heterocycloalkyl), -(CH2)q-aryl, or -(Chhjq-heteroaryl;
wherein said group is optionally substituted, one or more times, identically or differently, with a substituent selected from:
halo-, CrC6-alkyl-, halo-G-C6-alkyl-, halo-Ci -C6-alkoxy-. In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R6 represents a group selected from: -CH2-(CrC6-cycloalkyl) or -CH2-aryl; wherein said group is optionally substituted, one or more times, identically or differently, with a substituent selected from: halo-, G-Ce-alkyl-, halo-G-Ce-alkyl-, halo-G-Ce- alkoxy-. The C rC6-cycloalkyl- group preferably is a cyclopropyl- group; the aryl- group is preferably a phenyl- group.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R6 represents a group selected from: -(CH2)-phenyl, -(CH2)-cyclopropyl;
wherein said group is optionally substituted, one or more times, identically or differently, with a substituent selected from: halo-, G -C6-alkyl-. In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R7 represents a hydrogen atom or a G-C6-alkyl- group.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R7 represents a G-C3-alkyl- group.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R7 represents a methyl- group.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R7 represents a hydrogen atom, or a CrC6-cycloalkyl- group. In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R8 represents a hydrogen atom or a G-C6-alkyl- group, wherein said G-Ce-alkyl-group is optionally substituted, one or more times, identically or differently, with a substituent selected from:
halo-, hydroxy-, -NHR7, -NR7R7, -N(C,-C -alkyl)-C(=0)R7,
Figure imgf000044_0001
Ci -C3-alkoxy-,
halo-G-C3-alkoxy-. In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R8 represents a hydrogen atom or CrCe-cycloalkyl- group, wherein said CrC6-cycloalkyl- group is optionally substituted, one or more times, identically or differently, with a substituent selected from:
halo-, hydroxy-, -NHR7, -NR7R7, -N(C,-C3-alkyl)-C(=0)R7,
-N(C,-C3-alkyl)-C(=0)OR7, Ci-C3-alkyl-, R7-5(=0)2-, C,-C3-alkoxy-, halo-C,-C3- alkoxy-.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R8 represents a hydrogen atom or a G-Ce-alkyl- group, wherein said CrC6-alkyl-group is optionally substituted, one or more times, identically or differently, with a substituent selected from:
halo-, Ci-C3-alkyl-,
Figure imgf000044_0002
G-C3-alkoxy-, halo-C C3-alkoxy-.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R8 represents a hydrogen atom or C -C6-cycloalkyl- group, wherein said CrCe-cycloalkyl- group is optionally substituted, one or more times, identically or differently, with a substituent selected from: halo-, G-C3-alkyl-,
Figure imgf000045_0001
G-C3-alkoxy-, halo-G-C3-alkoxy-.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R8 represents a hydrogen atom or a G-Ce-alkyl- group, wherein said G-C6-alkyl-group is optionally substituted with a halogen atom.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R8 represents a hydrogen atom or a G-Cralkyl- group, wherein said G-Cralkyl- group is optionally substituted, one or more times, with a halogen atom.
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein R7 and R8 together with the molecular fragment they are attached to represent a 4- to 6-membered heterocyclic ring, which is optionally substituted, one or more times, identically of differently, with a halogen atom, a G-C -alkyl-, halo-G-C3-alkyl- or Ci-C3-alkoxy- group. In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein n represents an integer of 0, 1 or 2. Preferably, n represent 0 or 1 .
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein q represents an integer of 0, 1 or 2. Preferably, q represents 1 or 2. More preferably, q = 1 .
In another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein t represents an integer of 0 or 1 . Preferably, t = 0. As one of ordinary skill in the art knows, the molecular weight of a compound very often has an influence on the bioavailability; see e.g. Lipinski ¾ s Rule of five (Lipinski, C.A. ; Lombardo, F.; Dominy, B.W.; Feeney, P.J. ; Adv. Drug Deliver. Rev. 1997, 23, 3). As experimentally proven there is no clear cutoff at a molecular weight of 500 separating compounds with poor bioavailability from those with acceptable values - however, it is proven that higher bioavailability is indeed associated with lower molecular weight (see e.g. Veber et al.,J. Med. Chem. 2002, 45, 261 5-2623). Therefore, in another preferred embodiment, compound A is selected from the group of compounds of general formula (I), supra, wherein the molecular weight is less than 655. In another preferred embodiment, the molecular weight of the compound of formula (I), supra, is less than 630, more preferably less than 600, most preferably less than 590.
It is to be understood that the present invention relates also to any combination of the preferred embodiments of compound A described above. In a another preferred embodiment compound A is selected from the compounds A of the present invention specified in the Experimental Section.
The synergistic behavior of a combination of the present invention is demonstrated herein with distinct siRNAs that deplete one of the three anti- apoptotic multidomain proteins of the Bcl-2 family (Bcl-2, Bcl-XL, Mcl-1 ). This makes it evident, that principiaily any inhibitors of anti-apoptotic proteins of the Bcl-2 family can be used in a combination of the present invention.
So, compound B can be selected from inhibitors of an anti-apoptotic protein of the Bcl-2 family specifically or generically disclosed e.g. in the following publications which are incorporated herein by reference: US 8, 188,077 B2; C. Bodur and H. Basaga, Bcl-2 Inhibitors: Emerging Drugs in Cancer Therapy, Current Medicinal Chemistry, 2012, 19, 1804-1820; Mohammad, R. M., et al. Preclinical studies of TW-37, a new nonpeptidic small-molecule inhibitor of Bcl-2, in diffuse large cell lymphoma xenograft model reveal drug action on both Bcl-2 and Mcl- 1 . Clin. Cancer Res. 13, 2226-2235, 2007.
Compound B can be selected from the group of compounds consisting of:
B717/LIC-101 complex (Nippon Shinyaku Co. Ltd.), bcl-2 inhibiting siRNA/LIC- 24 liposome complex (Nippon Shinyaku Co. Ltd. ), beclanorsen (Santaris Pharma A/S), VMD-8018 (VM Discovery Inc.), oblimersen (Genta Inc.), apogossypol (Sanford-Burnham Medical Research Institute), 1 133719 (Kirin Brewery Co. Ltd.), PNT-100 (ProNAi Therapeutics Inc.), HG-1 1 13 (Human Genome Sciences Inc.), S-44563 (Servier), ABT-731 (Abbott Laboratories), modified HA14-1 compounds (GL Pharmaceutical Inc.), ONT-701 (Sanford- Burnham Medical Research Institute), gossypol derivatives (INSERM), BP-100- 1 .02 (Bio-Path Holdings Inc.), obatociax (Gemin X Pharmaceuticals Inc.), navitoclax (Abbott Laboratories), AT- 101 (University of Michigan). Preferably, compound B is selected from the group consisting of: Obatociax (GX-1 5-070), Navitoclax (ABT-263), TW-37, B717/LIC-101 complex, beclanorsen, VMD-8018, oblimersen, apogossypol, 1 133719, PNT-100, HG- 1 1 13, S-44563, ABT-731 , ONT-701 , BP-100- 1 .02, AT- 101 . In accordance with an embodiment, the present invention relates to a combination of any component A mentioned herein with any component B mentioned herein, optionally with any component C mentioned herein. In a particular embodiment, the present invention relates to a combination of a component A with a component B, optionally with a component C, as mentioned in the Examples Section herein. Further, the present invention relates to : a kit comprising :
- a combination of : component A : one or more Mps-1 kinase inhibitors, or a physiologically acceptable salt, solvate, hydrate or stereoisomer thereof ; component B : one or more inhibitors of an anti-apoptotic protein from the Bcl-2 family, or a physiologically acceptable salt, solvate, hydrate or stereoisomer thereof ; and, optionally, component C : one or more further pharmaceutical agents ; in which optionally either or both of said components A and B in any of the above-mentioned combinations are in the form of a pharmaceutical formulation which is ready for use to be administered simultaneously, concurrently, separately or sequentially. The components may be administered independnently of one another by the oral, intravenous, topical, local installations, intraperitoneal or nasal route.
Either or both of components A and B of any of the combinations of the present invention may be in a useful form, such as pharmaceutically acceptable salts, co-precipitates, metabolites, hydrates, solvates and prodrugs of all the compounds of examples. The term "pharmaceutically acceptable salt" refers to a relatively non-toxic, inorganic or organic acid addition salt of a compound of the present invention. For example, see S. M. Berge, et al. "Pharmaceutical Salts, " J. Pharm. Sci. 1977, 66, 1 -19. Pharmaceutically acceptable salts include those obtained by reacting the main compound, functioning as a base, with an inorganic or organic acid to form a salt, for example, salts of hydrochloric acid, sulfuric acid, phosphoric acid, methane sulfonic acid, camphor sulfonic acid, oxalic acid, maleic acid, succinic acid and citric acid. Pharmaceutically acceptable salts also include those in which the main compound functions as an acid and is reacted with an appropriate base to form, e.g. , sodium, potassium, calcium, magnesium, ammonium, and chorine salts. Those skilled in the art will further recognize that acid addition salts of the claimed compounds may be prepared by reaction of the compounds with the appropriate inorganic or organic acid via any of a number of known methods. Alternatively, alkali and alkaline earth metal salts of acidic compounds of the invention are prepared by reacting the compounds of the invention with the appropriate base via a variety of known methods. Representative salts of the compounds of this invention include the conventional non-toxic salts and the quaternary ammonium salts which are formed, for example, from inorganic or organic acids or bases by means well known in the art. For example, such acid addition salts include acetate, adipate, alginate, ascorbate, aspartate, benzoate, benzenesulfonate, bisulfate, butyrate, citrate, camphorate, camphorsulfonate, cinnamate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, fumarate, glucoheptanoate, glycerophosphate, hemisulfate, heptanoate, hexanoate, chloride, bromide, iodide, 2-hydroxyethanesulfonate, itaconate, lactate, maleate, mandelate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oxalate, pamoate, pectinate, persulfate, 3- phenylpropionate, picrate, pivalate, propionate, succinate, sulfonate, sulfate, tartrate, thiocyanate, tosylate, and undecanoate.
Base salts include alkali metal salts such as potassium and sodium salts, alkaline earth metal salts such as calcium and magnesium salts, and ammonium salts with organic bases such as dicyclohexylamine and N-methyl- D-glucamine. Additionally, basic nitrogen containing groups may be quaternized with such agents as lower alkyl halides such as methyl, ethyl, propyl, or butyl chlorides, bromides and iodides; dialkyl sulfates like dimethyl, diethyl, dibutyl sulfate, or diamyl sulfates, long chain halides such as decyl, lauryl, myristyl and strearyl chlorides, bromides and iodides, aralkyl halides like benzyl and phenethyl bromides and others.
A solvate for the purpose of this invention is a complex of a solvent and a compound of the invention in the solid state. Exemplary solvates would include, but are not limited to, complexes of a compound of the invention with ethanol or methanol. Hydrates are a specific form of solvate wherein the solvent is water. Compositions of this invention may be tableted with conventional tablet bases such as lactose, sucrose and cornstarch in combination with binders such as acacia, corn starch or gelatin, disintegrating agents intended to assist the break-up and dissolution of the tablet following administration such as potato starch, alginic acid, corn starch, and guar gum, gum tragacanth, acacia, lubricants intended to improve the flow of tablet granulation and to prevent the adhesion of tablet material to the surfaces of the tablet dies and punches, for example talc, stearic acid, or magnesium, calcium or zinc stearate, dyes, coloring agents, and flavoring agents such as peppermint, oil of wintergreen, or cherry flavoring, intended to enhance the aesthetic qualities of the tablets and make them more acceptable to the patient. Suitable excipients for use in oral liquid dosage forms include dicalcium phosphate and diluents such as water and alcohols, for example, ethanol, benzyl alcohol, and polyethylene alcohols, either with or without the addition of a pharmaceutically acceptable surfactant, suspending agent or emulsifying agent. Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. For instance tablets, pills or capsules may be coated with shellac, sugar or both.
Dispersible powders and granules are suitable for the preparation of an aqueous suspension. They provide the active ingredient in admixture with a dispersing or wetting agent, a suspending agent and one or more preservatives. Suitable dispersing or wetting agents and suspending agents are exemplified by those already mentioned above. Additional excipients, for example those sweetening, flavoring and coloring agents described above, may also be present.
The pharmaceutical compositions of this invention may also be in the form of oil-in-water emulsions. The oily phase may be a vegetable oil such as liquid paraffin or a mixture of vegetable oils. Suitable emulsifying agents may be (1 ) naturally occurring gums such as gum acacia and gum tragacanth, (2) naturally occurring phosphatides such as soy bean and lecithin, (3) esters or partial esters derived form fatty acids and hexitol anhydrides, for example, sorbitan monooleate, (4) condensation products of said partial esters with ethylene oxide, for example, polyoxyethylene sorbitan monooleate. The emulsions may also contain sweetening and flavoring agents.
Oily suspensions may be formulated by suspending the active ingredient in a vegetable oil such as, for example, arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin. The oily suspensions may contain a thickening agent such as, for example, beeswax, hard paraffin, or cetyl alcohol. The suspensions may also contain one or more preservatives, for example, ethyl or n-propyl p- hydroxybenzoate ; one or more coloring agents; one or more flavoring agents; and one or more sweetening agents such as sucrose or saccharin.
Syrups and elixirs may be formulated with sweetening agents such as, for example, glycerol, propylene glycol, sorbitol or sucrose. Such formulations may also contain a demulcent, and preservative, such as methyl and propyl parabens and flavoring and coloring agents.
The combinations of this invention may also be administered parenterally, that is, subcutaneously, intravenously, intraocularly, intrasynovially, intramuscularly, or interperitoneally, as injectable dosages of the compound in preferably a physiologically acceptable diluent with a pharmaceutical carrier which can be a sterile liquid or mixture of liquids such as water, saline, aqueous dextrose and related sugar solutions, an alcohol such as ethanol, isopropanol, or hexadecyl alcohol, glycols such as propylene glycol or polyethylene glycol, glycerol ketals such as 2,2-dimethyl-1 ,1 -dioxolane-4- methanol, ethers such as polyethylene glycol) 400, an oil, a fatty acid, a fatty acid ester or, a fatty acid glyceride, or an acetylated fatty acid glyceride, with or without the addition of a pharmaceutically acceptable surfactant such as a soap or a detergent, suspending agent such as pectin, carbomers, methycellulose, hydroxypropylmethylcellulose, or carboxymethylcellulose, or emulsifying agent and other pharmaceutical adjuvants.
Illustrative of oils which can be used in the parenteral formulations of this invention are those of petroleum, animal, vegetable, or synthetic origin, for example, peanut oil, soybean oil, sesame oil, cottonseed oil, corn oil, olive oil, petrolatum and mineral oil. Suitable fatty acids include oleic acid, stearic acid, isostearic acid and myristic acid. Suitable fatty acid esters are, for example, ethyl oleate and isopropyl myristate. Suitable soaps include fatty acid alkali metal, ammonium, and triethanolamine salts and suitable detergents include cationic detergents, for example dimethyl dialkyl ammonium halides, a Iky I pyridinium halides, and alkylamine acetates; anionic detergents, for example, alkyl, aryl, and olefin sulfonates, alkyl, olefin, ether, and monogiyceride sulfates, and sulfosuccinates; non-ionic detergents, for example, fatty amine oxides, fatty acid alkanolamides, and poly(oxyethylene- oxypropylene)s or ethylene oxide or propylene oxide copolymers; and amphoteric detergents, for example, alkyl-beta-aminopropionates, and 2- alkylimidazoline quaternary ammonium salts, as well as mixtures.
The parenteral compositions of this invention will typically contain from about 0.5% to about 25% by weight of the active ingredient in solution. Preservatives and buffers may also be used advantageously. In order to minimize or eliminate irritation at the site of injection, such compositions may contain a non-ionic surfactant having a hydrophile-lipophile balance (HLB) preferably of from about 12 to about 17. The quantity of surfactant in such formulation preferably ranges from about 5% to about 15% by weight. The surfactant can be a single component having the above HLB or can be a mixture of two or more components having the desired HLB.
Illustrative of surfactants used in parenteral formulations are the class of polyethylene sorbitan fatty acid esters, for example, sorbitan monooleate and the high molecular weight adducts of ethylene oxide with a hydrophobic base, formed by the condensation of propylene oxide with propylene glycol.
The pharmaceutical compositions may be in the form of sterile injectable aqueous suspensions. Such suspensions may be formulated according to known methods using suitable dispersing or wetting agents and suspending agents such as, for example, sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethyl-cellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia; dispersing or wetting agents which may be a naturally occurring phosphatide such as lecithin, a condensation product of an alkylene oxide with a fatty acid, for example, polyoxyethylene stearate, a condensation product of ethylene oxide with a long chain aliphatic alcohol, for example, heptadeca-ethyleneoxycetanol, a condensation product of ethylene oxide with a partial ester derived form a fatty acid and a hexitol such as polyoxyethylene sorbitol monooleate, or a condensation product of an ethylene oxide with a partial ester derived from a fatty acid and a hexitol anhydride, for example polyoxyethylene sorbitan monooleate.
The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent. Diluents and solvents that may be employed are, for example, water, Ringer's solution, isotonic sodium chloride solutions and isotonic glucose solutions. In addition, sterile fixed oils are conventionally employed as solvents or suspending media. For this purpose, any bland, fixed oil may be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid can be used in the preparation of injectables.
A composition of the invention may also be administered in the form of suppositories for rectal administration of the drug. These compositions can be prepared by mixing the drug with a suitable non-irritation excipient which is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug. Such materials are, for example, cocoa butter and polyethylene glycol.
Another formulation employed in the methods of the present invention employs transdermal delivery devices ("patches"). Such transdermal patches may be used to provide continuous or discontinuous infusion of the compounds of the present invention in controlled amounts. The construction and use of transdermal patches for the delivery of pharmaceutical agents is well known in the art (see, e.g., US Patent No. 5,023,252, issued June 1 1 , 1991 , incorporated herein by reference). Such patches may be constructed for continuous, pulsatile, or on demand delivery of pharmaceutical agents.
Controlled release formulations for parenteral administration include liposomal, polymeric microsphere and polymeric gel formulations that are known in the art.
It may be desirable or necessary to introduce the pharmaceutical composition to the patient via a mechanical delivery device. The construction and use of mechanical delivery devices for the delivery of pharmaceutical agents is well known in the art. Direct techniques for, for example, administering a drug directly to the brain usually involve placement of a drug delivery catheter into the patient's ventricular system to bypass the blood-brain barrier. One such implantable delivery system, used for the transport of agents to specific anatomical regions of the body, is described in US Patent No. 5,01 1 ,472, issued April 30, 1991 .
The compositions of the invention can also contain other conventional pharmaceutically acceptable compounding ingredients, generally referred to as carriers or diluents, as necessary or desired. Conventional procedures for preparing such compositions in appropriate dosage forms can be utilized. Such ingredients and procedures include those described in the following references, each of which is incorporated herein by reference: Powell, M.F. et al, "Compendium of Excipients for Parenteral Formulations" PDA Journal of Pharmaceutical Science ft Technology 1998, 52(5), 238-31 1 ; Strickley, R.G "Parenteral Formulations of Small Molecule Therapeutics Marketed in the United States (1999)-Part-1 " PDA Journal of Pharmaceutical Science & Technology 1999, 53(6), 324-349; and Nema, S. et al, "Excipients and Their Use in Injectable Products" PDA Journal of Pharmaceutical Science Et Technology 1997, 51 (4), 166-171 . Commonly used pharmaceutical ingredients that can be used as appropriate to formulate the composition for its intended route of administration include: acidifying agents (examples include but are not limited to acetic acid, citric acid, fumaric acid, hydrochloric acid, nitric acid); alkalinizing agents (examples include but are not limited to ammonia solution, ammonium carbonate, diethanolamine, monoethanolamine, potassium hydroxide, sodium borate, sodium carbonate, sodium hydroxide, triethanolamine, trolamine); adsorbents (examples include but are not limited to powdered cellulose and activated charcoal); aerosol propellants (examples include but are not limited to carbon dioxide, CC Fz, F2CIC-CCIF2 and CCIF3) air displacement agents (examples include but are not limited to nitrogen and argon); antifungal preservatives (examples include but are not limited to benzoic acid, butylparaben, ethylparaben, methylparaben, propylparaben, sodium benzoate); antimicrobial preservatives (examples include but are not limited to benzalkonium chloride, benzethonium chloride, benzyl alcohol, cetylpyridinium chloride, chlorobutanol, phenol, phenylethyl alcohol, phenylmercuric nitrate and thimerosal); antioxidants (examples include but are not limited to ascorbic acid, ascorbyl palmitate, butylated hydroxyanisole, butylated hydroxytoluene, hypophosphorus acid, monothioglycerol, propyl gallate, sodium ascorbate, sodium bisulfite, sodium formaldehyde sulfoxylate, sodium metabisulfite); binding materials (examples include but are not limited to block polymers, natural and synthetic rubber, polyacrylates, polyurethanes, silicones, polysiloxanes and styrene-butadiene copolymers); buffering agents (examples include but are not limited to potassium metaphosphate, dipotassium phosphate, sodium acetate, sodium citrate anhydrous and sodium citrate dihydrate) carrying agents (examples include but are not limited to acacia syrup, aromatic syrup, aromatic elixir, cherry syrup, cocoa syrup, orange syrup, syrup, corn oil, mineral oil, peanut oil, sesame oil, bacteriostatic sodium chloride injection and bacteriostatic water for injection) chelating agents (examples include but are not limited to edetate disodium and edetic acid) colorants (examples include but are not limited to FD&C Red No. 3, FD&C Red No. 20, FD&C Yellow No. 6, FD&C Blue No. 2, D&C Green No. 5, D&C Orange No. 5, D&C Red No. 8, caramel and ferric oxide red); clarifying agents (examples include but are not limited to bentonite); emulsifying agents (examples include but are not limited to acacia, cetomacrogol, cetyl alcohol, glyceryl monostearate, lecithin, sorbitan monooleate, polyoxyethylene 50 monostearate); encapsulating agents (examples include but are not limited to gelatin and cellulose acetate phthalate) flavorants (examples include but are not limited to anise oil, cinnamon oil, cocoa, menthol, orange oil, peppermint oil and vanillin); humectants (examples include but are not limited to glycerol, propylene glycol and sorbitol); levigating agents (examples include but are not limited to mineral oil and glycerin); oils (examples include but are not limited to arachis oil, mineral oil, olive oil, peanut oil, sesame oil and vegetable oil);
ointment bases (examples include but are not limited to lanolin, hydrophilic ointment, polyethylene glycol ointment, petrolatum, hydrophilic petrolatum, white ointment, yellow ointment, and rose water ointment); penetration enhancers (transdermal delivery) (examples include but are not limited to monohydroxy or polyhydroxy alcohols, mono-or polyvalent alcohols, saturated or unsaturated fatty alcohols, saturated or unsaturated fatty esters, saturated or unsaturated dicarboxylic acids, essential oils, phosphatidyl derivatives, cephalin, terpenes, amides, ethers, ketones and ureas) plasticizers (examples include but are not limited to diethyl phthalate and glycerol); solvents (examples include but are not limited to ethanol, corn oil, cottonseed oil, glycerol, isopropanol, mineral oil, oleic acid, peanut oil, purified water, water for injection, sterile water for injection and sterile water for irrigation); stiffening agents (examples include but are not limited to cetyl alcohol, cetyl esters wax, microcrystalline wax, paraffin, stearyl alcohol, white wax and yellow wax); suppository bases (examples include but are not limited to cocoa butter and polyethylene glycols (mixtures)); surfactants (examples include but are not limited to benzalkonium chloride, nonoxynol 10, oxtoxynol 9, polysorbate 80, sodium lauryl sulfate and sorbitan mono-palmitate); suspending agents (examples include but are not limited to agar, bentonite, carbomers, carboxymethylcellulose sodium, hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methylcellulose, kaolin, methylcellulose, tragacanth and veegum); sweetening agents (examples include but are not limited to aspartame, dextrose, glycerol, mannitol, propylene glycol, saccharin sodium, sorbitol and sucrose); tablet anti-adherents (examples include but are not limited to magnesium stearate and talc); tablet binders (examples include but are not limited to acacia, alginic acid, carboxymethylcellulose sodium, compressible sugar, ethylcellulose, gelatin, liquid glucose, methylcellulose, non-crosslinked polyvinyl pyrrolidone, and pregelatinized starch); tablet and capsule diluents (examples include but are not limited to dibasic calcium phosphate, kaolin, lactose, mannitol, microcrystalline cellulose, powdered cellulose, precipitated calcium carbonate, sodium carbonate, sodium phosphate, sorbitol and starch); tablet coating agents (examples include but are not limited to liquid glucose, hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methylcellulose, methylcellulose, ethylcellulose, cellulose acetate phthalate and shellac); tablet direct compression excipients (examples include but are not limited to dibasic calcium phosphate); tablet disintegrants (examples include but are not limited to alginic acid, carboxymethylcellulose calcium, microcrystalline cellulose, polacrillin potassium, cross -linked polyvinylpyrrolidone, sodium alginate, sodium starch glycollate and starch); tablet glidants (examples include but are not limited to colloidal silica, corn starch and talc); tablet lubricants (examples include but are not limited to calcium stearate, magnesium stearate, mineral oil, stearic acid and zinc stearate); tablet/capsule opaquants (examples include but are not limited to titanium dioxide); tablet polishing agents (examples include but are not limited to carnuba wax and white wax); thickening agents (examples include but are not limited to beeswax, cetyl alcohol and paraffin); tonicity agents (examples include but are not limited to dextrose and sodium chloride); viscosity increasing agents (examples include but are not limited to alginic acid, bentonite, carbomers, carboxymethylcellulose sodium, methylcellulose, polyvinyl pyrrolidone, sodium alginate and tragacanth); and wetting agents (examples include but are not limited to heptadecaethylene oxycetanol, lecithins, sorbitol monooleate, polyoxyethylene sorbitol monooleate, and polyoxyethylene stearate).
Pharmaceutical compositions according to the present invention can be illustrated as follows:
Sterile IV Solution: A 5 mg/mL solution of the desired compound of this invention can be made using sterile, injectable water, and the pH is adjusted if necessary. The solution is diluted for administration to 1 2 mg/mL with sterile 5% dextrose and is administered as an IV infusion over about 60 minutes. Lyophilized powder for IV administration: A sterile preparation can be prepared with (i) 100 - 1000 mg of the desired compound of this invention as a lypholized powder, (ii) 32- 327 mg/mL sodium citrate, and (iii) 300 - 3000 mg Dextran 40. The formulation is reconstituted with sterile, injectable saline or dextrose 5% to a concentration of 10 to 20 mg/mL, which is further diluted with saline or dextrose 5% to 0.2 - 0.4 mg/mL, and is administered either IV bolus or by IV infusion over 1 5 60 minutes.
Intramuscular suspension: The following solution or suspension can be prepared, for intramuscular injection:
50 mg/mL of the desired, water-insoluble compound of this invention
5 mg/mL sodium carboxymethylcellulose
4 mg/mL TWEEN 80
9 mg/mL sodium chloride
9 mg/mL benzyl alcohol
Hard Shell Capsules: A large number of unit capsules are prepared by filling standard two-piece hard galantine capsules each with 100 mg of powdered active ingredient, 1 50 mg of lactose, 50 mg of cellulose and 6 mg of magnesium stearate.
Soft Gelatin Capsules: A mixture of active ingredient in a digestible oil such as soybean oil, cottonseed oil or olive oil is prepared and injected by means of a positive displacement pump into molten gelatin to form soft gelatin capsules containing 100 mg of the active ingredient. The capsules are washed and dried. The active ingredient can be dissolved in a mixture of polyethylene glycol, glycerin and sorbitol to prepare a water miscible medicine mix.
Tablets: A large number of tablets are prepared by conventional procedures so that the dosage unit is 100 mg of active ingredient, 0.2 mg. of colloidal silicon dioxide, 5 mg of magnesium stearate, 275 mg of microcrystalline cellulose, 1 1 mg. of starch, and 98.8 mg of lactose. Appropriate aqueous and non-aqueous coatings may be applied to increase palatability, improve elegance and stability or delay absorption.
Immediate Release Tablets/Capsules: These are solid oral dosage forms made by conventional and novel processes. These units are taken orally without water for immediate dissolution and delivery of the medication. The active ingredient is mixed in a liquid containing ingredient such as sugar, gelatin, pectin and sweeteners. These liquids are solidified into solid tablets or caplets by freeze drying and solid state extraction techniques. The drug compounds may be compressed with viscoelastic and thermoelastic sugars and polymers or effervescent components to produce porous matrices intended for immediate release, without the need of water.
The combinations of the present invention may be used for the treatment or prophylaxis of diseases of uncontrolled cell growth, proliferation and/or survival, inappropriate cellular immune responses, or inappropriate cellular inflammatory responses, or diseases which are accompanied with uncontrolled cell growth, proliferation and/or survival, inappropriate cellular immune responses, or inappropriate cellular inflammatory responses, particularly in which the uncontrolled cell growth, proliferation and/or survival, inappropriate cellular immune responses, or inappropriate cellular inflammatory responses, such as, for example, haematological tumours, solid tumours, and/or metastases thereof, e.g. leukaemias and myelodysplastic syndrome, malignant lymphomas, head and neck tumours including brain tumours and brain metastases, tumours of the thorax including non-small cell and small cell lung tumours, gastrointestinal tumours, endocrine tumours, mammary and other gynaecological tumours, urological tumours including renal, bladder and prostate tumours, skin tumours, and sarcomas, and/or metastases thereof.
The term "inappropriate" within the context of the present invention, in particular in the context of "inappropriate cellular immune responses, or inappropriate cellular inflammatory responses", as used herein, is to be understood as preferably meaning a response which is less than, or greater than normal, and which is associated with, responsible for, or results in, the pathology of said diseases.
Combinations of the present invention might be utilized to inhibit, block, reduce, decrease, etc. , cell proliferation and/or cell division, and/or produce apoptosis.
This method comprises administering to a mammal in need thereof, including a human, an amount of a compound A and an amount of compound B of this invention, or a pharmaceutically acceptable salt, isomer, polymorph, metabolite, hydrate, solvate or ester thereof ; etc. which is effective to treat the disorder. Hyper- proliferative disorders include but are not limited, e.g. , psoriasis, keloids, and other hyperplasias affecting the skin, benign prostate hyperplasia (BPH) , solid tumors, such as cancers of the breast, respiratory tract, brain, reproductive organs, digestive tract, urinary tract, eye, liver, skin, head and neck, thyroid, parathyroid and their distant metastases. Those disorders also include lymphomas, sarcomas, and leukemias.
Examples of breast cancer include, but are not limited to invasive ductal carcinoma, invasive lobular carcinoma, ductal carcinoma in situ, and lobular carcinoma in situ. Examples of cancers of the respiratory tract include, but are not limited to small-cell and non-small-cell lung carcinoma, as well as bronchial adenoma and pleuropulmonary blastoma.
Examples of brain cancers include, but are not limited to brain stem and hypophtalmic glioma, cerebellar and cerebral astrocytoma, medulloblastoma, ependymoma, as well as neuroectodermal and pineal tumor.
Tumors of the male reproductive organs include, but are not limited to prostate and testicular cancer. Tumors of the female reproductive organs include, but are not limited to endometrial, cervical, ovarian, vaginal, and vulvar cancer, as well as sarcoma of the uterus.
Tumors of the digestive tract include, but are not limited to anal, colon, colorectal, esophageal, gallbladder, gastric, pancreatic, rectal, small- intestine, and salivary gland cancers.
Tumors of the urinary tract include, but are not limited to bladder, penile, kidney, renal pelvis, ureter, urethral and human papillary renal cancers.
Eye cancers include, but are not limited to intraocular melanoma and retinoblastoma.
Examples of liver cancers include, but are not limited to hepatocellular carcinoma (liver cell carcinomas with or without fibrolamellar variant), cholangiocarcinoma (intrahepatic bile duct carcinoma), and mixed hepatocellular cholangiocarcinoma.
Skin cancers include, but are not limited to squamous cell carcinoma, Kaposi's sarcoma, malignant melanoma, Merkel cell skin cancer, and non-melanoma skin cancer. Head-and-neck cancers include, but are not limited to laryngeal, hypopharyngeal, nasopharyngeal, oropharyngeal cancer, lip and oral cavity cancer and squamous cell. Lymphomas include, but are not limited to AIDS- related lymphoma, non-Hodgkin's lymphoma, cutaneous T-cell lymphoma, Burkitt lymphoma, Hodgkin's disease, and lymphoma of the central nervous system.
Sarcomas include, but are not limited to sarcoma of the soft tissue, osteosarcoma, malignant fibrous histiocytoma, lymphosarcoma, and rhabdomyosarcoma. Leukemias include, but are not limited to acute myeloid leukemia, acute lymphoblastic leukemia, chronic lymphocytic leukemia, chronic myelogenous leukemia, and hairy cell leukemia.
These disorders have been well characterized in humans, but also exist with a similar etiology in other mammals, and can be treated by administering pharmaceutical compositions of the present invention.
The term "treating" or "treatment" as stated throughout this document is used conventionally, e.g., the management or care of a subject for the purpose of combating, alleviating, reducing, relieving, improving the condition of, etc. , of a disease or disorder, such as a carcinoma. Combinations of the present invention might be used for the treatment of disorders associated with aberrant mitogen extracellular kinase activity, including, but not limited to stroke, heart failure, hepatomegaly, cardiomegaly, diabetes, Alzheimer's disease, cystic fibrosis, symptoms of xenograft rejections, septic shock or asthma. The phrase "aberrant kinase activity" or "aberrant tyrosine kinase activity, " includes any abnormal expression or activity of the gene encoding the kinase or of the polypeptide it encodes. Examples of such aberrant activity, include, but are not limited to, over- expression of the gene or polypeptide ; gene amplification ; mutations which produce constitutively-active or hyperactive kinase activity ; gene mutations, deletions, substitutions, additions, etc. The present invention also provides for methods of inhibiting a kinase activity, especially of mitogen extracellular kinase, comprising administering an effective amount of a combination of the present invention, including salts, polymorphs, metabolites, hydrates, solvates, prodrugs (e.g. : esters) thereof, and diastereoisomeric forms thereof. Kinase activity can be inhibited in cells (e.g., in vitro), or in the cells of a mammalian subject, especially a human patient in need of treatment.
Combinations of the present invention might also be used for treating disorders and diseases associated with excessive and/or abnormal angiogenesis. Inappropriate and ectopic expression of angiogenesis can be deleterious to an organism. A number of pathological conditions are associated with the growth of extraneous blood vessels. These include, e.g. , diabetic retinopathy, ischemic retinal-vein occlusion, and retinopathy of prematurity [Aiello et al. New Engl. J. Med. 1994, 331 , 1480 ; Peer et al. Lab. Invest. 1995, 72, 638], age-related macular degeneration [AMD ; see, Lopez et al. Invest. Opththalmol. Vis. Sci. 1996, 37, 855], neovascular glaucoma, psoriasis, retrolental fibroplasias, angiofibroma, inflammation, rheumatoid arthritis (RA), restenosis, in-stent restenosis, vascular graft restenosis, etc. In addition, the increased blood supply associated with cancerous and neoplastic tissue, encourages growth, leading to rapid tumor enlargement and metastasis. Moreover, the growth of new blood and lymph vessels in a tumor provides an escape route for renegade cells, encouraging metastasis and the consequence spread of the cancer. Thus, combinations of the present invention can be utilized to treat and/or prevent any of the aforementioned angiogenesis disorders, e.g., by inhibiting and/or reducing blood vessel formation ; by inhibiting, blocking, reducing, decreasing, etc. endothelial cell proliferation or other types involved in angiogenesis, as well as causing cell death or apoptosis of such cell types.
Dose and adm nistration
Based upon standard laboratory techniques known to evaluate compounds useful for the treatment of hyper-proliferative disorders and angiogenic disorders, by standard toxicity tests and by standard pharmacological assays for the determination of treatment of the conditions identified above in mammals, and by comparison of these results with the results of known medicaments that are used to treat these conditions, the effective dosage of the compounds of this invention can readily be determined for treatment of each desired indication. The amount of the active ingredients to be administered in the treatment of one of these conditions can vary widely according to such considerations as the particular compound and dosage unit employed, the mode of administration, the period of treatment, the age and sex of the patient treated, and the nature and extent of the condition treated.
The total amount of the active ingredients to be administered will generally range from about 0.001 mg/kg to about 200 mg/kg body weight per day, and preferably from about 0.01 mg/kg to about 20 mg/kg body weight per day. Clinically useful dosing schedules of a compound will range from one to three times a day dosing to once every four weeks dosing. In addition, "drug holidays" in which a patient is not dosed with a drug for a certain period of time, may be beneficial to the overall balance between pharmacological effect and tolerability. A unit dosage may contain from about 0.5 mg to about 1500 mg of active ingredient, and can be administered one or more times per day or less than once a day. The average daily dosage for administration by injection, including intravenous, intramuscular, subcutaneous and parenteral injections, and use of infusion techniques will preferably be from 0.01 to 200 mg/kg of total body weight. The average daily rectal dosage regimen will preferably be from 0.01 to 200 mg/kg of total body weight. The average daily vaginal dosage regimen will preferably be from 0.01 to 200 mg/kg of total body weight. The average daily topical dosage regimen will preferably be from 0.1 to 200 mg administered between one to four times daily. The transdermal concentration will preferably be that required to maintain a daily dose of from 0.01 to 200 mg/kg. The average daily inhalation dosage regimen will preferably be from 0.01 to 100 mg/kg of total body weight.
Of course the specific initial and continuing dosage regimen for each patient will vary according to the nature and severity of the condition as determined by the attending diagnostician, the activity of the specific compounds employed, the age and general condition of the patient, time of administration, route of administration, rate of excretion of the drug, drug combinations, and the like. The desired mode of treatment and number of doses of a compound of the present invention or a pharmaceutically acceptable salt or ester or composition thereof can be ascertained by those skilled in the art using conventional treatment tests.
The combinations of the present invention can be used in particular in therapy and prevention, i.e. prophylaxis, of tumour growth and metastases, especially in solid tumours of all indications and stages with or without pre-treatment of the tumour growth.
Methods of testing for a particular pharmacological or pharmaceutical property are well known to persons skilled in the art. The combinations of component A and component B of this invention can be administered as the sole pharmaceutical agent or in combination with one or more further pharmaceutical agents where the resulting combination of components A, B and C causes no unacceptable adverse effects. For example, the combinations of components A and B of this invention can be combined with component C, i.e. one or more further pharmaceutical agents, such as known anti-angiogenesis, anti-hyper-proliferative, antiinflammatory, analgesic, immunoregulatory, diuretic, antiarrhytmic, anti- hypercholsterolemia, anti-dyslipidemia, anti-diabetic or antiviral agents, and the like, as well as with admixtures and combinations thereof.
Component C, can be one or more pharmaceutical agents such as aldesleukin, alendronic acid, alfaferone, alitretinoin, allopurinol, aloprim, aloxi, altretamine, aminoglutethimide, amifostine, amrubicin, amsacrine, anastrozole, anzmet, aranesp, arglabin, arsenic trioxide, aromasin, 5- azacytidine, azathioprine, BCG or tice BCG, bestatin, betamethasone acetate, betamethasone sodium phosphate, bexarotene, bleomycin sulfate, broxuridine, bortezomib, busulfan, calcitonin, campath, capecitabine, carboplatin, casodex, cefesone, celmoleukin, cerubidine, chlorambucil, cisplatin, cladribine, cladribine, clodronic acid, cyclophosphamide, cytarabine, dacarbazine, dactinomycin, DaunoXome, decadron, decadron phosphate, delestrogen, denileukin diftitox, depo-medrol, deslorelin, dexomethasone, dexrazoxane, diethylstilbestrol, diflucan, docetaxel, doxifluridine, doxorubicin, dronabinol, DW-166HC, eligard, elitek, ellence, emend, epirubicin, epoetin alfa, epogen, eptaplatin, ergamisol, estrace, estradiol, estramustine phosphate sodium, ethinyl estradiol, ethyol, etidronic acid, etopophos, etoposide, fadrozole, farston, filgrastim, finasteride, filgrastim, floxuridine, fluconazole, fludarabine, 5-fluorodeoxyuridine monophosphate, 5-fluorouracil (5-FU), fluoxymesterone, flutamide, formestane, fosteabine, fotemustine, fulvestrant, gammagard, gemcitabine, gemtuzumab, gleevec, gliadel, goserelin, granisetron HCl, histrelin, hycamtin, hydrocortone, eyrthro-hydroxynonyladenine, hydroxyurea, ibritumomab tiuxetan, idarubicin, ifosfamide, interferon alpha, interferon-alpha 2, interferon alfa-2A, interferon alfa-2B, interferon alfa-n1 , interferon alfa-n3, interferon beta, interferon gamma- 1 a, interleukin-2, intron A, iressa, irinotecan, kytril, lentinan sulphate, letrozole, leucovorin, leuprolide, leuprolide acetate, lenalidomide, levamisole, levofolinic acid calcium salt, levothroid, levoxyl, lomustine, lonidamine, marinol, mechlorethamine, mecobalamin, medroxyprogesterone acetate, megestrol acetate, melphalan, menest, 6-mercaptopurine, Mesna, methotrexate, metvix, miltefosine, minocycline, mitomycin C, mitotane, mitoxantrone, Modrenal, Myocet, nedaplatin, neulasta, neumega, neupogen, nilutamide, nolvadex, NSC-631570, OCT-43, octreotide, ondansetron HCl, orapred, oxaiiplatin, paclitaxei (when component B is not itself paclitaxei), pediapred, pegaspargase, Pegasys, pentostatin, picibanil, pilocarpine HCl, pirarubicin, plicamycin, porfimer sodium, prednimustine, prednisolone, prednisone, premarin, procarbazine, procrit, raltitrexed, rebif, rhenium-186 etidronate, rituximab, roferon-A, romurtide, salagen, sandostatin, sargramostim, semustine, sizofiran, sobuzoxane, solu-medrol, sparfosic acid, stem-cell therapy, streptozocin, strontium-89 chloride, synthroid, tamoxifen, tamsulosin, tasonermin, tastolactone, taxotere, teceleukin, temozolomide, teniposide, testosterone propionate, testred, thioguanine, thiotepa, thyrotropin, tiludronic acid, topotecan, toremifene, tositumomab, trastuzumab, treosulfan, tretinoin, trexall, trimethylmelamine, trimetrexate, triptorelin acetate, triptorelin pamoate, UFT, uridine, valrubicin, vesnarinone, vinblastine, vincristine, vindesine, vinorelbine, virulizin, zinecard, zinostatin stimalamer, zofran, ABI- 007, acolbifene, actimmune, affinitak, aminopterin, arzoxifene, asoprisnil, atamestane, atrasentan, BAY 43-9006 (sorafenib), avastin, CCI-779, CDC-501 , celebrex, cetuximab, crisnatol, cyproterone acetate, decitabine, DN-101 , doxorubicin-MTC, dSLIM, dutasteride, edotecarin, eflornithine, exatecan, fenretinide, histamine dihydrochloride, histrelin hydrogel implant, holmium- 166 DOTMP, ibandronic acid, interferon gamma, intron-PEG, ixabepilone, keyhole limpet hemocyanin, L-651582, lanreotide, lasofoxifene, libra, lonafarnib, miproxifene, minodronate, MS -209, liposomal MTP-PE, MX-6, nafarelin, nemorubicin, neovastat, nolatrexed, oblimersen, onco-TCS, osidem, paclitaxel polyglutamate, pamidronate disodium, PN-401 , QS-21 , quazepam, R-1 549, raloxifene, ranpirnase, 13-cis -retinoic acid, satraplatin, seocalcitol, T- 138067, tarceva, taxoprexin, thalidomide, thymosin alpha 1 , tiazofurine, tipifarnib, tirapazamine, TLK-286, toremifene, TransMID-107R, valspodar, vapreotide, vatalanib, verteporfin, vinflunine, Z-100, zoledronic acid or combinations thereof.
Alternatively, said component C can be one or more further pharmaceutical agents selected from gemcitabine, paclitaxel, cisplatin, carboplatin, sodium butyrate, 5-FU, doxirubicin, tamoxifen, etoposide, trastumazab, gefitinib, intron A, rapamycin, 17-AAG, U0126, insulin, an insulin derivative, a PPAR ligand, a sulfonylurea drug, an a-glucosidase inhibitor, a biguanide, a PTP-1 B inhibitor, a DPP-IV inhibitor, a 1 1 -beta-HSD inhibitor, GLP-1 , a GLP-1 derivative, GIP, a GIP derivative, PACAP, a PACAP derivative, secretin or a secretin derivative.
Optional anti-hyper-proliferative agents which can be added as component C to the combination of components A and B of the present invention include but are not limited to compounds listed on the cancer chemotherapy drug regimens in the 1 1 th Edition of the Merck Index, (1996), which is hereby incorporated by reference, such as asparaginase, bleomycin, carboplatin, carmustine, chlorambucil, cisplatin, colaspase, cyclophosphamide, cytarabine, dacarbazine, dactinomycin, daunorubicin, doxorubicin (adriamycine), epirubicin, etoposide, 5-fluorouracil, hexamethylmelamine, hydroxyurea, ifosfamide, irinotecan, leucovorin, lomustine, mechlorethamine, 6- mercaptopurine, mesna, methotrexate, mitomycin C, mitoxantrone, prednisolone, prednisone, procarbazine, raloxifen, streptozocin, tamoxifen, thioguanine, topotecan, vinblastine, vincristine, and vindesine. Other anti-hyper-proliferative agents suitable for use as component C with the combination of components A and B of the present invention include but are not limited to those compounds acknowledged to be used in the treatment of neoplastic diseases in Goodman and Gil man's The Pharmacological Basis of Therapeutics (Ninth Edition), editor Molinoff et al. , publ. by McGraw-Hill, pages 1225- 1287, (1996), which is hereby incorporated by reference, such as aminoglutethimide, L-asparaginase, azathioprine, 5-azacytidine cladribine, busulfan, diethylstilbestrol, 2',2'-difluorodeoxycytidine, docetaxel, erythrohydroxynonyl adenine, ethinyl estradiol, 5-fluorodeoxyuridine, 5- fluorodeoxyuridine monophosphate, fludarabine phosphate, fluoxymesterone, flutamide, hydroxyprogesterone caproate, idarubicin, interferon, medroxyprogesterone acetate, megestrol acetate, melphalan, mitotane, paclitaxel (when component B is not itself paclitaxel) , pentostatin, N- phosphonoacetyl-L-aspartate (PALA), plicamycin, semustine, teniposide, testosterone propionate, thiotepa, trimethylmelamine, uridine, and vinorelbine.
Other anti-hyper-proliferative agents suitable for use as component C with the combination of components A and B of the present invention include but are not limited to other anti-cancer agents such as epothilone and its derivatives, irinotecan, raloxifen and topotecan.
Generally, the use of cytotoxic and/or cytostatic agents as component C in combination with a combination of components A and B of the present invention will serve to: (1 ) yield better efficacy in reducing the growth of a tumor or even eliminate the tumor as compared to administration of either agent alone,
(2) provide for the administration of lesser amounts of the administered chemotherapeutic agents,
(3) provide for a chemotherapeutic treatment that is well tolerated in the patient with fewer deleterious pharmacological complications than observed with single agent chemotherapies and certain other combined therapies,
(4) provide for treating a broader spectrum of different cancer types in mammals, especially humans,
(5) provide for a higher response rate among treated patients,
(6) provide for a longer survival time among treated patients compared to standard chemotherapy treatments,
(8) provide a longer time for tumor progression, and /or
(9) yield efficacy and tolerability results at least as good as those of the agents used alone, compared to known instances where other cancer agent combinations produce antagonistic effects. Further, the present invention relates to the use of the ratio of pro-apoptotic and anti-apoptotic proteins from the Bcl-2 family in a biological sample as a biomarker for a Mps- 1 kinase inhibitor treatment. The ratio of pro- and anti-apoptotic proteins from the Bcl-2 family in a biological sample may constitute a potential biomarker to predict the cytotoxic potential of Mps-1 kinase inhibitors. In case of two comparable biological samples of two different organisms, the probability of success of a monotherapy with an Mps-1 kinase inhibitor is expected to be higher in the case of the organism showing the higher ratio of pro- and anti-apoptotic proteins from the Bcl-2 family. As opposed to this, the probability of success of a combination therapy with an Mps-1 kinase inhibitor and an inhibitor of anti-apoptotic proteins from the Bcl-2 family is expected to be higher in case of the organism showing a lower ratio of pro- and anti-apoptotic proteins from the Bcl-2 family.
EXPERIMENTAL SECTION
Substituted [1 ,2,4]-triazolo-[1 ,5-o]-pyridines as being the preferred compounds A of the present invention were synthesized according to the methods described in WO2013/087579, WO2012/ 143329, and WO201 1 /063908 which are incorporated herein by reference. The compound BAY 3 was prepared according to the method described in WO2012/080230 which is incorporated herein by reference.
Figure imgf000076_0001
ExampleOI .8 3-ethoxy-4-{[6-(4-{[(4- fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]- pyridin-2-yl]amino}-N-(2-hydroxyethyl)benzamide
ExampleOI .9 3-ethoxy-4-{[6-(4-{[(4- fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5- a]pyridin-2-yl]amino}-N-(1 -hydroxy-2-methylpropan-2- yl)benzamide
ExampleOI .10 3-ethoxy-N,N-diethyl-4-{[6-(4-{[(4- fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5- a]pyridin-2-yl]amino}benzamide
ExampleOI .1 1 4-{[6-(4-{[(4- fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]- pyridin-2-yl]amino}-N-(2-hydroxyethyl)-3-(2,2,2- trifluoroethoxy)benzamide
ExampleOI .12 4-{[6-(4-{[(4- fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]- pyridin-2-yl]amino}-N-(2-hydroxy-2-methylpropyl)-3- methoxybenzamide
ExampleOI .13 4-{[6-(4-{[{4- fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]- pyridin-2-yl]amino}-N-(1 -hydroxy-2-methylpropan-2-yl)-3- methoxybenzamide
ExampleOI .14 N-{2-[acetyl(methyl)amino]ethyl}-4-{[6-{4-{[(4- fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5- a]pyridin-2-yl]amino}-3-methoxy-N-methylbenzamide
ExampleOI .1 5 2-(4-fluorophenyl)-N-[4-(2-{[2-methoxy-4- (methylsulfonyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)phenyl]acetamide ExampleOI .16 3-ethoxy-N-ethyl-4-{[6-(4-{[(4-fluorophenyl)- acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2- yl]amino}benzamide
Example01 .17 3-ethoxy-4-{[6-(4-{[(4- fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5- a]pyridin-2-yl]amino}-N-(2-hydroxy-2-methylpropyl)benzamide
ExampleOI .18 3-ethoxy-N-ethyl-4-{[6-(4-{[(4- fluorophenyl)acetyl]amino}pheny[)[1 ,2,4]triazolo[1 ,5- a]pyridin-2-yl]amino}-N-(2-methoxyethyl)benzamide
ExampleOI .19 3-ethoxy-4-{[6-(4-{[(4- fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5- a]pyridin-2-yl]amino}-N-(2-hydroxyethyl)-N-methylbenzamide
ExampleOI .20 4-{[6-(4-{[(4- fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-σ]- pyridin-2-yl]amino}-3-methoxy-N-methyl-N-[2-
(methylamino)ethyl]benzamide
ExampleOI .21 N-tert-butyl-4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)- [1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl]amino}-3-{2,2,2- trifluoroethoxy)benzamide
ExampleOI .22 N,N-diethyl-4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)- [1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl]amino}-3-(2,2,2- trifluoroethoxy)benzamide
ExampleOI .23 N,N-diethyl-4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)- [1 ,2,4]triazolo[1 ,5-a]pyndin-2-yl]amino}-3-propoxybenzamide
ExampleOI .24 3-(cyclopropylmethoxy)-N,N-diethyl-4-{[6-(4-{[(4- fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5- a]pyridin-2-yl]amino}benzamide ExampleOI .25 N,N-diethyl-4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)- [1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl]amino}-3- isopropoxybenzamide
ExampleOI .26 N,N-diethyl-4-{[6-(4-{[(4- fluorophenyl)acetyl]amino}pheny[)[1 ,2,4]triazolo[1 ,5- a]pyridin-2-y[]amino}-3-(2-methoxyethoxy)benzamide
ExampleOI .27 4-{[6-(4-{[(4- fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]- pyridin-2-yl]amino}-3-(2,2,2-trifluoroethoxy)-N-(2,2,2- trifluoroethyl)benzamide
ExampleOI .28 3-ethoxy-4-{[6-(4-{[(4- fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]- pyridin-2-yl]amino}-N-[2-(methylsulfonyl)ethyl]benzamide
ExampleOI .29 4-{[6-(4-{[(4- fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]- pyridin-2-yl]amino}-N-(2-hydroxy-2-methylpropyl)-3-(2,2,2- trifluoroethoxy)benzamide
ExampleOI .30 4-{[6-(4-{[(4- fluorophenyl)acetyl]amino}pheny[)[1 ,2,4]triazolo[1 ,5-a]- pyridin-2-yl]amino}-3-methoxy-N-methylbenzamide
ExampleOI .31 4-{[6-(4-{[(4- fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]- pyridin-2-yl]amino}-3-methoxy-N-(2,2,2- trifluoroethyl)benzamide
ExampleOI .32 N-[4-(2-{[2-ethoxy-4-
(methylsulfonyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)phenyl]-2-(4-fluorophenyl)acetamide ExampleOI .33 N-[4-(2-{[2-ethoxy-4-
(ethylsulfonyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)phenyl]-2-(4-fluorophenyl)acetamide
ExampleOI .34 2-(4-fluorophenyl)-N-[4-(2-{[4-(methylsulfonyl)-2-(2,2,2- trifluoroethoxy)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)phenyl]acetamide
ExampleOI .35 N-[4-(2-{[2-(difluoromethoxy)-4-
(methylsulfonyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5-o]pyridin-6- yl)phenyl]-2-(4-fluorophenyl)acetamide
ExampleOI .36 N-[4-(2-{[2-(difluoromethoxy)-4-
(ethylsulfonyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)phenyl]-2-(4-fluorophenyl)acetamide
ExampleOI .37 N-[4-(2-{[2-(cyclopropyloxy)-4-
(methylsulfonyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)phenyl]-2-(4-fluorophenyl)acetamide
Example02.1 4-[(6-{4-[(4- fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]pyridin-2- yl)amino]-N-(2-hydroxyethyl)-3-methoxybenzamide
Example02.2 3-ethoxy-4-[(6-{4-[(4- fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]pyridin-2- yl)amino]-N-(2-hydroxyethyl)benzamide
Example02.3 3-ethoxy-4-[(6-{4-[(4- fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]pyridin-2- yl)amino]-N-(1 -hydroxy-2-methylpropan-2-yl)benzamide
Example02.4 4-[(6-{4-[(4- fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]pyridin-2- yl)amino]-N-(2-hydroxyethyl)-3-(2,2,2- trifluoroethoxy)benzamide Example02.6 N-(4-fluorobenzyl)-4-(2-{[2-methoxy-4- (methylsulfonyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)benzamide
Example02.7 3-ethoxy-4- [(6-{4- [(4- fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 , 5-o]pyridin-2- yl)amino]-N-(2-hydroxy-2-methylpropyl)benzamide
Example02.8 4- [(6-{4- [(4- fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 , 5-a]pyridin-2- yl)amino]-N-(1 -hydroxy-2-methylpropan-2-yl)-3- methoxybenzamide
Example02.9 N-{2- [acetyl(methyl)amino]ethyl}-4-[(6-{4- [(4- fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 , 5-a]pyridin-2- yl)amino]-3-methoxy-N-methylbenzamide
Example02.10 N- (2-ethoxyethy[)-4- [(6-{4- [(4- fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 , 5-o]pyridin-2- yl)amino]-3-methoxybenzamide
Example02.1 1 4- [(6-{4- [(4- fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]pyridin-2- yl)amino]-3-methoxy-N-methyl-N- [2-
(methylamino)ethyl]benzamide
Example02.12 3-ethoxy-4- [(6-{4- [(4- fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 , 5-a]pyridin-2- yl)amino]-N-(2-hydroxyethyl)-N-methylbenzamide
Example02.1 3 4- [(6-{4- [(4- fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 , 5-a]pyridin-2- yl)amino]-3-methoxy-N-methylbenzamide
Example02.14 N-teri-butyl-4- [(6-{4-[(4- fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 , 5-a]pyndin-2- yl)amino]-3-methoxybenzamide Example02.15 4-[(6-{4-[(4- fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-o]pyridin-2- yl)amino]-3-methoxy-N-[2-(methylsulfonyl)ethyl]benzamide
Example02.16 4-{2-[(2,4-dimethoxyphenyl)amino][1 ,2,4]triazolo[1 ,5- a]pyridin-6-yl}-N-(4-fluorobenzyl)benzamide
Example02.17 4-[(6-{4-[(4- fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]pyridin-2- yl)amino]-3-methoxy-N-(2,2,2-trifluoroethyl)benzamide
Example02.18 4-[(6-{4-[(4- fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]pyridin-2- yl)amino]-N-(1 -hydroxy-2-methylpropan-2-yl)-3-(2,2,2- trifluoroethoxy)benzamide
Example02.19 3-ethoxy-4-[(6-{4-[(4- fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 , 5-o]pyridin-2- yl)amino]-N-[2-(methylsulfonyl)ethyl]benzamide
Example02.20 N-ethyl-4-[(6-{4-[(4- fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 , 5-a]pyridin-2- yl)amino]-3-methoxybenzamide
Example02.21 N-terf-butyl-3-ethoxy-4-[(6-{4-[(4- fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]pyridin-2- yl)amino]benzamide
Example02.22 4-[(6-{4-[(4- fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]pyridin-2- yl)amino]-N-(2-hydroxy-2-methylpropyl)-3-(2,2,2- trifluoroethoxy)benzamide
Example02.23 4-[(6-{4-[(4- fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]pyridin-2- yl)amino]-3-(2,2,2-trifluoroethoxy)-/V-(2,2,2- trifluoroethyl)benzamide Example02.24 4-(2-{[4-(dimethylamino)-2- methy[pheny[]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl)-N-(4- fluorobenzyl)benzamide
Example02.25 4-(2-{[2-ethoxy-4-
(methylsulfonyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)-N-(4-fluorobenzyl)benzamide
Example02.26 4-(2-{[2-ethoxy-4-
(ethylsulfonyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)-N-(4-fluorobenzyl)benzamide
Example02.27 N-(4-fluorobenzyl)-4-(2-{[4-(methylsulfonyl)-2-(2,2,2- trifluoroethoxy)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)benzamide
Example02.28 4-(2-{[2-(difluoromethoxy)-4-
(methylsulfonyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)-N-(4-fluorobenzyl)benzamide
Example02.29 4-(2-{[2-(cyclopropyloxy)-4-
(methylsulfonyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5-o]pyridin-6- yl)-N-(4-fluorobenzyl)benzamide
Example03.1 2-fluoro-N-(4-fluorobenzyl)-4-[2-({4-[(1 -hydroxy-2- methylpropan-2-yl)carbamoyl]-2- methoxyphenyl}amino)[1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl]- benzamide
Example04.1 N-(4-fluorobenzyl)-4-[2-({4-[(1 -hydroxy-2-methylpropan-2- yl)carbamoyl]-2-methoxyphenyl}amino)[1 ,2,4]triazolo[1 ,5- a]pyridin-6-yl]-2-methylbenzamide
Example04.2 N-(4-fluorobenzyl)-2-methyl-4-(2-{[4-(methylsulfonyl)-2- (2,2,2-trifluoroethoxy)phenyl]amino}[1 ,2,4]triazolo[1 ,5- a]pyridin-6-yl)benzamide Example05.1 2-chloro-N-(4-fluorobenzyl)-4-[2-({4-[(1 - hydroxy- 2- methylpropan-2-yl)carbamoyl]-2- methoxyphenyl}amino)[1 ,2,4]triazolo[1 , 5-a]pyridin-6-yl]- benzamide
Example06.1 4-[(6-{4-
[(cyclopropylmethyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]- pyridin-2-yl)amino]-3-ethoxy-N-ethylbenzamide
Example06.2 4-[(6-{4-
[(cyclopropylmethyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]- pyridin-2-yl)amino]-3-ethoxy-N-ethyl-N-(2- methoxyethyl)benzamide
Example06.3 4-[{6-{4-
[(cyclopropylmethyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]- pyridin-2-yl)amino]-3-ethoxy-N-(2-hydroxyethyl)benzamide
Example06.4 4-[(6-{4-
[(cyclopropylmethyl)carbamoyl]phenyl}[1 ,2,4]tr1azolo[1 ,5 a]- pyridin-2-yl)amino]-N-(2-hydroxyethyl)-3-(2,2,2- trifluoroethoxy)benzamide
Example06.5 4-[(6-{4-
[(cyclopropylmethyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]- pyridin-2-yl)amino]-N-ethyl-3-(2,2,2- trifluoroethoxy)benzamide
Example07.1 N-ethyl-4-[(6-{4-[(3- fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 , 5-a]pyridin-2- yl)amino]-3-methoxybenzamide
Example08.1 N-(4-fluorobenzyl)-4-[2-({4-[(1 -hydroxy-2-methylpropan-2- yl)carbamoyl]-2-methoxyphenyl}amino)[1 ,2,4]triazolo[1 ,5- a]pyridin-6-yl]-2-methoxybenzamide Example09.1 N-(4-fluorobenzyl)-2-methoxy-4-(2-{[2-methoxy-4-
(methylsulfonyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)benzamide
Examplel .01 (2/?)-2-(4-fluorophenyl)-N-[4-(2-{[2-methoxy-4-
(methylsulfonyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)phenyl]propanamide
Examplel .02 (2R)-N-[4-(2-{[2-ethoxy-4-
(methylsulfonyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)phenyl]-2-(4-fluorophenyl)propanamide
Examplel .03 (2/?)-2-(4-fluorophenyl)-N-[4-(2-{[4-(methylsulfonyl)-2-(2,2,2- trifluoroethoxy)phenyl]amino}[1 ,2,4]triazolo[1 ,5-o]pyridin-6- yl)phenyl]propanamide
Examplel .04 4-{[6-(4-{[{2R)-2-(4-fluorophenyl)propanoyl]- amino}phenyl)[1 ,2,4]triazolo[1 ,5-o]pyridin-2-yl]amino}-3- methoxy-N-(2,2,2-trifluoroethyl)benzamide
Examplel .05 4-{[6-(4-{[(2/?)-2-(4-fluorophenyl)propanoyl]amino}phenyl)- [1 ,2,4]triazolo[1 ,5-o]pyridin-2-yl]amino}-3-methoxybenzamide
Examplel .06 4-{[6-(4-{[(2/?)-2-(4- fluorophenyl)propanoyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-o]- pyridin-2-yl]amino}-3-(2,2,2-trifluoroethoxy)benzamide
Examplel .07 (2R)-N-{4-[2-({4-[(3-fluoroazetidin-1 -yl)carbonyl]-2- methoxyphenyl}amino)[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl]phenyl}-2-(4-fluorophenyl)propanamide
Examplel .08 (2R)-N-[4-(2-{[4-(azetidin-1 -ylcarbonyl)-2- methoxyphenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)phenyl]-2-(4-fluorophenyl)propanamide
Examplel .09 (2/?)-2-(4-fluorophenyl)-N-[4-(2-{[2-methoxy-4-(2-oxo-1 ,3- oxazolidin-3-yl)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)phenyl]propanamide Examplel .10 (-)-2-(4-fluorophenyl)-3-hydroxy-N-[4-(2-{[4-(methylsulfonyl)- 2-(2,2,2-trifluoroethoxy)phenyl]amino}[1 ,2,4]triazolo[1 ,5- a]pyridin-6-yl)phenyl]propanamide
Example"! .1 1 (2R)-2-amino-2-(4-fluorophenyl)-N-[4-(2-{[2-methoxy-4-
(methylsulfonyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)phenyl]ethanamide
Examplel .12 4-{[6-(4-{[(2R)-2-(4- fluorophenyl)propanoyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5- a]pyridin-2-yl]amino}-3-methoxy-N,N-dimethylbenzamide
Examplel .13 (2R)-2-(4-fluorophenyl)-N-[4-(2-{[2-methoxy-4-(pyrrolidin-1 - ylcarbonyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)phenyl]propanamide
Examplel .14 (2R)-N-{4-[2-({4-[(3-fluoroazetidin-1 -yl)carbonyl]-2-(2,2,2- trifluoroethoxy)phenyl}amino)[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl]phenyl}-2-(4-fluorophenyl)propanamide
Examplel .15 (2R)-2-(4-fluorophenyl)-N-{4-[2-({4-[(3-hydroxyazetidin-1 - yl)carbonyl]-2-(2,2,2- trifluoroethoxy)phenyl}amino)[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl]phenyl}propanamide
Examplel .16 (2R)-2-(4-fluorophenyl)-N-[4-(2-{[4-(pyrrolidin-1 -ylcarbonyl)-2- (2,2,2-trifluoroethoxy)phenyl]amino}[1 ,2,4]triazolo[1 ,5- a]pyridin-6-yl)phenyl]propanamide
Examplel .17 (2S)-2-(4-fluorophenyl)-3-hydroxy-N-[4-(2-{[2-methoxy-4-
(methylsulfonyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)phenyl]propanamide
Examplel .18 (2S)-N-{4-[2-({4-[(3-fluoroazetidin-1 -yl)carbonyl]-2-(2,2,2- trifluoroethoxy)phenyl}amino)[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl]phenyl}-2-(4-fluorophenyl)-3-hydroxypropanamide Examplel .19 (2R)-2-amino-2-(4-fluorophenyl)-N-[4-(2-{[4-(met ylsulfonyl)-
2-{2,2,2-trifluoroethoxy)phenyl]amino}[1 ,2,4]triazolo[1 ,5- a]pyridin-6-yl)phenyl]ethanamide
ExampleOI .20 (2R)-2-amino-2-(4-fluorophenyl)-N-[4-(2-{[2-methoxy-4-(2-oxo- 1 ,3-oxazolidin-3-yl)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin- 6-yl)phenyl]ethanamide
Examplel .21 (2R)-2-amino-N-{4-[2-({4-[(3-fluoroazetidin-1 -yl)carbonyl]-2- methoxyphenyl}amino)[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl]phenyl}-2-(4-fluorophenyl)ethanamide
Examplel .22 (2R)-2-amino-N-[4-(2-{[4-(azetidin-1 -ylcarbonyl)-2- methoxyphenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)phenyl]-2-(4-fluorophenyl)ethanamide
Examplel .23 (2R)-2-amino-2-(4-fluorophenyl)-N-[4-(2-{[2-methoxy-4- (pyrrolidin-1 -ylcarbonyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5- a]pyridin-6-yl)phenyl]ethanamide
Examplel .24 (2R)-2-amino-N-{4-[2-({4-[(3-fluoroazetidin-1 -yl)carbonyl]-2- (2,2,2-trifluoroethoxy)phenyl}amino)[1 ,2,4]triazolo[1 ,5- a]pyridin-6-yl]phenyl}-2-(4-fluorophenyl)ethanamide
Examplel .25 (2R)-2-amino-2-(4-fluorophenyl)-N-[4-(2-{[4-{pyrrolidin-1 - ylcarbonyl)-2-(2,2,2- trifluoroethoxy)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)phenyl]ethanamide
Example10.01 2-(2,4-difluorophenyl)-N-[4-(2-{[2-methoxy-4-
(methylsulfonyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)phenyl]acetamide
Examplel 1 .01 N-(2,4-difluorobenzyl)-4-(2-{[2-methoxy-4- (methylsulfonyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)benzamide Examplel 1.01 N-(2,4-difluorobenzyl)-4-(2-{[2-methoxy-4-
(methylsulfonyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)benzamide
Example12.01 4-{[6-(4-{[(4-fluorophenyl)- acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl]amino}- 3-methoxy-N-(2-methoxyethyl)benzamide
Examplel 2.02 4-{[6-(4-{[(4-fluorophenyl)- acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl]amino}- 3-methoxy-N,N-dimethylbenzamide
Examplel 2.03 4-{[6-(4-{[(4-fluorophenyl)- acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl]amino}-
3-methoxy-N-[2-(methylsulfonyl)ethy[]benzamide
Examplel 2.04 4-{[6-{4-{[(4-fluorophenyl)- acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl]amino}- 3-methoxybenzamide
Examplel 2.05 N-(2-fluoroethyl)-4-{[6-(4-{[(4-fluorophenyl)acetyl]- amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl]amino}-3- methoxybenzamide
Examplel 2.06 N-ethyl-4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}- phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl]amino}-3-methoxy-N- methylbenzamide
Examplel 2.07 N-(2,2-difluoroethyl)-4-{[6-(4-{[(4-fluorophenyl)- acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl]amino}- 3-methoxybenzamide
Examplel 2.08 N-[2-(dimethylamino)ethyl]-4-{[6-(4-{[(4-fluorophenyl)- acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl]amino}-
3-methoxy-N-methylbenzamide Exam pie 12.09 4-{[6-(4-{[(4-fluorophenyl)- acetyl]amino}phenyl)[1 ,2,4]triazo[o[1 ,5-a]pyridin-2-y[]amino}- 3-methoxy-N-methyl-N-(2,2,2-trifluoroethyl)benzamide
Example12.10 /V-[2-(dimethylamino)ethyl]-4-{[6-(4-{[(4-fluorophenyl)- acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl]amino}- 3-methoxybenzamide
Example12.1 1 4-{[6-(4-{[(4-fluorophenyl)- acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl]amino}- N-(3-fluoropropyl)-3-methoxybenzamide
Example12.12 N-[4-(2-{[5-fluoro-2-methoxy-4-(methylsulfonyl)- phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl)phenyl]-2-(4- fluorophenyl)acetamide
Example12.13 2-(4-fluorophenyl)-N-[4-(2-{[2-methoxy-4-(methyl- sulfinyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)phenyl]acetamide
Example12.14 N-[4-(2-{[5-fluoro-2-methoxy-4-(methylsulfinyl)- phenyl]amino}[1 ,2,4]triazolo[1 ,5-o]pyridin-6-yl)phenyl]-2-(4- fluorophenyl)acetamide
Example12.15 N-[4-(2-{[4-(tert-butylsulfamoyl)-2-methoxy- phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl)phenyl]-2-(4- fluorophenyl)acetamide
Example12.16 N-(4-{2-[(4-{[ethyl(1 -hydroxy-2-methylpropan-2- yl)amino]methyl}-2-methoxyphenyl)amino][1 ,2,4]triazolo[1 ,5- a]pyridin-6-yl}phenyl)-2-(4-fluorophenyl)acetamide
Example12.17 2-(4-fluorophenyl)-N-[4-(2-{[4-(2-hydroxypropan-2-yl)-2- methoxyphenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)phenyl]acetamide Example! 2.18 N-(4-{2-[(2,4-dimethoxyphenyl)amino][1 ,2,4]triazolo[1 ,5- a]pyridin-6-yl}phenyl)-2-(4-fluorophenyl)acetamide
Example12.19 3-ethoxy-N-ethyl-4-{[6-(4-{[(4-fluorophenyl)acetyl]- amino}phenyl)[1 ,2,4]triazolo[1 ,5-o]pyridin-2-yl]amino}-N- methylbenzamide
Example! 2.20 N-[2-(dimethylamino)ethyl]-3-ethoxy-4-{[6-(4-{[(4- fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]- pyridin-2-yl]amino}benzamide
Example12.21 4-{[6-(4-{[(4-fluorophenyl)- acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl]amino}- N-[2-(methylsulfonyl)ethyl]-3-(2,2,2- trifluoroethoxy)benzamide
Example12.22 4-{[6-(4-{[(4-fluorophenyl)- acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl]amino}- N-(1 -hydroxy-2-methylpropan-2-yl)-3-(2,2,2-trifluoroethoxy)- benzamide
Example12.23 N-[2-(dimethylamino)ethyl]-4-{[6-(4-{[(4-fluorophenyl)- acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl]amino}- 3-(2,2,2-trifluoroethoxy)benzamide
Example12.24 2-(4-fluorophenyl)-N-[4-(2-{[4-(methylsulfinyl)-2-(2,2,2- trifluoroethoxy)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)phenyl]acetamide
Example12.25 4-{[6-(4-{[(4-fluorophenyl)- acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl]amino}- 3-(trifluoromethoxy)benzamide Example! 2.26 N-[4-(2-{[2-(difluoromethoxy)-4-(propan-2- ylsulfonyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)phenyl]-2-(4-fluorophenyl)acetamide
Example12.27 N-[4-(2-{[2-(difluoromethoxy)-4-fluorophenyl]- amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl)phenyl]-2-{4- fluorophenyl)acetamide
Example12.28 4-{[6-(4-{[(4-fluorophenyl)- acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl]amino}- 3-methylbenzamide
Example12.29 4-{[6-(4-{[(4-fluorophenyl)- acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl]amino}- 3-methyl-N-(2,2,2-trifluoroethyl)benzamide
Example12.30 N-(2-fluoroethyl)-4-{[6-(4-{[(4-fluorophenyl)acetyl]- amino}phenyl)[1 ,2,4]triazolo[1 ,5-o]pyridin-2-yl]amino}-3- methylbenzamide
Example12.31 4-{[6-(4-{[(4-fluorophenyl)- acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl]amino}- N,N,3-trimethylbenzamide
Example12.32 2-(4-fluorophenyl)-N-[4-(2-{[2-methyl-4-(methyl- sulfonyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)phenyl]acetamide
Exam pie 12.33 2-(4-fluorophenyl)-N-[4-(2-{[2-methyl-4-(methyl- sulfinyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)phenyl]acetamide
Example12.34 2-(4-fluorophenyl)-N-{4-[2-({2-methyl-4-[(methyl- sulfonyl)amino]phenyl}amino)[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl]phenyl}acetamide Exam pie 12.35 2-(4-fluorophenyl)-N-(4-{2-[(4-methoxy-2-methyl- phenyl)amino][1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl}- pheny[)acetamide
Example12.36 N-[4-(2-{[4-(dimethylamino)-2-methylphenyl]- amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl)phenyl]-2-(4- fluorophenyl)acetamide
Example12.37 N-ethyl-5-{[6-(4-{[(4-fluorophenyl)acetyl]amino}- phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl]amino}-4- methylpyridine-2-carboxamide
Example12.38 5-{[6-(4-{[(4-fluorophenyl)- acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2-y[]amino}- 4-methyl-N-(2,2,2-tnfluoroethyl)pyridine-2-carboxamide
Example12.39 N-[4-(2-{[2-fluoro-4-(methylsulfonyl)phenyl]- amino}[1 ,2,4]triazolo[1 ,5-o]pyridin-6-yl)phenyl]-2-(4- fluorophenyl)acetamide
Exam pie 12.40 2-(4-fluoro-3-methylphenyl)-N-[4-(2-{[2-methoxy-4- (methylsulfonyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)phenyl]acetamide
Example12.41 2-(4-chlorophenyl)-N-[4-(2-{[2-methoxy-4-(methyl- sulfonyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- y[)pheny[]acetamide
Example12.42 N-[4-(2-{[2-methoxy-4-(methylsulfonyl)phenyl]- amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl)phenyl]-2- phenylacetamide
Example! 2.43 4-[(6-{4-[(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]tri- azolo[1 ,5-a]pyridin-2-yl)amino]-3-methoxybenzamide Exam pie 12.44 4-[(6-{4-[(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]tri- azolo[1 ,5-a]pyridin-2-yl)amino]-3-methoxy-N-(2- methoxyethyi)benzamide
Example12.45 4-[(6-{4-[(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4] tri- azolo[1 ,5-a]pyridin-2-yl)amino]-N-(2-fluoroethyl)-3- methoxybenzamide
Example12.46 4-[(6-{4-[(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]tri- azolo[1 ,5-a]pyridin-2-yl)amino]-3-methoxy-N,N- dimethylbenzamide
Example12.47 N-(2,2-difluoroethyl)-4-[(6-{4-[(4-fluorobenzyl)- carbamoy[]pheny[}[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl)amino]-3- methoxybenzamide
Example12.48 N-[2-(dimethylamino)ethyl]-4-[(6-{4-[(4-fluorobenzyl)- carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl)amino]-3- methoxybenzamide
Exam pie 12.49 N-[2-(dimethylamino)ethyl]-4-[(6-{4-[(4-fluorobenzyl)- carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl)amino]-3- methoxy-N-methylbenzamide
Example12.50 4-[(6-{4-[(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4] tri- azolo[1 ,5-a]pyridin-2-yl)amino]-N-(3-fluoropropyl)-3- methoxybenzamide
Example12.51 N-(4-fluorobenzyl)-4-(2-{[2-methoxy-4-(methylsulfinyl)- phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl)benzamide
Example12.52 4-{2-{[4-(iert-butylsulfamoyl)-2-methoxyphenyl]amino}[1 ,2,4]- triazolo[1 ,5-a]pyridin-6-yl)-N-(4-fluorobenzyl)benzamide Example! 2.53 4-{2-[(4-{[ethyl(1 -hydroxy-2-methylpropan-2-yl)amino]- methyl}-2-methoxyphenyl)amino][1 ,2,4]triazolo[1 ,5-o]pyridin- 6-yl}-N-(4-fluorobenzyl)benzamide
Example12.54 N-(4-fluorobenzyl)-4-(2-{[4-(2-hydroxypropan-2-yl)-2- methoxyphenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)benzamide
Example12.55 N-[2-(dimethylamino)ethyl]-3-ethoxy-4-[(6-{4-[(4-fluoro- benzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]pyridin-2- yl)amino]benzamide
Example12.56 3-ethoxy-N-ethyl-4-[(6-{4-[(4-fluorobenzyl)carbamoyl]- phenyl}[1 ,2,4]triazolo[1 ,5-o]pyridin-2-yl)amino]-N- methylbenzamide
Example12.57 3-ethoxy-4-[(6-{4-[(4-fluorobenzyl)carbamoyl]phenyl}- [1 ,2,4]triazolo[1 ,5-o]pyridin-2-yl)amino]-N-(2- fluoroethyl)benzamide
Example12.58 N-[2-{dimethylamino)ethyl]-4-[(6-{4-[(4-fluorobenzyl)- carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl)amino]-3- (2,2,2-trifluoroethoxy)benzamide
Example12.59 4-[(6-{4-[(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]tri- azolo[1 ,5-a]pyridin-2-yl)amino]-N-(2-fluoroethyl)-3-(2,2,2- trifluoroethoxy)benzamide
Exam pie 12.60 4-[(6-{4-[(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4] trl- azolo[1 ,5-K]pyridin-2-yl)amino]-3-(tnfluoro- methoxy)benzamide
Example12.61 4-{2-{[2-(difluoromethoxy)-4-(ethylsulfonyl)phenyl]- amino}[1 ,2,4]triazolo[1 ,5-o]pyridin-6-yl)-N-(4- fluorobenzyl)benzamide Example! 2.62 4-(2-{[2-(difluoromethoxy)-4-(propan-2-ylsulfonyl)- phenyl]amino}[1 ,2,4]triazolo[1 ,5-o]pyridin-6-yl)-N-(4- fluorobenzyl)benzamide
Example12.63 4-(2-{[2-(difluoromethoxy)-4-fluorophenyl]amino}- [1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl)-N-(4-fluoro- benzyl)benzamide
Example12.64 N-ethyl-4-[(6-{4-[(4-fluorobenzyl)carbamoyl]phenyl}-
[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl)amino]-3-methylbenzamide
Exam pie 12.65 4-[(6-{4-[(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]tri- azolo[1 ,5-a]pyridin-2-yl)amino]-3-methylbenzamide
Example12.66 4-[(6-{4-[(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4] tri- azolo[1 ,5-o]pyridin-2-yl)amino]-3-methyl-N-(2,2,2- trifluoroethyl)benzamide
Example12.67 4-[(6-{4-[(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4] tri- azolo[1 ,5-a]pyridin-2-yl)amino]-N-(2-fluoroethyl)-3- methylbenzamide
Example12.68 N-(4-fluorobenzyl)-4-(2-{[2-methyl-4-(methylsulfonyl)- phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl)benzamide
Example12.69 N-(4-fluorobenzyl)-4-(2-{[2-methyl-4-(methylsulfinyl)- phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl)benzamide
Example12.70 N-(4-fluorobenzyl)-4-[2-({2-methyl-4-[(methylsulfonyl)- amino]phenyl}amino)[1 ,2,4]triazolo[1 ,5-o]pyridin-6-yl]- benzamide
Example12.71 N-(4-fluorobenzyl)-4-{2-[(4-methoxy-2-methylphenyl)- amino][1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl}benzamide Exam pie 12.72 4-[(6-{4-[(4-chlorobenzyl)carbamoyl]phenyl}[1 ,2,4]tri- azolo[1 ,5-a]pyridin-2-yl)amino]-3-methoxy-N-(2,2,2- trifluoroethyl)benzamide
Example12.73 N-(4-chlorobenzyl)-4-(2-{[2-methoxy-4-(methylsulfonyl)- phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl)benzamide
Example12.74 N-(4-chlorobenzyl)-4-(2-{[2-methyl-4-(methylsulfonyl)- phenyl]amino}[1 ,2,4]triazolo[1 ,5-o]pyridin-6-yl)benzamide
Example12.75 N-(4-chlorobenzyl)-4-(2-{[2-methyl-4-(methylsulfinyl)- phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl)benzamide
Example12.76 4-(2-{[2-methoxy-4-(methylsulfonyl)phenyl]amino}- [1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl)-N-(4-methyl- benzyl)benzamide
Example12.77 N-(4-methylbenzyl)-4-(2-{[2-methyl-4-(methylsulfonyl)- phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl)benzamide
Example12.78 N-(4-methylbenzyl)-4-(2-{[2-methyl-4-(methylsulfinyl)- phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl)benzamide
Example12.79 4-[(6-{4-[(2,4-difluorobenzyl)carbamoyl]phenyl}-
[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl)amino]-3-methoxy-N-(2,2,2- trifluoroethyl)benzamide
Example12.80 N-(2,4-difluorobenzyl)-2-methyl-4-(2-{[4-(methylsulfonyl)-2- (2,2,2-trifluoroethoxy)phenyl]amino}[1 ,2,4]triazolo[1 ,5- o]pyridin-6-yl)benzamide
Example! 2.81 N-(4-fluorobenzyl)-4-(2-{[4-(2-hydroxypropan-2-yl)-2- methoxyphenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl)-2- methoxybenzamide Exam pie 12.82 2-(4-fluorophenyl)-N-[4-(2-{[2-methoxy-4-(S- methylsulfonimidoyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5- a]pyridin-6-yl)phenyl]acetamide
Example12.83 N-(4-fluorobenzyl)-4-(2-{[2-methoxy-4-(S- methylsulfonimidoyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5- o]pyridin-6-yl)benzamide
Exam pie 12.84 2-(4-fluorophenyl)-N-[4-(2-{[4-(hydroxymethyl)-2- methoxyphenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)phenyl]acetamide
Example12.85 N-(4-fluorobenzyl)-4-(2-{[4-(hydroxymethyl)-2- methoxyphenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)benzamide
Example13 N-(4-{2-[(2-cyanophenyl)amino][1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl}phenyl)-2-[4-(trifluoromethyl)phenyl]acetamide
Example14 N-(4-{2-[(2-cyanophenyl)amino][1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl}phenyl)-2-phenylacetamide (BAY 2)
Example16 N-cyclopropyl-4-{8-[(2-methylpropyl)amino]-6-(quinolin-5-yl)i midazo[1 ,2-a]pyrazin-3-yl}benzamide (BAY 3)
2012-07-06
Examples demonstrating the inhibitory effect on Mps-1 of the compounds A of the present invention Biological assay: Proliferation Assay
Cultivated tumor cells (MCF7, hormone dependent human mammary carcinoma cells, ATCC HTB22; NCI-H460, human non-small cell lung carcinoma cells, ATCC HTB-177; DU 145, hormone-independent human prostate carcinoma cells, ATCC HTB-81 ; HeLa- aTu, human cervical carcinoma cells, EPO-GmbH, Berlin; HeLa-MaTu-ADR, multidrug-resistant human cervical carcinoma cells, EPO-GmbH, Berlin; HeLa human cervical tumor cells, ATCC CCL-2; B16F10 mouse melanoma cells, ATCC CRL-6475) were plated at a density of 5000 cells/well (MCF7, DU145, HeLa-MaTu-ADR), 3000 cells/well (NCI-H460, HeLa-MaTu, HeLa), or 1000 cells/well (B16F10) in a 96-well multititer plate in 200 μΐ of their respective growth medium supplemented 10% fetal calf serum. After 24 hours, the cells of one plate (zero-point plate) were stained with crystal violet (see below), while the medium of the other plates was replaced by fresh culture medium (200 μΐ), to which the test substances were added in various concentrations (0 μΜ, as well as in the range of 0.01 -30 μΜ; the final concentration of the solvent dimethyl sulfoxide was 0.5%). The cells were incubated for 4 days in the presence of test substances. Cell proliferation was determined by staining the cells with crystal violet: the cells were fixed by adding 20 μΐ/measuring point of an 1 1% glutaric aldehyde solution for 15 minutes at room temperature. After three washing cycles of the fixed cells with water, the plates were dried at room temperature. The cells were stained by adding 100 μΐ/measuring point of a 0.1% crystal violet solution (pH 3.0). After three washing cycles of the stained cells with water, the plates were dried at room temperature. The dye was dissolved by adding 100 μΐ/measuring point of a 10% acetic acid solution. The extinction was determined by photometry at a wavelength of 595 nm. The change of cell number, in percent, was calculated by normalization of the measured values to the extinction values of the zero-point plate (=0%) and the extinction of the untreated (0 μηι) cells (=100%). The !Cso values were determined by means of a 4 parameter fit using the company's own software.
The compounds A of the present invention are characterized by an ICso determined in a HeLa-MaTu-ADR cell proliferation assay (as described above) that is lower than 10 μΜ. The IC50 of preferred compounds A is even lower than 2.0 μΜ. The ICso of more preferred compounds A is even lower than 500 nM. The IC¾) of even more preferred compounds A is even lower than 250 nM. The ICso of most preferred compounds A is even lower than 200 nM.
The compounds A of the present invention are characterized by the following iCso values, determined in a HeLa cell proliferation assay (as described above):
Figure imgf000099_0001
1 .14 < 100 nM
1 .15 < 100 nM
1 .16 < 100 nM
1 .17 < 600 nM
1 .18 < 100 nM
1 .19 < 200 nM
1 .20 < 200 nM
1 .21 < 200 nM
1 .22 < 200 nM
1 .23 < 400 nM
1 .24 < 100 nM
1 .25 < 200 nM
Mps-1 kinase assay
The human kinase Mps-1 phosphorylates a biotinylated substrate peptide. Detection of the phosphorylated product is achieved by time-resolved fluorescence resonance energy transfer (TR-FRET) from Europium-labelled anti-phospho-Serine/Threonine antibody as donor to streptavidin labelled with cross-linked allophycocyanin (SA-XLent) as acceptor. Compounds are tested for their inhibition of the kinase activity.
N-terminally GST-tagged human full length recombinant Mps-1 kinase (purchased from !nvitrogen, Karslruhe, Germany, cat. no PV4071 ) was used. As substrate for the kinase reaction a biotinylated peptide of the amino-acid sequence PWDPDDADITEILG (C-terminus in amide form, purchased from Biosynthan GmbH, Berlin) was used. For the assay 50 nl of a 100-fold concentrated solution of the test compound in DMSO was pipetted into a black low volume 384well microtiter plate (Greiner Bio-One, Frickenhausen, Germany), 2 μΐ of a solution of Mps-1 in assay buffer [0.1 mM sodium -ortho-vanadate, 10 mM MgCU, 2 mM DTT, 25 mM Hepes pH 7.7, 0.05% BSA, 0.001% Pluronic F-127] were added and the mixture was incubated for 15 min at 22' C to allow pre-binding of the test compounds to Mps-1 before the start of the kinase reaction. Then the kinase reaction was started by the addition of 3 μΐ of a solution of 16.7 adenosine-tri-phosphate (ATP, 16.7 μΜ => final cone, in the 5 μΐ assay volume is 10 μΜ) and peptide substrate (1.67 μΜ => final cone, in the 5 μΐ assay volume is 1 μΜ) in assay buffer and the resulting mixture was incubated for a reaction time of 60 min at 22 C. The concentration of Mps-1 in the assay was adjusted to the activity of the enzyme lot and was chosen appropriate to have the assay in the linear range, typical enzyme concentrations were in the range of about 1 nM (final cone, in the 5 μΐ assay volume). The reaction was stopped by the addition of 3 μΐ of a solution of HTRF detection reagents (100 mM Hepes pH 7.4, 0.1% BSA, 40 mM EDTA, 140 nM Streptavidin-XLent [# 61GSTXLB, Fa. Cis Biointernational, Marcoule, France], 1.5 nM anti-phospho(Ser/Thr)-Europium-antibody [#AD0180, PerkinElmer LAS, Rodgau-Jugesheim, Germany].
The resulting mixture was incubated 1 h at 22' C to allow the binding of the phosphorylated peptide to the anti-phospho(Ser/Thr)-Europium-antibody. Subsequently the amount of phosphorylated substrate was evaluated by measurement of the resonance energy transfer from the Europium-labelled anti-phospho(Ser/Thr) antibody to the Streptavidin-XLent. Therefore, the fluorescence emissions at 620 nm and 665 nm after excitation at 350 nm was measured in a Viewlux TR-FRET reader (PerkinElmer LAS, Rodgau-Jugesheim, Germany). The "blank-corrected normalized ratio" ( a Viewlux specific readout, similar to the traditional ratio of the emissions at 665 nm and at 622 nm, in which blank and Eu-donor crosstalk are subtracted from the 665 nm signal before the ratio is calculated) was taken as the measure for the amount of phosphorylated substrate. The data were normalised (enzyme reaction without inhibitor = 0 % inhibition, all other assay components but no enzyme = 100 % inhibition). Test compounds were tested on the same microtiter plate at 10 different concentrations in the range of 20 μΜ to 1 nM (20 μΜ, 6.7 μΜ, 2.2 μΜ, 0.74 μΜ, 0.25 μΜ, 82 nM, 27 nM, 9.2 nM, 3.1 nM and 1 nM, dilution series prepared before the assay at the level of the 100fold cone, stock solutions by serial 1 :3 dilutions) in duplicate values for each concentration and ICbo values were calculated by a 4 parameter fit using an inhouse software.
Specified compounds A of the present invention are characterized by the following ICso values, determined in Mps-1 kinase assays (as described above):
Figure imgf000102_0001
ExampieOI .12 < 1.0 < 1.0
ExampieOI.13 < 1.0 < 1.0
ExampieOI .14 < 1.0 < 1.0
ExampieOI.15 < 1.0 < 1.0
ExampieOI .16 < 1.0 < 1.0
ExampieOI .17 < 1.0 < 1.0
ExampieOI.18 < 1.0 < 1.0
ExampieOI.19 < 1.0 < 1.0
ExampieOI.20 < 1.0 < 1.0
ExampieOI .21 < 1.0 < 1.0
ExampieOI .22 < 1.0 < 1.0
ExampieOI .23 < 1.0 1.1
ExampieOI .24 < 1.0 1.2
ExampieOI .25 < 1.0 1.3
ExampieOI .26 < 1.0 21
ExampieOI .27 < 1.0 < 1.0
ExampieOI.28 < 1.0 < 1.0
ExampieOI.29 < 1.0 < 1.0
ExampieOI.30 < 1.0 < 1.0
ExampieOI .31 < 1.0 5.0
ExampieOI .32 < 1.0 < 1.0
ExampieOI .33 < 1.0 1.3
ExampieOI .34 < 1.0 < 1.0 ExampieOI .35 < 1.0 1.2
ExampieOI .36 < 1.0 < 1.0
ExampieOI .37 < 1.0 1.6
Example02.1 < 1.0 1.1
Example02.2 < 1.0 < 1.0
Example02.3 < 1.0 < 1.0
Example02.4 < 1.0 < 1.0
Example02.5 < 1.0 1.8
Example02.6 < 1.0 4.3
Example02.7 < 1.0 < 1.0
Example02.8 < 1.0 1.5
Example02.9 < 1.0 2.2
Example02.10 < 1.0 2.3
Example02.11 < 1.0 < 1.0
Example02.12 < 1.0 < 1.0
Example02.13 < 1.0 < 1.0
Example02.14 < 1.0 2.4
Example02.15 < 1.0 < 1.0
Example02.16 < 1.0 3.8
Example02.17 < 1.0 4.6
Example02.18 < 1.0 < 1.0
Example02.19 < 1.0 < 1.0
Example02.20 < 1.0 1.7 Example02.21 < 1.0 2.4
Example02.22 < 1.0 < 1.0
Example02.23 < 1.0 < 1.0
Example02.24 < 1.0 5.9
Example02.25 < 1.0 3.3
Example02.26 < 1.0 6.1
Example02.27 < 1.0 < 1.0
Example02.28 < 1.0 3.5
Example02.29 < 1.0 7.5
Example03.1 < 1.0 6.9
Example04.1 < 1.0 16
Example04.2 < 1.0 15
Example05.1 < 1.0 29
Example06.1 < 1.0 29
Example06.2 1.4 26
Example06.3 < 1.0 21
Example06.4 < 1.0 11
Example06.5 < 1.0 19
Example07.1 < 1.0 14
Example08.1 < 1.0 4.3
Example09.1 < 1.0 19
Example10.01 < 1.0 17
Examplel 1.01 < 1.0 11 Example12.01 < 1.0 < 1.0
Example12.02 < 1.0 < 1.0
Example12.03 < 1.0 < 1.0
Example12.04 < 1.0 < 1.0
Example12.05 < 1.0 < 1.0
Example12.06 < 1.0 < 1.0
Example12.07 < 1.0 < 1.0
Example12.08 < 1.0 < 1.0
Example12.09 < 1.0 2.5
Example12.10 < 1.0 < 1.0
Example12.11 < 1.0 1.2
Example12.12 < 1.0 13
Example12.13 < 1.0 < 1.0
Example12.14 < 1.0 8.5
Example12.15 < 1.0 1.6
Example12.16 < 1.0 < 1.0
Example12.17 < 1.0 < 1.0
Example12.18 < 1.0 1.5
Example12.19 < 1.0 < 1.0
Example 12.20 < 1.0 < 1.0
Example 12.21 < 1.0 < 1.0
Example12.22 < 1.0 < 1.0
Example12.23 < 1.0 < 1.0 Example 12.24 < 1.0 < 1.0
Example12.25 < 1.0 2.7
Example12.26 < 1.0 1.2
Example12.27 < 1.0 9.0
Example12.28 < 1.0 < 1.0
Example12.29 < 1.0 2.3
Example12.30 < 1.0 4.3
Example12.31 < 1.0 3.8
Example12.32 < 1.0 2.2
Example12.33 < 1.0 1.4
Example12.34 < 1.0 6.6
Example12.35 < 1.0 2.1
Example12.36 < 1.0 3.5
Example12.37 < 1.0 13
Example12.38 < 1.0 29
Example12.39 < 1.0 16
Example12.40 < 1.0 9.9
Example12.41 < 1.0 7.2
Example12.42 < 1.0 12
Example12.43 < 1.0 < 1.0
Example12.44 < 1.0 1.6
Example12.45 < 1.0 1.4
Example12.46 < 1.0 3.5 Example 12.47 < 1.0 2.4
Example12.48 < 1.0 1.3
Example12.49 < 1.0 3.4
Example12.50 < 1.0 3.1
Example12.51 < 1.0 2.6
Example12.52 < 1.0 14
Example12.53 < 1.0 6.9
Example12.54 < 1.0 1.1
Example12.55 < 1.0 < 1.0
Example12.56 < 1.0 < 1.0
Example12.57 < 1.0 < 1.0
Example12.58 < 1.0 < 1.0
Example12.59 < 1.0 < 1.0
Example12.60 < 1.0 5.0
Example12.61 < 1.0 6.1
Example12.62 < 1.0 3.5
Example12.63 < 1.0 26
Example12.64 < 1.0 1.6
Example12.65 < 1.0 < 1.0
Example12.66 < 1.0 2.0
Example12.67 < 1.0 5.0
Example12.68 < 1.0 1.9
Example12.69 < 1.0 4.5 Example 12.70 < 1.0 9.5
Example12.71 < 1.0 8.8
Example12.72 < 1.0 16
Example12.73 < 1.0 16
Example12.74 < 1.0 16
Example12.75 < 1.0 5.1
Example12.76 < 1.0 7.4
Example12.77 < 1.0 11
Example12.78 < 1.0 7.6
Example12.79 < 1.0 23
Example12.80 < 1.0 18
Example12.81 < 1.0 7.3
Example12.82 < 1.0 < 1.0
Example12.83 < 1.0 1.8
Example12.84 < 1.0 < 1.0
Example12.85 < 1.0 2.2
Example13 8.2
Example14 < 1.0
Example15 2.8
Example16 1.0
Figure imgf000110_0001
1 .23 < 1 nM < 1 nM
1 .24 < 1 nM < 1 nM
1 .25 < 1 nM < 1 nM
Comparison with compounds specified in WO 201 1/063908 Mps-1 Inhibition in Inhibition Assay with 10 μΜ ATP:
Figure imgf000111_0001
7 1 .1
8 1 .4
9 1 .6
10 2.1
Comparison with compounds specified in WO201 1/063908
Mps-1 Inhibition in Inhibition Assay with 2 mM ATP:
Figure imgf000112_0001
Spindle Assembly Checkpoint Assay
The spindle assembly checkpoint assures the proper segregation of chromosomes during mitosis. Upon entry into mitosis, chromosomes begin to condensate which is accompanied by the phosphorylation of histone H3 on serine 10. Dephosphorylation of histone H3 on serine 10 begins in anaphase and ends at early telophase. Accordingly, phosphorylation of histone H3 on serine 10 can be utilized as a marker of cells in mitosis. Nocodazole is a microtubule destabilizing substance. Thus, nocodazole interferes with microtubule dynamics and mobilises the spindle assembly checkpoint. The cells arrest in mitosis at G2/M transition and exhibit phosphorylated histone H3 on serine 10. An inhibition of the spindle assembly checkpoint by Mps-1 inhibitors overrides the mitotic blockage in the presence of nocodazole, and the cells complete mitosis prematurely. This alteration is detected by the decrease of cells with phosphorylation of histone H3 on serine 10. This decline is used as a marker to determine the capability of compounds of the present invention to induce a mitotic breakthrough.
Cultivated cells of the human cervical tumor cell line HeLa (ATCC CCL-2) were plated at a density of 2500 cells/well in a 384-well microtiter plate in 20 μΐ Dulbeco's Medium (w/o phenol red, w/o sodium pyruvate, w 1000 mg/ml glucose, w pyridoxine) supplemented with 1% (v/v) glutamine, 1% (v/v) penicillin, 1% (v/v) streptomycin and 10% (v/v) fetal calf serum. After incubation overnight at 37 C, 10 μΐ/well nocodazole at a final concentration of 0.1 Mg/ml were added to cells. After 24 h incubation, cells were arrested at G2/M phase of the cell cycle progression. Test compounds solubilised in dimethyl sulfoxide (DMSO) were added at various concentrations (0 μΜ, as well as in the range of 0.005 μΜ 10 μΜ; the final concentration of the solvent DMSO was 0.5% (v/v)). Cells were incubated for 4 h at 37 C in the presence of test compounds. Thereafter, cells were fixed in 4% (v/v) paraformaldehyde in phosphate buffered saline (PBS) at 4 C overnight then permeabilised in 0.1% (v/v) Triton X™ 100 in PBS at room temperature for 20 min and blocked in 0.5% (v/v) bovine serum albumin (BSA) in PBS at room temperature for 15 min. After washing with PBS, 20 μΐ/well antibody solution (anti-phospho-histone H3 clone 3H10, FITC; Upstate, Cat# 16-222; 1 :200 dilution) was added to cells, which were incubated for 2 h at room temperature. Afterwards, cells were washed with PBS and 20 μΐ/well HOECHST 33342 dye solution (5 g/ml) was added to cells and cells were incubated 12 min at room temperature in the dark. Cells were washed twice with PBS then covered with PBS and stored at 4 C until analysis. Images were acquired with a Perkin Elmer OPERA™ High- Content Analysis reader. Images were analyzed with image analysis software MetaXpress™ from Molecular devices utilizing the Cell Cycle application module. In this assay both labels HOECHST 33342 and phosphorylated Histone H3 on serine 10 were measured. HOECHST 33342 labels DNA and is used to count cell number. The staining of phosphorylated Histone H3 on serine 10 determines the number of mitotic cells. Inhibition of Mps-1 decreases the number of mitotic cells in the presence of nocodazole indicating an inappropriate mitotic progression. The raw assay data were further analysed by four parameter logistic regression analysis to determine the ICso value for each tested compound.
Hydrolytic stability Assay
The hydrolytic stability assay investigates the stability of a compound in an aqueous buffer system. Standard solution stability assay is run in 0.05 M Phosphate buffer at pH 7.4 (pH of blood plasma) at 37 C. As compounds in the Gl tract are exposed to a wide variety of pHs any relevant pH (as pH 2 to simulate the acidic condition of the Gl tract in the following experiment) can be chosen. Compounds are incubated in relevant solution at 37 C and analyzed by HPLC immediately after incubation and after 1 , 2 and 24 hrs. Degredation rate (decay in %) is calculated by relating peak areas after 1 , 2 and 24 hrs to the time zero injection.
Compound is available as 10 mM in DMSO (solution 1 ). 2.5 μΙ_ of solution 1 is dissolved in 1 mL acetonitrile leading to solution 2. Poorly soluble compounds may demand another dilution step of solution 2 (1 :5 and 1 : 10 respectively) in Acetonitrile). Solution 2 is incubated at 37 C in a tempered HPLC autosampler. 1 rrsL buffer pH 2 is transferred into an HPLC vial. 100 μί of solution 2 is added to the buffer pH 2 solution and mixed thoroughly. Immediately after mixing the combined solution is injected into the HPLC to give the time zero injection. Injections are repeated after 1 , 2 and 24 hrs. The degredation rate (decay in %) is calculated using HPLC software Millennium and Excel respectively.
Figure imgf000115_0001
Example01.28 < 10 %
Example01.29 < 10%
Example02.1 < 10%
Example02.2 < 10%
Example02.3 < 10%
Example02.4 < 10%
Example02.5 < 10%
Example02.6 < 10%
Example02.7 < 10%
Example02.8 < 10%
Example02.9 < 10%
Example02.10 < 10%
Example02.11 < 10%
Example02.12 < 10%
Example02.13 < 10%
Example02.14 < 10%
Example02.15 < 10%
Example02.16 < 10%
Example02.17 < 10%
Example02.18 < 10%
Example02.19 < 10%
Example02.20 < 10%
Example02.21 < 10%
Example02.22 < 10%
Example02.23 < 10%
Example02.24 < 10%
Example03.1 < 10%
Example04.1 < 10%
Example05.1 < 10%
Example06.1 < 10%
Example06.2 < 10%
Example06.3 < 10%
Example06.4 < 10%
Example06.5 < 10%
Example07.1 < 10%
Example08.1 < 10% Comparison with compounds specified in WO201 1/063908 Hydroiytic stability:
Figure imgf000117_0001
Figure imgf000118_0001
The half maximal inhibitory concentration (ICM) of the most potent compounds specified in WO201 1 /063908, determined in an Mps- 1 kinase assay with a concentration of 10 μΜ ATP, was lower than 2 nM (more potent than 2 nM).
However, all these compounds show either an ICso higher than 30 nM (less potent than 30 nM) in an Mps- 1 kinase assay with a concentration of 2 mM ATP, or they show a low hydrolytic stability at pH 2 with more than 1 5 % decay after 24 h.
Preferred compounds A of the present invention are characterized by
an ICbo lower than 2 nM (more potent than 2 nM) in an Mps- 1 kinase assay with a concentration of 10 μΜ ATP, and
- an ICso lower than 30 nM (more potent than 30 nM) in an Mps- 1 kinase assay with a concentration of 2 mM ATP, and
a high hydrolytic stability, with less than 10 % decay after 24 h at pH 2.
Determination of metabolic stability in vitro
(including calculation of hepatic in vivo blood clearance (CL) and of maximal oral bioavailability (Fmax))
The metabolic stability of test compounds in vitro was determined by incubating them at 1 μΜ with a suspension liver microsomes in 100 mM phosphate buffer, pH7.4 (NaH2P04 x H20 + Na2HP04 x 2H20) at a protein concentration of 0.5 mg/mL and at 37 C. The reaction was activated by adding a co-factor mix containing 1 .2 mg NADP, 3 !U glucose-6-phosphate dehydrogenase, 14.6 mg glucose-6-phosphate and 4.9 mg MgC in phosphate buffer, pH 7.4. Organic solvent in the incubations was limited to <0.2 % dimethylsulfoxide (DMSO) and < 1% methanol. During incubation, the microsomal suspensions were continuously shaken and aliquots were taken at 2, 8, 16, 30, 45 and 60 min, to which equal volumes of cold methanol were immediately added. Samples were frozen at -20 C over night, subsequently centrifuged for 15 minutes at 3000 rpm and the supernatant was analyzed with an Agilent 1200 HPLC-system with LCMS/MS detection. The half-life of a test compound was determined from the concentration-time plot. From the half-life the intrinsic clearances were calculated. Together with the additional parameters liver blood flow, specific liver weight and microsomal protein content the hepatic in vivo blood clearance (CL) and the maximal oral bioavailability (Fmax) were calculated for the different species. The following parameter values were used: Liver blood flow - 1 .3 L/h/kg (human), 2.1 L/h/kg (dog), 4.2 L/h/kg (rat); specific liver weight - 21 g/kg (human), 39 g/kg (dog), 32 g/kg (rat); microsomal protein content - 40 mg/g.
With the described assay only phase-l metabolism of microsomes is reflected, e.g. typically oxidoreductive reactions by cytochrome P450 enzymes and flavin mono-oxygenases (FMO) and hydrolytic reactions by esterases (esters and amides).
Specified compounds A of the present invention are characterized by the values of maximum oral bioavailability (Fmax) in rat, dog and humans (determined by means of liver microsomes as described above) shown in the table below:
Figure imgf000120_0001
In a preferred embodiment, the compounds A of the present invention are characterized by the following attributes:
The IC50 determined in an Mps-1 kinase assay with a concentration of 10 μΜ ATP (as described above) is lower than or equal to 1 nM.
The IC50 determined in an Mps-1 kinase assay with a concentration of 2 mM ATP (as described above) is lower than 10 nM. The IC50 of preferred compounds is even lower than 5 nM. The IC50 of more preferred compounds is even lower than 3 nM. The IC¾ of most preferred compounds is even lower than 2 nM. The maximum oral bioavailability (Fmax) in rat (determined by means of rat liver microsomes as described above) is higher than 50 %. The Fmax of preferred compounds is even higher than 70 %. The Fmax of more preferred compounds is even higher than 80 %.
The maximum oral bioavailability (Fmax) in dog (determined by means of dog liver microsomes as described above) is higher than 45 %. The Fmax of preferred compounds is even higher than 52 %. The Fmax of more preferred compounds is even higher than 70 %.
The maximum oral bioavailability (Fmax) in human (determined by means of human liver microsomes as described above) is higher than 45 ¾. The Fmax of preferred compounds is even higher than 60 %. The Fmax of more preferred compounds is even higher than 85 %.
The IC¾) determined in a HeLa cell proliferation assay (as described above) is lower than 600 nM. The IC¾ of preferred compounds is even lower than 400 nM. The ICso of more preferred compounds is even lower than 200 nM. The ICso of most preferred compounds is even lower than 100 nM.
The following table demonstrates the superiority of preferred compounds A of the present invention.
Figure imgf000122_0001
Figure imgf000123_0001
Preferred
Example 92 64 1.01
Q Preferred
Example 93 55
1.03
Preferred
Example 58 48
1.09
Preferred
Example 83 86 1.07
Preferred
Example 87 94 1.04
Figure imgf000125_0001
Figure imgf000126_0001
Figure imgf000126_0002
WO 201 1 / 064328 A1 1 1 .083 32 nM
WO 201 1 / 064328 A1 1 1 .084 40 nM
WO 201 1 /064328 A1 1 1 .085 1800 nM
WO 201 1 / 064328 A1 1 1 .086 2200 nM
WO 201 1 / 064328 A1 1 1 .087 870 nM
WO 201 1 / 064328 A1 1 1 .088 15 nM
WO 201 1 / 064328 A1 1 1 .089 25 nM
WO 201 1 / 064328 A1 1 1 .091 1300 nM
WO 201 1 / 064328 A1 1 1 .092 820 nM
WO 201 1 / 064328 A1 1 1 .093 2400 nM
WO 201 1 / 064328 A1 1 1 .094 1400 nM
WO 201 1 / 064328 A1 1 1 .095 2000 nM
WO 201 1 / 064328 A1 1 1 .096 1900 nM
Figure imgf000127_0001
Examples demonstrating the synergistic effect of the combinations of compounds A and B of the present invention
Cell lines and culture conditions:
Unless otherwise indicated, media and supplements for cell culture were purchased from Gibco-Life Technologies Corporation (Carlsbad, CA, USA) and plastic ware from Corning B.V. Life Sciences (Corning, NY, USA). Wild type, Bax" and TP53 '~ human colon carcinoma HCT 1 16 cells (kindly provided by Bert Vogelstein, Johns Hopkins Kimmel Cancer Center, Baltimore, MD, USA) were routinely maintained in McCoy's 5A medium supplemented with 10% fetal calf serum (FCS), 10 mM HEPES buffer, 100 units/mL penicillin G sodium and 100 Mg/mL streptomycin sulfate. Wild type, Bak ' and Bak ! Bax mouse embryonic fibroblasts MEFs cells were routinely maintained in DMEM medium supplemented with 10% fetal calf serum (FCS), 10 mM HEPES buffer, 100 units/mL penicillin G sodium, 100 g/mL streptomycin sulfate and non essential amino acids. Cells were seeded onto the appropriate supports (6-, 12-, 24- or 96-well plates) 24 h before the beginning of experiments.
Chemicals:
The pan-caspase inhibitor Z-VAD-fmk (N-benzyloxycarbonyl-Val-Ala- Asp.fluoromethylketone) was obtained from Bachem Bioscience (Bubendorf, Switzerland) and stocked as a 50 mM solution in DMF. C/'s- diammineplatinum(ll) dichloride (cisplatin, CDDP) and anthra [1 ,9-cd] pyrazole-6 (2H)-one (SP600125) were purchased from Sigma-Aldrich (St Louis, MO, USA). The Bcl-2 inhibitor ABT-737 was purchased from Selleckchem.com and a stock solution of 100 mM in DMSO was prepared. An appropriate volume of DMSO and/or DMF was always employed to provide negative control conditions. Cytofluorometric studies: For the simultaneous quantification of plasma membrane integrity and mitochondrial transmembrane potential (ΔΨη), cells were collected and stained with 1 pg/mL propidium iodide (PI, which only incorporates into dead cells, from Sigma-Aldrich) and 40 nM 3,3'-dihexyloxacarbocyanine iodide (DiOC6(3), a Δψ,,Γ sensitive dye, from Molecular Probes-lnvitrogen, Eugene, OR, USA) for 30 min at 37 C [Galluzzi et al. Cell Death Differentiation 2009, 16, 1093-1 107; Kepp et al. Nat. Rev. Drug Discovery 201 1 , 10, 221 -237] . For the assessment of cell cycle distribution, cells were collected, washed once with 0.1% (w/v) D-glucose (Sigma-Aldrich) in PBS, and then fixed by gentle vortexing in ice-cold 80% (v/v) ethanol (Carlo Erba Reagents, Milano, Italy) for 30 sec. After overnight incubation at -20 C, samples were centrifuged to remove ethanol and stained with 50 g/mL PI in 0.1% (w/v) D-glucose in PBS supplemented with 1 g/mL (w/v) RNAse A (Sigma-Aldrich) for 30 min at 37 C. Afterwards, samples were incubated for at least 2 h at 4 C before cytofluorometric analysis. For the EdU assay, cells were incubated with 10 μΜ EdU for 30 min at 37 C, fixed, permeabilized and stained with the fluorescent dye azide (Click-iT™ reaction cocktail, from Invitrogen) and PI, according to the manufacturer's instructions. Cytofluorometric acquisitions were performed by means of a FACSCalibur (BD Biosciences, San Diego, CA, USA) or a FACScan (BD Biosciences) cytofluorometer equipped with a 70 m nozzle or with a Gallios cytofluorometer (Beckman Coulter, Miami, FL, USA). Data were statistically evaluated using the CellQuest™ (Becton Dickinson) or Kaluza (Beckman Coulter) software. Only the events characterized by normal forward scatter (FSC) and side scatter (SSC) parameters were gated for inclusion in the statistical analysis.
RNA interference:
The knockdown of proteins reported in Table 4S was performed with validated specific small interfering RNAs (siRNA) purchased from Sigma-Proligo. Alternatively, siRNA duplexes for the downregulation of AURKA (SIHK0142) were purchased from Sigma-Aldrich and siRNAs for the downregulation of BAK1 and BAX (Hs_BAK1_5 and Hs_BAX_10 HP Validated siRNAs, respectively) from Qiagen (Hilden, Germany). Cells pre-seeded in 12-well plates were transfected with siRNAs at 30-40% confluence by means of the HiPerFect · transfection reagent (Qiagen), as previously described. After 48 or 72 h, transfection efficiency was determined by immunoblotting.
Table 4S: siRNAs sequences
Target Sequence Reference
UNR 5' GCCGGUAUGCCGGUUAAGU 3'
APAF-1 5' GAGCAGCUAUGCUGAUUAA 3' (Zermati et al 2007)
APC 5' GGAAGUAUUGAAGAUGAAG 3' (Huang and Guo 2006)
ATM 5' AACAUACUACUCAAAGACA 3' (Olson et al 2006)
ATR 5' CCUCCGUGAUGUUGCUUGA 3' (Myers and Cortez 2006)
BAK1 Hs_BAK1_5 (Qiagen) (de La Motte Rouge et al
BAX Hs_BAX_10 (Qiagen) (de La Motte Rouge et al
BCL2 5 -GCUGCACCUGACGCCCUUC-3' (Maley et al 2004)
BCL2XL 5' CAGGGACAGCAUAUCAGAG 3' (Jiang and Milner 2003)
BECN1 5' GAUUGAAGACACAGGAGGC 3' (Boy a et al 2005)
BRCA1 5' GCAACCUGUCUCCACAAAG 3' (Lou et al 2003)
BRCA2 5' CUGAGCAAGCCUCAGUCAA 3' (Fan et al 2006)
BUB1 5'AUACCACAAUGACCCAAGA 3' (Johnson et al 2004)
BUBR1 5' AAGGGAAGCCGAGCUGUUGAC 3' (Wang et al 2004)
CENPE 5' GGCUACAAUGGUACUAUAU 3' (Johnson et al 2004)
CHK1 5' UCGUGAGCGUUUGUUGAAC 3' (Pichierri and Rosselli 2004)
CHK2 5' UGUGUGAAUGACAACUACU 3' (Vitale et al 2007)
CLIP1 5' CUGCAAUGACGACGAAACC 3' (Tanenbaum et al 2006)
HSET Smart-pool L-004958 (Dharmacon) (Vitale et al 2010)
LKB1 5' GGACUGACGUGUAGAACAA 3' (Zhong et al 2008)
MAD2 5' ACCUUUACUCGAGUGCAGA 3' (Nitta et al 2004)
MCL1 5' CGGGACUGGCUAGUUAAACAA 3' (Kepp et al 2009)
MOS 5' GCCCGCGAACAUCUUGAUC 3' (Vitale et al 2010)
MPS1 (1 ) 5' CCCAGAGGACUGGUUGAGU 3' (Stucke et al 2004)
MPS1 (2) 5' GCACGUGACUACUUUCAAA 3' (Xu et al 2009) p14ARF 5' GCUUCCUAGAAGACCAGGU 3' (Ma and Pederson 2007) p15INK4 5' GGGAUAUUUAGGAGUGUGU 3' (Chen et al 2006) p16INK4 5' CGCACCGAAUAGUUACGGU 3' (Gabriely et al 201 1 ) p21 5' CUUCGACUUUGUCACCGAG 3' (Spierings et al 2004) ρ38Π 5' GCAAGAAACUAUAUUCAG 3' (Gao et al 2004) p53 5' GACUCCAGUGGUAAUCUAC 3' (Brummelkamp et al 2002) p63 5' CCAUGAGCUGAGCCGUGAA 3' (Lee et al 2006) p73 5' ACGUCCAUGCUGGAAUCCG 3' (Toscano et al 2007)
PAW Smart-pool M-004434 (Dharmacon)
PLK1 5' CGAGCUGCUUAAUGACGAG 3' (Gimenez-Abian et al 2004)
PLK4 5' GCCAUGUACAAAGCAGGAA 3' (Li et al 2005)
PTEN 5' GUCAGAGGCGCUAUGUGUA 3' (Rottmann et al 2008)
TNKS 5' CAAUUCACCGUCGUCCUCU 3' (Chang et al 2005)
UVRAG 5' CAUCAGCUCCUUGAUACCUACUUUA (Itakura et al 2008)
VDAC1 5' GUACGGCCUGACGUUUACA 3' (Criollo et al 2007) Results:
HCT1 16 and MEF cells were transfected with 36 distinct siRNAs that target cell cycle or cell death-relevant genes/proteins. Among this collection, three siRNAs that deplete one of the three anti-apoptotic multidomain proteins of the Bcl-2 family (Bcl-2, BCI-XL, Mcl-1 ) were found to be particularly efficient in sensitizing the cells to BAY 2 or BAY 3-induced killing (Fig. 1 A). Conversely, siRNAs targeting either of the two pro-apoptotic multidomain proteins of the Bcl-2 family (Bax, Bak) avoided the loss of cellular viability induced by BAY 2 or BAY 3 (Fig. 1A).
Moreover, depletion of Apaf- 1 , the essential co-activator of caspase-9 acting downstream of mitochondria (Galluzzi et al), protected against killing by Mps- 1 inhibition. Accordingly, the knockout of Bax, Bak or both greatly reduced cell killing by BAY 2 and BAY 3 (Fig. 1 B,C), and neutralization of Bcl-2 and Bcl- XL with ABT737 sensitized to cell death induction by BAY 2 and BAY 3 (Fig. 1 D). The proteins of the Bcl-2 family are known to regulate apoptosis through their capacity to regulate mitochondrial membrane permeabilization and caspase activation [Kroemer et al. Phys. Rev. 2007, 87, 99-163]. Accordingly, BAY 2 and 3 induced the release of cytochrome c from mitochondria to cytosol, preceding the activation of caspase-3 (Fig. 1 E), and inhibition of caspases by Z-VAD-fmk reduced killing by BAY 2 or BAY 3 (Fig. 1 F).
Description of the Figures Figures 1A to 1 F: Depletion or pharmacological inhibition of anti-apoptotic proteins of the Bcl-2 family sensitizes tumor cells to Mps-1 inhibitors BAY 2 and BAY 3.
Fig 1A: Human colorectal carcinoma HCT1 16 cells transfected with a control siRNA (siUNR) or with a panel of validated siRNAs directed against the reported proteins were treated 24h later with 1 μΜ BAY 2 or BAY 3 for additional 48 h. Thereafter apoptosis-associated parameters were assessed by co-staining with DiOC6(3)/P! and cytofluorimetric analyses. The figure reports the unsupervised hierarchical clustering of the effects of the siRNA screen on the response to the drugs. Green and red boxes depict siRNA-mediated cytoprotection (Δ < 0) and chemosensitization (Δ > 0), respectively. Δ represents the difference between the percentage of death in cell transfected with the reported siRNAs then left untreated or treated with BAY 2 or BAY 3 and the percentage of apoptosis in siUNR-transfected cells in the same condition.
Figs. 1 B -1 D: HCT1 16 cells or immortalized MEFs with the illustrated genetic background, as well as WT HCT1 16 pre-exposed for 3h to the BCI-2/BCI-XL inhibitor ABT-737, were kept in control conditions or incubated for 72 h with BAY 2 or BAY 3 at the depicted dose (usually 1 μΜ). Thereafter, cell were collected and analyzed by DiOC6(3)/PI co-staining.
Fig. 1 E: BAY 2- or BAY 3- treated HCT 1 16 cells were co-immunostained with antibodies directed against cytochrome c (CYT C) and activated caspase-3 (CASP3a) followed by quantification of the percentage of cells presenting exhibiting diffuse CYT C staining or caspase-3 activation as determined by fluorescence microscopy. Nuclei were counterstained with Hoechst 33342. Representative fluorescence microphotographs of HCT1 16 cells treated with 1 μΜ BAY 2 for 72 h and quantitative results at (means ± SEM, n = 4) are shown. Scale bar = 10 μητι.
Fig. 1 F: Upon 24 h of pre-treatment with the pancaspase inhibitor Z-VAD-FMK, HCT 1 16 cells were subjected to BAY 2 or BAY 3 administration followed by cytofluorometric assessment of cell death-related parameters as described in panel B-D. Means ± SEM; n = 4. In Fig.s 1 B, 1 C, 1 D and 1 F, white and black columns illustrate the percentage of dying (PI" DiOC6(3)'OW) and dead (PI ) cells, respectively (means ± SEM, n = 3) .
Conclusions:
The depletion or pharmacological inhibition of the anti-apoptotic proteins of the Bcl-2 family, such as Bcl-2, BCI-XL, Mcl- 1 sensitized to Mps- 1 inhibitors, while the depletion of the pro- apoptotic proteins Bax and Bak reduced Mps- 1 inhibitor-mediated killing of tumor cells. These results suggest that combination treatment of tumor cells with inhibitors of anti-apoptotic proteins of the Bcl-2 family and Mps- 1 inhibitors has superior therapeutic efficacy as compared to the respective single agent treatments.
References
Boya P, Gonzalez-Polo R A, Casares N, Perfettini JL, Dessen P, Larocheite N et al (2005). Inhibition of macroautophagy triggers apoptosis. Molecular and cellular biology 25: 1 025- 1 040.
Brummelkamp TR, Bernards R, Agami R ( 2002 ). A system for stable expression of short interfering RNAs in mammalian cells. Science 296: 550-553. Chang P, Coughlin M, M itchison TJ (2005). Tankyrase- 1 polymerization of poly(ADP- ribose) is required for spindle structure and function. Nature cell biology 7: 1 133- 1 139.
Chen Z, Li DQ, Tong L, Stewart P. Chu C, Pflugfelder SC (2006). Targeted inhibition of p57 and p 15 blocks transforming growth factor beta- inhibited proliferation of primary cultured human limbal epithelial cells. Molecular vision 12: 983-994.
Criollo A, Galluzzi L, Maiuri MC, Tasdem ir E, Lavandero S, Kroemer G (2007).
Mitochondrial control of cell death induced by hyperosmotic stress. Apoptosis : an international journal on programmed cell death 12: 3- 18. de La Motte Rouge T, Galluzzi L, Olaussen K.A, Zermati Y, Tasdemir E, Robert T et al (2007). A novel epidermal growth factor receptor inhibitor promotes apoptosis in non- small ceil lung cancer ceils resistant to eriotinib. Cancer Res 67: 6253-6262. Fan S, Meng Q, Aubom K, Carter T, Rosen EM (2006). BRCA l and BRCA2 as molecular targets for phytochemieals indole-3-carbinol and genistein in breast and prostate cancer ceils. British journal of cancer 94: 407-426.
Gabriely G, Yi M, arayan RS. Niers JM, Wurdinger T, I mitola J et al (201 1). Human glioma growth is controlled by microRNA- lOb. Cancer Res 71 : 3563-3572.
Gao X, Wang H, Sairenj i T (2004). Inhibition of Epstein-Barr virus (EBV) reactivation by short interfering RNAs targeting p38 mitogen-activated protein kinase or c-myc in EBV-positive epithelial cells. Journal of virology 78: 1 1798- 1 1806.
Gimenez-Abian JF, Sumara I, Hirota T, Hauf S, Geriich D, de la Torre C et al (2004). Regulation of sister chromatid cohesion between chromosome arms. Current biology : CB 14: 1 1 7- 1 1 93. Huang X, Guo B (2006). Adenomatous polyposis coli determines sensitivity to histone deacetylase inhibitor-induced apoptosis in colon cancer cells. Cancer Res 66: 9245- 925 1 .
I takura E, Kishi C, !noue K. Mizushima N (2008). Becl in 1 forms two distinct
phosphatidyl inositol 3 -kinase complexes with mammalian AtgI4 and UVRAG. Mol Biol Cell 19: 5360-5372. Jiang M, Milner .1 (2003). Bcl-2 constiiutively suppresses p53-dependent apoptosis in colorectal cancer cells. Genes & development 17: 832-837.
Johnson VL, Scott MI, Holt SV, Hussein D, Taylor SS (2004). Bub l is required for kinetochore localization of BubRl, Cenp-E, Cenp-F and Mad 2, and chromosome congression. Journal of cell science 117: 1577- 1589.
Kepp O, Gottschalk K, Churin Y, Rajalingam K, Brinkmann V, Machuy N et al (2009). Bim and Bmf synergize to induce apoptosis in Neisseria gonorrhoeae infection. PLoS pathogens 5: el000348.
Lee HO, Lee JH, Choi E, Seoi JY, Yun Y, Lee H (2006). A dominant negative form of p63 inhibits apoptosis in a p53- independent manner. Biochemical and biophysical research communications 344: 166- 172.
Li J, Tan M, Li L, Pamarthy D, Lawrence TS, Sun Y (2005). SAK, a new polo-like kinase, is transcriptionally repressed by p53 and induces apoptosis upon RNAi. silencing. Neoplasia 7: 312-323. Lou Z, Chin i CC, Minter-Dykhouse K, Chen J (2003). Mediator of DNA damage checkpoint protein 1 regulates BRCA l localization and phosphorylation in DNA damage checkpoint control. The Journal of biological chemistry 278: 13599- 13602.
Ma H, Pederson T (2007). Depletion of the nucleolar protein nucleostemin causes Gl cel l cycle arrest via the p53 pathway. Mol Biol Cell 18: 2630-2635.
Maley CC, Galipeau PC, Li X, Sanchez CA, Paulson TG, Blount PL et al (2004). The combination of genetic instability and clonal expansion predicts progression to esophageal adenocarcinoma. Cancer Res 64: 7629-7633.
Myers JS, Cortez D (2006). Rapid activation of ATR by ionizing radiat ion requires ATM and Mrel l . The Journal of biological chemistry 281 : 9346-9350.
Nitta M, Kobayashi O, Honda S, H i rot a T, Kun inaka S, Marumoto T et al (2004). Spindle checkpoint function is required for mitotic catastrophe induced by DNA- damaging agents. Oncogene 23: 6548-6558.
Olson E, Nievera CJ, Kl imovieh V, Fanning E, Wu X (2006). RPA2 is a direct downstream target for ATR to regulate the S-phase checkpoint. The Journal of biological chemistry 281 : 39517-39533.
Pichierri P, Rosselli F (2004). The DNA crosslink-induced S-phase checkpoint depends on ATR-CHK1 and A TR-N BS 1 -FANCD2 pathways. The EMBO journal 23: 1 178- 1 187.
Rottmann S, Speckgens S, Luscher-Firzlaff J, Luscher B (2008). Inhibition of apoptosis by MAD I is mediated by repression of the PTEN tumor suppressor gene. FASEB journal : official publication of the Federation of American Societies for Experimental
Biology 22: 1 124- 1 134.
Spielings DC, de Vries EG, Stel AJ, te Rietstap N, Vellenga E, de Jong S (2004). Low p21 Wafl/Cipl protein level sensitizes testicular germ cel l tumor cells to Fas-mediated apoptosis. Oncogene 23: 4862-4872.
Stucke VM, Baumann C, Nigg EA (2004). Kinetochore local ization and m icrotubule interaction of the human spindle checkpoint kinase Mpsl . Chromosoma 113: 1- 15.
Tancnbaum ME, Galjart N, van Vugt MA, Medema RH (2006). CLIP- 170 facilitates the formation of k inetochorc-microtubule attachments. The EMBO journal 25: 45-57.
Toscano F, Parmentier B, Fajoui ZE, Estomes Y, Chayviaile JA, Saurin JC et al (2007). p53 dependent and independent sensitivity to oxaliplatin of colon cancer cel ls.
Biochemical pharmacology 74: 392-406.
Vitaie I, Galluzzi L, Vivet S, Nanty L, Dessen P, Senov il la L et al (2007). Inhibition of Chkl kills tetraploid tumor ceils through a p53-dependent pathway. PloS one 2: e l 37.
Vitaie I, Senovilla L, Jemaa M, Michaud M, Galluzzi L, Kepp O et al (2010). Multipolar mitosis of tetraploid cells: inhibition by p53 and dependency on Mos. The EMBO journal 29: 1 272- 1 284. Wang Q, Liu T. Fang Y, Xie S, Huang X, Mahmood R et al (2004). BUBR l deficiency results in abnormal megakaryopoiesis. Blood 103: 1278- 1285.
Xu Q, Zhu S, W ang W, Zhang X, Old W, Aim N et al (2009). Regulation of kinetochorc recruitment of two essential mitotic spindle checkpoint proteins by Mpsl
phosphorylation. Mol Biol Cell 20: 10-20.
Zermati Y, Mouhamad S, Stergiou L, Besse B, Galluzzi L, Boehrer S et al (2007). Nonapoptotic role for Apaf- 1 in the DNA damage checkpoint. Mol Cell 28: 624-637. Zhong D, Liu X, Kliuri FR, Sun SY, Vertino PM, Zhou W (2008). LKB 1 is necessary for Akt-mediated phosphorylation of proapoptotic proteins. Cancer Res 68: 7270-7277.

Claims

1. Combination of at least two compounds A and B, compound A being an inhibitor of Mps-1 kinase, and compound B being an inhibitor of an anti- apoptotic protein of the Bcl-2 family.
2. The combination according to claim 1 , wherein the compound A is selected from the group of compounds of general formula (I) :
Figure imgf000138_0001
in which :
represents a group selected from:
-N(H)C(=0)R6, -C(=0)N(H)R6 ; each
RA2 independently represents halo-, hydroxy-, nitro-, G-Ce-alkyl-,
CrC6-alkoxy-, hydroxy-Ci -C6-alkyl-, -N(H)C(=0)R8, -N(H)C(=0)NR8R7,
-C(=0)N(H)R8 or -N(H)S(=0)2R8; represents a
Figure imgf000138_0002
group; wherein * indicates the point of attachment of said group with the rest of the molecule;
R3 represents a hydrogen atom, a halogen atom, a hydroxy-, amino-, cyano-, nitro-, G-Cralkyl-, halo-CrC4-alkyl-, G-Ccalkoxy-,
halo-Ci-C4-alkoxy-, hydroxy-Ci-C4-alkyl-, Ci -C4-alkoxy-CrC4-alkyl-,
halo-CrC4-alkoxy-Ci -C4-alkyl-, G-Ce-alkenyl-, C2-C6-alkynyl-,
halo-C2-C6-alkenyl-, halo-C2-C6-alkynyl-, C3-C6-cycloalkyl-, or
a halo-CrC6-cycloalkyl- group;
R4 represents a hydrogen atom, a halogen atom, a hydroxy-, amino-, cyano-, nitro-, G-C4-alkyl-, halo-CrC4-alkyl-, G-C4-alkoxy-,
halo-CrC4-alkoxy-, hydroxy-Ci -C4-alkyl- , G-C4-alkoxy-Ci-C4-alkyl-,
halo-CrC4-alkoxy-Ci -C4-alkyl-, d-Ce-alkenyl-, C2-C6-alkynyl-,
halo-C2-C6-alkenyl-, halo-C2-C6-alkynyl-, CrC6-cycloalkyl-, or
a halo-CrC6-cycloalkyl- group;
R5 represents a hydrogen atom or a G-Cralkyl- group ; R a represents a group selected from:
cyano-, halo-, nitro-, G-Ce-alkyl-, halo-G-C6-alkyl-, G-C6-alkoxy-,
halo-G-C6-alkoxy-, hydroxy-CrCe-alkyl-, G-C6-alkoxy-G-C6-alkyl-,
halo-CrC6-alkoxy-Ci-C6-alkyl-, R8-(G-C6-alkoxy)-, R8-0-, NR8R7,
R8-S-, R8-S(=0)-, R8-S(=0)2- , (C3-C6-cycloalkyl)-(CH2)n-0-;
R b represents a group selected from:
hydrogen, halo-, hydroxy-, cyano-, nitro-, G-C6-alkyl-, halo-G-C6-alkyl-,
G-C6-alkoxy-, halo-G-C6-alkoxy-, hydroxy-G-C6-alkyl-,
G-C6-alkoxy-G-C6-alkyl-, halo-G-C6-alkoxy-G -C6-alkyl-,
R8-(G-C6-alkyl)-, R8-(CH2)n(CHOH)(CH2)m-, R8-(Ci-Cs-alkoxy)-, R8-(CH2)n(CHOH)(CH2)p-0-, R8-(Ci-C6-alkoxy-Ci-C6-alkyl)-,
R8-(CrC6-alkoxy-Ci-C6-alkyl)-0-, -0-(CH2)n-C(=0)NR8R7, R8-0-,
-C(=0)R8, -C(=0)0-R8, -0C(=0)-R8, -N(H)C(=0)R8, -N(R7)C(=0)R8,
-N(R7)C(=0)OR8, -N(H)C(=0)NR8R7, -N(R7)C(=0)NR8R7, NR8R7, NR7R7,
-C(=0)N(H)R8, -C(=0)NR8R7, R8-S-, R8-S(=0)-, R8-S(=0)2-, R7-S(=0)2-,
-N(H)S(=0)R8, -N(R7)S(=0)R8, -S(=0)N(H)R8, -S(=0)NR8R7, -N(H)S(=0)2R8,
-N(R7)S(=0)2R8, -S(=0)2N(H)R8, -S(=0)2NR8R7, -5(=0)(=NR8)R7,
-5(=0)(=NR7)R8, -N=5(=0)(R8)R7; R6 represents a group selected from CrC6-cycloalkyl-, 3- to 10-membered heterocycloalkyl-, aryl-, heteroaryl-, -(CH2)Q- (C3-C6-cycloalkyl),
-(CH2)q-(3- to 10-membered heterocycloalkyl), -(CH2)q-aryl, or
-(CH2)q-heteroaryl,
wherein said group is optionally substituted, one or more times, identically or differently, with a substituent selected from:
halo-, hydroxy-, cyano-, nitro-, G-C6-alkyl-, halo-G-C6-alkyl-,
C C6-alkoxy-, halo-G-Ce-alkoxy-, hydroxy-G-Ce-alkyl-,
CrC6-alkoxy-Ci-C6-alkyl-, halo-Ci-C6-alkoxy-Ci -C6-alkyl-,
-N(H)R8; -N(R7)R8, N(H)(R8)-C,-Cralkyl-, N(R7)(R8)-Ci-Cralkyl- ;
R7 represents a hydrogen atom, a Ci-Ce-alkyl- or a C3-C6-cycloalkyl- group;
R8 represents a hydrogen atom or a G-Ce-alkyl- or CrCe-cycloalkyl- group, wherein said Ci-C6-alkyl- or C3-C6-cycloalkyl- group is optionally substituted, one or more times, identically or differently, with a substituent selected from:
halo-, hydroxy-, G-Cralkyl-, G-Cralkoxy-, halo-G-Cs-alkoxy-;
or
R7 and R8 together with the molecular fragment they are attached to represent a 4- to 6-membered heterocyclic ring, which is optionally substituted, one or more times, identically of differently, with a halogen atom, a G-C3-alkyl-, halo-G-C -alkyl- or d-Cralkoxy- group;
Q1 represents a group selected from: N, CH, C-(G-C6-alkyl),
C-(CrC6-alkoxy), C-halo;
Q2 represents a group selected from: N, CH, C b;
Q3 represents a group selected from: N, CH, CR b; n, m, p,
represent, independently from each other, an integer of 0, 1 , 2 or 3; q represents an integer of 1 , 2 or 3; and
t represents an integer of 0, 1 or 2; or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a mixture of same.
3. The combination according to claim 2, wherein
R5a represents a group selected from:
halo-, nitro-, G-Ce-alkyl-, halo-G-C6-alkyl-, G-C6-alkoxy-,
halo-CrC6-alkoxy-, hydroxy-G -C6-alkyl- , G-C6-alkoxy-G-C6-alkyl-,
halo-Ci-C6-alkoxy-C, -C6-alkyl-, R8-(G-C6-alkoxy)-, R8-0-, NR8R7,
R8-S-, R8-S(=0)-, R8-S(=0)2-, (CrC6-cycloalkyl)-(CH2)n-0-;
and
R b represents a group selected from:
halo-, hydroxy-, cyano-, nitro-, G-C6-alkyl-, halo-G-C6-alkyl-, G-Ce-alkoxy-, halo-G-Ce-alkoxy-, hydroxy-G -C6-alkyl- ,
CrC6-alkoxy-CrC6-alkyl- , halo-G-Ce-alkoxy-G -Ce-alkyl-,
R8-(CrC6-alkyl)- , R8-(CH2)n(CHOH)(CH2)m-, R8-(Ci-C6-alkoxy)- ,
R8- (CH2)n(CHOH)(CH2)P-0-, R8-(Ci-C6-alkoxy-C,-C6-alkyl)- ,
R8-(CrC6-alkoxy-C,-C6-alkyl)-0-, -0-(CH2)n-C(=0)NR8R7, R8-0-,
-C(=0)R8, -C(=0)0-R8, -OC(=0)-R8, -N(H)C(=0)R8, -N(R7)C(=0)R8,
-N(R7)C(=0)OR8, -N(H)C(=0)NR8R7, -N(R7)C(=0)NR8R7, NR8R7, NR7R7,
-C(=0)N(H)R8, -C(=0)NR8R7, R8-S-, R8-S(=0)-, R8-S(=0)2-, R7-5(=0)2-,
-N(H)S(=0)R8, -N(R7)S(=0)R8, -S(=0)N(H)R8, -S(=0)NR8R7, -N(H)S(=0)2R8, -N(R7)S(=0)2R8, -S(=0)2N(H)R8, -S(=0)2NR8R7, -S(=0)(=NR8)R7,
-S(=0)(=NR7)R8, -N=S(=0)(R8)R7.
4. The combination according to claim 2 or 3, wherein
R5 represents a hydrogen atom ;
R a represents a group selected from: G -C2-alkoxy- , halo-CrC2-alkoxy-; R6 represents a
Figure imgf000142_0001
group ;
wherein * indicates the point of attachment of said group with the rest of the molecule ;
R9 represents a group selected from: methyl- , hydroxy-methyl- , -NH2;
R'° represents a hydrogen atom or a methyl- group ;
and
Q\ Q2, and Q3 represent CH. combination according to any one of claims 2 to 4, wherein
represents a group selected from:
-C(=0)N(H)R8, -C(=0)NR8R7; R7 represents a G -G-alkyl- group;
R8 represents a hydrogen atom or a Ci -C^-alkyl- group;
wherein said C i -Cralkyl- group is optionally substituted, one or more times, with a halogen atom ;
or
R7 and R8 together with the molecular fragment they are attached to represent a 4- to 6-memberered heterocyclic ring, which is optionally substituted, one or more times, identically or differently, with a halogen atom. 6. The combination according to any one of claims 2 to 4, wherein
R b represents a -N(R7)C(=0)OR8 group ;
and
R7 and R8 together with the molecular fragment they are attached to represent a 4- to 6-memberered heterocyclic ring.
7. The combination according to any one of claims 2 to 4, wherein
R b represents a
Figure imgf000143_0001
group ;
and
R7 represents a G -G-alkyl- group.
8. The combination according to claim 1 , wherein compound A is selected from the group consisting of:
N,N-diethyl-4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 , 5- a]pyridin-2-yl]amino}-3-methoxybenzamide, N-(4-{2- [(4-cyano-2-methoxyphenyl)amino] [1 ,2,4]triazolo[1 , 5-o]pyridin-6-yl}- phenyl)-2-(4-fluorophenyl)acetamide,
N-(4-{2- [(2-ethoxy-4-fluorophenyl)amino] [1 ,2,4]triazolo[1 , 5-a]pyridin-6-yl}- phenyl)-2-(4-fluorophenyl)acetamide,
N-ethyl-4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 , 5- a]pyridin-2-yl]amino}-3-methoxybenzamide, N-fert-butyl-4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo- [1 ,5-a]pyridin-2-yl]amino}-3-methoxybenzamide,
4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2- yl]amino}-N-(2-hydroxyethyl)-3-methoxybenzamide, N-(2-ethoxyethyl)-4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]- triazolo[1 ,5-o]pyridin-2-yl]amino}-3-methoxybenzamide,
3-ethoxy-4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5- a]pyridin-2-yl]amino}-N-(2-hydroxyethyl)benzamide,
3-ethoxy-4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5- a]pyridin-2-yl]amino}-N-(1 -hydroxy-2-methylpropan-2-yl)benzamide,
3- ethoxy-N,N-diethyl-4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]- triazolo[1 ,5-o]pyridin-2-yl]amino}benzamide,
4- {[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2- yl]amino}-N-(2-hydroxyethyl)-3-(2,2,2-trifluoroethoxy)benzamide, 4-{[6-{4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2- yl]amino}-N-(2-hydroxy-2-methylpropyl)-3-methoxybenzamide,
4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-o]pyridin-2- yl]amino}-N-(1 -hydroxy-2-methylpropan-2-yl)-3-methoxybenzamide,
N-{2-[acetyl(methyl)amino]ethyl}-4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}- phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl]amino}-3-methoxy-N-methyl- benzamide,
2- (4-fluorophenyl)-N-[4-(2-{[2-methoxy-4-(methylsulfonyl)phenyl]amino}- [1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl)phenyl]acetamide,
3- ethoxy-N-ethyl-4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]- triazolo[1 ,5-o]pyridin-2-yl]amino}benzamide,
3-ethoxy-4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5- a]pyridin-2-yl]amino}-/V-(2-hydroxy-2-methylpropyl)benzamide, 3-ethoxy-N-ethyl-4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]- triazolo[1 ,5-a]pyridin-2-yl]amino}-N-(2-methoxyethyl)benzamide,
3-ethoxy-4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5- a]pyridin-2-yl]amino}-N-(2-hydroxyethyl)- -methylbenzamide, 4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2- yl]amino}-3-methoxy-N-methyl-N-[2-(methylamino)ethyl]benzamide,
N-ieri-butyl-4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo- [1 ,5-a]pyndin-2-yl]amino}-3-(2,2,2-trifluoroethoxy)benzamide,
N,N-diethyl-4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5- a]pyndin-2-yl]amino}-3-(2,2,2-trifluoroethoxy)benzamide,
N,N-diethyl-4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5- o]pyridin-2-yl]amino}-3-propoxybenzamide,
3- (cyclopropylmethoxy)-N,N-diethyl-4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}- phenyl)[1 ,2,4]triazolo[1 ,5-o]pyridin-2-yl]amino}benzamide, N,N-diethyl-4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5- a]pyridin-2-yl]amino}-3-isopropoxybenzamide,
N,N-diethyl-4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5- o]pyridin-2-yl]amino}-3-(2-methoxyethoxy)benzamide,
4- {[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2- yl]amino}-3-(2,2,2-trifluoroethoxy)-N-(2,2,2-trifluoroethyl)benzamide,
3- ethoxy-4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5- a]pyridin-2-yl]amino}-N-[2-(methylsulfonyl)ethyl]benzamide,
4- {[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 , 5-a]pyridin-2- yl]amino}-N-(2-hydroxy-2-methylpropyl)-3-(2,2,2-trifluoroethoxy)benzamide, 4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2- yl]amino}-3-methoxy-N-methylbenzamide, 4-[(6-{4-[(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl)- amino]-N-(2-hydroxyethyl)-3-methoxybenzamide,
3- ethoxy-4-[(6-{4-[(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]- pyridin-2-yl)amino]-N-(2-hydroxyethyl)benzamide, 3-ethoxy-4-[(6-{4-[(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]- pyridin-2-yl)amino]-N-(1 -hydroxy-2-methylpropan-2-yl)benzamide,
4- [(6-{4-[(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl)- amino]-N-(2-hydroxyethyl)-3-(2,2,2-trifluoroethoxy)benzamide,
4-[(6-{4-[(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-o]pyridin-2-yl)- amino]-N-(2-hydroxy-2-methylpropyl)-3-methoxybenzamide,
N-(4-fluorobenzyl)-4-(2-{[2-methoxy-4-(methylsulfonyl)phenyl]amino}[1 ,2,4]- triazolo[1 ,5-a]pyridin-6-yl)benzamide,
3- ethoxy-4-[(6-{4-[(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]- pyridin-2-yl)amino]-N-(2-hydroxy-2-methylpropyl)benzamide, 4-[(6-{4-[(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl)- amino]-N-(1 -hydroxy-2-methylpropan-2-yl)-3-methoxybenzamide,
N-{2-[acetyl(methyl)amino]ethyl}-4-[(6-{4-[(4-fluorobenzyl)carbamoyl]phenyl}- [1 ,2,4]triazolo[1 ,5-o]pyridin-2-yl)amino]-3-methoxy-N-methylbenzamide,
N-(2-ethoxyethyl)-4-[(6-{4- [(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo- [1 ,5-a]pyridin-2-yl)amino]-3-methoxybenzamide,
4- [(6-{4-[(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl)- amino]-3-methoxy-N-methyl-N-[2-(methylamino)ethyl]benzamide,
3-ethoxy-4-[(6-{4-[(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]- pyridin-2-yl)amino]-N-(2-hydroxyethyl)-N-methylbenzamide, 4-[(6-{4-[(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl)- amino]-3-methoxy-N-methylbenzamide, N-fert-butyl-4-[(6-{4-[(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]- pyridin-2-yl)amino]-3-methoxybenzamide,
4-[(6-{4-[(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-o]pyridin-2-yl)- amino]-3-methoxy-N-[2-(methylsulfonyl)ethyl]benzamide, 4-{2- [(2,4-dimethoxyphenyl)amino][1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl}-N-(4- fluorobenzyl)benzamide,
4-[(6-{4-[(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl)- amino]-3-methoxy-N-(2,2,2-trifluoroethyl)benzamide,
4-[(6-{4-[(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl)- amino]-N-(1 -hydroxy-2-methylpropan-2-yl)-3-(2,2,2-trifluoroethoxy)- benzamide,
3- ethoxy-4-[(6-{4-[(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]- pyridin-2-yl)amino]-N-[2-(methylsulfonyl)ethyl]benzamide,
N-ethyl-4-[(6-{4-[(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]- pyridin-2-yl)amino]-3-methoxybenzamide,
N-ieri-butyl-3-ethoxy-4-[(6-{4-[(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]- triazolo[1 ,5-o]pyridin-2-yl)amino]benzamide,
4- [(6-{4-[(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl)- amino]-N-(2-hydroxy-2-methylpropyl)-3-(2,2,2-trifluoroethoxy)benzamide, 4-[(6-{4-[(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl)- amino]-3-(2,2,2-trifluoroethoxy)-N-(2,2,2-trifluoroethyl)benzamide,
4-(2-{[4-(dimethylamino)-2-methylphenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin- 6-yl)-N-(4-fluorobenzyl)benzamide,
2-fluoro-N-(4-fluorobenzyl)-4-[2-({4-[(1 -hydroxy-2-methylpropan-2-yl)- carbamoyl]-2-methoxyphenyl}amino)[1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl]- benzamide, N-(4-fluorobenzyl)-4-[2-({4-[(1 -hydroxy-2-methylpropan-2-yl)carbamoyl]-2- methoxyphenyl}amino)[1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl]-2-methylbenzamide,
2-chloro-N-(4-fluorobenzyl)-4-[2-({4-[(1 -hydroxy-2-methylpropan-2-yl)- carbamoyl]-2-methoxyphenyl}amino)[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yljbenzamide,
4-[(6-{4-[(cyclopropylmethyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]pyridin-2- yl)amino]-3-ethoxy-N-ethylbenzamide,
4-[(6-{4-[(cyclopropylmethyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]pyridin-2- yl)amino]-3-ethoxy-N-ethyl-N-(2-methoxyethyl)benzamide, 4-[(6-{4-[(cyclopropylmethyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]pyridin-2- yl)amino]-3-ethoxy-N-(2-hydroxyethyl)benzamide,
4-[(6-{4-[(cyclopropylmethyl)carbamoyl]phenyl}[1 ,2,4]triazo[o[1 ,5-a]pyridin-2- yl)amino]-N-(2-hydroxyethyl)-3-(2,2,2-trifluoroethoxy)benzamide,
4-[(6-{4-[(cyclopropylmethyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 , 5-a]pyridin-2- yl)amino]-N-ethyl-3-(2,2,2-trifluoroethoxy)benzamide,
N-ethyl-4-[(6-{4-[(3-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]- pyridin-2-yl)amino]-3-methoxybenzamide,
N-(4-fluorobenzyl)-4-[2-({4-[(1 -hydroxy-2-methylpropan-2-yl)carbamoyl]-2- methoxyphenyl}amino)[1 ,2,4]triazolo[1 ,5-o]pyridin-6-yl]-2-methoxy- benzamide,
4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2- yl]amino}-3-methoxy-N-(2,2,2-trifluoroethyl)benzamide,
N-[4-(2-{[2-ethoxy-4-(methylsulfonyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]- pyridin-6-yl)phenyl]-2-(4-fluorophenyl)acetamide, N-[4-(2-{[2-ethoxy-4-(ethylsulfonyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5-o]pyridin- 6-yl)phenyl]-2-(4-fluorophenyl)acetamide, 2-(4-fluorophenyl)-N-[4-(2-{[4-(methylsulfonyl)-2-(2,2,2-trifluoroethoxy)- phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl)phenyl]acetamide,
N-[4-(2-{[2-(difluoromethoxy)-4-(methylsulfonyl)phenyl]amino}[1 ,2,4]triazolo- [1 ,5-o]pyridin-6-yl)phenyl]-2-(4-fluorophenyl)acetamide, N-[4-(2-{[2-(difluoromethoxy)-4-(ethylsulfonyl)phenyl]amino}[1 ,2,4]triazolo- [1 ,5-o]pyridin-6-yl)phenyl]-2-(4-fluorophenyl)acetamide,
N-[4-(2-{[2-(cyclopropyloxy)-4-(methylsulfonyl)phenyl]amino}[1 ,2,4]triazolo- [1 ,5-o]pyridin-6-yl)phenyl]-2-(4-fluorophenyl)acetamide,
4-(2-{[2-ethoxy-4-(methylsulfonyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5-o]pyridin- 6-yl)-N-(4-fluorobenzyl)benzamide,
4-(2-{[2-ethoxy-4-(ethylsulfonyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)-N-(4-fluorobenzyl)benzamide,
N-(4-fluorobenzyl)-4-(2-{[4-(methylsulfonyl)-2-(2,2,2-trifluoroethoxy)phenyl]- amino}[1 ,2,4]triazolo[1 ,5-o]pyridin-6-yl)benzamide, 4-(2-{[2-(difluoromethoxy)-4-(methylsulfonyl)phenyl]amino}[1 ,2,4]triazolo[1 , 5- o]pyridin-6-yl)-N-(4-fluorobenzyl)benzamide,
4-(2-{[2-(cyclopropyloxy)-4-(methylsulfonyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5- o]pyridin-6-yl)-N-(4-fluorobenzyl)benzamide,
N-(4-fluorobenzyl)-2-methyl-4-(2-{[4-(methylsulfonyl)-2-(2,2,2-trifluoro- ethoxy)phenyl]amino}[1 ,2,4]triazolo[1 ,5-o]pyridin-6-yl)benzamide,
N-(4-fluorobenzyl)-2-methoxy-4-(2-{[2-methoxy-4-(methylsulfonyl)phenyl]- amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl)benzamide,
2-(2,4-difluorophenyl)-N-[4-(2-{[2-methoxy-4-(methylsulfonyl)phenyl]amino}- [1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl)phenyl]acetamide, N-(2,4-difluorobenzyl)-4-(2-{[2-methoxy-4-(methylsulfonyl)phenyl]amino}- [1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl)benzamide, 4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2- yl]amino}-3-methoxy-N-(2-methoxyethyl)benzamide,
4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2- yl]amino}-3-methoxy-N,N-dimethylbenzamide, 4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2- yl]amino}-3-methoxy-N-[2-(methylsulfonyl)ethyl]benzamide,
4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-o]pyridin-2- yl]amino}-3-methoxybenzamide,
N-(2-fluoroethyl)-4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]- triazolo[1 ,5-a]pyridin-2-yl]amino}-3-methoxybenzamide,
N-ethyl-4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]- pyndin-2-yl]amino}-3-methoxy-N-methylbenzamide,
N-(2,2-difluoroethyl)-4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]- triazolo[1 ,5-a]pyridin-2-yl]amino}-3-methoxybenzamide, N-[2-(dimethylamino)ethyl]-4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)- [1 ,2,4]triazolo[1 ,5-a]pyndin-2-yl]amino}-3-methoxy-N-methylbenzamide,
4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2- yl]amino}-3-methoxy-N-methyl-N-(2,2,2-trifluoroethyl)benzamide,
N-[2-(dimethylamino)ethyl]-4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)- [1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl]amino}-3-methoxybenzamide,
4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2- yl]amino}-N-(3-fluoropropyl)-3-methoxybenzamide,
N-[4-(2-{[5-fluoro-2-methoxy-4-(methylsulfonyl)phenyl]amino}[1 ,2,4]triazolo- [1 ,5-a]pyridin-6-yl)phenyl]-2-(4-fluorophenyl)acetamide, 2-(4-fluorophenyl)-N- [4-(2-{[2-methoxy-4-(methylsulfinyl)phenyl]amino}- [1 ,2,4]triazolo[1 , 5-a]pyridin-6-yl)phenyl]acetamide,
N- [4-(2-{[5-fluoro-2-methoxy-4-(methylsulfinyl)phenyl]amino}[1 ,2,4]triazolo- [1 , 5-a]pyridin-6-yl)phenyl]-2-(4-fluorophenyl)acetamide, N- [4-(2-{[4-(teri-butylsulfamoyl)-2-methoxyphenyl]amino}[1 ,2,4]triazolo[1 ,5- a]pyridin-6-yl)phenyl]-2-(4-fluorophenyl)acetamide,
2- (4-fluorophenyl)-N- [4-(2-{[4-(2-hydroxypropan-2-yl)-2-methoxyphenyl]- amino}[1 ,2,4]triazolo[1 , 5-a]pyridin-6-yl)phenyl]acetamide,
N-(4-{2- [(2,4-dimethoxyphenyl)amino] [1 ,2,4]triazolo[1 , 5-a]pyridin-6-yl}- phenyl)-2-(4-fluorophenyl)acetamide,
3- ethoxy-N-ethyl-4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]- triazolo[1 , 5-o]pyridin-2-yl]amino}-N-methylbenzamide,
N- [2-(dimethylamino)ethyl]-3-ethoxy-4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}- phenyl)[1 ,2,4]triazolo[1 , 5-a]pyridin-2-yl]amino}benzamide, 4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 , 5-o]pyridin-2- yl]amino}-N- [2-(methylsulfonyl)ethyl]-3-(2,2,2-tnfluoroethoxy)benzamide,
4- {[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 , 5-a]pyridin-2- yl]amino}-N-(1 -hydroxy-2-methylpropan-2-yl)-3-(2,2,2-trifluoroethoxy)- benzamide, N- [2-(dimethylamino)ethyl]-4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)- [1 ,2,4]triazolo[1 , 5-a]pyridin-2-yl]amino}-3-(2,2,2-trifluoroethoxy)benzamide,
2-(4-fluorophenyl)-N- [4-(2-{[4-(methylsulfinyl)-2-(2,2,2-trifluoroethoxy)- phenyl]amino}[1 ,2,4]triazolo[1 , 5-a]pyridin-6-yl)phenyl]acetamide,
4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 , 5-a]pyridin-2- yl]amino}-3-(trifluoromethoxy)benzamide, N-[4-(2-{[2-(difluoromethoxy)-4-(propan-2- ylsulfonyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl)phenyl]-2-(4- fluorophenyl)acetamide,
N-[4-(2-{[2-(difluoromethoxy)-4-fluorophenyl]amino}[1 ,2,4]triazolo[1 ,5-a]- pyridin-6-yl)phenyl]-2-(4-fluorophenyl)acetamide,
4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2- yl]amino}-3-methylbenzamide,
4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-a]pyridin-2- yl]amino}-3-methyl-N-(2,2,2-trifluoroethyl)benzamide, -(2-fluoroethyl)-4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]- triazolo[1 ,5-a]pyridin-2-yl]amino}-3-methylbenzamide,
4-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5-o]pyridin-2- yl]amino}-N,N,3-trimethylbenzamide,
2-(4-fluorophenyl)-N-[4-(2-{[2-methyl-4-(methylsulfonyl)phenyl]amino}[1 ,2,4]- triazolo[1 ,5-a]pyridin-6-yi)phenyl]acetamide,
2-(4-fluorophenyl)-N-[4-(2-{[2-methyl-4-(methylsulfinyl)phenyl]amino}[1 ,2,4]- triazolo[1 ,5-a]pyridin-6-yl)phenyl]acetamide,
2-(4-fluorophenyl)-N-{4-[2-({2-methyl-4-[(methylsulfonyl)amino]phenyl}- amino)[1 ,2,4]triazolo[1 ,5-o]pyridin-6-yl]phenyl}acetamide, 2-(4-fluorophenyl)-N-(4-{2-[(4-methoxy-2-methylphenyl)amino][1 ,2,4]triazolo- [1 ,5-a]pyridin-6-yl}phenyl)acetamide,
N-[4-(2-{[4-(dimethylamino)-2-methylphenyl]amino}[1 ,2,4]triazolo[1 ,5-o]- pyridin-6-yl)phenyl]-2-(4-fluorophenyl)acetamide,
N-ethyl-5-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5- a]pyridin-2-yl]amino}-4-methylpyridine-2-carboxamide, 5-{[6-(4-{[(4-fluorophenyl)acetyl]amino}phenyl)[1 ,2,4]triazolo[1 , 5-a]pyridin-2- yl]amino}-4-methyl-N-(2,2,2-trifluoroethyl)pyridine-2-carboxamide,
N- [4-(2-{[2-fluoro-4-(methylsulfonyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]- pyridin-6-yl)phenyl] -2-(4-fluorophenyl)acetamide, 2-(4-fluoro-3-methylphenyl)-N- [4-(2-{[2-methoxy-4-(methylsulfonyl)phenyl]- amino}[1 ,2,4]triazolo[1 , 5-a]pyridin-6-yl)phenyl]acetamide,
2-(4-chlorophenyl)-N- [4-(2-{[2-methoxy-4-(methylsulfonyl)phenyl]amino}- [1 ,2,4]triazolo[1 , 5-a]pyridin-6-yl)phenyl]acetamide,
N- [4-(2-{[2-methoxy-4-(methylsulfonyl)phenyl]amino}[1 ,2,4]triazolo[1 , 5-a]- pyridin-6-yl)phenyl]-2-phenylacetamide,
4- [(6-{4- [(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 , 5-a]pyridin-2-yl)- amino]-3-methoxybenzamide,
4- [(6-{4- [(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 , 5-a]pyridin-2-yl)- amino]-3-methoxy-N-(2-methoxyethyl)benzamide, 4- [{6-{4- [(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 , 5-o]pyridin-2-yl)- amino]-N-(2-fluoroethyl)-3-methoxybenzamide,
4- [(6-{4- [(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 , 5-a]pyridin-2-yl)- amino]-3-methoxy-N,N-dimethylbenzamide,
N-(2,2-difluoroethyl)-4- [(6-{4- [(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]- triazolo[1 , 5-a]pyridin-2-yl)amino]-3-methoxybenzamide,
N- [2-(dimethylamino)ethyl] -4- [(6-{4- [(4-fluorobenzyl)carbamoyl]phenyl}- [1 ,2,4]triazolo[1 , 5-o]pyridin-2-yl)amino]-3-methoxybenzamide,
N- [2-(dimethylamino)ethyl] -4- [(6-{4- [(4-fluorobenzyl)carbamoyl]phenyl}- [1 ,2,4]triazolo[1 , 5-a]pyridin-2-yl)amino]-3-methoxy-N-methylbenzamide, 4-[(6-{4-[(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl)- amino]-N-(3-fluoropropyl)-3-methoxybenzamide,
N-(4-fluorobenzyl)-4-(2-{[2-methoxy-4-(methylsulfinyl)phenyl]amino}[1 ,2,4]- triazolo[1 ,5-a]pyridin-6-yl)benzamide, 4-(2-{[4-(ieri-butylsulfamoyl)-2-methoxyphenyl]amino}[1 ,2,4]triazolo[1 ,5-a]- pyridin-6-yl)-N-(4-fluorobenzyl)benzamide,
N-(4-fluorobenzyl)-4-(2-{[4-(2-hydroxypropan-2-yl)-2-methoxyphenyl]amino}- [1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl)benzamide,
N- [2-(dimethylamino)ethyl]-3-ethoxy-4-[(6-{4-[(4-fluorobenzyl)carbamoyl] - phenyl}[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl)amino]benzamide,
3-ethoxy-N-ethyl-4-[(6-{4-[(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo- [1 ,5-a]pyridin-2-yl)amino]-N-methylbenzamide,
3- ethoxy-4-[(6-{4-[(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]- pyridin-2-yl)amino]-N-(2-fluoroethyl)benzamide, N- [2-(dimethylamino)ethyl] -4-[(6-{4-[(4-fluorobenzyl)carbamoyl]phenyl}-
[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl)amino]-3-(2,2,2-tnfluoroethoxy)benzamide,
4- [(6-{4-[(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl)- amino]-N-(2-fluoroethyl)-3-(2,2,2-trifluoroethoxy)benzamide,
4-[(6-{4-[(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 ,5-a]pyridin-2-yl)- amino]-3-(trifluoromethoxy)benzamide,
4-(2-{[2-(difluoromethoxy)-4-(ethylsulfonyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5- a]pyridin-6-yl)-N-(4-fluorobenzyl)benzamide,
4-(2-{[2-(difluoromethoxy)-4-(propan-2-ylsulfonyl)phenyl]amino}[1 ,2,4]- triazolo[1 ,5-a]pyridin-6-yl)-/V-(4-fluorobenzyl)benzamide, 4-(2-{[2-(difluoromethoxy)-4-fluorophenyl]amino}[1 ,2,4]triazolo[1 , 5-a]pyridin- 6-yl)-N-(4-fluorobenzyl)benzamide,
N-ethyl-4-[(6-{4- [(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 , 5- a]pyridin-2-yl)amino]-3-methylbenzamide, 4- [(6-{4- [(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 , 5-a]pyridin-2-yl)- amino]-3-methylbenzamide,
4- [(6-{4- [(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 , 5-a]pyridin-2-yl)- amino]-3-methyl-N-(2,2,2-trifluoroethyl)benzamide,
4- [(6-{4- [(4-fluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 , 5-a]pyridin-2-yl)- amino]-N-(2-fluoroethyl)-3-methylbenzamide,
N-(4-fluorobenzyl)-4- (2-{[2-methyl-4- (methylsulfonyl)phenyl]amino}[1 ,2,4]- triazolo[1 , 5-a]pyridin-6-yl)benzamide,
N-(4-fluorobenzyl)-4-(2-{[2-methyl-4-(methylsulfinyl)phenyl]amino}[1 ,2,4]- triazolo[1 , 5-a]pyridin-6-yl)benzamide, N-(4-fluorobenzyl)-4- [2-({2-methyl-4- [(methylsulfonyl)amino]phenyl}amino)- [1 ,2,4]triazolo[1 , 5-a]pyridin-6-yl]benzamide,
N-(4-fluorobenzyl)-4-{2- [(4-methoxy-2-methylphenyl)amino] [1 ,2,4]triazolo- [1 , 5-a]pyridin-6-yl}benzamide,
4- [(6-{4- [(4-chlorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 , 5-a]pyridin-2-yl)- amino]-3-methoxy-N-(2,2,2-trifluoroethyl)benzamide,
N-(4-chlorobenzyl)-4-(2-{[2-methoxy-4-(methylsulfonyl)phenyl]amino}[1 ,2,4] - triazolo[1 , 5-a]pyridin-6-yl)benzamide,
N-(4-chlorobenzyl)-4-(2-{[2-methyl-4-
(methylsulfonyl)phenyl]amino}[1 ,2,4]triazolo[1 , 5-o]pyridin-6-yl)benzamide, N-(4-chlorobenzyl)-4-(2-{[2-methyl-4-(methylsulfinyl)phenyl]amino}[1 ,2,4] - triazolo[1 , 5-a]pyridin-6-yl)benzamide,
4-(2-{[2-methoxy-4-(methylsulfonyl)phenyl]amino}[1 ,2,4]triazolo[1 , 5-a]- pyridin-6-yl)-N-(4-methylbenzyl)benzamide, N-(4-methylbenzyl)-4-(2-{[2-methyl-4-(methylsulfonyl)phenyl]amino}[1 ,2,4]- triazolo[1 , 5-a]pyridin-6-yl)benzamide,
N-(4-methylbenzyl)-4-(2-{[2-methyl-4-(methylsulfinyl)phenyl]amino}[1 ,2,4]- triazolo[1 , 5-a]pyridin-6-yl)benzamide,
4- [(6-{4- [(2,4-difluorobenzyl)carbamoyl]phenyl}[1 ,2,4]triazolo[1 , 5-a]pyridin-2- yl)amino]-3-methoxy-N-(2,2,2-trifluoroethyl)benzamide,
N-(2,4-difluorobenzyl)-2-methyl-4-(2-{[4-(methylsulfonyl)-2- (2,2,2-tnfluoro- ethoxy)phenyl]amino}[1 ,2,4]triazolo[1 , 5-a]pyridin-6-yl)benzamide,
N-(4-fluorobenzyl)-4-(2-{[4-(2-hydroxypropan-2-yl)-2-methoxyphenyl]amino}- [1 ,2,4]triazolo[1 , 5-a]pyndin-6-yl)-2-methoxybenzamide, 2-(4-fluorophenyl)-N- [4-(2-{[2-methoxy-4-(S-methylsulfonimidoyl)phenyl]- amino}[1 ,2,4]triazolo[1 , 5-a]pyridin-6-yl)phenyl]acetamide,
/V-(4-fluorobenzyl)-4-(2-{[2-methoxy-4-(S-methylsulfonimidoyl)phenyl]amino}- [1 ,2,4]triazolo[1 , 5-o]pyridin-6-yl)benzamide,
2-(4-fluorophenyl)-N- [4-(2-{[4-(hydroxymethyl)-2-methoxyphenyl]amino}- [1 ,2,4]triazolo[1 , 5-a]pyridin-6-yl)phenyl]acetamide,
N-(4-fluorobenzyl)-4-(2-{[4-(hydroxymethyl)-2-methoxyphenyl]amino}[1 ,2,4]- triazolo[1 , 5-a]pyridin-6-yl)benzamide,
(2/?)-2-(4-fluorophenyl)-N- [4-(2-{[2-methoxy-4-(methylsulfonyl)phenyl]amino}- [1 ,2,4]triazolo[1 , 5-o]pyridin-6-yl)phenyl]propanamide, (2/?)-N-[4-(2-{[2-ethoxy-4-(methylsulfonyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5- a]pyridin-6-yl)phenyl]-2-(4-fluorophenyl)propanamide,
(2/?)-2-(4-fluorophenyl)-N-[4-(2-{[4-(methylsulfonyl)-2-(2,2,2-trifluoroethoxy)- phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl)phenyl]propanamide, 4-{[6-(4-{[(2/?)-2-(4-fluorophenyl)propanoyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5- o]pyridin-2-yl]amino}-3-methoxy-N-(2,2,2-tnfluoroethyl)benzamide,
4-{[6-(4-{[(2/?)-2-(4-fluorophenyl)propanoyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5- a]pyridin-2-yl]amino}-3-methoxybenzamide,
4-{[6-(4-{[(2/?)-2-(4-fluorophenyl)propanoyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5- a]pyndin-2-yl]amino}-3-(2,2,2-trifluoroethoxy)benzamide,
(2/?)-N-{4-[2-({4-[(3-fluoroazetidin-1 -yl)carbonyl]-2-methoxyphenyl}amino)- [1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl]phenyl}-2-(4-fluorophenyl)propanamide,
(2 ?)-N-[4-(2-{[4-(azetidin-1 -y[carbony[)-2-methoxypheny[]amino}[1 ,2,4]- triazolo[1 ,5-a]pyridin-6-yl)phenyl]-2-(4-fluorophenyl)propanamide, (2/?)-2-(4-fluorophenyl)-N-[4-(2-{[2-methoxy-4-(2-oxo-1 ,3-oxazolidin-3-yl)- phenyl]amino}[1 ,2,4]triazolo[1 ,5-aJpyridin-6-yl)phenyl]propanamide,
(-)-2-(4-fluorophenyl)-3-hydroxy-N-[4-(2-{[4-(methylsulfonyl)-2-(2,2,2-tri- fluoroethoxy)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl)phenyl]propan- amide, (2R)-2-amino-2-(4-fluorophenyl)-N-[4-(2-{[2-methoxy-4-(methylsulfonyl)- phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl)phenyl]ethanamide,
4-{[6-(4-{[(2R)-2-(4-fluorophenyl)propanoyl]amino}phenyl)[1 ,2,4]triazolo[1 ,5- a]pyridin-2-yl]amino}-3-methoxy-N,N-dimethylbenzamide,
(2R)-2-(4-fluorophenyl)-N-[4-(2-{[2-methoxy-4-(pyrrolidin-1 - ylcarbonyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)phenyl]propanamide, (2R)-N-{4-[2-({4-[(3-fluoroazetidin-1 -y[)carbony[]-2-(2,2,2- trifluoroethoxy)phenyl}amino)[1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl]phenyl}-2-(4- fluorophenyl)propanamide,
(2R)-2-(4-fluorophenyl)-N-{4-[2-({4-[(3-hydroxyazetidin-1 -yl)carbonyl]-2-(2,2,2- trifluoroethoxy)phenyl}amino)[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl]phenyl}propanamide,
(2R)-2-(4-fluorophenyl)-N-[4-(2-{[4-(pyrrolidin-1 -ylcarbonyl)-2-(2,2,2- trifluoroethoxy)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)phenyl]propanamide, (2S)-2-(4-fluorophenyl)-3-hydroxy-N-[4-(2-{[2-methoxy-4-
(methylsulfonyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- yl)phenyl]propanamide,
(2S)-N-{4-[2-({4-[(3-fluoroazetidin-1 -yl)carbonyl]-2-(2,2,2- trifluoroethoxy)phenyl}amino)[1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl]phenyl}-2-(4- fluorophenyl)-3-hydroxypropanamide,
(2R)-2-amino-2-(4-fluorophenyl)-N-[4-(2-{[4-(methylsulfonyl)-2-(2,2,2- trifluoroethoxy)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6- y[)pheny[]ethanamide,
(2R)-2-amino-2-(4-fluorophenyl)-N-[4-(2-{[2-methoxy-4-(2-oxo-1 ,3-oxazolidin- 3-yl)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl)phenyl]ethanamide,
(2R)-2-amino-N-{4-[2-({4-[(3-fluoroazetidin-1 -yl)carbonyl]-2- methoxyphenyl}amino)[1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl]phenyl}-2-(4- fluorophenyl)ethanamide,
(2R)-2-amino-N-[4-(2-{[4-(azetidin-1 -ylcarbonyl)-2- methoxyphenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl)phenyl]-2-(4- fluorophenyl)ethanamide,
(2R)-2-amino-2-(4-fluorophenyl)-N-[4-(2-{[2-methoxy-4-(pyrrolidin-1 - ylcarbonyl)phenyl]amino}[1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl)phenyl]ethanamide, (2R)-2-amino-N-{4-[2-({4-[(3-fluoroazetidin-1 -y[)carbony[]-2-(2,2,2- trifluoroethoxy)phenyl}amino)[1 ,2,4]triazolo[1 ,5-a]pyridin-6-yl]phenyl}-2-(4- fluorophenyl)ethanamide, and
(2R)-2-amino-2-(4-fluorophenyl)-N-[4-(2-{[4-(pyrrolidin- 1 -ylcarbonyl)-2-(2,2,2- trifluoroethoxy)phenyl]amino}[1 ,2,4]triazolo[1 , 5-a]pyridin-6- yl)phenyl]ethanamide, or a tautomer, an N-oxide, a hydrate, a solvate, or a salt thereof, or a mixture of same.
9. The combination according to any one of claims 1 to 8, wherein compound B is selected from the group consisting of:
Obatoclax, Navitoclax, beclanorsen, VMD-8018, oblimersen, apogossypol, 1 133719, PNT-100, HG-1 1 13, S-44563, ABT-731 , ONT-701 , BP-100-1 .02, AT- 101 . 10. Use of a combination according to any one of claims 1 to 9 for the preparation of a medicament for the treatment or prophylaxis of a cancer, particularly hepatocyte carcinoma, lung cancer, in particular non-small cell lung carcinoma, colorectal cancer, melanoma, pancreatic cancer or breast cancer.
1 1 . A method of treatment or prophylaxis of a cancer, particularly hepatocyte carcinoma, lung cancer, in particular non-small cell lung carcinoma, colorectal cancer, melanoma, pancreatic cancer or breast cancer, in a subject, comprising administering to said subject a therapeutically effective amount of a combination accoring to any one of claims 1 to 9.
12. A kit comprising a combination of :
one or more compounds A as defined in any one of the claims 1 to 8;
one or more compounds B as defined in any of claims 1 or 9; and, optionally, one or more further pharmaceutical agents C;
in which optionally both or either of said components A and B are in the form of a pharmaceutical formulation which is ready for use to be administered simultaneously, concurrently, separately or sequentially.
13. Use of an anti-apoptotic protein from the Bcl-2 family as a sensitizer of cells to Mps-1 inhibitors.
14. Use of the ratio of pro-apoptotic and anti-apoptotic proteins from the Bcl- 2 family in a biological sample as a biomarker for a Mps-1 kinase inhibitor treatment.
PCT/EP2013/066038 2012-08-02 2013-07-30 Combinations for the treatment of cancer WO2014020043A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP12178984 2012-08-02
EP12178984.6 2012-08-02

Publications (1)

Publication Number Publication Date
WO2014020043A1 true WO2014020043A1 (en) 2014-02-06

Family

ID=48914274

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2013/066038 WO2014020043A1 (en) 2012-08-02 2013-07-30 Combinations for the treatment of cancer

Country Status (1)

Country Link
WO (1) WO2014020043A1 (en)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3007692A1 (en) * 2013-06-11 2016-04-20 Bayer Pharma Aktiengesellschaft Combinations for the treatment of cancer comprising a mps-1 kinase inhibitor and a mitotic inhibitor
WO2021072232A1 (en) * 2019-10-11 2021-04-15 Incyte Corporation Bicyclic amines as cdk2 inhibitors
CN112739349A (en) * 2018-09-18 2021-04-30 圣诺康生命科学公司 Combination therapy for the treatment of leukemia
US11066404B2 (en) 2018-10-11 2021-07-20 Incyte Corporation Dihydropyrido[2,3-d]pyrimidinone compounds as CDK2 inhibitors
US11384083B2 (en) 2019-02-15 2022-07-12 Incyte Corporation Substituted spiro[cyclopropane-1,5′-pyrrolo[2,3-d]pyrimidin]-6′(7′h)-ones as CDK2 inhibitors
US11427567B2 (en) 2019-08-14 2022-08-30 Incyte Corporation Imidazolyl pyrimidinylamine compounds as CDK2 inhibitors
US11440914B2 (en) 2019-05-01 2022-09-13 Incyte Corporation Tricyclic amine compounds as CDK2 inhibitors
US11447494B2 (en) 2019-05-01 2022-09-20 Incyte Corporation Tricyclic amine compounds as CDK2 inhibitors
US11472791B2 (en) 2019-03-05 2022-10-18 Incyte Corporation Pyrazolyl pyrimidinylamine compounds as CDK2 inhibitors
WO2022237844A1 (en) * 2021-05-12 2022-11-17 微境生物医药科技(上海)有限公司 Pyrrolopyrimidine derivative containing pyrazine structure
US11919904B2 (en) 2019-03-29 2024-03-05 Incyte Corporation Sulfonylamide compounds as CDK2 inhibitors

Citations (33)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5011472A (en) 1988-09-06 1991-04-30 Brown University Research Foundation Implantable delivery system for biological factors
US5023252A (en) 1985-12-04 1991-06-11 Conrex Pharmaceutical Corporation Transdermal and trans-membrane delivery of drugs
WO2008025821A1 (en) 2006-08-30 2008-03-06 Cellzome Limited Triazole derivatives as kinase inhibitors
WO2009002482A1 (en) 2007-06-25 2008-12-31 Solutia, Inc. Process of catalytic ammoxidation for hydrogen cyanide production
WO2009010530A1 (en) 2007-07-18 2009-01-22 Novartis Ag Bicyclic heteroaryl compounds and their use as kinase inhibitors
WO2009024824A1 (en) 2007-08-23 2009-02-26 Astrazeneca Ab 2-anilinopurin-8-ones as inhibitors of ttk/mps1 for the treatment of proliferative disorders
WO2009027283A1 (en) 2007-08-31 2009-03-05 Merck Serono S.A. Triazolopyridine compounds and their use as ask inhibitors
WO2009047514A1 (en) 2007-10-10 2009-04-16 Cancer Research Technology Limited [1,2,4]triazolo[1,5-a]pyridine and [1,2,4]triazolo[1,5-c]pyrimidine compounds and their use
WO2009156315A1 (en) 2008-06-26 2009-12-30 Nerviano Medical Sciences S.R.L. Pyrazolo-quinazolines
WO2010092041A1 (en) 2009-02-13 2010-08-19 Fovea Pharmaceuticals Sa [1, 2, 4] triazolo [1, 5 -a] pyridines as kinase inhibitors
WO2010111406A2 (en) 2009-03-24 2010-09-30 Myriad Pharmaceuticals, Inc. Compounds and therapeutic uses thereof
WO2010124826A1 (en) 2009-04-29 2010-11-04 Bayer Schering Pharma Aktiengesellschaft Substituted imidazoquinoxalines
WO2011013729A1 (en) 2009-07-30 2011-02-03 オンコセラピー・サイエンス株式会社 Fused imidazole derivative having ttk inhibitory action
WO2011026579A1 (en) 2009-09-04 2011-03-10 Bayer Schering Pharma Aktiengesellschaft Substituted aminoquinoxalines as tyrosine threonine kinase inhibitors
WO2011063908A1 (en) 2009-11-30 2011-06-03 Bayer Schering Pharma Aktiengesellschaft Triazolopyridines
WO2011064328A1 (en) 2009-11-30 2011-06-03 Bayer Schering Pharma Aktiengesellschaft Triazolopyridine derivatives
WO2011063907A1 (en) 2009-11-30 2011-06-03 Bayer Schering Pharma Aktiengesellschaft Substituted triazolopyridines
WO2011068863A1 (en) * 2009-12-04 2011-06-09 Abbott Laboratories Combination therapy for treating cancer and diagnostic assays for use therein
WO2011113862A1 (en) 2010-03-18 2011-09-22 Bayer Pharma Aktiengesellschaft Imidazopyrazines
WO2011151259A1 (en) 2010-06-01 2011-12-08 Bayer Pharma Aktiengesellschaft Substituted imidazopyrazines
WO2011157688A1 (en) 2010-06-16 2011-12-22 Bayer Pharma Aktiengesellschaft Substituted triazolopyridines
WO2012013557A1 (en) 2010-07-30 2012-02-02 Nerviano Medical Sciences S.R.L. Isoxazolo-quinazolines as modulators of protein kinase activity
WO2012032031A1 (en) 2010-09-10 2012-03-15 Bayer Pharma Aktiengesellschaft Substituted imidazopyridazines
US8188077B2 (en) 2010-03-25 2012-05-29 Abbott Laboratories Apoptosis-inducing agents for the treatment of cancer and immune and autoimmune diseases
US8198405B2 (en) 2003-11-05 2012-06-12 Dana-Farber Cancer Institute, Inc. Stabilized alpha helical peptides and uses thereof
WO2012080230A1 (en) 2010-12-17 2012-06-21 Bayer Pharma Aktiengesellschaft 6 substituted imidazopyrazines for use as mps-1 and tkk inhibitors in the treatment of hyperproliferative disorders
WO2012080229A1 (en) 2010-12-17 2012-06-21 Bayer Pharma Aktiengesellschaft Imidazopyrazines for use as mps-1 and tkk inhibitors in the treatment hyperproliferative disorders
WO2012080236A1 (en) 2010-12-17 2012-06-21 Bayer Pharma Aktiengesellschaft 6-substituted imidazopyrazines for use as mps-1 and tkk inhibitors in the treatment of hyperproliferative disorders
WO2012080234A1 (en) 2010-12-17 2012-06-21 Bayer Pharma Aktiengesellschaft Substituted 6-imidazopyrazines for use as mps-1 and tkk inhibitors in the treatment of hyperproliferative disorders
WO2012080228A1 (en) 2010-12-17 2012-06-21 Bayer Pharma Aktiengesellschaft 6-thio-substituted imidazopyrazines for use as mps-1 and tkk inhibitors in the treatment of hyperproliferative disorders
WO2012143329A1 (en) 2011-04-21 2012-10-26 Bayer Intellectual Property Gmbh Triazolopyridines
WO2012160029A1 (en) * 2011-05-23 2012-11-29 Bayer Intellectual Property Gmbh Substituted triazolopyridines
WO2013087579A1 (en) 2011-12-12 2013-06-20 Bayer Intellectual Property Gmbh Substituted triazolopyridines and their use as ttk inhibitors

Patent Citations (33)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5023252A (en) 1985-12-04 1991-06-11 Conrex Pharmaceutical Corporation Transdermal and trans-membrane delivery of drugs
US5011472A (en) 1988-09-06 1991-04-30 Brown University Research Foundation Implantable delivery system for biological factors
US8198405B2 (en) 2003-11-05 2012-06-12 Dana-Farber Cancer Institute, Inc. Stabilized alpha helical peptides and uses thereof
WO2008025821A1 (en) 2006-08-30 2008-03-06 Cellzome Limited Triazole derivatives as kinase inhibitors
WO2009002482A1 (en) 2007-06-25 2008-12-31 Solutia, Inc. Process of catalytic ammoxidation for hydrogen cyanide production
WO2009010530A1 (en) 2007-07-18 2009-01-22 Novartis Ag Bicyclic heteroaryl compounds and their use as kinase inhibitors
WO2009024824A1 (en) 2007-08-23 2009-02-26 Astrazeneca Ab 2-anilinopurin-8-ones as inhibitors of ttk/mps1 for the treatment of proliferative disorders
WO2009027283A1 (en) 2007-08-31 2009-03-05 Merck Serono S.A. Triazolopyridine compounds and their use as ask inhibitors
WO2009047514A1 (en) 2007-10-10 2009-04-16 Cancer Research Technology Limited [1,2,4]triazolo[1,5-a]pyridine and [1,2,4]triazolo[1,5-c]pyrimidine compounds and their use
WO2009156315A1 (en) 2008-06-26 2009-12-30 Nerviano Medical Sciences S.R.L. Pyrazolo-quinazolines
WO2010092041A1 (en) 2009-02-13 2010-08-19 Fovea Pharmaceuticals Sa [1, 2, 4] triazolo [1, 5 -a] pyridines as kinase inhibitors
WO2010111406A2 (en) 2009-03-24 2010-09-30 Myriad Pharmaceuticals, Inc. Compounds and therapeutic uses thereof
WO2010124826A1 (en) 2009-04-29 2010-11-04 Bayer Schering Pharma Aktiengesellschaft Substituted imidazoquinoxalines
WO2011013729A1 (en) 2009-07-30 2011-02-03 オンコセラピー・サイエンス株式会社 Fused imidazole derivative having ttk inhibitory action
WO2011026579A1 (en) 2009-09-04 2011-03-10 Bayer Schering Pharma Aktiengesellschaft Substituted aminoquinoxalines as tyrosine threonine kinase inhibitors
WO2011063908A1 (en) 2009-11-30 2011-06-03 Bayer Schering Pharma Aktiengesellschaft Triazolopyridines
WO2011064328A1 (en) 2009-11-30 2011-06-03 Bayer Schering Pharma Aktiengesellschaft Triazolopyridine derivatives
WO2011063907A1 (en) 2009-11-30 2011-06-03 Bayer Schering Pharma Aktiengesellschaft Substituted triazolopyridines
WO2011068863A1 (en) * 2009-12-04 2011-06-09 Abbott Laboratories Combination therapy for treating cancer and diagnostic assays for use therein
WO2011113862A1 (en) 2010-03-18 2011-09-22 Bayer Pharma Aktiengesellschaft Imidazopyrazines
US8188077B2 (en) 2010-03-25 2012-05-29 Abbott Laboratories Apoptosis-inducing agents for the treatment of cancer and immune and autoimmune diseases
WO2011151259A1 (en) 2010-06-01 2011-12-08 Bayer Pharma Aktiengesellschaft Substituted imidazopyrazines
WO2011157688A1 (en) 2010-06-16 2011-12-22 Bayer Pharma Aktiengesellschaft Substituted triazolopyridines
WO2012013557A1 (en) 2010-07-30 2012-02-02 Nerviano Medical Sciences S.R.L. Isoxazolo-quinazolines as modulators of protein kinase activity
WO2012032031A1 (en) 2010-09-10 2012-03-15 Bayer Pharma Aktiengesellschaft Substituted imidazopyridazines
WO2012080230A1 (en) 2010-12-17 2012-06-21 Bayer Pharma Aktiengesellschaft 6 substituted imidazopyrazines for use as mps-1 and tkk inhibitors in the treatment of hyperproliferative disorders
WO2012080229A1 (en) 2010-12-17 2012-06-21 Bayer Pharma Aktiengesellschaft Imidazopyrazines for use as mps-1 and tkk inhibitors in the treatment hyperproliferative disorders
WO2012080236A1 (en) 2010-12-17 2012-06-21 Bayer Pharma Aktiengesellschaft 6-substituted imidazopyrazines for use as mps-1 and tkk inhibitors in the treatment of hyperproliferative disorders
WO2012080234A1 (en) 2010-12-17 2012-06-21 Bayer Pharma Aktiengesellschaft Substituted 6-imidazopyrazines for use as mps-1 and tkk inhibitors in the treatment of hyperproliferative disorders
WO2012080228A1 (en) 2010-12-17 2012-06-21 Bayer Pharma Aktiengesellschaft 6-thio-substituted imidazopyrazines for use as mps-1 and tkk inhibitors in the treatment of hyperproliferative disorders
WO2012143329A1 (en) 2011-04-21 2012-10-26 Bayer Intellectual Property Gmbh Triazolopyridines
WO2012160029A1 (en) * 2011-05-23 2012-11-29 Bayer Intellectual Property Gmbh Substituted triazolopyridines
WO2013087579A1 (en) 2011-12-12 2013-06-20 Bayer Intellectual Property Gmbh Substituted triazolopyridines and their use as ttk inhibitors

Non-Patent Citations (78)

* Cited by examiner, † Cited by third party
Title
"Merck Index", 1996
ABRIEU A ET AL., CELL, vol. 106, 2001, pages 83 - 93
AIELLO ET AL., NEW ENGL. J. MED., vol. 331, 1994, pages 1480
BAKHASHI ET AL., CELL, vol. 41, 1985, pages 899FF
BOYA P; GONZALEZ-POLO RA; CASARES N; PERFETTINI JL; DESSEN P; LAROCHETTE N ET AL.: "Inhibition ofmacroautophagy triggers apoptosis", MOLECULAR AND CELLULAR BIOLOGY, vol. 25, 2005, pages 1025 - 1040
BRUMMELKAMP TR; BERNARDS R; AGAMI R: "A system for stable expression of short interfering RNAs in mammalian cells", SCIENCE, vol. 296, 2002, pages 550 - 553
C. BODUR ET AL: "Bcl-2 Inhibitors: Emerging Drugs in Cancer Therapy", CURRENT MEDICINAL CHEMISTRY, vol. 19, no. 12, 1 March 2012 (2012-03-01), pages 1804 - 1820, XP055084378, ISSN: 0929-8673, DOI: 10.2174/092986712800099839 *
C. BODUR; H. BASAGA: "Bcl-2 Inhibitors: Emerging Drugs in Cancer Therapy", CURRENT MEDICINAL CHEMISTRY, vol. 19, 2012, pages 1804 - 1820
CHANG P; COUGHLIN M; MITCHISON TJ: "Tankyrase-1 polymerization ofpoly(ADP- ribose) is required for spindle structure and function", NATURE CELL BIOLOGY, vol. 7, 2005, pages 1133 - 1139
CHEN Z; LI DQ; TONG L; STEWART P; CHU C; PFLUGFELDER SC: "Targeted inhibition of p57 and p15 blocks transforming growth factor beta-inhibited proliferation of primary cultured human limbal epithelial cells", MOLECULAR VISION, vol. 12, 2006, pages 983 - 994
CHITTENDEN ET AL., EMBO, vol. 14, 1995, pages 5589FF
CLEARY ET AL., PROC. NAT'L. ACAD. SCI. USA, vol. 82, 1985, pages 7439FF
CRIOLLO A; GALLUZZI L; MAIURI MC; TASDEMIR E; LAVANDERO S; KROEMER G: "Mitochondrial control of cell death induced by hyperosmotic stress", APOPTOSIS : AN INTERNATIONAL JOURNAL ON PROGRAMMED CELL DEATH, vol. 12, 2007, pages 3 - 18
DE LA MOTTE ROUGE T; GALLUZZI L; OLAUSSEN KA; ZERMATI Y; TASDEMIR E; ROBERT T ET AL.: "A novel epidermal growth factor receptor inhibitor promotes apoptosis in non- small cell lung cancer cells resistant to erlotinib", CANCER RES, vol. 67, 2007, pages 6253 - 6262
DORER RK ET AL., CURRENT BIOLOGY, vol. 15, 2005, pages 1070 - 76
FAN S; MENG Q; AUBORN K; CARTER T; ROSEN EM: "BRCAl and BRCA2 as molecular targets for phytochemicals indole-3-carbinol and genistein in breast and prostate cancer cells", BRITISH JOURNAL OF CANCER, vol. 94, 2006, pages 407 - 426
GABRIELY G; YI M; NARAYAN RS; NIERS JM; WURDINGER T; IMITOLA J ET AL.: "Human glioma growth is controlled by microRNA-lOb", CANCER RES, vol. 71, 2011, pages 3563 - 3572
GALLUZZI ET AL., CELL DEATH DIFFERENTIATION, vol. 16, 2009, pages 1093 - 1107
GAO X; WANG H; SAIRENJI T: "Inhibition of Epstein-Barr virus (EBV) reactivation by short interfering RNAs targeting p38 mitogen-activated protein kinase or c-myc in EBV-positive epithelial cells", JOURNAL OF VIROLOGY, vol. 78, 2004, pages 11798 - 11806
GIMENEZ-ABIAN JF; SUMARA I; HIROTA T; HAUF S; GERLICH D; DE LA TORRE C ET AL.: "Regulation of sister chromatid cohesion between chromosome arms", CURRENT BIOLOGY : CB, vol. 14, 2004, pages 1187 - 1193
GOODMAN; GILMAN'S ET AL.: "Pharmacological Basis of Therapeutics", 1996, MCGRAW-HILL, pages: 1225 - 1287
HUANG X; GUO B: "Adenomatous polyposis coli determines sensitivity to histone deacetylase inhibitor-induced apoptosis in colon cancer cells", CANCER RES, vol. 66, 2006, pages 9245 - 9251
ITAKURA E; KISHI C; INOUE K; MIZUSHIMA N: "Beclin 1 forms two distinct phosphatidylinositol 3-kinase complexes with mammalian Atgl4 and UVRAG", MOL BIOL CELL, vol. 19, 2008, pages 5360 - 5372
JELLUMA N ET AL., PLOS ONE, vol. 3, 2008, pages E2415
JIANG M; MILNER J: "Bcl-2 constitutively suppresses p53-dependent apoptosis in colorectal cancer cells", GENES & DEVELOPMENT, vol. 17, 2003, pages 832 - 837
JOHNSON VL; SCOTT MI; HOLT SV; HUSSEIN D; TAYLOR SS: "Bubl is required for kinetochore localization of BubRl, Cenp-E, Cenp-F and Mad2, and chromosome congression", JOURNAL OF CELL SCIENCE, vol. 117, 2004, pages 1577 - 1589
JONES MH ET AL., CURRENT BIOLOGY, vol. 15, 2005, pages 160 - 65
KEN-ICHI KUSAKABE ET AL.: "Diaminopyridine-Based Potent and Selective Mps1 Kinase Inhibitors Binding to an Unusual Flipped-Peptide Conformation", ACS MED. CHEM. LETT., vol. 3, 2012, pages 560 - 564
KEPP O; GOTTSCHALK K; CHURIN Y; RAJALINGAM K; BRINKMANN V; MACHUY N ET AL.: "Bim and Bmf synergize to induce apoptosis in Neisseria gonorrhoeae infection", PLOS PATHOGENS, vol. 5, 2009, pages E1000348
KEPP, NAT. REV. DRUG DISCOVERY, vol. 10, 2011, pages 221 - 237
KING RW, BIOCHIMICA ET BIOPHYSICA ACTA, vol. 1786, 2008, pages 4 - 14
KOPS GJ ET AL., NATURE REVIEWS CANCER, vol. 5, 2005, pages 773 - 85
KROEMER ET AL., PHYS. REV., vol. 87, 2007, pages 99 - 163
LEE HO; LEE JH; CHOI E; SEOL JY; YUN Y; LEE H: "A dominant negative form of p63 inhibits apoptosis in a p53-independent manner", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 344, 2006, pages 166 - 172
LI J; TAN M; LI L; PAMARTHY D; LAWRENCE TS; SUN Y: "SAK, a new polo-like kinase, is transcriptionally repressed by p53 and induces apoptosis upon RNAi silencing", NEOPLASIA, vol. 7, 2005, pages 312 - 323
LIPINSKI, C.A.; LOMBARDO, F.; DOMINY, B.W.; FEENEY, P.J., ADV. DRUG DELIVER. REV., vol. 23, 1997, pages 3
LOPEZ ET AL., INVEST. OPTHTHALMOL. VIS. SCI., vol. 37, 1996, pages 855
LOU Z; CHINI CC; MINTER-DYKHOUSE K; CHEN J: "Mediator of DNA damage checkpoint protein 1 regulates BRCA1 localization and phosphorylation in DNA damage checkpoint control", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 278, 2003, pages 13599 - 13602
MA H; PEDERSON T: "Depletion of the nucleolar protein nucleostemin causes Gl cell cycle arrest via the p53 pathway", MOL BIOL CELL, vol. 18, 2007, pages 2630 - 2635
MALEY CC; GALIPEAU PC; LI X; SANCHEZ CA; PAULSON TG; BLOUNT PL ET AL.: "The combination of genetic instability and clonal expansion predicts progression to esophageal adenocarcinoma", CANCER RES, vol. 64, 2004, pages 7629 - 7633
MOHAMED JEMAÀ ET AL: "Preferential killing of p53-deficient cancer cells by reversine", CELL CYCLE, vol. 11, no. 11, 1 June 2012 (2012-06-01), pages 2149 - 2158, XP055084348, ISSN: 1538-4101, DOI: 10.4161/cc.20621 *
MOHAMED JEMAÀ ET AL: "Selective killing of p53-deficient cancer cells by SP600125", EMBO MOLECULAR MEDICINE, vol. 4, no. 6, 21 June 2012 (2012-06-21), pages 500 - 514, XP055084368, ISSN: 1757-4676, DOI: 10.1002/emmm.201200228 *
MOHAMMAD, R. M. ET AL.: "Preclinical studies of TW-37, a new nonpeptidic small-molecule inhibitor of Bcl-2, in diffuse large cell lymphoma xenograft model reveal drug action on both Bct-2 and Mcl-1", CLIN. CANCER RES., vol. 13, 2007, pages 2226 - 2235
MOON D O ET AL: "Bcl-2 overexpression attenuates SP600125-induced apoptosis in human leukemia U937 cells", CANCER LETTERS, NEW YORK, NY, US, vol. 264, no. 2, 18 June 2008 (2008-06-18), pages 316 - 325, XP022637679, ISSN: 0304-3835, [retrieved on 20080314], DOI: 10.1016/J.CANLET.2008.02.011 *
MUSACCHIO A; SALMON ED, NAT REV MOL CELL BIOL., vol. 8, 2007, pages 379 - 93
MYERS JS; CORTEZ D: "Rapid activation of ATR by ionizing radiation requires ATM andMre11", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 281, 2006, pages 9346 - 9350
NEMA, S. ET AL.: "Excipients and Their Use in Injectable Products", PDA JOURNAL OF PHARMACEUTICAL SCIENCE ET TECHNOLOGY, vol. 51, no. 4, 1997, pages 166 - 171
NITTA M; KOBAYASHI O; HONDA S; HIROTA T; KUNINAKA S; MARUMOTO T ET AL.: "Spindle checkpoint function is required for mitotic catastrophe induced by DNA- damaging agents", ONCOGENE, vol. 23, 2004, pages 6548 - 6558
OLSON E; NIEVERA CJ; KLIMOVICH V; FANNING E; WU X: "RPA2 is a direct downstream target for ATR to regulate the S-phase checkpoint", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 281, 2006, pages 39517 - 39533
PEER ET AL., LAB. INVEST., vol. 72, 1995, pages 638
PICHIERRI P; ROSSELLI F: "The DNA crosslink-induced S-phase checkpoint depends on ATR-CHKl and ATR-NBS1-FANCD2 pathways", THE EMBO JOURNAL, vol. 23, 2004, pages 1178 - 1187
POWELL, M.F. ET AL.: "Compendium of Excipients for Parenteral Formulations", PDA JOURNAL OF PHARMACEUTICAL SCIENCE & TECHNOLOGY, vol. 52, no. 5, 1998, pages 238 - 311
PURE APPL CHEM, vol. 45, 1976, pages 11 - 30
ROTTMANN S; SPECKGENS S; LUSCHER-FIRZLAFF J; LUSCHER B: "Inhibition of apoptosis by MAD 1 is mediated by repression of the PTEN tumor suppressor gene", F4SEB JOURNAL : OFFICIAL PUBLICATION OF THE FEDERATION OF AMERICAN SOCIETIES FOR EXPERIMENTAL BIOLOGY, vol. 22, 2008, pages 1124 - 1134
S. M. BERGE ET AL.: "Pharmaceutical Salts", J. PHARM. SCI., vol. 66, 1977, pages 1 - 19
SCHMIDT M ET AL., EMBO REPORTS, vol. 6, 2005, pages 866 - 72
SCHMIDT M ET AL: "Ablation of the spindle assembly checkpoint by a compound targeting Mps1", EMBO REPORTS, NATURE PUBLISHING GROUP, LONDON, GB, vol. 6, no. 9, 29 July 2005 (2005-07-29), pages 866 - 872, XP002408936, ISSN: 1469-221X, DOI: 10.1038/SJ.EMBOR.7400483 *
SCHMIDT M; BASTIANS H, DRUG RESISTANCE UPDATES, vol. 10, 2007, pages 162 - 81
SCHMIDT M; MEDEMA RH, CELL CYCLE, vol. 5, 2006, pages 159 - 63
SPIERINGS DC; DE VRIES EG; STEL AJ; TE RIETSTAP N; VELLENGA E; DE JONG S: "Low p21 Waf1/Cip1 protein level sensitizes testicular germ cell tumor cells to Fas-mediated apoptosis", ONCOGENE, vol. 23, 2004, pages 4862 - 4872
STRICKLEY, R.G: "Parenteral Formulations of Small Molecule Therapeutics Marketed in the United States (1999)-Part-1", PDA JOURNAL OF PHARMACEUTICAL SCIENCE TECHNOLOGY, vol. 53, no. 6, 1999, pages 324 - 349
STUCKE VM; BAUMANN C; NIGG EA: "Kinetochore localization and microtubule interaction of the human spindle checkpoint kinase Mpsl", CHROMOSOMA, vol. 113, 2004, pages 1 - 15
SUIJKERBUIJK SJ; KOPS GJ, BIOCHEMICA ET BIOPHYSICA ACTA, vol. 1786, 2008, pages 24 - 31
T.W. GREENE; P.G.M. WUTS: "Protective Groups in Organic Synthesis", 1999, WILEY
TANENBAUM ME; GALJART N; VAN VUGT MA; MEDEMA RH: "CLIP-170 facilitates the formation of kinetochore-microtubule attachments", THE EMBO JOURNAL, vol. 25, 2006, pages 45 - 57
TOSCANO F; PARMENTIER B; FAJOUI ZE; ESTOMES Y; CHAYVIALLE JA; SAURIN JC ET AL.: "p53 dependent and independent sensitivity to oxaliplatin of colon cancer cells", BIOCHEMICAL PHARMACOLOGY, vol. 74, 2007, pages 392 - 406
TZE-CHEN HSIEH ET AL: "The 2,6-disubstituted purine reversine induces growth arrest and polyploidy in human cancer cells.", INTERNATIONAL JOURNAL OF ONCOLOGY, vol. 31, no. 6, 1 December 2007 (2007-12-01), pages 1293 - 1300, XP055084551, ISSN: 1019-6439 *
VEBER ET AL., J. MED. CHEM., vol. 45, 2002, pages 2615 - 2623
VITALE I; GALLUZZI L; VIVET S; NANTY L; DESSEN P; SENOVILLA L ET AL.: "Inhibition of Chkl kills tetraploid tumor cells through a p53-dependent pathway", PLOS ONE, vol. 2, 2007, pages E1337
VITALE I; SENOVILLA L; JEMAA M; MICHAUD M; GALLUZZI L; KEPP O ET AL.: "Multipolar mitosis of tetraploid cells: inhibition by p53 and dependency on Mos", THE EMBO JOURNAL, vol. 29, 2010, pages 1272 - 1284
WANG ET AL., GENES DEV., vol. 10, 1996, pages 2859FF
WANG Q; LIU T; FANG Y; XIE S; HUANG X; MAHMOOD R ET AL.: "BUBR1 deficiency results in abnormal megakaryopoiesis", BLOOD, vol. 103, 2004, pages 1278 - 1285
WEAVER BA; CLEVELAND DW, CANCER RESEARCH, vol. 67, 2007, pages 10103 - 5
XU Q; ZHU S; WANG W; ZHANG X; OLD W; AHN N ET AL.: "Regulation of kinetochore recruitment of two essential mitotic spindle checkpoint proteins by Mpsl phosphorylation", MOL BIOL CELL, vol. 20, 2009, pages 10 - 20
XUEDONG LIU ET AL: "The MPS1 Family of Protein Kinases", ANNUAL REVIEW OF BIOCHEMISTRY, vol. 81, no. 1, 7 July 2012 (2012-07-07), pages 561 - 585, XP055084382, ISSN: 0066-4154, DOI: 10.1146/annurev-biochem-061611-090435 *
YUAN B ET AL., CLINICAL CANCER RESEARCH, vol. 12, 2006, pages 405 - 10
ZERMATI Y; MOUHAMAD S; STERGIOU L; BESSE B; GALLUZZI L; BOEHRER S ET AL.: "Nonapoptotic role for Apaf-1 in the DNA damage checkpoint", MOL CELL, vol. 28, 2007, pages 624 - 637
ZHONG D; LIU X; KHURI FR; SUN SY; VERTINO PM; ZHOU W: "LKB1 is necessary for Akt-mediated phosphorylation ofproapoptotic proteins", CANCER RES, vol. 68, 2008, pages 7270 - 7277

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3007692A1 (en) * 2013-06-11 2016-04-20 Bayer Pharma Aktiengesellschaft Combinations for the treatment of cancer comprising a mps-1 kinase inhibitor and a mitotic inhibitor
CN112739349A (en) * 2018-09-18 2021-04-30 圣诺康生命科学公司 Combination therapy for the treatment of leukemia
CN112739349B (en) * 2018-09-18 2024-03-01 圣诺康生命科学公司 Combination therapy for the treatment of hematological cancers
US11066404B2 (en) 2018-10-11 2021-07-20 Incyte Corporation Dihydropyrido[2,3-d]pyrimidinone compounds as CDK2 inhibitors
US11866432B2 (en) 2018-10-11 2024-01-09 Incyte Corporation Dihydropyrido[2,3-d]pyrimidinone compounds as CDK2 inhibitors
US11384083B2 (en) 2019-02-15 2022-07-12 Incyte Corporation Substituted spiro[cyclopropane-1,5′-pyrrolo[2,3-d]pyrimidin]-6′(7′h)-ones as CDK2 inhibitors
US11472791B2 (en) 2019-03-05 2022-10-18 Incyte Corporation Pyrazolyl pyrimidinylamine compounds as CDK2 inhibitors
US11919904B2 (en) 2019-03-29 2024-03-05 Incyte Corporation Sulfonylamide compounds as CDK2 inhibitors
US11440914B2 (en) 2019-05-01 2022-09-13 Incyte Corporation Tricyclic amine compounds as CDK2 inhibitors
US11447494B2 (en) 2019-05-01 2022-09-20 Incyte Corporation Tricyclic amine compounds as CDK2 inhibitors
US11427567B2 (en) 2019-08-14 2022-08-30 Incyte Corporation Imidazolyl pyrimidinylamine compounds as CDK2 inhibitors
CN115298177A (en) * 2019-10-11 2022-11-04 因赛特公司 Bicyclic amines as CDK2 inhibitors
US11851426B2 (en) 2019-10-11 2023-12-26 Incyte Corporation Bicyclic amines as CDK2 inhibitors
WO2021072232A1 (en) * 2019-10-11 2021-04-15 Incyte Corporation Bicyclic amines as cdk2 inhibitors
WO2022237844A1 (en) * 2021-05-12 2022-11-17 微境生物医药科技(上海)有限公司 Pyrrolopyrimidine derivative containing pyrazine structure

Similar Documents

Publication Publication Date Title
US8551980B2 (en) Substituted triazolopyridines
WO2014020043A1 (en) Combinations for the treatment of cancer
AU2012244859B2 (en) Triazolopyridines
EP2651946B1 (en) 2-substituted imidazopyrazines for use as mps-1 and tkk inhibitors in the treatment of hyperproliferative disorders
JP5833644B2 (en) Substituted triazolopyridine
US9199999B2 (en) Substituted imidazopyrazines
CA2781915A1 (en) Triazolopyridines
EP2651950A1 (en) 6 substituted imidazopyrazines for use as mps-1 and tkk inhibitors in the treatment of hyperproliferative disorders
JP5951750B2 (en) Substituted imidazopyridines and intermediates thereof
US9388140B2 (en) Substituted benzimidazoles
CA2902978A1 (en) Substituted imidazopyridazines
US9212184B2 (en) 6-thio-substituted imidazo[1,2-a]pyrazines as Mps-1 inhibitors
US9512126B2 (en) Substituted imidazopyridazines
WO2014020041A1 (en) Combinations for the treatment of cancer
US20180022750A1 (en) 6-hydroxybenzofuranyl- and 6-alkoxybenzofuranyl-substituted imidazopyridazines
WO2012160029A1 (en) Substituted triazolopyridines
TW201406760A (en) Amino-substituted imidazopyridazines

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13744521

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13744521

Country of ref document: EP

Kind code of ref document: A1