WO2014014162A1 - 가뭄 스트레스 저항성 관련 유전자 및 형질전환 식물체 - Google Patents

가뭄 스트레스 저항성 관련 유전자 및 형질전환 식물체 Download PDF

Info

Publication number
WO2014014162A1
WO2014014162A1 PCT/KR2012/008987 KR2012008987W WO2014014162A1 WO 2014014162 A1 WO2014014162 A1 WO 2014014162A1 KR 2012008987 W KR2012008987 W KR 2012008987W WO 2014014162 A1 WO2014014162 A1 WO 2014014162A1
Authority
WO
WIPO (PCT)
Prior art keywords
atrzfl
plant
gene
plants
drought stress
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2012/008987
Other languages
English (en)
French (fr)
Inventor
김철수
주현우
민지희
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Industry Foundation of Chonnam National University
Original Assignee
Industry Foundation of Chonnam National University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Industry Foundation of Chonnam National University filed Critical Industry Foundation of Chonnam National University
Publication of WO2014014162A1 publication Critical patent/WO2014014162A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93—Ligases (6)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y603/00—Ligases forming carbon-nitrogen bonds (6.3)
    • C12Y603/02—Acid—amino-acid ligases (peptide synthases)(6.3.2)
    • C12Y603/02019—Ubiquitin-protein ligase (6.3.2.19), i.e. ubiquitin-conjugating enzyme

Definitions

  • the present invention relates to a drought stress resistance-related gene and a transformed plant in which the expression of the gene is suppressed.
  • Protein ubiquitination in eukaryotic cells is an important post-translational modification that is used to regulate various cellular and developmental processes (Dye and Schulman, 2007). Ubiquitinylated proteins are involved in abiotic or biological stress reactions, hormone reactions, cell cycle progression and cell differentiation in higher plants (Craig et al., 2009; Santner and Estelle, 2009; Marrocco et al., 2010; Ryu et al., 2010).
  • Ubiquitin (Ub) is an 8 kDa conserved protein that is first activated by the UTP-activating enzyme El Jb—activating enzyme El) in an ATP-dependent manner, and when the Ub-E2 complex binds to Ub-protein ligase E3 Ub migrates from Ub_E2 to the substrate protein and is recognized and degraded by the 26S proteasome (Vierstra, 2003).
  • the function of protein ubiquitation independent of degradation such as DNA repair and protein transport is also known (Chen et al., 2009). More than 1,400 genes in the Arabidopsis genome are predicted to encode Ub-E3 ligase (Vierstra, 2009).
  • E3 ligase is classified into two groups.
  • One group consists of Really Interesting New Gene (RING) / U-B0X and HECT Homology to E6-AP Car boxy 1 Terminus (E3) enzymes that act as single subunits.
  • RING Really Interesting New Gene
  • E3 Homology to E6-AP Car boxy 1 Terminus
  • APC Anaphase-Promoting Complex
  • SCF Sk P l_Cul ⁇ -F box
  • Multi Tyers and Jorgensen, 2000; Lin et al.. , 2002.
  • E3 ligase containing about 469 RING motifs, constitutes the third largest gene family in Arabidopsis (Mudgil et al., 2004; Stone et al., 2005).
  • the Cys-Rich RING Finger was first introduced in the early 1990s. It is known (Freemont et al., 1991) and is defined as a linear series of conserved Cys and His residues that bind two zinc atoms in a cross brace configuration.
  • RING fingers can be divided into two types, C 3 HC 4 (RING-HC) and C 3 H 2 C 3 (RING-H2), depending on whether there is a Cys or His residue at the fifth position of the motif (Freemont, 2000). ).
  • RING E3 ligase is involved in a variety of intracellular processes such as auxin signaling, abscitic acid signaling, brassinosteroid reactions, seed germination, hair growth, alternative metabolic processes for nitrogen source restriction and sugar responses.
  • auxin signaling such as auxin signaling, abscitic acid signaling, brassinosteroid reactions, seed germination, hair growth, alternative metabolic processes for nitrogen source restriction and sugar responses.
  • RING proteins play an important role in the response to environmental stimuli.
  • RING proteins are involved in photomorphogenesis, defense signaling, aging, resistance to cold, drought, salinity and osmotic stress (Yan et al., 2003; Craig et al., 2009; Fujita et al., 2011; Smirnova et al., 2011).
  • many papers and patent documents are referenced and their citations are indicated.
  • the disclosures of cited papers and patent documents are incorporated herein by reference in their entirety, and the level of the technical field to which the present invention belongs and the contents of the present invention are more clearly explained.
  • an object of the present invention is to provide a composition for improving drought stress resistance of plants.
  • Another object of the present invention is to provide a transgenic plant cell and a transgenic plant having drought stress resistance.
  • Another object of the present invention to provide a method for producing a transgenic plant with improved drought stress resistance.
  • the present invention provides a protein comprising the amino acid sequence of SEQ ID NO: 2 of the sequence listing sequence of the first sequence encoding the amino acid sequence of the inhibitor or SEQ ID NO: It provides a composition for enhancing drought stress resistance of a plant comprising an expression inhibitor of a nucleotide sequence.
  • the present inventors made diligent research efforts to find genes that can improve the resistance of plants to drought stress.
  • nucleotide sequence encoding the amino acid sequence of the sequence listing second sequence of the present invention is not limited to the nucleotide sequence of the attached sequence listing ⁇ -7. It is clear.
  • nucleic acids do not result in changes in proteins.
  • Such nucleic acids include functionally equivalent codons or codons that encode the same amino acid (eg, by codon degeneracy, six codons for arginine or serine), or codons that encode biologically equivalent amino acids. And nucleic acid molecules.
  • nucleic acid molecules used in the present invention are also interpreted to include sequences that exhibit substantial identity with the sequences listed in the Sequence Listing.
  • the substantial identity is at least 60% when the sequence of the present invention and any other sequence are maximally treated to the maximum, and the aligned sequence is analyzed using algorithms commonly used in the art.
  • homology more preferably 70% homology, even more preferably 80% homology, most preferably homology of.
  • Alignment methods for sequence comparison are known in the art.
  • Various methods and algorithms for alignment are described in Smith and Waterman, Adv. Appl. Math. 2: 482 (1981); Needleman and Wunsch, J. Mol. Bio. 48: 443 (1970); Pearson and Lipman, Methods in Mol.
  • BLSAT is accessible at http://www.ncbi.nlm.nih.gov/BLAST/. Sequence homology comparison method using this program is http: // ⁇ . ncbi.nlm.nih.gov/BLAST/blast_help. You can check it in html.
  • the term “drought stress” used in the present invention means damage to plant growth and survival in a state in which normal water supply is not provided in plant growth. It is used in very general terms, including all types of abiotic (eg, exposure to several chemicals to treatment or drying conditions) and biological (infection with multiple infectious agents) stress conditions.
  • the term "resistance” or “resistance” to stress means having a strong resistance that can be detected as compared to its wild-type damage to the above stress, the transgenic plant of the present invention is such resistance or resistance Refers to a plant, plant part, plant tissue or plant cell having
  • the protein inhibitor used in the present invention means an inhibitor that inhibits the activity of AtRZFl protein, which is an E3 ubiquitin ligase having the amino acid sequence of SEQ ID NO: 2, or prevents the AtRZFl protein from binding to a substrate. .
  • the inhibitor of the protein consisting of the amino acid sequence of the second sequence of the present invention is preferably antibody, peptide aptamer, AdNectin, af body (af f ibody), Avi Avitner, Kunitz domain or compound.
  • Antibodies that specifically bind to and inhibit activity by the AtRZFl protein that can be used in the present invention are polyclonal or monoclonal antibodies, preferably monoclonal antibodies.
  • Antibodies to the AtRZFl protein can be prepared by methods commonly practiced in the art, such as fusion methods (Kohler and Milstein, European Journal of Immunology, 6: 511-519 (1976)), recombinant DNA methods (US Pat. No. 4). , 816, 56) or phage antibody library methods (Clackson et al, Nature, 352: 624-628 (1991) and Marks et al, J. Mol. Biol., 222: 58 : 1-597 (1991)).
  • Peptide 3 ⁇ 4mers that can be used in the present invention are DNA or RNA oligonucleotides that are folded into unique conformations to bind to the target antigen with high specificity and affinity.
  • Such aptamers can be obtained by the Systemic Evolution of Ligands by Exponential Enrichment (SELEX) method (Tuerk and Gold, Science, 249: 505—510 (1990)).
  • AtRZFl protein Compounds as inhibitors to proteins consisting of amino acid sequences of SEQ ID NO: 2 of the present invention (AtRZFl protein) can be obtained by screening for substances that inhibit the activity of AtRZFl protein or bind to AtRZFl protein.
  • the AtRZFl protein may be in any form, such as an AtRZFl protein in an isolated form or an AtRZFl protein contained in a cell.
  • the method of screening a compound as an AtRZFl protein inhibitor in the present invention can be carried out in a variety of ways, in particular in a high throughput manner according to various binding assays known in the art.
  • the test substance or AtRZFl protein may be labeled with a detectable label.
  • the detectable label may include a chemical label (eg, biotin), an enzyme label (eg, horseradish peroxidase, alkaline phosphatase, peroxidase, luciferase, -galactosida).
  • radiolabels eg C 14 , I 125 , ⁇ 32 and S 35
  • fluorescent labels eg coumarin, fluorescein, fluoresein Isothiocyanate (FITC), rhodamine 6G (rhodamine 6G) , Rhodamine B (rhodamine B), TAMRA (6-carboxy- tetramethyl-rhodamine), Cy-3, Cy_5, Texas Red, Alexa Fluor, DAPI (4,6-diamidino-2-phenyl indole), HEX, TET, Dabsyl and FAM], luminescent labels, chemi luminescent labels, fluorescence resonance energy transfer (FRET) labels or metal labels (eg gold and silver).
  • fluorescent labels eg coumarin, fluorescein, fluoresein Isothiocyanate (FITC), rhodamine 6G (rhodamine 6G) , Rhodamine B (rhodamine B), TAM
  • AtRZFl protein or test substance labeled with a detectable label If used, the binding between At ZFl protein and the test substance can be analyzed by detecting the signal from the label. For example, when alkaline phosphatase is used as a label, bromochloroindolyl phosphate (BCIP), nitro blue tetrazolium (NBT), naphth-AS-B1-phosphate (naphthol® AS-Bl- Signals are detected using colorimetric substrates such as phosphate) and enhanced chemi fluorescence (ECF).
  • BCIP bromochloroindolyl phosphate
  • NBT nitro blue tetrazolium
  • naphth-AS-B1-phosphate naphth-AS-B1-phosphate
  • ECF enhanced chemi fluorescence
  • binding of the test substance to the AtRZFl protein may be analyzed without labeling the interactants.
  • a microphysiometer can be used to analyze whether the test substance binds to the AtRZFl protein.
  • Microphysiometers are analytical tools that measure the rate at which a cell acidifies its environment using a light-addressable potent ion sensor (LAPS). The change in acidification rate can be used as an indicator for binding between test substance and AtRZFl protein (McConnell et al., Science 257: 1906-1912 (1992)).
  • the binding ability of the test substance with the AtRZFl protein can be analyzed using real-time bimolecular interaction analysis (BIA) (Sjolander & Urbaniczky, Anal. Chem. 63: 2338-2345 (1991), and Szabo et al., Curr. Op in. Struct. Biol. 5: 699—705 (1995)).
  • BIA is a technique for analyzing specific interactions in real time and can be performed without labeling of the interactions (eg, BIAcore TM). Changes in surface plasmon resonance (SPR) can be used as indicators for real-time reactions between molecules.
  • the screening method can be carried out according to a two-hybrid analysis or a three-hybrid analysis method (US Pat. No. 5,283,317; Zervos et al., Cell 72, 223-232, 1993; Madura et al., J. Biol. 268, 12046-12054, 1993; Bartel et al. , BioTechniques 14, 920-924, 1993; Iwabuchi et al. , Oncogene 8, 1693-1696, 1993; and W) 94/10300).
  • the AtRZFl protein can be used as a bait protein.
  • substances which bind to AtRZFl protein, particularly proteins can be screened.
  • the two-hybrid system is based on all the properties of the transcription factors composed of cleavable DNA-binding and activation domains.
  • this assay uses two DNA constructs.
  • an AtRZFl-encoding polynucleotide is fused to a DNA binding domain-encoding polynucleotide of a known transcription factor (eg GAL-4).
  • a DNA sequence encoding a protein of interest (“prey” or “sample”) is fused to a polynucleotide encoding an activation domain of the above known transcription factors.
  • the DNA-binding and activation domains of the transcription factors are contiguous, triggering reporter genes (eg, Lac ⁇ transcription). According to the present invention, it can be used to detect AtRZFl protein and can be used as AtRZFl protein inhibitor.
  • the inhibitor of expression of the nucleotide sequence of SEQ ID NO: 1 encoding the amino acid sequence of 2 sequences is preferably a nucleic acid molecule or a mutation inducing agent.
  • the term “inhibition of expression” means a modification on the nucleotide sequence that causes a decrease in the function of the target gene, and preferably means that the target gene expression becomes undetectable or present at a meaningless level.
  • the nucleic acid molecule of the present invention is siRNA, shRNA, miRNA, ribozyme (r ibozyme), pep tide nucleic acids (PNA) or antisense oligonucleotides.
  • siRNA refers to a short double-chain RNA that can induce RNAKRNA interference through cleavage of certain mRNAs. It consists of a sense RNA strand having a sequence homologous to the mRNA of the target gene and an antisense RNA strand having a sequence complementary thereto. Since siRNA can inhibit expression of a target gene, it is provided as an efficient gene knockdown method or as a gene therapy method.
  • siRNAs are not limited to the complete pairing of double-stranded RNA portions paired with RNA, but paired by mismatches (bases not complementary), bulges (no bases on one chain), etc. May be included.
  • the total length is 10 to 100 bases, preferably 15 to 80 bases, most preferably 20 to 70 bases.
  • the siRNA terminal structure can be either blunt or cohesive, as long as the expression of the target gene can be suppressed by the RNAi effect.
  • the cohesive end structure is possible in both a three-terminal protruding structure and a five-terminal protruding structure.
  • the number of protruding bases is not limited. For example, the number of bases may be 1 to 8 bases, preferably 2 to 6 bases.
  • siRNA is a low-molecular RNA (for example, natural RNA molecules such as tRNA, rRNA, viral RNA or artificial RNA molecules, such as tRNA, rRNA, viral RNA, etc.) to the extent that can maintain the expression inhibitory effect of the target gene ) May be included.
  • the siRNA terminal structure does not need to have a cleavage structure at both sides, and may be a stem loop type structure in which one terminal portion of the double chain RNA is connected by a linker RNA.
  • the length of the linker is not particularly limited as long as it does not interfere with pairing of stem portions.
  • shRNA refers to a nucleotide composed of 50-70 single strands, and forms a stem-loop structure on in wVo.
  • Long R A of 19-29 nucleotides complementary to both loop regions of 5-10 nucleotides form base pairs to form a double stranded stem.
  • miRNA regulates gene expression and has a total length of 20-50 nucleotides, preferably 20-45 nucleotides, more preferably 20-40 nucleotides, even more preferably 20 -30 nucleotides, most preferably single-stranded RNA molecules consisting of 21-23 nucleotides.
  • miRNAs are ligonucleotides that are not expressed intracellularly and have a short stem-loop structure. miRNAs are homologous, in whole or in part, with one or more mRNAs (messenger RNAs), Target gene expression is inhibited through complementary binding to the mRNA.
  • Ribozyme refers to an RNA molecule having a function such as an enzyme that recognizes a base sequence of a specific RNA and cleaves it by itself as a kind of RNA. Ribozyme is a complementary nucleotide sequence of a target messenger RNA strand consisting of a region that binds with specificity and a region that cleaves the target RNA.
  • PNMPeptide nucleic acid is a molecule having both nucleic acid and protein properties, and refers to a molecule capable of complementarily binding to DNA or RNA.
  • PNA was first reported in 1999 as analogous DNA with nucleobases linked to peptide bonds (Nielsen PE, Egholm M, Berg RH, Buchardt 0, “Sequence-select ive recognition of DNA by strand displacement with a thymine-subst i tuted polyamide ", Science 1991, Vol. 254: pp 1497-1500]).
  • PNA is not found in nature but is artificially synthesized by chemical methods. PNAs hybridize with native nucleic acids of complementary base sequences to form double strands.
  • PNA / DNA duplexes are more stable than DNA / DNA duplexes and PNA / RNA duplexes are more stable than DNA / R A duplexes.
  • the most commonly used 3 ⁇ 4 basic skeleton is N- (2-aminoethyl) glycine, which is repeatedly linked by amide bonds.
  • the backbone of the peptide nucleic acid is different from that of the negatively charged natural nucleic acid. It is electrically neutral.
  • the four nucleic acid bases present in the PNA have approximately the same spatial size and distance between nucleic acid bases as for natural nucleic acids.
  • PNA is not only chemically more stable than natural nucleic acids but also biologically stable because it is not degraded by nucleases or proteases.
  • antisense oligonucleotide refers to DNA or RNA or derivatives thereof that contain a nucleotide sequence complementary to a sequence of a particular mRNA, and binds to a complementary sequence within the mRNA to inhibit translation of the mRNA into a protein.
  • Antisense nucleotide sequence of the present invention means a DNA or RNA sequence complementary to the mRNA of the target gene and capable of binding to the mRNA of the target gene, translation of the target gene and mRNA, translocation into the cytoplasm (trans cation ), Maturity (mat ur at ion) or May inhibit essential activity for all other global biological functions.
  • 3 ⁇ 4 of the antisense oligonucleotide is 6 to 100 bases, preferably 10 to 40 bases.
  • the antisense oligonucleotides can be modified at one or more bases, sugars or backbone positions to enhance efficacy (De Mesmaeker et al., Curr Opin Struct Biol., 5 (3): 343-55, 1995). Oligonucleotide backbones can be modified with phosphorothioates, phosphoesters, methyl phosphonates, short chain alkyls, cycloalkyls, short chain heteroatomics, heterocyclic intersaccharide linkages, and the like.
  • antisense nucleic acids may comprise one or more substituted sugars . It may include a sugar moiety.
  • Antisense oligonucleotides may comprise modified bases.
  • Modified bases include hypoxanthine, 6-methyladenine, 5-me pyrimidine (particularly 5-methylcytosine), 5-hydroxymethylcytosine (HMC), glycosyl HMC, gentobiosil HMC, 2-aminoadenine, 2 Thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N6 (6-aminonucleosil) adenine, 2,6-diaminopurine, etc. There is this.
  • the mutation inducing agent of the present invention is a vector for plant transformation inserted into the genomic DNA (gDNA) for a protein consisting of the amino acid sequence of SEQ ID NO: 2, more preferably T-DNA to be.
  • T-DNA refers to a DNA fragment delivered to the nucleus of a host plant cell as transfer DNA of a Ti (tumor-inducing) plasmid of Agrobacterium species. There is a 25 bp repetition sequence at both ends of the T-DNA. The transmission starts at the left border and ends at the right border.
  • the bacterial T-DNA is about 20,000 bp long and is used to cause insert ional mutagenesis by disrupting the target gene by their insertion, and the inserted T-DNA sequence not only mutates but also marks the target gene. Sometimes. Insertion of T-DNA into the gene of interest can be induced by selecting and using a specific T-DNA from the T-DNA collection (The SAIL collection). Since chromosomal insertion sites are known for each T-DNA collection, T-DNA insertion into specific genes is possible (Alonso et al., Science, vol. 301, no. 5633, p. 653-657 (2003).
  • the present inventors prepared the expression inhibitory mutant of the AtRZFl gene through transduction of Ti plasmid, and the primers in front of and behind the T-DNA border primer and T-DNA were inserted. As a result of the genotyping PCR, it was confirmed that T-DNA was inserted into the first exon, and RNA expression of the expression inhibitory mutant was extracted to confirm that gene expression was inhibited by RT-PCR (FIG. 7A). .
  • the present invention provides a transformed plant cell having drought stress resistance in which the E3 ubiquitin ligase atrzfl gene is inactivated.
  • the present invention provides a transformed plant having drought stress resistance in which the E3 ubiquitin ligase atrzfl gene is inactivated.
  • inactivation of the E3 ubiquitin ligase atrzfl gene can be carried out by inducing a mutation of the atrzfl gene.
  • the T-DNA is inserted into a genomic DNA (gDNA) for a protein consisting of the amino acid sequence of SEQ ID NO: 2.
  • a plant can be transformed by inserting an exogenous polynucleotide into a carrier such as a vector such as a plasmid or a virus, and can use Agrobacterium bacteria as a medium (Chilton et ai. Cell 11: 263: 271 (1977)), Plants can be transformed by directly introducing foreign polynucleotides into plant cells (Lorz et ai. Mo I. Genet. 199: 178-182; (1985)). For example, when using a vector that does not include a T-DNA site, electroporation, microparticle bombardment, and polyethylene glycol-mediated uptake may be used.
  • plant is used as a meaning including not only mature plants but also plant cells, plant tissues and seeds of plants that can develop into mature plants.
  • the plant to which the method of the present invention can be applied is not particularly limited.
  • the plants to which the method of the present invention can be applied most of the dicotyledonous plants including lettuce, cabbage, potato and radish or monocotyledonous pi ants such as rice and barley banana can be used. It is effective to increase the storage efficiency when applied to edible vegetables or fruits that show a sharp deterioration due to aging due to thin skins such as tomatoes and plants whose leaves are traded as main products.
  • the method of the present invention comprises food crops including rice, wheat, barley, corn, soybeans, potatoes, wheat, arms, oats and sorghum; Vegetable crops including Arabidopsis, Chinese cabbage, radish, peppers, strawberries, tomatoes, watermelons, cucumbers, cabbages, melons, pumpkins, green onions, onions, and carrots; Special crops including ginseng, tobacco, cotton, sesame, sugar cane, sugar beet, perilla, peanuts and rapeseed; Fruit trees, including apples, pears, jujube trees, peaches, lambs, grapes, citrus fruits, persimmons, plums, apricots and bananas; Flowers, including roses, gladiolus, gerberas, carnations, chrysanthemums, lilies, and yulips; And plant crops including lygras, redclover, orchardgrass, alphaalpha, pescue and perennial lygragrass.
  • Vegetable crops including Arabi
  • inactivation of the E3 ubiquitin ligase atrzfl gene in plant cells inserts T-DNA into the E3 ubiquitin ligase atrzfl gene (SEQ ID NO: 3) in the plant's gDNA. Do it.
  • T-DNA is introduced into plant cells in a form contained in a recombinant vector for plant transformation.
  • the recombinant vector for plant transformation of the present invention is an Agrobacterium (4 ⁇ rowc ⁇ / 1 ⁇ 27) binary vector.
  • binary vector refers to a vector in which a plasmid having a gene necessary for transferring a target nucleotide and a plasmid having a LB eft border and an RB right border, which are necessary for movement in a TKtumor inducible) plasmid, are divided into two.
  • Agrobacterium for transformation of the present invention may be any one suitable for the expression of the nucleotide sequence of the present invention, and in particular, Agrobacterium strain for plant transformation in the present invention is usually Agrobacterium tumefaciens (ro0ac er / uffl tmefaciens) GV31 () 1 is preferred.
  • the method of introducing the recombinant vector of the present invention to Agrobacterium may be carried out through various methods known to those skilled in the art, for example, particle bombardment, electroporat ion, transfection method ( transfection), lithium acetate method and heat shock. Preferably electroporation is used.
  • Selection of transformed plant cells can be carried out by exposing the transformed culture to a selection agent (eg metabolic inhibitors, antibiotics and herbicides). Plant cells that are transformed and stably contain marker genes that confer selective resistance are grown and divided in the cultures described above. Exemplary labels include, but are not limited to, hygromycin phosphotransferase genes, glycophosphate resistance genes and neomycin phosphotransferase (npt II) systems.
  • the invention provides a method of imparting drought stress resistance to a plant comprising the following steps:
  • the present invention provides a composition for improving drought stress resistance of plants, transformed plants having drought stress resistance, and a method for producing the transformed plants.
  • AtRZFl protein 1 is a diagram showing the structural characteristics of the AtRZFl protein.
  • (a) A schematic representation of the structure of the AtRZFl protein conserved moiety. Prediction of signal peptides was inconsistent between software programs. The primary structure of the RING-H2 zinc finger motif site is indicated by a black box.
  • (b) Infer AtRZFl ⁇ amino acid sequence and other AtRZFl homologs from other plant species via C3H2C3-type RING motif alignment.
  • AtRZFl (At3g56580), AtRHCla (At2g40830), AtRHC2a (At2g39720), AtSIS3 (At3g47990), Oryza saltiva RHCla (0sRZFl; NP_001044543) and Zea mays RHCla (ZmRHCla; showed black and NP_001149547) And similar amino acids
  • FIG. 2 shows the amino acid sequence of the predicted AtRZFl and associated therewith The sequences are shown. AtRZFl (At3g56580), OsRHCla (NP_001044543) and ZinRHCla (P_001149547) were shown, with black and gray shades representing identical and similar amino acids, respectively. A gap was inserted to optimize the alignment. RING H2—Type Zinc Finger Domain (186-226) is indicated by black lines on the alignment.
  • Figure 3 is a diagram showing the intracellular distribution of AtRZFl-EGFP fusion protein. 35S-EGFP and 25S-AtRZFl-EGFP constructs were transformed into Arabidopsis leaf protoplasts using PEG mediated methods. The distribution of the fusion protein was visualized using a fluorescence microscope. Scale bar indicates 10 ⁇ .
  • Figure 4 shows the results of confirming the AtRZFl promoter GUS expression pattern in transgenic Arabidopsis plants.
  • AtRZFl gene of Arabidopsis under water shortage stress. Manni was shown by quantitative RT-PCR analysis of AtRZFl ex expression for (a) or drought (b) reactions. Total RNA samples were obtained for each time period for 14-day-old plants treated with drought conditions or 400 mM mantle. Error bars represent standard deviation for three independent samples. AtRZFl or "expression differences RAB18 in 14 day-old Arabidopsis seedlings according to the presence or absence of various abiotic stress refers to the significance P ⁇ 0.01 (**). The RAB18 gene was used to control drought or manny as a stress control. "
  • Figure 6 shows the results of measuring AtRZFl E3 ubiquitin ligase activity in vitro. Incubate purified MBP-AtRZFl with El, E2, ubiquitin and ATP for 1 hour at 37 ° C. Poly ubiquitin chains were visualized using anti-ubiquitin (a) and anti-MBP (b) antibodies. Omission of E1 or E2 causes loss of ubiquitation. MBP was used as a negative control. The left figure shows the molecular weight (kDa) of the protein marker.
  • Figure 7 is a result showing the effect of the atrzfl frame mutation line on the osmotic test resistance.
  • wild type, atrzfl mutant and AtRZFl AtRZFl expression levels in two independent transgenic plants expressing (0X1-1 and 0X4-2) were determined by RT-PCR method using total RNA extracted from 2 week old seedlings. RT-PCR data was normalized to mRNA levels of the Actin 8 gene.
  • Atrzfl mutant plants show the results of confirming the osmotic stress resistance of the atrzfl mutant plant. Seeds were sprinkled on MS agar plates with or without 400 mM Manni and grown for 8 days. atrzfl mutant plants appear darker green than wild-type and AtRZFl overexpressing (0X1-1 and 0X4-2) plants under osmotic stress conditions. Scale bar: 10 mm.
  • FIG. 11 is a result of measuring the expression level of stress-related genes (P5CS1, P5CR, RAB18, RD29A, RD29B, AOXla, C0R15A, ERD15 and ERD1).
  • Stress-related genes P5CS1, P5CR, RAB18, RD29A, RD29B, AOXla, C0R15A, ERD15 and ERD1.
  • Two-week old wild type atrzfl and two independent AtRZFl overexpressing transgenic plants were grown for 10 days under normal or drought conditions.
  • Total RNA was obtained from plants and dPCR was performed using the gene specific primers listed in Table 1.
  • Each bar is a response to drought stress, indicating the relative expression of P5CS1, P5CR, RAB18, RD29A, RD29B, AOXla, C0R15A, ERD15 and ERD1 genes with increased expression induction compared to the control.
  • AtRZFl Overexpressing Plants (0X1 1 and 0X4-2) Total RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, Calif., USA) from 2 week old Arabidopsis leaves, and then RT-PCR was performed to obtain full length AtRZFlck t3g565.
  • Trizol reagent Invitrogen, Carlsbad, Calif., USA
  • RT-PCR was performed to obtain full length AtRZFlck t3g565.
  • primer 5'-TCTAGMTGTCAAGTATTCGGAATAC-3 'U3 ⁇ 4al region underlined we have a primer 5'-TCTAGMTGTCAAGTATTCGGAATAC-3 'U3 ⁇ 4al region underlined) and a reverse 5'- GTCGACATAGTCAAAAGGCCATCCAC-3 1 (sail region underlined) primer, 30 seconds at 94 ° C, 30 at 55 ° C PCR was performed by repeating a total of 35 cycles for 1 minute at 72
  • the amplified PCR product was cloned into a pGEM T-easy vector and then subjected to sequencing analysis to assay for nucleotide sequence of the AtRZFl gene.
  • the mutated AtRZFl cDNA molecules whose sequences were assayed were cloned into the Xba ⁇ and Sal ⁇ portions of the plant expression vector pBI 121-1 plasmid after treatment with the restriction enzymes Xba ⁇ and contained in the primers.
  • AtRZFl genes cloned in the plant expression vector were introduced into Agrobacteri tumefaciens strain GV3101 bacteria, and then transformed into Arabidopsis plants with the transformed Agrobacteriwn by vacuum transformation (Bechtold and Pelletier, 1998). After three generations of transformation, twelve different homogenous plants were obtained, and two overexpressing plants (0X1-1 and 0X4-2) were used to analyze the phenotype associated with drought stress. Two different superior obedient overexpressing plants (0X1-1 and 0X4-2) were identified as single locus by kanamycin antibiotic resistance analysis. Homogenous (homozygous) atrzfl mutant plant analysis
  • SALK_024296 (3 ⁇ / 7) with T-DNA inserted into the axon portion of the AtRZFl gene was obtained from Salk Institute's Arabidopsis T—DNA insertion collection (Alonso et al., 2003).
  • Gene-specific primers forward: 5'-TCTAGAATGTCAAGTATTCGGAATAC-3 ', reverse: 5'-GTCGACATAGTCAAAAGGCCATCCAC-3'
  • Genomic DNA was extracted from the atrzfl mutant and wild Arabidopsis plants (Ecotype, Col-0), followed by PCR analysis with gene specific primers.
  • WT can obtain PCR amplification products for the AtRZFl gene.
  • PCR amplification products for the AtRZFl gene could not be obtained from the genomic DNA of the atrzfl mutant. Since the T-DNA insertion was confirmed by combining the gene-specific forward primer and ⁇ -DNA left border-specific primer (5 ' ⁇ GCGTGGACCGOTGCTGCACCT-3'). T-DNA was inserted into the first axon region of the AtRZFl gene.
  • Good purebred (homozygous) atrzfl PCT conditions to secure a mutant plant is set in 30 seconds at 94X, 30 seconds at 57 ° C, 72 ° C in one minute, and PCR was performed by repeating 35 cycles.
  • RT-PCR was performed to determine whether transcription of AtRZFl gene was expressed from atrzfl mutant plants. After germination, total RNA was extracted from the 10-day old atrzfl mutant seedlings using Trizol reagent (Invitrogen, Carlsbad, CA, USA) to perform RT-PCR. Total RNA concentration was 5 for synthesizing cDNA and cDNA was synthesized using oligo- (dT) 15 primer and Superscript II reverse transcriptase (Invirogen, Gaithersburg, MD, USA). PCR was performed with the synthesized cDNA and AtRZFl gene specific primers.
  • PCR was performed by repeating a total of 27 cycles under conditions of 30 seconds at 94 ° C, 30 seconds at 55 ° C, and 1 minute at 72 ° C.
  • RT-PC it was found that the atrzfl mutant plant was not transcriptionally expressed in the AtRZFl gene.
  • the determination of suitability for RT-PCR performance conditions was used Arabidopsis Actin8 gene as a control.
  • the primers of the gene were used as the forward 5'-CCTTGCTGGTCGTGACCTTACTGA-3 'and reverse 5'-CTCTCAGCACCGATCGTGATCACT-3' primer sets.
  • Actin8 performing PCR gene expression was amplified PCR was carried out by repeating 24 cycles of 1 minute to 30 seconds at 94 ° C, 55 ° 30 sec at C, 72 ° C. Growth conditions and stress induction
  • Osmotic stress on the plants was induced by soaking the two-week-old Arabidopsis seedling in a solution containing 400 ⁇ manny. Samples were obtained at 0, 6, 12 and 24 hours after osmotic stress induction. Seedlings were grown by normal sprinkling for 3 days to induce drought stress, and after 2 weeks, plants were separated into two groups. One group induced drought stress by not supplying water for 10 days, and the control group supplied water normally.
  • AtRZFl-GFP constructs For transient expression of AtRZFl-GFP constructs, the open reading frame of AtRZFl was amplified using primers (5'-TCTAGAATGTCAAGTATTCGGAATAC-3 'and 5'-CCCTTGCTCACCATATAGTCAMAGGC-3'), and the EGFP gene was 5'-. Amplification was performed using GCCTTTTGACTATat ggt gagcaaggg-3 'and 5'-GAGCTCAGTTATCTAGATCC-3' primers.
  • the transformed protoplasts were placed on a slide glass and observed using a FluoViewlOOO confocal microscope (Olympus, Tokyo, Japan). Images were obtained by processing using FV10-ASW 1.7A software (Olympus). Expression analysis of drought stress-related genetic differences using quantitative PCR ( q PCR)
  • Quantitative real-time PCR was used with a Roter-Gene 6000 quantitative PCR machine (Corbett Research, Mortlake, NSW, Australia), and gene expression analysis was performed using the RG6000 1.7 software program (Corbett Research). .
  • Total RNA was extracted by RNeasy Plant Mini kit (CQiagen- Valencia-, £ ⁇ USA) from two-week-old plants with or without stress, and the total RNA concentration of each sample was 100 ng for qPCR.
  • SensiMix One-Step Kit (Quantance, London, UK) was used to perform quantitative PCR of each gene.
  • the QPCR performance procedure conditions are as follows.
  • AtRZFl cDNA was amplified using the following primers: 5′-GMTTCATGTCAAGTATrCGGAATAC-3 ′ ⁇ underlined EcoRi region) and 5′-GTCGACATAGTCAAAAGGCCATCCAC-3 ′ (under SaJl region).
  • PCR products were digested using EcoRi and Sail and inserted into pMAL P2x vectors (New England BioLabs, Beverly MA, USA).
  • the plasmid was transformed into E. coli BL21 strain to induce expression, and protein was purified by affinity chromatography using amylose resin (New England BioLabs).
  • In vitro self-ubiquitation assays were performed using Au) -ubiquitinylation kit (Enzo Life Sciences, Farmingdale, NY, USA). Immune blotting
  • the reaction samples were separated by electrophoresis using a 12% SDS-PAGE gel and then transferred to a polyvinylidene fluoride (PVDF) membrane using a semi-dry transfer (Bio-Rad, Hercules, Calif., USA).
  • PVDF polyvinylidene fluoride
  • Membrane is BSA / PBS-T Buffet (phosphate-buffered saline) solution containing 1% bovine serum albumin (BSA) and 0.2% twenty (137 mM NaCl, 3 mM KC1, 10 mM Na 2 HP0 4 , 2 mM). KH 2 P0 4 , pH7.4)] and the solution was blocked while shaking gently for 2 hours at room temperature with a solution.
  • BSA bovine serum albumin
  • the blocked membrane was a PBS solution containing PBS-T buffer 0.2% Tween 20 (137 mM NaCl, 3 mM KC1, 10 mM Na 2 HP0 4 , 2 mM KH 2 P0 4 , pH7.4)] solution at room temperature.
  • the first anti-Maltose Binding Protein (MBP) antibody (New England BioLabs) diluted 1: 10,000 or the first anti-Ub antibody (Enzo Life Sciences) diluted 1: 500
  • MBP MBP
  • the cultured membrane was washed three times for 10 minutes at room temperature with PBS-T buffer solution, followed by secondary anti-mouse antibody-peroxidase binding (New England BioLabs) or 1: 5,000 diluted 1: 10,000.
  • Anti-rabbit IgG antibody-HP binding (Enzo Life) Sciences) was added to the BSA / PBS-T buffer solution added to the membrane, and then incubated with gentle shaking for 2 hours at room temperature.
  • the cultured membrane was washed repeatedly with PBS-T buffer solution for 6 minutes at room temperature for 10 minutes, and then the membrane was exposed on the X-ray film using the Super signal West Pico ECL Substrate kit (Thermo Scientific).
  • At3g56580 belongs to the C3H2C3 'type RING—H2 finger gene family in whole Arabidopsis genome sequence analysis (Stone et al., 2005).
  • At3g56580 is 963 bp, has one 0RF encoding a protein consisting of 320 amino acids, and has a molecular weight of 35.8 kDa.
  • Several software programs http://ihg.gsf.de; http://hannibal.biol.uoa.gr) were used to predict the signal peptide sequence of the At3g56580 protein (FIG. La). Referring to FIG.
  • AtRZFl The At3g56580 gene is designated AtRZFl.
  • Amino acid sequence alignments between AtRZFl and protein and orthologs unknown from rice and maize are shown in FIG. 2. Comparing the amino acid sequence between the AtRZFl protein and the orolog protein in rice or maize, homology values of .36 ⁇ 7OT identity and 43-75% similarity were obtained.
  • AtRZFl comprises a single RING domain, the central portion of which refers to a region having 39-95% identity with other plant RING proteins and the corresponding region of the Arabidopsis. The function of these proteins is unknown, except for Sugar-insensitive 3 (SIS3).
  • SIS3 encodes ubiquitin E3 ligase and acts as a positive regulator of saccharide signaling during early seedling development (Huang et al., 2010).
  • AtRZFl To measure the intracellular distribution of AtRZFl, a GFP reporter gene was inserted into the AtRZFl coding region to construct a construct capable of producing AtRZFl-EGFP recombinant protein in Arabidopsis plasma cells. As shown in FIG. 3, the fluorescence signal of the AtRZFl-EGFP construct was detected in the cytoplasm of Arabidopsis lobular protoplasts. These results indicate that the intracellular distribution of AtRZFl is the same as the cytoplasm-distributing protein. Expression of MRZF1 in Arabidopsis
  • AtRZFl Arabidopsis transgenic plants comprising the 1.146-kb AtRZFl promoter-GUS recombinant construct were histochemically GUS stained to evaluate the initial expression pattern of AtRZFl.
  • GUS staining was observed in the calyx ( Figure 4c), stamens (Figure 4d) and pollen (Figure 4e).
  • AtRZFl expression was reduced by osmotic stress in Arabidopsis (hUp: // jsp. Weigelworld.org).
  • AtRZFl mRNA accumulation of 2 week old Arabidopsis seedlings under osmotic stress conditions was evaluated using quantitative RT-PCR. As shown in FIG. 5A, the transcription level of AtRZFl decreased about 3 times after 24 hours of treatment with Manni. AtRZFl expression was also decreased in Arabidopsis leaves under drought stress (FIG. 5B). Osmotic stress-induced RAB18 (responsive to ABA) (Huang et al., 2008) gene was used as a control for water deficient stress (FIG. 5A b). Mirrored results strongly suggest that ⁇ is controlled by drought conditions. Invitro Ubiquitin E3 Ligase Activity of AtRZFl
  • RING domain proteins are a type of E3 ligase involved in ubiquitination (Lorick et al., 1999). AtRZFl protein is a member of the C 3 3 ⁇ 4C 3 -type RING-3 ⁇ 4 protein (FIG. Lb), and there is no known E3 ligase activity (Kim et al., 2012). Thus, the present inventors attempted to confirm the AtRZFl function as an E3 ligase in the ubiquitination process. E3 ligase activity against AtRZFl was measured using an in vitro assay (FIG. 6). Recombinant MBP-AtRZFl protein was produced by E. coli and purified using amylose resin.
  • the ubiquitated MBP-AtRZFl protein was detected by immunoblotting with anti-Ub (FIG. 6A) and anti-MBP (FIG. 6B) antibodies. In the absence of E1 or E2, the ubiquitination activity of MBP-AtRZFl was not observed. As shown in FIG. 6, the polymer ubiquitation band is produced by AtRZFl, which indicates that AtRZFl has Ub E3 ligase activity in vitro.
  • AtRZFl overexpression was induced by regulation of 35S promoter in Arabidopsis. Twelve homozygous lines (T 3 generation) were obtained, and two lines (0X1-1 and 0X4-2) indicating high expression levels of the transgene were selected for phenotypic characterization (FIG. 7A). Comparing AtRZFl overexpression lines and wild type plants showed no morphological changes or growth inhibition (FIG. 8).
  • SALK_024296 At3g5658 tagged T-DNA insertion mutant
  • the atrzfl mutant plant was constructed by inserting T-DNA into the axon 1 of the At3g56580 gene, and as a result, expression of the endogenous AtRZFl gene was inhibited. Whether T— DNA was inserted into the At3g56580 gene 1 exon was confirmed by PCR. Homozygosity was established and AtRZFl ex expression was confirmed via RT-PCR (FIG. 7A).
  • AtRZFl overexpressing plants were isolated. 400 mM Manni was germinated in MS medium further comprising, and then grown for 8 days prior to measuring the survival rate of AtRZFl and expressing plants in a dry stress response (FIG. 8). Compared to 400 mM Manny, about 35% of the leaves of wild-type plants were greened under the conditions, the 0X1-1 and 0X4-2 lines were greened to 1 or less (FIG. 7B). In contrast, atrzfl mutant lines survived about 80% at 8 days after germination (FIG. 7B). As can be seen from the above results, AtRZFl overexpressing plants are hypersensitive to osmotic stress in terms of cotyledon development, and mutant and AtRZFl overexpressing plants have opposite phenotypes in response to drought stress.
  • the atrzfl mutant plant exhibits a low membrane ion leakage of the leaf compared to wild-type and AtrZFl overexpressing plants, resulting in a late drought-induced phenotype (FIG. 10B). These results indicate that the phenotype induced by the physiological process of drought is earlier in AtRZFl overexpressing plants than in wild-type and atrzfl mutant plants.
  • P5CR Polyrroline-5- Carboxylate Reductase
  • RAB18 Responsive to Dessication 29A (RD29A), RD29B, A0Xla (Alternative Oxidase la), C0R15A (Co ld-Regulated 15A), ERD15 (Early Responsive to Dehydration 15) and ERDl Genes Expression is induced by stress (Savour6 et al., 1997; Strizhov et al., 1997; Tran et al., 2006; Vanlerberghe et al., 2009; Lim et al. 2010). Specifically, expression of P5CR, RAB18 and ERD15 is expressed by salinity and drought stress.
  • AtRZFl overexpressing 0X1-1 and 0X4-2 plants over drought conditions at wild type and atrzfl mutant plants.
  • the transcription of these nine genes is induced more in atrzfl mutant plants than in wild type plants.
  • AtRZFl negatively acts on drought stress-related genes.
  • the AtRZFl gene encodes a C3H2C3-type RING zinc finger protein and plays an important role in drought reactions. Atrzfl mutants were less sensitive to drought conditions in water deprivation assays, whereas AtRZFl overexpressing plants were more sensitive. These results indicate that AtRZFl negatively regulates drought response during seed germination and early seedling development. As a result, the present invention shows that AtRZFl overexpressing transgenic plants and atrzfl mutant plants show significant differences in water deprivation and ion leakage (FIG. 10A). The leaves of the AtRZFl overexpression line showed a marked increase in water deprivation and increased membrane ion leakage under drought conditions when compared to wild-type and atrzfl mutant leaves (FIG. 10B).
  • AtRZFl is cited as one of the RING finger proteins. Some RING finger proteins act as ubiquitin E3 ligase and play an important role in the process of ubiquitination / protease complexes (Smalle and Vierstra, 2004). The ubiquitin E3 ligase activity of AtRZFl is analyzed using in vitro assays. Measured.
  • AtRZFl protein was found to actually have E3 ligase activity by generating self ubiquitation of MBP-AtRZFl recombinant protein in the presence of E1 and E2 enzymes (FIG. 6).
  • E3 ubiquitin ligases act as negative regulators in stress response.
  • HOSK High Expression of Ossically Responsive Genes 1 regulates the expression of low temperature reactive genes by ubiquitizing I CEK Inducer of CBP Expression l) (Chinnusamy et al., 2007), and DRIP1 (DREB2A-Interacting Protein 1).
  • AtCHIP HSC70-Interacting Protein
  • a novel E3 ligase, KEGCKeep on Going) protein has recently been found to be regulated by AGA (Stone et al., 2006). KEG degrades ABI5 by interacting with ABI5 (ABA Insensitive 5), a positive regulator of ABA signaling. ABA promotes KEG degradation through self-ubiquitation and maintains a balance between KEG and ABI5.
  • some E3 ligase are active as positive regulators of abiotic stress.
  • Such proteins include ⁇ 2a (RING-H2 Finger A2a) (Bu et al., 2009) and AtAIR PKABA Insensitive RING Protein 1 (Ryu et al., 2010), which are involved in many aspects of ABA signaling. Proteins targeted by RHA2a are expected to be negative regulators of ABA signaling oligos.
  • Overexpression of AtAIPRl is a seed And ABA hypersensitivity during stomatal closure, resulting in drought stress tolerance.
  • AtRZFl acts as an E3 ligase
  • AtRZFl itself is known to negatively regulate drought reactions, and we believe that the proteins degraded by ⁇ ⁇ are positive regulators of water deficiency stress, and removing these molecules would have the effect of activating the drought response. Expected.
  • functional studies of AtRZFl such as target proteins of AtRZFl and their interactions, are essential to fully understand the drought response network in plants. references
  • Nan j o T Kobayashi M, Yoshiba Y, Kakubar i Y, Yamaguch ich Shi nozak i K, Shi nozak i K. 1999. FEBS Letters 461: 205-210.
  • P5CS genes control 1 ing proline accumulation during salt-stress requires ABA and is regulated by ABAl, ABI1 and AXR2 in Arabidopsis. 12: 557-569.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

본 발명은 식물체의 가뭄 스트레스 저항성 증진용 조성물, 가뭄 스트레스 저항성을 갖는 형질전환된 식물체 및 상기 형질전환 식물체의 제조방법에 관한 것이다. 본 발명의 가뭄 스트레스 저항성 증진용 조성물 및 형질전환 식물체의 제조방법을 이용하면 가뭄 저항성이 탁월한 신기능 식물체를 제조할 수 있다.

Description

【명세서】
【발명의 명칭】
가뭄 스트레스 저항성 관련 유전자 및 형질전환 식물체 【기술분야】
본 발명은 가뭄 스트레스 저항성 관련 유전자 및 상기 유전자의 발현이 억제된 형질전환 식물체에 관한 것이다.
【배경기술】
진핵세포에서 단백질 유비퀴티네이션은 중요한 번역 후 변형 과정으로 다양한 세포 및 발달 과정을 조절하기 위해 이용된다 (Dye and Schulman, 2007) . 유비퀴틴화된 단백질은 고등 식물에서 무생체 또는 생체적 스트레스 반웅， 호르몬 반웅， 세포주기 진행 및 세포 분화에 관여한다 (Craig et al . , 2009; Santner and Estelle, 2009； Marrocco et al., 2010； Ryu et al · , 2010). 유비퀴틴 (Ubiquitin, Ub)은 8 kDa의 보존적 단백질로 ATP—의존적 방식으로 Ub-활성화 효소 El Jb— activating enzyme El)에 의해 처음 활성화되고， Ub-E2 복합체가 Ub-단백질 리가아제 E3에 결합하면 Ub는 Ub_E2로부터 기질 단백질로 이동하고， 26S 프로테아좀에 의해 인식되고 분해된다 (Vierstra, 2003) . 단백질 분해를 유도하는 것 이외에 DNA 리페어 및 단백질 운송과 같은 분해 (degradation)와 무관한 단백질 유비퀴티네이션의 기능 또한 알려져 있다 (Chen et al., 2009). 애기장대 (Arabidopsis) 유전체에서 1,400개 이상의 유전자가 Ub-E3 리가아제를 코딩하는 것으로 예측된다 (Vierstra, 2009). E3 리가아제는 2 그룹으로 분류된다. 한 그룹은 싱글 서브유닛으로서 작용하는 RING(Really Interesting New Gene)/U-B0X 및 HECT Homo logy to E6-AP Car boxy 1 Terminus) E3 효소로 구성된다. 다른 그룹은 SCF(SkPl_Cul Πη-F box) 및 멀티-서브유닛 복합체로서 기능하는 APC(Anaphase-Promoting Complex)을 포함한다 (Gmachl et al . , 2000； Tyers and Jorgensen, 2000; Lin et al . , 2002). 약 469개의 RING 모티프를 포함하는 E3 리가아제는 애기장대에서 3번째로 큰 유전자 패밀리를 구성한다 (Mudgil et al., 2004； Stone et al . , 2005) . Cys-리치 RING 핑거는 1990년대 초기에 처음으로 알려졌으며 (Freemont et al. , 1991), 크로스 브레이스 배치에서 두 아연 원자를 묶는 보존된 Cys 및 His 잔기의 선형 시리즈 (linear series)로 정의된다. RING 핑거는 모티프의 다섯번째 위치에 Cys 또는 His 잔기가 있느냐에 따라서 C3HC4(RING-HC) 및 C3H2C3(RING-H2)의 두 가지 타입으로 나눌 수 있다 (Freemont, 2000). 최근 애기장대 RING E3 리가아제가 옥신 신호전달, 아브시스산 신호전달， 브라시노스테로이드 반응， 종자 발아， 유모 성장， 질소원 제한에 대한 대안적 대사과정 및 당 반응과 같은 다양한 세포내 과정에 관여한다는 것이 알려졌다 (Stone et al .， 2006； Peng et al. 2007； Bu et al. , 2009； Santner and Estelle, 2009； Huang et al .， 2010). 부분적으로 RING 단백질은 환경적 자극에 대한 반웅에 있 ^서 중요한 역할을 한다. 예를 들면， RING 단백질은 광형태형성 (photomorphogenesis), 방어 신호전달， 노화， 추위에 대한 내성 메커니즘， 가뭄， 염분 및 삼투압 스트레스에 관여한다 (Yan et al .， 2003； Craig et al. , 2009； Fujita et al., 2011； Smirnova et al. , 2011). 본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
【발명의 내용】
【해결하려는 과제】
본 발명자들은 식물체의 가뭄 스트레스에 대한 저항성을 향상시킬 수 있는 유전자를 발굴하고자 예의 연구 노력하였다. 그 결과， 서열목록 제 2서열의 아미노산 서열로 이루어진 단백질의 활성 또는 서열목록 ¬¬제2서열의 아미노산 서열을 코딩하는 서열목록 제 1서열의 뉴클레오타이드 서열의 발현이 식물체의 형질에 관여한다는 사실을 도출하였고， 서열목록 제 2서열의 아미노산 서열로 이루어진 단백질의 활성을 억제시키거나 서열목록 제 1서열의 뉴클레오타이드 서열의 발현을 억제시키는 경우 가뭄 스트레스홰 대한ᅳ저함섬―아 향상된 형질을 갖는 형잘전환- 식물체를 수득할 수 있음을 규명함으로써， 본 발명을 완성하게 되었다. 따라서 본 발명의 목적은 식물체의 가뭄 스트레스 저항성 증진용 조성물을 제공하는 데 있다.
본 발명의 다른 목적은 가뭄 스트레스 저항성을 갖는 형질전환 식물세포 및 형질전환 식물체를 제공하는 데 있다.
본 발명의 또 다른 목적은 가뭄 스트레스 저항성이 증진된 형질전환 식물체를 제조하는 방법을 제공하는 데 있다.
본 발명의 또 다른 목적은 식물체에 가뭄 스트레스 저항성을 부여하는 방법을 제공하는 데 있다. 본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명 및 청구범위에 의해 보다 명확하게 된다.
【과제의 해결 수단】 , 본 발명의 일 양태에 따르면 , 본 발명은 서열목록 게 2서열의 아미노산 서열로 이루어진 단백질의: 억제제 또는 서열목록 제 2서열의 아미노산 서열을 코딩하는 서열목록 제 1서열의 뉴클레오타이드 서열의 발현 억제제를 포함하는 식물체의 가뭄 스트레스 저항성 증진용 조성물을 제공한다. 본 발명자들은 식물체의 가뭄 스트레스에 대한 저항성을 향상시킬 수 있는 유전자를 발굴하고자 예의 연구 노력하였다. 그 결과， 서열목록 제 2서열의 아미노산 서열로 이루어진 단백질의 활성 또는 서열목록 제 2서열의 아미노산 서열을 코딩하는 서열목록 제 1서열의 뉴클레오타이드 서열의 발현이 식물체의 형질에 관여한다는 사실을 도출하였고， 서열목록 제 2서열의 아미노산 서열로 이루어진 단백질의 활성을 억제시키거나 서열목록 제 1서열의 뉴클레오타이드 서열의 발현을 억제시키는 경우 가뭄 스트레스에 대한 저항성이 향상된 형질을 갖는 형질전환 식물체를 수득할 수 있음을 규명하였다.
본 발명에 따르면 , 본 발명의 서열목록 제 2서열의 아미노산 서열을 코딩하는 뉴클레오타이드 서뎔은 첨부한 서열목록^ —7ᅵ재된 서열목톡 제 1서열의 뉴클레오타이드 서열에 한정되지 않는다는 것은 당업자에게 명확하다.
뉴클레오타이드에서의 변이는 단백질에서 변화를 가져오지 않는 것도 있다. 이러한 핵산은 기능적으로 균등한 코돈 또는 동일한 아미노산을 코딩하는 코돈 (예를 들어， 코돈의 축퇴성에 의해， 아르기닌 또는 세린에 대한 코돈은 여섯 개이다)， 또는 생물학적으로 균등한 아미노산을 코딩하는 코돈을 포함하는 핵산분자를 포함한다.
상술한 생물학적 균등 활성을 갖는 변이를 고려한다면， 본 발명에서 이용되는 핵산 분자는 서열목록에 기재된 서열과 실질적인 동일성 (substantial identity)을 나타내는 서열도 포함하는 것으로 해석된다. 상기의 실질적인 동일성은， 상기한 본 발명의 서열과 임의의 다른 서열을 최대한 대웅되도록 얼라인하고， 당업계에서 통상적으로 이용되는 알고리즘을 이용하여 얼라인된 서열을 분석한 경우에， 최소 60%의 상동성， 보다 바람직하게는 70%의 상동성， 보다 더 바람직하게는 80%의 상동성, 가장 바람직하게는 의 상동성올 나타내는 서열을 의미한다. 서열비교를 위한 얼라인먼트 방법은 당업계에 공지되어 있다. 얼라인먼트에 대한 다양한 방법 및 알고리즘은 Smith and Waterman, Adv. Appl . Math. 2:482(1981)； Needleman and Wunsch, J. Mol . Bio. 48:443(1970); Pearson and Lipman, Methods in Mol. Biol. 24： 307-31(1988)； Higgins and Sharp, Gene 73:237-44(1988)； Higgins and Sharp, CABIOS 5:151-3(1989)； Corpet et al. , Nuc. Acids Res. 16:10881-90(1988); Huang et al. , Comp. Appl. BioSci. 8:155-65(1992) and Pearson et al . , Meth. Mol. Biol. 24:307- 31(1994)에 개시되어 있다. NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al. , J. Mol. Biol. 215 :403-10(1990))은 NBC I (National Center for Biological Information) 등에서 접근 가능하며, 인터넷 상에서 blastp, blasm, blastx, tblastn and tblastx와 같은 서열 분석 프로그램과 연동되어 이용할 수 있다. BLSAT는 http://www.ncbi .nlm.nih.gov/BLAST/에서 접속 가능하다. 이 프로그램을 이용한 서열 상동성 비교 방법은 http://丽. ncbi .nlm.nih.gov/BLAST/blast_help. html에서 확인할 수 있다. 본— 발명에서 사용된 용어 "가뭄 스트레스" 란 식물 성장에 있어서 정상적인 수분 공급이 되지 않는 상태로 식물 성장 및 생존에 피해효과를 나타내는 모든 종류의 비생물적인 (예를 들어, 여러 화학물질을 처리 또는 건조 조건에 노출) 및 생물적인 (여러 감염원에 의한 감염) 스트레스 조건들을 포함하는 매우 일반적인 용어로 사용된다.
본 발명에서 스트레스에 "저항성 " 또는 "내성 " 가진다는 용어는 상기와 같은 스트레스에 대하여 그것의 야생형의 손상에 비하여 검출 가능한 강한 저항성을 가지는 것을 의미하며， 본 발명의 형질전환 식물체란 이러한 저항성 또는 내성을 가지는 식물체， 식물체 일부, 식물 조직 또는 식물세포를 의미한다 .
본 발명에 따르면， 본 발명에서 이용되는 단백질 억제제는 서열목록 제 2서열의 아미노산 서열을 갖는 E3 유비퀴틴 리가아제인 AtRZFl 단백질의 활성을 억제하거나 또는 AtRZFl 단백질이 기질과 결합하는 것을 방해하는 억제제를 의미한다.
본 발명의 바람직한 구현예에 따르면， 본 발명의 서열목톡 제 2서열의 아미노산 서열로 이루어진 단백질의 억제제는 바람직하게는 항체， 펩타이드 앱타머, 어드넥틴 (AdNectin), 어피바디 (af f ibody)， 아비머 (Avitner) , 쿠니쪼 도메인 (Kunitz domain) 또는 화합물이다.
본 발명에서 이용될 수 있는 AtRZFl 단백질에 특이적으로 결합하여 활성을 억제하는 항체는 폴리클로날 또는 모노클로날 항체이며， 바람직하게는 모노클로날 항체이다. AtRZFl 단백질에 대한 항체는 당업계에서 통상적으로 실시되는 방법들， 예를 들어， 융합 방법 (Kohler and Milstein, European Journal of Immunology, 6:511-519(1976))， 재조합 DNA 방법 (미국 특허 제 4, 816, 56호) 또는 파아지 항체 라이브러리 방법 (Clackson et al, Nature, 352:624-628(1991) 및 Marks et al , J. Mol. Biol. , 222： 58 : 1-597(1991))에 의해 제조될 수 있다. 항체 제조에 대한 일반적인 과정은 Harlow, E. and Lane, D.， Using Antibodies-' A Laboratory Manual, Cold Spring Harbor Press, New York, 1999； Zola, H.， Monoclonal Antibodies-' A Manual of Techniques , C C Press , Inc. , Boca Raton, Florida, 1984； 및 Coligan ， CURRENT PROTOCOLS IN IMMUNOLOGY, Wi ley /Greene, NY, 1991에 상세하게 기재되어 있으며， 상기 문헌들은 본 명세서에 참조로서 삽입된다. 예를 들어, 단일클론 항체를 생산하는 하어브-리도마 세포의 제조는 불사멸화 세포주를 항체 -생산 림프구와 융합시켜 이루어지며, 이 과정에 필요한 기술은 당업자에게 잘 알려져 있으며 용이하게 실시할 수 있다 . 폴리클로날 항체는 AtRZFl 단백질 항원을 적합한 동물에게 주사하고， 이 동물로부터 항혈청을 수집한 다음, 공지의 친화성 (affinity) 기술을 이용하여 항혈청으로부터 항체를 분리하여 얻을 수 있다.
본 발명에서 이용될 수 있는 펩타이드 ¾타머는 높은 특이성 및 친화성을 가지고 타겟 항원에 결합할 수 있도록 독특한 컨포메이션으로 폴딩되는 DNA 또는 RNA 을리고뉴클레오타이드이다. 이러한 앱타머는 SELEX( Systemic Evolution of Ligands by Exponential Enrichment) 방법에 의해 얻을 수 있다 (Tuerk and Gold, Science, 249:505—510(1990)).
본 발명의 서열목록 제 2서열의 아미노산 서열로 이루어진 단백질 (AtRZFl 단백질)에 대한 억제제로서의 화합물은 AtRZFl 단백질의 활성을 억제하거나 AtRZFl 단백질에 결합하는 물질을 스크리닝함으로써 수득할 수 있다. 이 경우 AtRZFl 단백질은 분리된 형태의 AtRZFl 단백질 또는 세포 내에 포함되어 있는 AtRZFl 단백질 등 어떠한 형태의 것도 사용할 수 있다.
본 발명에서 AtRZFl 단백질 억제제로서의 화합물을 스크리닝 하는 방법은 다양한 방식으로 실시할 수 있으며, 특히 당업계에 공지된 다양한 결합 분석 (binding assay)에 따라 고속 (high throughput ) 방식으로 실시할 수 있다. 상기 스크리닝 방법에 있어서, 시험물질 또는 AtRZFl 단백질은 검출가능한 표지 (detectable label)로 레이블링될 수 있다. 예를 들어， 상기 검출가능한 표지 (detectable label)는， 화학적 표지 (예컨대， 바이오틴)， 효소 표지 (예컨대, 호스래디쉬 퍼옥시다아제， 알칼린 포스파타아제, 퍼옥시다아제, 루시퍼라아제， -갈락토시다아제 및 - 글루코시다아제)， 방사능 표지 (예컨대， C14, I125, Ρ32 및 S35), 형광 표지 [예컨대， 쿠마린， 플루오레세인, FITC(fluoresein Isothiocyanate) , 로다민 6G(rhodamine 6G)， 로다민 B(rhodamine B) , TAMRA(6-carboxy- tetramethyl-rhodamine) , Cy-3, Cy_5, Texas Red, Alexa Fluor , DAPI(4,6- diamidino-2-phenyl indole), HEX, TET, Dabsyl 및 FAM] , 발광 표지 , 화학발광 (chemi luminescent) 표지， FRET( fluorescence resonance energy transfer) 표지 또는 금속 표지 (예컨대, 금 및 은)어다.
검출가능한 표지가 레이블링된 AtRZFl 단백질 또는 시험물질을 이용하는 경우， At ZFl 단백질과 시험물질 사이의 결합 발생 여부는 표지로부터 나오는 시그널을 검출하여 분석할 수 있다. 예를 들어, 표지로서 알칼린 포스파타아제가 이용되는 경우에는, 브로모클로로인돌일 포스페이트 (BCIP), 니트로 블루 테트라졸리움 (NBT), 나프를 -AS-B1- 포스페이트 (naphtholᅳ AS-Bl-phosphate) 및 ECF(enhanced chemi fluorescence)와 같은 발색반응 기질을 이용하여 시그널을 검출한다. 표지로서 호스 래디쉬 퍼옥시다아제가 이용되는 경우에는 클로로나프를， 아미노에틸카바졸， 디아미노벤지딘， D-루시페린， 루시게닌 (비스 -N- 메틸아크리디늄 니트레이트)， 레소루핀 벤질 에테르， 루미놀， 암플렉스 레드 시약 (10-아세틸 -3,그디하이드록시페녹사진)， HYR ( -pheny 1 ened i am i ne- HC1 and pyrocatechol ) , TMB(tetramethylbenzidine) , ABTS(2,2 '一 Azine— di[3-ethylbenzthiazoline sulfonate]), 페닐렌디아민 (OPD) 및 나프를 /파이로닌와 같은 기질을 이용하여 시그널을 검출한다.
택일적으로， 시험물질의 AtRZFl 단백질로의 결합 여부는 상호작용물 (interactants)의 레이블링 없이 분석할 수도 있다. 예를 들어， 마이크로피지오미터 (microphysiometer)를 이용하여 시험물질이 AtRZFl 단백질에 결합하는지 여부를 분석할 수 있다. 마이크로피지오미터는 LAPS( light— addressable potent i omet ric sensor)를 이용하여 셀이 그의 환경을 산성화하는 속도를 측정하는 분석 도구이다. 산성화 속도의 변화는， 시험물질과 AtRZFl 단백질 사이의 결합에 대한 지시자 (indicator)로 이용될 수 있다 (McConnell et al . , Science 257： 1906-1912(1992)) .
시험물질의 AtRZFl 단백질과의 결합 능력은 실시간 이분자 상호작용 분석 (BIA)를 이용하여 분석할 수 있다 (Sjolander & Urbaniczky, Anal. Chem. 63：2338-2345(1991), and Szabo et al . , Curr. Op in. Struct. Biol. 5:699— 705(1995)). BIA는 실시간으로 특이적 상호작용을 분석하는 기술로서， 상호작용물 (interactants)의 레이블링 없이 실시할 수 있다 (예컨대， BIAcore™). 표면 플라즈몬 공명 (SPR)에서의 변화는 분자들 사이의 실시간 반웅에 대한 지시자 (indicator)로 이용될 수 있다.
또한， 상기 스크리닝 방법은， 투 -하이브리드 분석 또는 쓰리- 하이브리드 분석 방법에 따라 실시할 수 있다 (U.S. Pat . No. 5,283,317； Zervos et al. , Cell 72, 223-232, 1993； Madura et al . , J. Biol. Chem. 268, 12046-12054, 1993； Bartel et al . , BioTechniques 14, 920-924, 1993； Iwabuchi et al. , Oncogene 8， 1693-1696, 1993； 및 W) 94/10300). 이 경우， AtRZFl 단백질을 베이트 (bait) 단백질로 이용할 수 있다. 이 방법에 따르면, AtRZFl 단백질에 결합하는 물질， 특히 단백질을 스크리닝 할 수 있다. 투 -하이브리드 시스템은 분할 가능한 DNA-결합 및 활성화 도메인으로 구성된 전사인자의 모들 특성에 기초한다. 간단하게는， 이 분석 방법은 두 가지 DNA 컨스트럭트를 이용한다. 예컨대, 하나의 컨스트럭트에서, AtRZFl-코딩 폴리뉴클레오타이드를 공지의 전사 인자 (예컨대， GAL-4)의 DNA 결합 도메인 -코딩 폴리뉴클레오타이드에 융합시킨다. 다른 컨스트럭트에서, 분석 대상의 단백질 ( "프레이" 또는 "시료" )을 코딩하는 DNA 서열을 상기 공지의 전사인자의 활성화 도메인을 코딩하는 폴리뉴클레오타이드에 융합시킨다. 만일, 베이트 및 프레이가 인 비보에서 상호작용하여 복합체를 형성하면， 전사인자의 DNA-결합 및 활성화 도메인이 인접하게 되며， 이는 리포터 유전자 (예컨대， Lac^^ 전사를 촉발하게 된다. 리포터 유전자의 발현을 검출할 수 있으며， 이는 분석 대상의 단백질이 AtRZFl 단백질과 결합할 수 있음을 나타내는 것이며， 결론적으로 AtRZFl 단백질 억제제로 이용될 수 있음을 나타내는 것이다. 본 발명에 따르면, 본 발명에서 이용되는 서열목톡 제 2서열의 아미노산 서열을 코딩하는 서열목록 제 1서열의 뉴클레오타이드 서열의 발현 억제제는 바람직하게는 핵산분자 또는 돌연변이 유도제이다.
본 명세서에서 용어 "발현 억제" 는 표적 유전자의 기능 저하를 야기하는 뉴클레오타이드 서열상의 변형을 의미하며， 바람직하게는 이에 의해 표적 유전자 발현이 탐지 불가능해지거나 무의미한 수준으로 존재하게 되는 것을 의미한다.
본 발명의 바람직한 구현예에 따르면， 본 발명의 핵산분자는 siRNA, shRNA, miRNA, 리보자임 (r ibozyme)， PNA( pep tide nucleic acids) 또는 안티센스 올리고뉴클레오타이드이다.
본 명세서에서 용어 "siRNA" 는 특정 mRNA의 절단 (cleavage)을 통하여 RNAKRNA interference) 현상을 유도할 수 있는 짧은 이중사슬 RNA를 의미한다. 타겟 유전자의 mRNA와 상동인 서열을 가지는 센스 RNA 가닥과 이와 상보적인 서열을 가지는 안티센스 RNA 가닥으로 구성된다. siRNA는 타겟 유전자의 발현을 억제할 수 있기 때문에 효율적인 유전자 넉다운 방법으로서 또는， 유전자치료 (gene therapy)의 방법으로 제공된다.
siRNA는 RNA끼리 짝을 이루는 이중사슬 RNA 부분이 완전히 쌍을 이루는 것에 한정되지 않고 미스매치 (대웅하는 염기가 상보적이지 않음)， 벌지 (일방의 사슬에 대웅하는 염기가 없음)등에 의하여 쌍을 이루지 않는 부분이 포함될 수 있다. 전체 길이는 10 내지 100 염기， 바람직하게는 15 내지 80 염기， 가장 바람직하게는 20 내지 70 염기이다. siRNA 말단 구조는 타겟 유전자의 발현을 RNAi 효과에 의하여 억제할 수 있는 것이면 평활 (blunt) 말단 혹은 점착 (cohesive) 말단 모두 가능하다. 점착 말단 구조는 3 말단 돌출한 구조와 5 말단 쪽이 돌출한 구조 모두 가능하다. 돌출하는 염기 수는 한정되지 않는다. 예를 들어， 염기 수로는 1 내지 8 염기 ， 바람직하게는 2 내지 6 염기로 할 수 있다. 또한 siRNA는 타겟 유전자의 발현억제 효과를 유지할 수 있는 범위에서 예를 들어, 한 쪽 말단의 돌출 부분에 저분자 RNA (예를 들어 , tRNA, rRNA, 바이러스 RNA와 같은 천연의 RNA분자 또는 인공의 RNA분자)를 포함할 수 있다. siRNA 말단구조는 양측 모두 절단 구조를 가질 필요는 없고， 이중사슬 RNA의 일방의 말단 부위가 링커 RNA에 의하여 접속된 스템 루프형 구조일 수도 있다. 링커의 길이는 스템 부분의 쌍을 이루는 데 지장이 없는 길이면 특별히 한정되지 않는다.
본 명세서에서 용어 "shRNA" 는 단일 가닥으로 50-70개로 구성된 뉴클레오타이드를 의미하며， in wVo상에서 스템 -루프 (stem-loop) 구조를 이루고 있다. 5- 10개의 뉴클레오타이드의 루프 부위 양쪽으로 상보적으로 19-29개의 뉴클레오타이드의 긴 R A가 염기쌍을 이루어 이중가닥의 스템을 형성한다.
본 명세서에서 용어 "miRNA(microR A)" 는 유전자 발현을 조절하며， 전장 20-50개 뉴클레오타이드 바람직하게는 20-45개 뉴클레오타이드, 보다 바람직하게는 20-40개 뉴클레오타이드, 보다 더욱 더 바람직하게는 20-30개 뉴클레오타이드, 가장 바람직하게는 21-23개의 뉴클레오타이드로 구성된 단일 가닥 RNA분자를 의미한다. miRNA는 세포내에서 발현되지 않는 을리고뉴클레오타이드이며， 짧은 스템—루프 구조를 가진다. miRNA는 1 또는 2이상의 mRNA (messenger RNA)와 전체 또는 부분적으로 상동성을 가지며， 상기 mRNA와 상보적인 결합을 통하여 타겟 유전자 발현을 억제시킨다.
본 명세서에서 용어 "리보자임 (ribozyme)" 은 RNA의 일종으로 특정한 RNA의 염기 서열을 인식하여 자체적으로 이를 절단하는 효소와 같은 기능을 가진 RNA 분자를 의미한다. 리보자임은 타겟 전령 RNA 가닥의 상보적인 염기서열로 특이성을 가지고 결합하는 영역과 타겟 RNA를 절단하는 영역으로 되어 있다.
본 명세서에서 용어 "PNMPeptide nucleic acid)" 는 핵산과 단백질의 성질을 모두 가지고 있는 분자로서， DNA 또는 RNA와 상보적으로 결합이 가능한 분자를 의미한다. PNA는 핵산염기 (nucleobase)가 펩티드 결합으≤ 연결된 유사 DNA로 1999년에 처음 보고되었다 (문헌 [Nielsen PE, Egholm M, Berg RH, Buchardt 0, "Sequence-select ive recognition of DNA by strand displacement with a thymine-subst i tuted polyamide" , Science 1991, Vol. 254： pp 1497- 1500] ) . PNA는 자연계에서는 발견되지 않고 인공적으로 화학적인 방법으로 합성된다. PNA는 상보적인 염기 서열의 천연 핵산과 흔성화 (hybridization) 반응을 일으켜서 이중가닥을 형성한다. 길이가 같은 경우 PNA/DNA 이중가닥은 DNA/DNA 이중가닥보다， PNA/RNA 이중가닥은 DNA/R A 이중가닥보다 안정하다. ¾티드 기본 골격으로는 N-(2- 아미노에틸)글리신이 아미드 결합에 의해 반복적으로 연결된 것이 가장 흔히 쓰이며， 이 경우 펩티드 핵산의 기본골격 (backbone)은 음전하를 띠는 천연 핵산의 기본골격과 달리 전기적으로 중성이다. PNA에 존재하는 4개의 핵산염기는 공간적 크기와 핵산염기 사이의 거리가 천연 핵산의 경우와 거의 같다. PNA는 화학적으로 천연 핵산보다 안정할 뿐 아니라 핵산분해효소 (nuclease)나 단백질분해효소 (protease)에 의해 분해되지 않아 생물학적으로도 안정하다.
본 명세서에서 용어 "안티센스 올리고뉴클레오타이드" 이란 특정 mRNA의 서열에 상보적인 뉴클레오타이드 서열을 함유하고 있는 DNA 또는 RNA 또는 이들의 유도체를 의미하고， mRNA내의 상보적인 서열에 결합하여 mRNA의 단백질로의 번역을 저해하는 특징이 오타이드 본 발명의 안티센스 뉴클레오타이드 서열은 타겟 유전자의 mRNA에 상보적이고 타겟 유전자의 mRNA에 결합할 수 있는 DNA 또는 RNA 서열을 의미하고 타겟 유전자와 mRNA의 번역， 세포질내로의 전위 (trans의 cation), 성숙 (mat ur at ion) 또는 다른 모든 전체적인 생물학적 기능에 대한 필수적인 활성을 저해할 수 있다. 안티센스 올리고뉴클레오타이드의 ¾이는 6 내지 100 염기이고， 바람직하게는 10 내 40 염기이다.
상기 안티센스 을리고뉴클레오타이드는 효능을 증진시키기 위하여 하나 이상의 염기， 당 또는 골격 (backbone)의 위치에서 변형될 수 있다 (De Mesmaeker et al. , Curr Opin Struct Biol. , 5(3)： 343-55, 1995) . 올리고뉴클레오타이드 골격은 포스포로티오에이트, 포스포트리에스테르， 메틸 포스포네이트， 단쇄 알킬， 시클로알킬， 단쇄 헤쩨로아토믹， 헤테로시클릭 당간 결합 등으로 변형될 수 있다. 또한， 안티센스 핵산은 하나 이상의 치환된 당. 모이어티 (sugar moiety)를 포함할 수 있다. 안티센스 올리고뉴클레오타이드는 변형된 염기를 포함할 수 있다. 변형된 염기에는 하이포크잔틴， 6-메틸아데닌, 5-me 피리미딘 (특히 5-메틸시토신), 5-하이드록시메틸시토신 (HMC), 글리코실 HMC, 젠토비오실 HMC, 2- 아미노아데닌， 2-티오우라실, 2-티오티민， 5-브로모우라실， 5- 하이드록시메틸우라실， 8-아자구아닌， 7-데아자구아닌， N6 (6- 아미노핵실)아데닌 , 2,6-디아미노퓨린 등이 있다.
본 발명의 바람직한 구현예에 따르면， 본 발명의 돌연변이 유도제는 서열목록 제 2서열의 아미노산 서열로 이루어진 단백질에 대한 gDNA(genomic DNA)에 삽입되는 식물 형질전환용 백터이며， 보다 바람직하게는 T-DNA이다. 본 명세서에서 용어 "T-DNA" 는 Agrobacterium 종의 Ti (tumor- inducing) 플라스미드의 전달 (transfer) DNA로서 숙주 식물세포의 핵으로 전달되는 DNA 절편을 말한다. T-DNA의 양 끝 가장자리에는 25 bp의 반복서열이 존재하며， 전달은 왼쪽 경계 (left border)에서 전달이 시작되어 오른쪽 경계 (right border)에서 종료된다. 박테리아 T-DNA는 약 20,000 bp 길이로서 이들의 삽입에 의하여 타겟 유전자를 붕괴시킴으로서 삽입 돌연변이 (insert ional mutagenesis)를 일으키는 데에 사용되며， 삽입된 T- DNA 서열은 돌연변이를 일으킬 뿐 아니라 타겟 유전자를 표지하기도 한다. 목적으로 하는 유전자로의 T-DNA의 삽입은 T-DNA 콜렉션 (The SAIL col lection)으로부터 특정 T-DNA를 선정하여 이용함으로써 유도할 수 있다. 각각의 T-DNA 콜렉션에 태한 염색체 삽입 위치가 알려져 있으므로 특정 유전자로의 T-DNA 삽입이 가능하다 (Alonso et al. , Science, vol. 301， no. 5633, p. 653-657(2003)).
본 발명에 따르면 본 발명자들은 Ti 플라스미드의 형질도입을 통하여 AtRZFl 유전자의 발현억제 돌연변이체를 제작하였으며， T-DNA 보더 프라이머 (boder primer)와 T-DNA가 삽입된 부위의 앞， 뒤 부분의 프라이머를 이용하여 지노타이핑 PCR을 진행한 결과 T-DNA가 첫 번째 엑손에 삽입된 것을 확인하였으며， 발현억제 돌연변이체의 RNA를 추출하여 RT-PCR의 방법으로 유전자의 발현이 억제되었음을 확인하였다 (도 7a). 본 발명의 다른 양태에 따르면， 본 발명은 E3 유비퀴틴 리가아제 atrzfl 유전자가 불활성화 (inactivated)된 가뭄 스트레스 저항성을 갖는 형질전환된 식물세포를 제공한다.
본 발명의 또 다른 양태에 따르면， 본 발명은 E3 유비퀴틴 리가아제 atrzfl 유전자가 불활성화 (inactivated)된 가뭄 스트레스 저항성을 갖는 형질전환된 식물체를 제공한다.
본 발명에 따르면， 본 발명에서 E3 유비퀴틴 리가아제 atrzfl 유전자가 불활성화 (inactivation)는 atrzfl 유전자의 돌연변이를 유도함으로써 실시할 수 있다. 바람직하게는 서열목록 제 2서열의 아미노산 서열로 이루어진 단백질에 대한 gDNA(genomic DNA)에 T-DNA를 삽입 (insertion) 하여 실시한다.
본 발명의 형질전환 식물세포 및 형질전환 식물체를 제조하기 위하여 당업계에 일반적으로 공지된 방^ (Metiods of Enzymology, Vol. 153, (1987))에 따라 실시될 수 있다. 외래성 폴리뉴클레오티드를 플라스미드나 바이러스 등과 같은 백터 등의 운반체에 삽입하여 식물을 형질전환 시킬 수 있고， 아그로박테리움 박테리아를 매개체로 사용할 수 있으며 (Chilton et ai. Cell 11:263:271(1977))， 직접 외래성 폴리뉴클레오티드를 식물 세포내로 도입시켜 식물을 형질전환시킬 수 있다 (Lorz et ai . Mo I. Genet. 199 :178-182 ;(1985)). 예를 들어， T-DNA 부위를 포함하지 않는 백터를 이용하는 경우에는 전기천공법 (electroporation), 입자충격법 (microparticle bombardment ) , 폴리에틸렌 글리콜 침전법 (polyethylene glycol-mediated uptake)을 이용할 수 있다.
일반적으로 식물을 형질전환시킴에 있어 많이 사용되는 것이 외래성 폴리뉴클레오티드로 형질전환된 아그로박테리움 투메페이시언스 g ^aci r/iffl? tumefaciens)로— 식물 세포나 종자 등을 감염시키는 방법이다 (참조: 미합중국 특허 제 5,004,863, 5,349,124 및 5,416,011 호). 당업자는 공지된 적절한 조건하에서 형질전환된 식물 세포나 종자를 배양 또는 재배하여 식물로 발육시킬 수 있다.
본 명세서에서， 용어 "식물 (체) " 는 성숙한 식물뿐만 아니라 성숙한 식물로 발육할 있는 식물 세포， 식물 조직 및 식물의 종자 등을 모두 포함하는 의미로서 사용된다.
본 발명의 방법이 적용될 수 있는 식물체는 특별하게 제한되지 않는다. 본 발명의 방법이 적용될 수 있는 식물로는 상치, 배추, 감자 및 무를 포함하는 대부분의 쌍자엽 식물 (dicotyledonous plant) 또는 벼， 보리 바나나 등의 단자엽 식물 (monocotyledonous pi ant)을 모두 이용될 수 있으며， 특히 토마토와 같이 과피가 얇아 노화에 따른 품질 저하가 급격히 나타나는 식용 채소 또는 과일 그리고 잎이 주된 상품으로 거래되는 식물 등에 적용할 경우 저장 효율을 높이는 데 효과적이다. 바람직하게는， 본 발명의 방법은 벼， 밀, 보리， 옥수수， 콩, 감자， 밀， 팔， 귀리 및 수수를 포함하는 식량 작물류; 애기장대， 배추， 무， 고추， 딸기， 토마토， 수박， 오이, 양배추， 참외, 호박， 파， 양파 및 당근을 포함하는 채소 작물류; 인삼， 담배， 목화， 참깨， 사탕수수， 사탕무우, 들깨， 땅콩 및 유채를 포함하는 특용작물류; 사과나무, 배나무， 대추나무， 복숭아, 양다래， 포도， 감귤, 감， 자두， 살구 및 바나나를 포함하는 과수류; 장미， 글라디올러스， 거베라， 카네이션， 국화， 백합 및 률립을 포함하는 화훼류; 및 라이그라스， 레드클로버， 오차드그라스， 알파알파， 를페스큐 및 페레니얼라이그라스를 포함하는 사료작물류로 구성된 군으로부터 선택되는 식물체에 적용된다. 본 발명의 또 다른 양태에 따르면ᅳ 본 발명은 다음의 단계를 포함하는 가뭄 스트레스 저항성이 증진된 형질전환 식물체를 제조하는 방법을 제공한다:
(a) 식물 세포의 E3 유비퀴틴 리가아제 atrzfl 유전자를 불활성화 (inactivation) 시키는 단계; 및
(b) 상기 식물세포로부터 가뭄 스트레스 저항성이 증진된 형질전환 식물체를 수득하는 단계.
본 발명의 바람직한 구현예에 따르면, 식물 세포에서 E3 유비퀴틴 리가아제 atrzfl 유전자의 불활성화는 식물의 gDNA에 있는 E3 유비퀴틴 리가아제 atrzfl 유전자 (서열목록 제 3서열)에 T-DNA를 삽입 ( insert ion) 하여 실시한다.
T-DNA는 식물 형질전환용 재조합 백터에 포함된 형태로 식물세포에 도입된다.
본 발명의 바람직한 구현예에 따르면， 본 발명의 식물 형질전환용 재조합백터는 아그로박테리움 (4§rowc^/ ½7) 바이너리 백터이다.
본 명세서에서 용어 "바이너리 백터" 는 TKtumor inducible) 플라스미드에서 이동에 필요한 부분인 LB eft border)와 RB right border)를 가지는 플라스미드와 타겟 뉴클레오타이드를 옮기는데 필요한 유전자를 가진 플라스미드를 두 개로 나누어 놓은 백터를 말한다. 본 발명의 형질전환용 아그로박테리움은 본 발명의 상기 뉴클레오타이드 서열의 발현에 적합한 것이면 어느 것이라도 좋고, 특히 본 발명에서 식물 형질전환용 아그로박테리움 균주로는 통상 아그로박테리움 투메파시엔스 ( ro0ac er/uffl tmefaciens) GV31()1이 바람직하다.
본 발명의 재조합 백터를 아그로박테리움에 도입하는 방법은 당업자에게 공지된 다양한 방법을 통해 실시될 수 있으며， 예를 들면 입자 중격법 (particle bombardment ) , 전기천공법 (electroporat ion)， 형질감염법 (transfection), 리튬아세테이트법 (lithium acetate method) 및 열충격법 (heat shock) 등이 있다. 바람직하게는 전기천공법을 사용한다. 형질전환된 식물세포의 선별은 형질전환 배양물을 선택제 (예: 대사 억제제， 항생제 및 제초제)에 노출시켜 실시될 수 있다. 형질전환되고 선택제 내성을 부여하는 표지 유전자를 안정되게 포함하고 있는 식물세포는 상기한 배양물에서 성장하고 분할한다. 예시적인 표지는， 하이그로마이신 포스포트랜스퍼라아제 유전자， 글리코포스페이트 내성 유전자 및 네오마이신 포스포트랜스퍼라아제 (npt II) 시스템을 포함하나， 이에 한정되는 것은 아니다. 식물 원형질 또는 다양한 익스플랜드로부터 식물체의 발달 -또는 재분화시키는 방법은 당업계쩨 잘 알려져 었다. 아그로박테리움에 의해 도입된 외래 유전자를 포함하는 식물체의 발달 또는 재분화는 당업계에 공지된 방법에 따라 달성될 수 있다 (참조: 미합중국 특허 제 5,004,863, 5,349,124 및 5,416,011 호). 본 발명의 다른 양태에 따르면， 본 발명은 다음의 단계를 포함하는 식물체에 가뭄 스트레스 저항성을 부여하는 방법을 제공한다:
(a) 식물 세포의 E3 유비퀴틴 리가아제 atrzfl 유전자를 불활성화 (inactivation) 시키는 단계; 및
(b) 상기 식물세포로부터 가뭄 스트레스 저항성이 증진된 형질전환 식물체를 수득하는 단계.
【발명의 효과】
본 발명의 특징 및 이점을 요약하면 다음과 같다:
(a) 본 발명은 식물체의 가뭄 스트레스 저항성 증진용 조성물， 가뭄 스트레스 저항성을 갖는 형질전환된 식물체 및 상기 형질전환 식물체의 제조방법을 제공한다.
(b) 본 발명의 가뭄 스트레스 저항성 증진용 조성물 및 형질전환 식물체의 제조방법을 이용하여 가뭄 저항성이 탁월한 신기능 식물체를 제조할 수 있다. 【도면의 간단한 설명】
도 1은 AtRZFl 단백질의 구조적 특징을 나타낸 그림이다. (a) AtRZFl 단백질 보존된 부분의 구조를 나타내는 모식도임. 신호 펩타이드의 예측은 소프트웨어 프로그램 간에 일치하지 않았음. RING-H2 징크 핑거 모티프 부위의 일차 구조는 검은 상자로 표시하였음. (b) C3H2C3-타입 RING 모티프 얼라인먼트를 통해 다른 식물 종으로부터 AtRZFl^ 아미노산 서열 및 다른 AtRZFl 호몰로그를 유추함. AtRZFl(At3g56580), AtRHCla(At2g40830) , AtRHC2a(At2g39720), AtSIS3(At3g47990) , Oryza saltiva RHCla(0sRZFl; NP_001044543) 및 Zea mays RHCla(ZmRHCla; NP_001149547)의 서열을 나타냈으며， 검정색 및 회색 음영은 각각 일치 및 유사한 아미노산을 나타ᅵ냄
도 2는 예측된 AtRZFl의 아미노산 서열 및 그와 비교하여 연관된 서열들을 나타낸 것이다. AtRZFl(At3g56580), OsRHCla(NP_001044543) 및 ZinRHCla( P_001149547)의 서열을 나타냈으며， 검정색 및 회색 음영은 각각 일치 및 유사한 아미노산을 나타냄. 갭 (gap)은 얼라인먼트를 최적화하기 위해 삽입되었음. RING H2—타입 징크 핑거 도메인 (186-226)은 얼라인먼트 상에서 검정색 선으로 표시하였음.
도 3은 AtRZFl-EGFP 융합 단백질의 세포 내 분포를 나타낸 그림이다. 35S-EGFP 및 25S-AtRZFl-EGFP 컨스트럭트는 PEG 매개 방법을 이용하여 애기장대 잎 원형질체로 형질전환 시켰음. 융합단백질의 분포는 형광현미경을 이용하여 가시화되었음. 스케일 바는 10 μπι를 나타냄.
도 4는 형질전환 애기장대 식물에서 AtRZFl 프로모터ᅳ GUS 발현 패턴을 확인한 결과이다. (a) 7일령 유묘 식물의 GUS 염색 결과임. (b) 3주령 형질전환 식물의 완전히 확장된 로제트 잎에서 GUS 발현을 확인한 결과임. (c) 4주령 형질전환 식물의 꽃에 대한 GUS 염색 결과임. (d) 수술에서의 GUS 발현을 확인한 결과임. (d) GUS 활성은 화분 (pollen)에서 강하게 검출됨 .
도 5는 물 부족 스트레스 하에 애기장대의 AtRZFl 유전자의 발현을 나타낸 그림이다. 만니를 (a) 또는 가뭄 (b) 반웅에 대한 AtRZFl엑 발현을 정량적 RT-PCR로 분석한 결과를 나타냄 . 총 RNA 샘플은 가뭄조건 또는 400 mM 만니틀을 처리한 14일령 식물을 각 시간대 별로 수득하몄음. 에러 바는 3개의 독립적인 샘플에 대한 표준 편차를 나타냄. 다양한 비생물학적 스트레스의 유무에 따른 14일령 애기장대 유묘에서의 AtRZFl 또는' RAB18의 발현 차이는 P < 0.01(**)로 유의성을 나타냄. RAB18 유전자는 가뭄 또는 만니를 스트레스에 대한대조군으로서 사용되었음. "
도 6은 인 비트로에서 AtRZFl E3 유비퀴틴 리가아제 활성을 측정한 결과이다. 정제된 MBP-AtRZFl을 El, E2, 유비퀴틴 및 ATP와 함께 37°C에서 1시간 배양함. 폴리 유비퀴틴 체인은 항ᅳ유비퀴틴 (a) 및 항 -MBP(b) 항체를 이용하여 가시화하였음. E1 또는 E2의 생략은 유비퀴티네이션의 손실을 야기함. MBP는 음성 대조군으로서 이용되었음. 왼쪽 숫자는 단백질 마커의 분자량 (kDa)을 나타냄 .
도 7은 삼투깝 스트테스 저항성에 대한 atrzfl 틀연변이 라인의 영향을 나타낸 결과이다. (a) 야생형 (訂)， atrzfl 돌연변이 및 AtRZFl을 발현하는 두개의 비의존적 형질전환 식물 (0X1-1 및 0X4-2)에서 AtRZFl 발현 레벨은 2주령 유묘로부터 추출한 총 RNA를 이용하여 RT-PCR 방법으로 측정함. RT-PCR 데이터는 액틴 8 유전자의 mRNA 수준에 맞추어 표준화하였음. (b) 삼투압 스트레스는 식물 떡잎의 녹화 (greening)에 영향을 미침. 씨앗은 400 mM 만니를을 추가적으로 포함하거나 포함하는 않는 MS 아가 플레이트에 뿌리고， 8일간 성장시킨 후， 녹색 떡잎을 갖는 유묘의 수를 측정하였음 (3배수 측정， n=50). 에러 바는 표준편차를 나타냄. 같은 조건에서 성장한 야생형, atrzfl 돌연변이 및 AtRZFl 형질전환 식물간의 차이는 P < 0.01O*)로 유의성을 나타냄.
도 8은 atrzfl 돌연변이 식물의 삼투압 스트레스 저항성을 확인한 결과이다. 씨앗은 400 mM 만니를을 추가적으로 포함 또는 포함하지 않는 MS 아가 플레이트에 뿌리고 8일간 성장시킴. atrzfl 돌연변이 식물은 삼투압 스트레스 조건하에서 야생형 및 AtRZFl 과발현 (0X1-1 및 0X4-2) 식물에 비해 더욱 진한 녹색을 나타냄. 스케일 바: 10 mm.
도 9는 atrzfl 돌연변이 식물의 가뭄 스트레스 저항성을 확인한 결과이다. atrzfl 돌연변이 식물은 가뭄 스트레스 조건하에서 야생형 및 AtRZFl 과발현 (0X1-1 및 0X4-2) 식물에 비해 더욱 진한 녹색을 나타냈으며 , 보다 잘 생장하였음. (a) 2주령 식물을 10일간 급수하지 않음. (b) 재급수 3일 후 생존율을 측정함.
도 10은 야생형， atrzfl 및 AtRZFl 과발현 식물에서 물 부족 및 전해질 누출을 측정한 결과이다. (a) 2주령 야생형， atrzfl 및 2개의 비의존적 AtRZFl 과발현 식물에서 물 부족을 정량화한 것임. 동일한 발달 단계의 로제트 잎을 채취하고， 채취한 후 다양한 시점에 무게를 측정함. 물 손실은 초기 무게에 대한 백분율로 계산함. 데이터는 5개의 잎을 각각 7회씩 측정하여 평균값 및 표준편차로 나타냄ᅳ 별표는 야생형과 비교하여 통계학적으로 유의한 차이를 나타냄 [0.05 > P > 0.01O) 또는 P < 0.01(**)]. (b) 가뭄 스트레스 하에서 야생형, atrzfl 및 두개의 비의존적인 AtRZFl 과발현 형질전환 식물 잎에서의 전해질 누출 측정 결과를 나타냄. 2주령 식물을 정상 또는 가뭄 조건에서 10일간 성장시키고 ¾ 조직을 조심스럽게 채취한 후， 전해질 누출을 측정하몄음. 데이터는 7개의 잎을 각각 7회씩 측정하여 평균값 및 표준편차로 나타냄. 동일 조건에서 성장한 야생형, 돌연변이 및 형질전환 식물간의 차이는 0.05 > P > 0.01 ) 또는 P < 0.01 *)로 유의적인 수준이었음.
도 11은 스트레스 관련 유전자 (P5CS1, P5CR, RAB18, RD29A, RD29B, AOXla, C0R15A, ERD15 및 ERD1)의 발현 정도를 측정한 결과이다. 2주령 야생형 atrzfl 및 두개의 비의존적인 AtRZFl 과발현 형질전환 식물을 정상 또는 가뭄 조건에서 10일간 성장시킴. 총 RNA는 식물로부터 수득하였고, 표 1에 기재된 유전자 특이적 프라이머를 이용하여 dPCR을 수행하였음. 각 바 (bar)는 가뭄스트레스에 대한 반웅으로서 대조군과 비교하여 발현 유도가 증가된 P5CS1, P5CR, RAB18, RD29A, RD29B, AOXla, C0R15A, ERD15 및 ERD1 유전자의 상대적 발현정도를 나타냄. 데이터 값은 3회 반복 실험을 통해 수득하였으며， 액틴 8 유전자의 mRNA 수준에 맞추어 표준화하였음. 가뭄 스트레스 유무에 따른 애기장대 유묘에서의 P5CS1, P5CR, RAB18, RD29A, RD29B, AOXla, C0R15A, ERD15 및 ERD1 발현 차이는 0.05 > P > 0.01(*) 또는 P < 0.01(**)로 유의적인 차이를 나타냄.
도 12는 야생형, atrzfl 돌연변이 및 AtRZFl 과발현 식물의 잎에서 프를린 함량을 측정한 결과이다. 2주령 식물을 정상 또는 가뭄 조건 하에서 10일간 성장시키고， 잎 조직을 조심스럽게 채취한 후， 프를린 함량올 측정함. 에러 바는 표준편차를 나타냄. 동일 조건하에서 성장한 야생형， 돌연변이 및 형질전환 식물 간의 차이는 P < 0.01(**)로 유의적인 차이를 나타냄ᅳ
【발명을 실시하기 위한 구체적인 내용】
이하， 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로， 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다. 실시예
재료 및 방법
AtRZFl과발현 식물체 (0X1 1 및 0X4-2) 제작 2 주령 애기장대 잎으로부터 Trizol 시약 (Invitrogen, Carlsbad, CA, USA)을 이용하여 총 RNA 를 추출한 다음， 전장 AtRZFl c k t3g565 를 얻기 위해 RT-PCR 을 수행하였다. 유전자 증폭올 위하여， 정방향 5'- TCTAGMTGTCAAGTATTCGGAATAC-3 ' U¾al 부위는 밑줄) 프라이머와 역방향 5'- GTCGACATAGTCAAAAGGCCATCCAC-31 ( Sail 부위는 밑줄) 프라이머를 가지고， 94°C에서 30 초, 55°C에서 30 초， 72°C에서 1 분으로 해서 총 35 사이클을 반복하여 PCR 을 수행하였다. 증폭된 PCR 산물을 pGEM T-easy 백터에 클로닝한 후， 염기서열 결정 분석을 통해 AtRZFl 유전자의 염기서멸을 검정하였다. 염기서열이 검정된 을바른 AtRZFl cDNA 분자들은 프라이머에 포함된 제한효소 Xba\ 및 을 처리한 후， 식물발현백터 pBI 121-1 플라스미드 내 Xba\ 및 Sal\ 부분에 클로닝하였다. 식물발현백터에 클로닝된 AtRZFl 유전자들을 Agrobacteri tumefaciens strain GV3101 세균에 도입시킨 후， 형질전환된 Agrobacteriwn 을 가지고 진공 형질전환법 (Bechtold and Pelletier, 1998)을 이용하여 애기장대 식물체에 형질전환 시켰다. 형질전환 시킨 3 세대 후, 서로 다른 우수 순종 (homozygous) 12 개의 식물체들을 확보하였고， 그 중 2 개의 과발현 식물체 (0X1-1 및 0X4-2)들을 가지고 가뭄스트레스와 관련된 표현형을 분석하였다. 서로 다른 2 개의 우수 순종 과발현 식물체 (0X1-1 및 0X4- 2)들은 카나마이신 항생제 저항성 분석 결과, 싱글 로커스임을 확인할 수 있었다. 우수 순종 (homozygous) atrzfl 돌연변이식물체분석
AtRZFl 유전자의 액손 부분에 T-DNA 가 삽입된 SALK_024296(3 ^/7)는 Salk Institute 의 애기장대 T—DNA 삽입 콜렉션으로부터 수득하였다 (Alonso et al., 2003). T-DNA 삽입에 대한 동형접합성 (homozygous) 식물체를 선별하기 위해， 유전자 특이적 프라이머 (정방향: 5' -TCTAGAATGTCAAGTATTCGGAATAC-3' ， 역방향: 5' - GTCGACATAGTCAAAAGGCCATCCAC-3 ' )를 이용하였다. atrzfl 돌연변이체 및 야생종 애기장대 식물체 (에코타입， Col-0)로부터 지노믹 DNA 를 추출한 후， 유전자 특이적 프라이머를 가지고 PCR 분석을 수행하였다. PC 수행 결과， WT 에서는 AtRZFl 유전자에 대한 PCR 증폭 산물을 얻을 수 있는 반면， atrzfl 돌연변이체의 지노믹 DNA 로부터는 AtRZFl 유전자에 대한 PCR 증폭 산물을 얻을 수 없었다. 이후 T-DNA 삽입 여부는 유전자 특이적 정방향 프라이머 및 τ-DNA 좌측 보더 특이적 프라이머 (5' ᅳ GCGTGGACCGOTGCTGCACCT-3' )를 조합하여 확인하였다. T-DNA 는 AtRZFl 유전자의 첫 번째 액손 부위에 삽입됨을 알 수 있었다. 우수 순종 (homozygous) atrzfl 돌연변이 식물체를 확보하기 위해 PCT 조건은 94X에서 30 초, 57°C에서 30 초， 72°C에서 1 분으로 설정하고， 총 35 사이클을 반복하여 PCR을 수행하였다. 또한， atrzfl돌연변이 식물체로부터 AtRZFl유전자의 전사 발현 여부를 알기 위하여 RT-PCR 을 수행하였다. RT- PCR을 수행하기 위하여 발아 후， 10 일 된 atrzfl돌연변이 유식물체로부터 Trizol 시약 (Invitrogen, Carlsbad, CA, USA)을 이용하여 총 RNA 를 추출하였다. cDNA 를 합성하기 위해 총 RNA 농도는 5 을 사용하였고 올리고 -(dT)15 프라이머와 Superscript II 역전사 효소 (Invirogen, Gaithersburg, MD, USA)를 이용하여 cDNA 를 합성하였다. 합성된 cDNA 와 AtRZFl 유전자 특이적 프라이머를 가지고 PCR 를 수행하였다. PCR 은 94°C에서 30초， 55°C에서 30 초, 72°C에서 1 분의 조건으로 총 27 사이클을 반복하여 PCR 을 수행하였다. RT-PC 수행 결과， atrzfl 돌연변이 식물체는 AtRZFl 유전자의 전사 발현이 되지 않음을 알 수 있었다. 이러한 결과는 atrzfl 돌연변이 식물체는 AtRZFl 유전자에 대해 녹ᅳ아웃 식물체임을 말해준다. RT-PCR 수행 조건에 대한 적합 여부의 판단은 애기장대 Actin8 유전자를 대조군으로 사용하였다. 유전자의 프라이머는 정방향 5 '- CCTTGCTGGTCGTGACCTTACTGA— 3' 및 역방향 5' -CTCTCAGCACCGATCGTGATCACT-3 ' 프라이머 세트를 이용하였다. Actin8 유전자 증폭 발현 PCR 수행은 94°C에서 30 초， 55°C에서 30 초， 72°C에서 1 분으로 해서 총 24 사이클을 반복하여 PCR을 수행하였다. 성장조건 및스트레스 유도
식물에 대한 삼투압 스트레스는 2 주령 애기장대 유묘 (seedling)를 400 πιΜ 만니를을 포함하는 용액에 담가 유도하였다. 샘플은 삼투압 스트레스유도후 0， 6, 12 및 24시간에 수득하였다. 가뭄 스트레스를 유도하기 위해 유묘를 3 일 동안 정상 살수하여 성장시킨 다음 2주 후， 식물을 두 그룹으로 분리하였다. 한 그룹은 10 일간 물을 공급하지 않음으로써 가뭄 스트레스를 유도하였고, 대조군은 정상적으로 물을 공급하였다.
회수된 유묘는 즉시 액체질소로 동결시킨 다음 -80°C에 보관하였다. 애기장대 원형질체에서의 AtRZFl-EGFP재조합 단백질 분포
AtRZFl-GFP 컨스트럭트의 일시적 발현을 위해 AtRZFl 의 0RF(open reading frame)를 프라이머 (5' -TCTAGAATGTCAAGTATTCGGAATAC-3 ' 및 5' - CCCTTGCTCACCATATAGTCAMAGGC-3' )를 이용하여 증폭시키고， EGFP 유전자는 5' -GCCTTTTGACTATat ggt gagcaaggg-3 ' 및 5' -GAGCTCAGTTATCTAGATCC-3 ' 프라이머를 이용하여 증폭시켰다. 두 PCR 결과물을 어닐링 시킨 다음 5' - TCTAGAATGTCMGTATTCGGAATAC-3' 및 5' -GAGCTCAGTTATCTAGATCC-3' 프라이머를 이용하여 재증폭시킨 후, pGEM T-이지 백터로 삽입 시키고 DNA 시¾싱을 실시하였다. 상기 제작한 컨스트럭트를 Xbal 및 Notl 제한효소를 이용하여 절단한 다음， PBI221 로 삽입시켜 클로닝하였다. AtRZFl-EGFP 재조합 유전자는 PEGCpolyethylene glycol)를 이용하여 애기장대 원형질체 세포로 형질전환시켰다 (Abel and Theologis, 1994) . AtRZFl-EGFP 및 EGFP의 발현은 형질전환후 12시간에 측정하였다. 형질전환된 원형질체는 슬라이드 글라스에 을려놓은 후， FluoViewlOOO 공초점 현미경 (Olympus, Tokyo, Japan)을 이용하여 관찰하였다. 이미지는 FV10-ASW 1.7A 소프트웨어 (Olympus)를 이용하여 처리함으로써 수득하였다. 정량적 PCR(qPCR)을 이용한가뭄스트레스 관련 유전차들의 발현 분석
정량적 PCR(Quantitative real-time PCR, qPCR)에는 Roter-Gene 6000 정량적 PCR 기계 (Corbett Research, Mortlake, NSW, Australia)를 이용하였고, 유전자 발현 분석은 RG6000 1.7 소프트웨어 프로그램 (Corbett Research)을 이용하여 분석하였다. 총 RNA 는 스트레스를 처리한 혹은 처리하지 않은 2 주 된 식물체들로부터 RNeasy Plant Mini kitCQiagen- Valencia-, £Α USA)에 의해ᅳ추출하였고, —qPCR을 하기 위해 각 샘플의- 총 RNA 농도는 100 ng 을 사용하였으며, SensiMix 원 -스텝 키트 (Quantance, London, UK)를 이용하여 각 유전자들의 정량적 PCR 을 수행하였다. QPCR 수행 절차 조건은 다음과 같다. 첫 번째， 42°C에서 30 분; 두 번째, 95°C에서 10 분; 세 번째 , 95°C에서 15 초; 네 번째， 55°C에서 30 초; 다섯 번째， 72°C에서 30 초의 조건으로 PCR을 수행한 후， 다시 세 번째부터 다섯 번째까지 35회 반복하여 PCR을 수행하였다. 정량적 PCR에 이용된 유전자 특이적 프라이머는 표 1과 같다.
【표 1】
Figure imgf000024_0001
역방향： CTCTCAGCACCGATCGTGATCACT 인 비트로 자가ᅳ유비퀴티네이션 어세이
전장 (full-length) AtRZFl cDNA 는 다음의 프라이머를 이용하여 증폭시켰다: 5' -GMTTCATGTCAAGTATrCGGAATAC-3 ' {EcoRi 부위는 밑줄) 및 5' -GTCGACATAGTCAAAAGGCCATCCAC-3 ' (SaJl 부위는 밑줄). PCR 산물은 EcoRi 및 Sail 을 이용하여 절단하고 pMAL P2x 백터 (New England BioLabs, Beverly MA, USA)로 삽입하였다. 상기 플라스미드는 E.coli BL21 스트레인에 형질전환하여 발현을 유도하였고, 아밀로스 레진 (New England BioLabs)을 이용하여 친화성크로마토그래피를 실시하여 단백질을 정제하였다. 인 비트로 자가-유비퀴티네이션 어세이는 Au )-ubiquitinylation kit(Enzo Life Sciences, Farmingdale, NY, USA)를 이용하여 실시하였다. 면역 블롯팅
반응 샘플은 12% SDS-PAGE 겔을 이용하여 전기영동하여 분리한 다음， 세미-드라이 트랜스퍼 (Bio-Rad, Hercules, CA, USA)를 이용하여 PVDF(polyvinylidene fluoride) 멤브레인으로 이동시켰다. 멤브레인은 BSA/PBS-T 버페 1% BSA( bovine serum albumin)과 0.2% 트원 20 이 포함된 PBS (phosphate-buffered saline) 용액 (137 mM NaCl , 3 mM KC1， 10 mM Na2HP04, 2 mM KH2P04, pH7.4)] 용액을 가지고 상온에서 2 시간 동안 가볍게 흔들면서 멤브레인을 블로킹 시켰다. 블로킹된 멤브레인은 PBS-T 버페 0.2% Tween 20 이 포함된 PBS 용액 (137 mM NaCl， 3 mM KC1 , 10 mM Na2HP04, 2 mM KH2P04, pH7.4)] 용액으로 상온에서 10 분 동안 3 번 반복해서 세척한 후， 1:10,000 으로 희석시킨 1 차 항 -MBP(Maltose Binding Protein) 항체 (New England BioLabs) 또는 1:500 으로 희석시킨 1 차 항 -Ub 항체 (Enzo Life Sciences)가 첨가된 BSA/PBS— T 버퍼 용액에 멤브레인을 넣은 다음, 4°C에서 12 시간 동안 가볍게 흔들면서 배양시켰다. 배양된 멤브레인을 PBS-T 버퍼 용액으로 상온에서 10 분 동안 3 번 반복해서 세척한 후, 1:10,000 으로 희석시킨 2 차 항-마우스 항체-퍼록시다아제 결합 (New England BioLabs) 또는 1:5,000 으로 회석시킨 2 차 항 -토끼 IgG 항체 -H P 결합 (Enzo Life Sciences)이 첨가된 BSA/PBS-T 버퍼 용액에 멤브레인을 넣은 다음， 상온에서 2 시간 동안 가볍게 흔들면서 배양시켰다. 배양된 멤브레인을 PBS-T 버퍼 용액으로 상온에서 10 분 동안 6 번 반복해서 세척한 후， Super signal West Pico ECL Substrate kit (Thermo Scientific)를 이용， 멤브레인을 X-선 필름 위에 노출시켰다. 실험결과
AtRZFl(M3g56580)의 아미노산서열 분석
본 실험에서 아미노산 서열은 전체 애기장대 유전체 시퀀스 분석에서 C3H2C3ᅳ타입 RING— H2 핑거 유전자 패밀리에 속하는 At3g56580 을 분석한 것이다 (Stone et al .， 2005). At3g56580 는 963 bp 이며， 320 개의 아미노산으로 구성된 단백질을 코딩하고 있는 하나의 0RF 를 가지며， 상기 단백질의 분자량은 35.8 kDa 이다. 여러 소프트웨어 프로그램 (http://ihg.gsf .de; http://hannibal .biol .uoa.gr)을 이용하여 At3g56580 단백질의 신호 펩타이드 서열을 예측하였다 (도 la). 도 lb 를 살펴보면， 추정된 아미노산 서열이 RING-H2 징크 핑거 단백질 패밀리와 높은 상동성을 갖는 것으로 나타났다. A thai i ana At3g56580 유전자는 AtRZFl으로 지정된다. AtRZFl 및 쌀과 옥수수로부터 알려지지 않은 단백질 오솔로그 간의 아미노산 서열 얼라인먼트는 도 2 에 나타냈다. AtRZFl 단백질과 벼 혹은 옥수수에서의 오솔로그 단백질 간의 아미노산 서열을 비교한 결과， .36ᅳ 7OT 동일성 및 43-75% 유사성의 호몰로지 값을 얻을 수 있었다,
AtRZFl 은 단일 RING 도메인을 포함하며， 그것의 중심 부위는 다른 식물 RING 단백질 및 애기장대의 해당 부위와 39-95% 동일성을 갖는 부위를 말한다. SIS3(Sugar-insensitive 3)를 제외한 이러한 단백질들의 기능은 알려져 있지 않다. SIS3 는 유비퀴틴 E3 리가아제를 코딩하고 있으며 , 초기 유묘 발달 동안에 당류 신호전달의 양성 조절자로 작용한다 (Huang et al., 2010). 41 개 아미노산 RING 모티프에서 Cys-X2-Cys-xl4-Cys-n-His-X2-His-X2- Cys-xio-Cys-x2-Cys 서열은 잘 보존 (도 lb)되어 있기 때문에, AtRZFl 은 C3H2C3-타입 RJNG-H2 단백질로 분류돤다 (Jensenetal . ,2005) . AtRZFl 단백질의 세포 내 분포
도 1 에서 예측된 도메인에 대한 AtRZFl 아미노산 서열을 조사하기 위해 몇몇 소프트웨어 프로그램을 이용하였다.
Mi toprot2(htt / ihg.gsf.de) 및 PredSLChttp: //hannibal .biol .uoa.gr) 프로그램은 AtRZFl 이 아미노산 1-23 에서 미토콘드리아 신호 펩타이드를 갖는다고 예측하였다. 반면， PrediSi 프로그램(11»1):// .1^6(11 .(16)은 AtRZFl 이 신호 펩타이드를 갖고 있지 않다고 예측하였다. 따라서， AtRZFl 신호 펩타이드를 갖고 있는지 여부는 확실치 않다.
AtRZFl 의 세포 내 분포를 측정하기 위해, GFP 리포터 유전자를 AtRZFl 암호 영역에 삽입하여 애기장대 원형질 세포에서 AtRZFl-EGFP 재조합 단백질 생산할 수 있는 컨스트럭트를 제조하였다. 도 3 에서 보는 바와 같이， AtRZFl-EGFP 컨스트럭트의 형광 시그날은 애기장대 엽육 원형질세포의 세포질에서 검출되었다. 이러한 결과는 AtRZFl 의 세포 내 분포가 세포질 -분포 단백질과 같다는 것을 나타낸다. 애기장대에서 MRZF1의 발현
AtRZFl 의 기능에 대한 정보를 얻기 위해, 1.146-kb AtRZFl 프로모터 -GUS 재조합 컨스트럭트를 포함하는 애기장대 형질전환 식물을 조직화학 GUS 염색하여 AtRZFl 의 초기 발현 패턴을 평가하였다. 형질전환 식물의 전체 유묘, 특히 관다발에서 GUS 활성이 강하게 나타났다 (도 4a-b). 꽃에서는 꽃받침 (도 4c)， 수술 (도 4d) 및 화분 (도 4e)에서 GUS 염색이 관찰되었다. 애기장대에서 전장유전체 발현 분석 결과， AtRZFl 의 발현은 삼투압 스트레스에 의해 감소하였다 (hUp://jsp. weigelworld.org). 인 비보에서 AtRZFl 의 기능을 확인하기 위해, 삼투압 스트레스 조건 하에서 2 주령 애기장대 유묘의 AtRZFl mRNA 축적을 정량적 RT-PCR 을 이용하여 평가하였다. 도 5a 에서 보는 바와 같이， AtRZFl 의 전사 레벨은 만니를 처리 24 시간 후 약 3 배 감소하였다. 가뭄 스트레스 하에서 애기장대 잎에서의 AtRZFl 발현 또한 감소하였다 (도 5b). 삼투압 스트레스 -유도 RAB18( responsive to ABA) (Huang et al . , 2008) 유전자는 물 부족 스트레스에 대한 대조군으로 사용되었다 (도 5a b). 미러한 결과들은 Π 가 가뭄 조건에 의해 조절된다는 것을 강하게 시사한다. AtRZFl의 인 비트로 유비퀴틴 E3 리가아제 활성
RING 도메인 단백질은 유비퀴티네이션에 관여하는 E3 리가아제의 한 종류이다 (Lorick et al .， 1999) . AtRZFl 단백질은 C3¾C3-타입 RING-¾ 단백질의 멤버이며 (도 lb), E3 리가아제 활성에 대해서는 기존에 알려진 바가 없다 (Kim et al., 2012). 이에, 본 발명자들은 유비퀴티네이션 과정에서 E3 리가아제로서의 AtRZFl 기능을 확인해보고자 하였다. 인 비트로 분석법을 이용하여 AtRZFl 에 대한 E3 리가아제 활성을 측정하였다 (도 6). 재조합 MBP-AtRZFl 단백질은 E.coli 에서 생산하였으며， 아밀로스 레진을 이용하여 정제하였다. E1 및 E2 가 존재할 때， 유비퀴티네이션된 MBP-AtRZFl 단백질은 항 -Ub (도 6a) 및 항 -MBP (도 6b) 항체를 이용한 면역블롯팅에 의해 검출되었다. E1 또는 E2 가 없을 경우， MBP-AtRZFl 의 유비퀴티네이션 활성은 관찰되지 않았다. 도 6 에서 보는 바와 같이， 고분자 유비퀴티네이션 밴드는 AtRZFl 에 의해 생산되며， 이러한 결과는 AtRZFl 가 인 비트로에서 Ub E3 리가아제 활성을 갖는다는 것을 나타낸다.
AtRZFl 과발현에 따른 가뭄스트레스 민감성
AtRZFl 의 인 비보 기능을 조사하기 위해, 애기장대에서 35S 프로모터의 조절 에 의한 AtRZFl 과발현을 유도하였다. 12 개 동형 접합성 라인 (T3 generation)을 수득하였고， 표현형 특성 평가를 위해 이식유전자의 높은 발현 레벨을 나타내는 2개 라인 (0X1-1 및 0X4-2)을 선별하였다 (도 7a). AtRZFl 과발현 라인 및 야생형 식물을 비교한 결과, 형태학적 변화 또는 성장 저해는 나타나지 않았다 (도 8). 애기장대에서 AtRZFl 의 기능을 평가하기 위해， At3g5658으 tagged T-DNA 삽입 돌연변이체 (SALK_024296)를 수득하였다. atrzfl돌연변이 식물체는 At3g56580 유전자의 1 번 액손에 T- DNA 를 삽입함으로써 제작하였고, 결과적으로 내재적 (endogenous) AtRZFl 유전자의 발현은 저해된다. At3g56580 유전자 1 번 엑손에 T— DNA 이 삽입되었는지 여부는 PCR 을 이용하여 확인하였다. 동형접합성은 확립되었으며 , AtRZFl엑 발현은 RT-PCR을 통해 확인하였다 (도 7a).
만니를을 포함하는 발아 조건에서 AtRZFl 발현에 대한 효과를 측정하기 위해, 야생형， 돌연변이 AtRZFl 과발현 식물의 씨앗을 400 mM 만니를을 추가적으로 포함하는 MS 배지에서 발아시킨 다음, 건조 스트레스 반응에서 AtRZFl과발현 식물의 생존율을 측정하기에 앞서 8 일간 성장시켰다 (도 8). 400 mM 만니를 조건에서 야생형 식물의 잎의 약 35%가 녹화 (greening)된 것과 비교하였을 때， 0X1-1 및 0X4-2 라인은 1 이하로 녹화가 진행되었다 (도 7b). 반면， atrzfl 돌연변이 라인은 발아 후 8 일 시점에 약 80%가 생존하였다 (도 7b). 상기 결과에서 보는 바와 같이， AtRZFl 과발현 식물은 떡잎 발달 면에서 삼투압 스트레스에 과민성을 나타내며， 돌연변이 및 AtRZFl과발현 식물은 가뭄 스트레스에 따른 반웅으로 상반된 표현형을 갖는다.
다음으로, 본 발명자들은 극심한 가뭄 스트레스에 대한 atrzfl 돌연변이 식물의 반웅을 조사하였다. 가뭄 스트레스에 대한 반웅성을 더욱 증가시키기 ·위해, 야생형, atrzfl 돌연변이 및 AtRZFl 과발현 식물올 정상 성장조건에서 2주간성장시킨 다음 완전히 건조된 땅에서 10 일간 급수를 하지 않았다. 그 다음 재 급수를 실시하여 '상기 식물들의 생존율을 측정하였다. 도 9 에서 보는 바와 같이， 대부분의 야생형 및 AtRZFl과발현 식물은 심각하게 시들고 손상되었으며 (도 9a), 재급수 3 일 후 성장율은 야생형 식물 38·1%(55 개 중 21 개)， 0X1-1 라인 16.3%(55 개 중 9 개) 및 0X4-2 라인 10.9¾(55 개 중 6 개)으로 나타났다 (도 9b). 이러한 결과는 형질전환 식물이 야생형 식물에 비해 물 부족에 더욱 민감하다는 것을 나타낸다. 반면， atrzfl 돌연변이는 심각한 가뭄 조건 후에도 상대적으로 건강한 상태를 보였다 (도 9a). 재급수 3 일 후， atrzfl돌연변이의 생존율을 72.7%(55 개 중 40 개)였다 (도 9b). 이러한 결과는， atrzfl돌연변이 식물이 AtRZFl 과발현 식물과 비교하여 심각한 가뭄 스트레스에 높은 저항성을 갖는다는 것을 의미한다.
AtRZFl 과발현 식물의가뭄 민감성
가뭄 스트레스에 대한 반응을 평가하기 위해, 식물의 CRWUcut rosette water loss rates)을 측정하였다. 잎으로부터 물 손실을 측정하기 위해, 야생형 , atrzfl돌연변이 및 AtRZFl과발현 식물에서 비슷한 사이즈， 나이 및 위치를 갖는 잎을 분리하고 공지된 방법 (Sang et al., 2001)에 따라 잎 무게의 감소를 측정하였다. 잎 분리 후, AtRZFl 과발현 식물의 잎은 야생형 및 atrzfl 돌연변이 식물에 비해 대기 조건 하에서 중량 감소가 더 크다 (도 10a). 물 감소는 잎 분리 후 시간이 경과할수록 더욱 분명하게 나타났다. 또한, 가뭄 스트레스는 세포 사멸의 마지막 단계인 세포 원형질막 붕괴를 수반한다. 이것은 전해질 누출을 통해 편리하게 정량화할 수 있다 (Nanjo et al . , 1999) . atrzfl돌연변이 식물은 야생형 및 AtrZFl 과발현 식물과 비교하여 잎의 낮은 멤브레인 이온 누출을 나타내기 때문에 가뭄으로 유도되는 표현형이 늦게 나타난다 (도 10b). 이러한 결과들은 가뭄의 생리학적 과정이 유도하는 표현형은 야생형 및 atrzfl 돌연변이 식물보다 AtRZFl 과발현 식물에서 보다 일찍 나타난다는 것을 가리킨다. 가뭄스트레스 관련 유전자들의 발현
델타 -P5CSl(Pyrroline-5-Carboxylate Synthasel), 델타-
P5CR(Pyrroline-5- Carboxylate Reductase), RAB18, RD29A(Responsive to Dessication 29A), RD29B, A0Xla(Alternative Oxidase la), C0R15A(Co ld- Regulated 15A), ERD15( Early Responsive to Dehydration 15) 및 ERDl 유전자의 발현은 스트레스에 의해 유도된다 (Savour6 et al . , 1997； Strizhov et al .， 1997； Tran et al .， 2006； Vanlerberghe et al. , 2009； Lim et al. 2010). 상세하게는, P5CR, RAB18 및 ERD15 의 발현은 염분 및 가뭄 스트레스에 의해 발현된다. 도 11 은 가뭄 조건에 의해 야생형 및 atrzfl 돌연변이 식물보다 AtRZFl 과발현 0X1-1 및 0X4-2 식물에서 P5CS1, P5CR, RAB18, RD29A, RD29B, AOXla, C0R15A, ERD15 및 ERD1 을 포함하는 스트레스-유도발현 유전자의 전사체가 감소하는 것을 나타낸다. 가뭄 조건하에서 상기 9 개 유전자의 전사는 야생형 식물보다 atrzfl 돌연변이 식물에서 더욱 많이 유도된다. 이러한 결과를 종합하여 볼 때， 본 발명의 발현 데이터는 AtRZFl 은 가뭄 스트레스 관련 유전자에 있어서 음성적으로 작용한다고 사료돤다. 가뭄스트레스 하에서 atrzfl 돌연변이의고프를린 함량
P5CS1 및 P5CR- 유전자의 전사체는 atrzfl 들연변이 식물에서 증가하기 때문에， 본 발명자들은 야생형 및 형질전환 식물의 본잎 (rosette leaves)에서 프를린 함량을 측정하였다. 야생형， atrzfl 돌연변이 및 AtRZFl 과발현 식물에서 프를린 축적에 대한 차이를 측정하기 위해 가뭄 조건 10 일 후에 잎에서 프롤린 함량을 측정하였다. 스트레스를 받기 이전에는 모든 유묘에서 프를린 함량은 비슷하게 낮은 수준을 나타냈다 (도 12). 가뭄 스트레스 하에서， 프롤린 함량은 야생형， atrzfl 돌연변이 및 AtRZFl 과발현 식물 간에 현저한 차이를 나타냈다. 프롤린 함량에 있어서, atrzfl 돌연변이는 야생형 및 AtRZFl 과발현 식물에 비해 높은 수준을 나타냈다. 가뭄 조건에 의해 증가되는 프를린 함량은 AtRZFl 과발현 식물보다 야생형 식물에서 더 높게 나타났다 (도 12). 이러한 결과는 AtRZFl 가뭄 조건에서 프롤린 생산에 음성적으로 (negatively) 작용한다는 것을 의미한다. 논의
AtRZFl 유전자는 C3H2C3-타입 RING 징크 핑거 단백질을 코딩하며， 가뭄 반웅에서 중요한 역할을 한다. 물 부족 반응 어세이에서 atrzfl 돌연변이는 가뭄 조건에 대해 덜 민감한 반면， AtRZFl 과발현 식물은 더욱 민감하였다. 이러한 결과는 AtRZFl 이 씨앗의 발아 및 초기 유묘 발달 동안에 가뭄 반응을 음성적으로 조절한다는 것을 의미한다. 결과적으로 본 발명은 AtRZFl 과발현 형질전환 식물 및 atrzfl 돌연변이 식물은 물 부족 및 이온 누출에 있어서 현저한 차이를 나타낸다 (도 10a). AtRZFl 과발현 라인의 잎들은 현저한 물 부족 증가를 나타내었고， 야생형 및 atrzfl 돌연변이 잎들과 비교하였을 때 가뭄 조건 하에서 멤브레인 이온 누출도 증가하였다 (도 10b).
P5CS1, P5CR, RAB18, RD29A, RD29B, AOXla, C0R15A, ERD15 및 ERD1 을 포함하는 스트레스 -유도 유전자의 전사 레벨은 가뭄 조건 후, 야생형 및 atrzfl 돌연변이 식물에 비해 AtRZFl 과발현 식물에서 보다 더 감소하였다 (도 lla-c). 이러한 결과는 AtRZFl 이 가뭄 스트레스 반웅에서 음성적으로 작용한다는 것을 증명한다. atrzfl 돌연변이는 야생형 및 AtrZFl 과발현 식물에 비해 현저한 가뭄 저항성을 나타냈다. 식물세포에서 프를린의 축적은 삼투압 스트레스로부터 세포를 보호할 수 었다 (Szabados and Savoure, 2010). 돌연변이 식물에서 프를린의 축적은 야생형 및 AtRZFl 과발현 식물에 비해 더 높은 수준이며 (도 12)， 이는 AtRZFl 이 삼투압 관련 요소들의 조절을 통해 가뭄 민감성 유도에 관여한다는 것을 시사한다. AtRZFl은 RING 핑거 단백질의 하나로 인용된다. 몇몇 RING 핑거 단백질은 유비퀴틴 E3 리가아제로 작용하여 유비퀴티네이션 /단백질분해효소복합체 과정에 있어서 중요한 역할을 수행한다 (Smalle and Vierstra, 2004) , AtRZFl 의 유비퀴틴 E3 리가아제 활성은 인 비트로 분석법을 이용하여 측정하였다. 측정 결과, AtRZFl 단백질은 E1 및 E2 효소가 존재하는 가운데 MBP-AtRZFl 재조합 단백질의 자가 유비퀴티네이션을 발생시킴으로써 실제로 E3 리가아제 활성을 갖는 것으로 나타났다 (도 6). 홍미롭게도， 많은 E3 유비퀴틴 리가아제는 스트레스 반웅에 있어서 음성 조절자로서 작용한다. 예컨대， HOSKHigh Expression of Osmot ical ly Responsive Genes 1)은 I CEK Inducer of CBP Expression l)(Chinnusamy et al . , 2007)을 유비퀴틴화 시킴으로써 저온 반응성 유전자의 발현을 조절하며， DRIP1(DREB2A-Interacting Protein 1)은 DREB2A(Dehydrat ionᅳ Responsive Element Binding protein 2A)의 : 유비퀴티네이션을 타겟으로 하여 결과적으로 이들의 불안정화 및 스트레스 반웅을 하향조절을 유도한다 (Qin et al., 2008). AtCHIP(HSC70-Interact ing Protein)의 카르복실 말단은 PP2A(Protein Phosphatase 2A)의 A 서브유닛을 모노유비퀴티네이션 시키고 그것의 활성을 증가시킨다는 것이 보고되었으나， AtCHIP 과발현 애기장대는 저온 스트레스에서 민감성이 증가되었다 (Yan et al., 2003). 신규한 E3 리가아제인 KEGCKeep on Going) 단백질은 최근 AGA 에 의해 조절된다는 것이 밝혀졌다 (Stone et al . , 2006). KEG 는 ABA 신호전달의 양성 조절자인 ABI5(ABA Insensitive 5)와 상호작용하여 ABI5를 분해시킨다. ABA 는 자가 -유비퀴티네이션을 통해 KEG 분해를 촉진시키며， KEG 및 ABI5 간의 균형을 유지시킨다. 게다가， 몇몇 E3 리가아제는 비생물학적 (abiotic) 스트레스의 양성 조절자로서 활성을 나타낸다. 이러한 단백질들은 腿 2a(RING-H2 Finger A2a)(Bu et al . , 2009) 및 AtAIRPKABA Insensitive RING Protein l)(Ryu et al . , 2010)을 포함하며 , 이들은 ABA 신호전달의 여러 측면에 관여한다. RHA2a 에 의해 표적화된 단백질들은 ABA 신호전달 과점의 음성 조절자라고 예상된탸. AtAIPRl의 과발현은 씨앗꽐아 및 기공 폐쇄 (stomatal closure) 동안에 ABA 과민증을 유발하며, 결과적으로 가뭄 스트레스 내성을 야기한다.
상기 결과들에 기초하여， 본 발명자들은 E3 리가아제로써 작용하는 AtRZFl 가 유비퀴틴-단백질분해효소 복합체를 통해 AtRZFl 기질의 분해를 매개한다는 가설을 도출하였다. AtRZFl 은 그 자체로 가뭄 반웅을 음성적으로 조절하는 것으로 알려져 있으며， 본 발명자들은 ^ ^ 에 의해 분해되는 단백질들이 물 부족 스트레스의 양성 조절자이며， 이러한 분자들을 제거하면 가뭄 반응을 활성화 시키는 효과를 가질 것이라고 예상하였다. 따라서， AtRZFl 의 타겟 단백질 및 그들의 상호작용과 같은 AtRZFl 의 기능 연구는 식물에서 가뭄 반웅 네트워크를 완전히 이해하는데 필수적이다. 참고문헌
1. Abel S, Theologis A. 1994. Plant Journal 5: 421-427.
2. Alonso JMStepanova ANLeisse TJ, Kim CJ, Chen H, Shinn P.et al . 2003. Genome-wide insert ional mutagenesis of ScienceSOl: 653657
3. Bu Q, Li H, Zhao Q, Jiang H, Zhai Q, Zhang J, Wu X, Sun J, Xie Q, Wang D, Li C. 2009. Plant Physiology 150:463-481.
4. Chen ZJ, Sun LJ . 2009. Molecular Cell 33:275-286.
5. Chinnusamy V， Zhu J, Zhu JK. 2007. Trends in Plant Science 12:444- 451.
6. Craig A, Ewan R, Mesmar J, Gudipati V, Sadanandom A. 2009. Journal of Experimental Botany 60:1123-1132.
7. Dye BT, Schulman BA. 2007. Annual Review of Biophysics and Biomolecular Structure 36： 131-150.
8. Freemont PS. 2000. Current Biology 10:R84-R87.
9. Freemont PS, Hanson IM, Trowsdale J. 1991. Cell 64:483-484.
10. Fujita Y, Fuj ita M, Shinozaki K, Yamaguch i -Sh i nozak i K. 2011. Journal of Plant Research 124:509—525.
11. Gmachl M, Gieffers C, Podtelejnikov AV, Mann M, Peters JM. 2000. Proceedings of the National Academy of Sciences, USA 97:8973-8978. 12. Harb A, Krishnan A, Ambavaram MMR, Pereira A. 2010. Plant Physiology 154:1254-1271.
13. Huang D, Wu W, Abrams SR, Cutler AJ. 2008. Journal of Experimental Botany 59:2991-3007.
14. Huang Y, Li CY, Pat ti son DL, Gray 丽, Park S, Gibson SI. 2010. Plant Physiology 152:1889-1900.
15. Jakab G, Ton J, Flors V, Zimmerl i L, Metraux J.P, Mauch-Mani B. 2005. Plant Physiology 139:264—274.
16. Jensen RB, Jensen KL, Jespersen 丽， Skriver K. 1998. FEBS Letters 436:283-287.
17. Kim SJ, Ryu MY, Kim WT. 2012. Biochemical and Biophysical Research Communications 420 :141ᅳ 147.
18. Lim GH, Zhang X， Chung MS, Lee DJ, Woo YM, Cheong HS, Kim CS. 2010. New Phytologist 185： 103-113.
19. Lin HK, Wang L, Hu YC, Altuwaijri S, Chang CS. 2002. The EMB0 Journal 21:4037-4048.
20. Marrocco K, Bergdoll M, Achard P, Criqui MC Genschik P. 2010. Current Opinion in Plant Biology 13: 631-639.
21. Mudgi 1 Y, Shiu SH, Stone SL, Salt JN, Goring DR. 2004. Plant Physiology 134:59—66.
22. Nan j o T, Kobayashi M, Yoshiba Y, Kakubar i Y, Yamaguch iᅳ Shi nozak i K, Shi nozak i K. 1999. FEBS Letters 461:205-210.
23. Peng M, Hannam C, Gu H, Bi YM, Rothstein SJ. 2007. Plant Journal 50:320-337.
24. Qin F, Sakuma Y, Tran LS, Maruyama K, Kidokoro S, Fujita Y, Fujita M, Umezawa T, Sawano Y, Miyazono K. , Tanokura M, Shi nozak i K, Yamaguchi-Shinozaki K. 2008. Pl nt Cell 20:1693-1707.
25. Ryu MY, Cho SK, Kim, WT. 2010. Plant Physiology 154:1983-1997.
26. Santner A, Estelle M. 2009. Nature 459:1071-1078.
27. Savour e A, Hua XJ, Bertauche N, Montagu MV, Verbruggen N. 1997. Molecular and General Genetics 254:104-109. 28. Smalle J, Vierstra RD 2004. Annual Review of Plant Physiology 55:555-590.
29. Smirnova 0G, Stepanenkoa Iᄂ， Shumnyia VK. 2011. Biology Bui let in Reviews 1： 314-324.
30. Stone SL, Hauksdottir H, Troy A, Herschleb J , Kraft E, Cal lis J. 2005. Plant Physiology 137:13-30.
31. Stone SL, Williams LA, Farmer LM, Vierstra RD, Cal lis J. 2006. Plant Cell 18:3415-3428.
32. Str izhov N, Abraham E, Okresz L, Bl ickl ing S, Zi lberstein A, Schel 1 J, Koncz C, Szabados L. 1997. Differential expression of two
P5CS genes control 1 ing proline accumulation during salt-stress requires ABA and is regulated by ABAl, ABI1 and AXR2 in Arabidopsis. 12:557-569.
33. Szabados L, Savour e A. 2010. Trends in Plant Science 15:89-97.
34. Tran LSP, Nakashima , Sakuma Y, Osakabe Y, Qin F, Simpson SD, Maruyama K, Fuj ita Y, Shinozaki K, Yamaguchi-Shinozaki K. 2006. Plant Journal 49： 46-63.
35. Tyers M, Jorgensen P. 2000. Current Opinion in Genetics & Development 10:54-64.
36. Vanlerberghe GC, Cvetkovska M,Wang J . 2009. Physiologia PI ant arum 137:392-406.
37. Vierstra RD. 2003. Trends in Plant Science 8:135-142.
38. Vierstra RD. 2009. Nature Reviews Molecular Cell Biology 10:385- 397.
39. Yan J, Wang J, Li Q, Hwang JR, Patterson C, Zhang H. 2003. API ant Physiology 132:861-869. 이상으로 본 발명의 특정한 부분을 상세히 기술하였는바， 당업계의 통상의 지식올 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현ᅳ예일 ^아며-， 아에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서， 본 발명의 실질적인 범위는 첨부된 청구항과
Figure imgf000036_0001
등가물에 의하여 정의된다고 할 것이다.

Claims

【특허청구범위】
【청구항 1】
(a) 서열목록 제 2서열의 아미노산 서열로 이루어진 단백질의 억제제 또는 (b) 서열목록 제 2서열의 아미노산 서열을 코딩하는 서열목록 제 1서열의 뉴클레오타이드 서열의 발현 억제제를 포함하는 식물체의 가뭄 스트레스 저항성 증진용 조성물.
【청구항 2】
제 1 항에 있어서， 상기 단백질의 억제제는 항체， 펩타이드 앱타머， 어드넥틴 (AdNectin), 어피바디 (af f ibody)， 아비머 (Avimer), 쿠니쪼 도메인 (Kunitz domain) 또는 화합물인 것을 특징으로 하는 조성물.
【청구항 3]
제 1 항에 있어서， 상기 발현 억제제는 핵산 분자 또는 돌연변이 유도제인 것을 특징으로 하는 조성물.
【청구항 4】
제 3 항에 있어서， 상기 발현 억제제로서 돌연변이 유도제는 서열목록 제 2서열의 아미노산 서열로 이루어진 단백질에 대한 gDN genomic DNA)에 삽입되는 식물 형질전환용 백터인 것을 포함하는 조성물.
【청구항 5】
E3 유비퀴틴 리가아제 atrzfl 유전자가 불활성화 (inactivated)된 가뭄 스트레스 저항성을 갖는 형질전환된 식물세포.
【청구항 6]
E3 유비퀴틴 리가아제 atrzfl 유전가가 불활성화 (inactivated)된 가뭄 스트레스 저항성을 갖는 형질전환된 식물체.
【청구항 7】
제 6 항에 있어서， 상기 식물체는 식량 작물류， 채소 작물류， 특용 작물류， 화훼류 및 사료 작물류로 구성된 군으로부터 선택되는 것을 특징으로 하는 식물체 .
【청구항 8】
다음의 단계를 포함하는 가뭄 스트레스 저항성이 증진된 형질전환 식물체를 제조하는 방법 :
(a) 식물 세포의 E3 유비퀴틴 리가아제 atrzfl 유전자를 불활성화 (inactivation) 시키는 단계; 및
(b) 상기 식물세포로부터 가뭄 스트레스 저항성이 증진된 형질전환 식물체를 수득하는 단계.
【청구항 9】
제 8 항에 있어서, 상기 단계 (a)는 서열목록 제 3서열의 뉴클레오타이드 서열로 이루어진 E3 유비퀴틴 리가아제 atrzfl유전자에 T- DNA 삽입 (insertion) 하여 실시되는 것을 특징으로 하는 방법.
【청구항 10】
다음의 단계를 포함하는 식물체에 가뭄 스트레스 저항성을 부여하는 방법：
(a) 식물 세포의 E3 유비퀴틴 리가아제 atrzfl 유전자를 불활성화 (inactivation) 시키는 단계; 및
(b) 상기 식물세포로부터 가뭄 스트레스 저항성이 증진된 형질전환 식물체를 수득하는 단계. 【청구항 11】
제 10 항에 있어서， 상기 단계 (a)는 서열목톡 제 3서열의 뉴클레오타이드 서열로 이루어진 E3 유비퀴틴 리가아제 atrzfl유전자에 T- DNA삽입 (insertion) 하여 실시되는 것을 특징으로 하는 방법.
PCT/KR2012/008987 2012-07-17 2012-10-30 가뭄 스트레스 저항성 관련 유전자 및 형질전환 식물체 Ceased WO2014014162A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020120077892A KR101361149B1 (ko) 2012-07-17 2012-07-17 가뭄 스트레스 저항성 관련 유전자 및 형질전환 식물체
KR10-2012-0077892 2012-07-17

Publications (1)

Publication Number Publication Date
WO2014014162A1 true WO2014014162A1 (ko) 2014-01-23

Family

ID=49947723

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2012/008987 Ceased WO2014014162A1 (ko) 2012-07-17 2012-10-30 가뭄 스트레스 저항성 관련 유전자 및 형질전환 식물체

Country Status (3)

Country Link
US (1) US20140026254A1 (ko)
KR (1) KR101361149B1 (ko)
WO (1) WO2014014162A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20240025882A1 (en) * 2018-12-14 2024-01-25 Lynk Pharmaceuticals Co. Ltd. Benzamides of pyrazolylamino- pyrimidinyl derivatives, and compositions and methods thereof

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101582047B1 (ko) * 2014-09-05 2016-01-04 중앙대학교 산학협력단 고추 CaAIP1을 이용한 식물체의 건조 스트레스 저항성 증진방법
KR101918590B1 (ko) 2016-10-26 2018-11-14 연세대학교 산학협력단 식물의 가뭄 스트레스 내성과 관련된 신규 유전자 및 그의 용도
JP2018098327A (ja) * 2016-12-13 2018-06-21 太陽誘電株式会社 積層セラミックコンデンサおよびその製造方法
KR101881009B1 (ko) 2017-12-15 2018-07-23 전남대학교산학협력단 히터 및 온도센서가 집적된 다층구조의 환경장애 진단용 종이센서
CN110272911A (zh) * 2019-07-05 2019-09-24 四川大学 AOX1a基因在提高植物耐旱性方面的应用
CN112430584B (zh) * 2020-12-07 2022-05-13 南京农业大学 一种杜梨泛素连接酶基因、编码蛋白及其在植物抗旱遗传改良中的应用
CN114107331A (zh) * 2021-12-02 2022-03-01 云南中烟工业有限责任公司 参与烟草干旱胁迫反应的基因及其应用
CN117143889A (zh) * 2023-10-24 2023-12-01 四川农业大学 一种e3泛素连接酶基因的新用途

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20110071821A (ko) * 2009-12-21 2011-06-29 연세대학교 산학협력단 건조 스트레스 저항성 관련 유전자 및 형질전환 식물체
US20110321197A1 (en) * 2008-10-23 2011-12-29 Basf Plant Science Gmbh Plants with Increased Yield (NUE)
KR20120035543A (ko) * 2010-10-06 2012-04-16 경상대학교산학협력단 ＯｓＳＩＺ1 및 ＯｓＳＩＺ2 단백질 발현을 통한 벼 식물의 스트레스 적응 방법

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110321197A1 (en) * 2008-10-23 2011-12-29 Basf Plant Science Gmbh Plants with Increased Yield (NUE)
KR20110071821A (ko) * 2009-12-21 2011-06-29 연세대학교 산학협력단 건조 스트레스 저항성 관련 유전자 및 형질전환 식물체
KR20120035543A (ko) * 2010-10-06 2012-04-16 경상대학교산학협력단 ＯｓＳＩＺ1 및 ＯｓＳＩＺ2 단백질 발현을 통한 벼 식물의 스트레스 적응 방법

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
LEE, JAE-HOON ET AL.: "Regulation of abiotic stress signal transduction by E3 ubiquitin ligases in Arabidopsis", MOLECULES AND CELLS, vol. 31, no. 3, March 2011 (2011-03-01), pages 201 - 208 *
ZENG, LI-RONG ET AL.: "Classificaion, Expression Pattern, and E3 Ligase Activity Assay of Rice U-Box-Containing Proteins", MOL. PLANT, vol. 1, no. 5, 2008, pages 800 - 815 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20240025882A1 (en) * 2018-12-14 2024-01-25 Lynk Pharmaceuticals Co. Ltd. Benzamides of pyrazolylamino- pyrimidinyl derivatives, and compositions and methods thereof
US12030870B2 (en) * 2018-12-14 2024-07-09 Lynk Pharmaceuticals Co. Ltd. Benzamides of pyrazolylamino-pyrimidinyl derivatives, and compositions and methods thereof

Also Published As

Publication number Publication date
US20140026254A1 (en) 2014-01-23
KR101361149B1 (ko) 2014-02-24
KR20140011129A (ko) 2014-01-28

Similar Documents

Publication Publication Date Title
KR101361149B1 (ko) 가뭄 스트레스 저항성 관련 유전자 및 형질전환 식물체
US20230203519A1 (en) Methods of modulating seed and organ size in plants
EP3078749B1 (en) Transgenic plants with enhanced agronomic traits
Kandasamy et al. Silencing the nuclear actin‐related protein AtARP4 in Arabidopsis has multiple effects on plant development, including early flowering and delayed floral senescence
US20080263726A1 (en) SVP gene controlling flowering time of plants
Paparelli et al. Misexpression of a chloroplast aspartyl protease leads to severe growth defects and alters carbohydrate metabolism in Arabidopsis
US20090083877A1 (en) Transcription Factors, DNA and Methods for Introduction of Value-Added Seed Traits and Stress Tolerance
Hong et al. Wheat F-box protein recruits proteins and regulates their abundance during wheat spike development
MX2014005212A (es) Mejoramiento de la tolerancia a la sequia, eficiencia de uso de nitrogeno y rendimiento de una planta.
CN107787180A (zh) 转基因植物
Barrero et al. A role for PM19-Like 1 in seed dormancy in Arabidopsis
CA2700981C (en) Plants having increased biomass
CN110964739A (zh) 调节植物中的种子和器官大小的方法
KR101200989B1 (ko) 건조 스트레스 저항성 관련 유전자 및 형질전환 식물체
US7910801B2 (en) Plants with reduced expression of phosphatase type 2C gene for enhanced pathogen resistance
WO2015066180A1 (en) Improving plant tolerance to stress through the control of chloroplast stability
Gray-Mitsumune et al. Loss of ovule identity induced by overexpression of the fertilization-related kinase 2 (ScFRK2), a MAPKKK from Solanum chacoense
AU2002334300B2 (en) Caax prenyl protease nucleic acids and polypeptides and methods of use thereof
US20160108416A1 (en) Atsp1, an e3 ubiquitin ligase, and its use
KR20110092148A (ko) 식물의 노화 지연 기능 및 스트레스 내성 기능을 갖는 ａｔｈｇ１ 단백질과 그 유전자 및 이들의 용도
KR101285763B1 (ko) Ａｂａ 호르몬을 통해 식물의 스트레스 반응을 조절하는 유전자 및 형질전환 식물체
KR20150003099A (ko) 식물의 생산성 증대 기능, 스트레스 내성 기능 및 노화 지연 기능을 갖는 atpg6 단백질과 그 유전자 및 이들의 용도
Mulangi Characterization of polyamine transporters from rice and Arabidopsis
Zhao et al. Arabidopsis ATHB17 coordinates nuclear and plastidic photosynthesis gene expression in response to abiotic stress
Beecher Mini-Symposium: Gametophytic Self-incompatibility

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12881198

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 12881198

Country of ref document: EP

Kind code of ref document: A1