WO2014006203A1 - Engineered clostridium strain for butanol production - Google Patents
Engineered clostridium strain for butanol production Download PDFInfo
- Publication number
- WO2014006203A1 WO2014006203A1 PCT/EP2013/064302 EP2013064302W WO2014006203A1 WO 2014006203 A1 WO2014006203 A1 WO 2014006203A1 EP 2013064302 W EP2013064302 W EP 2013064302W WO 2014006203 A1 WO2014006203 A1 WO 2014006203A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- thiolase
- activity
- coa
- butanol
- enzyme
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/33—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Clostridium (G)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1025—Acyltransferases (2.3)
- C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
- C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
- C12P7/16—Butanols
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y203/00—Acyltransferases (2.3)
- C12Y203/01—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
- C12Y203/01009—Acetyl-CoA C-acetyltransferase (2.3.1.9)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y203/00—Acyltransferases (2.3)
- C12Y203/01—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
- C12Y203/01016—Acetyl-CoA C-acyltransferase (2.3.1.16)
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
- Y02E50/00—Technologies for the production of fuel of non-fossil origin
- Y02E50/10—Biofuels, e.g. bio-diesel
Definitions
- the present invention is related to the field of industrial microbiology and genetic engineering of microorganisms. More specifically, the invention relates to a process for producing a chemical compound using an acetoacetyl coenzyme A-dependeni metabolic pathway in a microbial host, such as the genus Clostridium, the chemical being in particular n-butanol.
- butanoI (n-butanol or just butanol) is an important commodity chemical, produced today almost exclusively from petrochemical resources.
- the fermentative production of butanol is - in present understanding - restricted to the genus Clostridium, a group of Gram-positive, spore forming anaerobes comprising mainly species from terrestrial habitats (Durre 1998, Durre 201 1 ).
- the biosynthesis of butanol requires a C-specific biosynthetic pathway deviating from a central metabolic intermediate such as the activated C 2 compound acetyl- CoA. Such a carbon-carbon bond formation constitutes an important metabolic step and the thiolase is a typical biocatalyst mediating this reaction.
- Clostridium acetobutylicum has been first discovered and to date is the best characterized solventogenic Clostridium species.
- Clostridium strain improvements for biotechnotogicai applications have been obtained with random mutagenesis and plate screening approaches (US 4,757,010; US 6,358,717), Considering the recent development of new metabolic engineering and analytical tools for members of the genus Clostridium, several rational approaches to improve butanol production were conducted (Lee, ef a/., 2008, Papoutsakis, 2008, Lutke-Eversloh & Bahl, 201 1 ) These are, however, limited to the manipulation of gene expression patterns such as gene knockout or downregulation, respectively, and/or gene overexpression to manipulate metabolic fluxes towards the desired product.
- Thiolase (acetyl-coenzyme A [CoA] acetyltransferase, EC 2.3.1.19) plays a key role in the production of butanol and other metabolites in organisms including C. acetobutylicum and its activity may determine the ratio of C3 & C4 products (e.g. butanol, acetone and butyrate) to ⁇ C2 products (e.g. ethanol and acetate); ⁇ Wiesenbom et al. (1988). iesenborn et al. (1988) further described that thiolase may be inhibited by micromolar levels of Coenzyme A [Co A].
- C3 & C4 products e.g. butanol, acetone and butyrate
- ⁇ C2 products e.g. ethanol and acetate
- ⁇ Wiesenbom et al. (1988) iesenborn et al. (1988) further described that thiola
- acetobutylicum ATCC 824 strain comprising a downregulated acetone pathway and adhEI overexpression could not be increased by simultaneous thIA overexpression (Sillers, et al , 2008, Sillers,, et a!. , 2009). These findings clearly indicated that increased amounts of thIA transcripts do not directly lead to an increased flux into the C 4 pathway.
- the invention provides an improved process for producing a chemical using an acetoacetyl-
- the CoA-dependent metabolic pathway is improved because it has a thiolase activity with higher specific activity and/or with reduced sensitivity towards the inhibitor coenzyme A compared to the activit and sensitivity of a wildtype enzyme, such as the polypeptide having SEQ ID NO: 1 .
- the thiolase variants of the invention show reduced sensitivity towards its physiological inhibitor coenzyme A (CoA-SH).
- the process of the invention can be performed by expressing the enzyme of the invention recombinantly, leading to a recombinant (rnicro)organism, such as for example a recombinant Clostridium acetobutylicum expressing the thiolase of the invention.
- Said enzyme surprisingly shows improved productivity of butanoi.
- the inventors achieved the invention by analyzing the polypeptide sequence of a wiidtype thiolase, generating a library of mutant thiolase genes, followed by ahigh-throughput screening assay, employing Escherichia coli as host cells for expression of the mutant thiolase gene library. Screening of this library resulted in the identification of various thiolase enzyme variants, including a thio!ase enzyme variant with significantly increased activity in the presence of free CoA-SH.
- the most preferred (optimized) thiolase variant has three amino acid substitutions ⁇ R.133G, H 158N, G222V) and its gene was expressed in C, acetobutylicum ATCC 824 to assess the effect of reduced feedback-inhibition on solvent production
- the invention also provides host cells expressing the enzyme of the invention and/or suitable in the process of the invention, as well as nucleic acids encoding the enzyme of the invention,
- a process of item 1 wherein said thiolase has 5% or higher, preferably 10% or higher, more preferably 20% or higher, even more preferably 30% or higher activity, as compared to the parental wiidtype enzyme under physiological conditions.
- a polypeptide having thiolase activity characterized in that it has 70 % or more, preferably 75 % or more, more preferably 80 % or more, more preferably 85 % or more, more preferably 90 % or more, more preferably 95 % or more, such as 98 % or more, 97 % or more, 98 % or more, 99 % or more sequence identity with SEQ ID NO: 1 , provided that at least one, such as any combination of two, or alt three of the residues 133, 156, 222 display a mutation (selected from substitution, deletion or insertion) with respect to SEQ ID NO: 1 ,
- a vector comprising the nucleic acid of item 14. [16] A host cell carrying the nucleic acid of item 14 or the vector of claim 15.
- the present invention provides the following items;
- [1 ] A process for producing a chemical using an acetoacetyl-CoA-dependent metabolic pathway which has a thioiase activity with higher specific activity and reduced sensitivity towards the inhibitor coenzyme A compared to the activity and sensitivity of the polypeptide having SEQ ID NO; 1 , and wherein the activity of said thioiase is not inhibited by 10 ⁇ CoA- SH,
- a process for producing a chemical using an acetoacetyl-CoA-dependent metabolic pathway which has a thioiase activity with higher specific activity and/or reduced sensitivity towards the inhibitor coenzyme A compared to the activity and sensitivity of the polypeptide having SEQ ID NO: 1 , and wherein the thioiase is a mutant protein having at least one mutation selected from
- [3] A process for producing a chemical using an acetoacetyl-CoA-de endent metabolic pathway which has a thioiase activity with higher specific activity and/or reduced sensitivity towards the inhibitor coenzyme A compared to the activity and sensitivity of the polypeptide having SEQ ID NO: 1 , and wherein the thioiase is a mutant protein having at least one mutation into the CoA-SH binding loop domain with respect to the parental wildtype enzyme.
- a process for producing a chemical using an acetoacety!-CoA-dependent metabolic pathway which has a thioiase activity with higher specific activity and/or reduced sensitivity towards the inhibitor coenzyme A compared to the activity and sensitivity of the polypeptide having SEQ ID NO: 1 , wherein the thioiase is a mutant protein having at least one mutation into the CoA-SH binding loop domain with respect to the parental wildtype enzyme, and wherein the determination of thioiase activity is performed by a 3-hydroxybutyyl-CoA dehydrogenase-coupled spectrophotometnc assay.
- FIGURES Figure 1 Thiolase assay development in 98-welI microtiter plates.
- Thiolase activities were measured in cell crude extracts without (a) and in the presence of 10 ⁇ free CoA-SH (b). The relative distribution as percent of wildtype thiolase activity without (c) and in the presence of 10 ⁇ free CoA-SH (d) are shown.
- a total of 1620 clones of the £ coli BL21 (DE3) AS K- 1 B A3 : i thlA m ⁇ T library were analyzed for thiolase activities and sensitivity towards free CoA-SH.
- mutant thiolase activities exhibited a wide range of both increased and reduced values as compared to the wildtype ThIA activity ( Figure 3a, c), and only 56 clones ( ⁇ 4 %) revealed no thiolase activity.
- ThlA ⁇ Open squares and dashed line, ThlA ⁇ ; dosed circles and solid line, ThlA 0PT . Mean values of six independent measurements are shown. The clearly reduced sensitivity of ThlA 0FT towards free CoA-SH in comparison to Th!A WT is illustrated. Remarkably, at a concentration of 50 ⁇ CoA-SH, ThlA OPT showed a more than 10-foid higher thiolase activity than ThlA T ,
- C. acetobutylicum pT::thlA 0PT Closed circles, C. acetobutylicum pT (vector control). Average data of three independent replicates for each strain are shown.
- C. acetobutylicum pJ:MA 0Pr produced similar amounts of acetone but higher levels of ethanol and butanol as compared to the vector control strain. Acetone and ethanol formation was clearly delayed whereas butanol synthesis began at the same time as in the control culture.
- the present invention provides an improved process for the production of a chemical using an acetoacetyl-CoA-dependent metabolic pathway.
- the present invention thus relates to a process for the production of a chemical involving a higher flux into the acetoacetyl coenzyme A-dependent metabolic pathway.
- the process of the invention is improved because it has a thiolase activity with higher specific activity and/or with reduced sensitivity towards the inhibitor coenzyme A compared to the activity and sensitivity of a wildtype enzyme, such as the polypeptide having SEQ ID NO; 1.
- Saidimproved variants of the enzyme thiolase thlA that have higher activity and/or reduced feedback inhibition are also comprised in the invention.
- microbial strains expressing such an enzyme variant show higher productivity and/or selectivity towards butanol production although prior art approaches em ploying microbial strains overexpressing such wildtype enzyme had not shown the respective effect Stiller et al. (2008).
- the inventors of the present invention applied a two-step process In the first step, they aligned the amino acid sequence of CAC2873 with the Z. ramigera thiolase. This was done in view of the sequence homology of the Z. ramigera thiolase (for Alignment, see Figure 2), which had previously been subjected to detailed biochemical and crystallographic analyses.
- the inventors of the present invention designed a mutagenesis protocol aiming at introducing random mutations into the loop region, i.e. the region of residues 1 19- 254, i.e the catalytic residues Cys89, His348 and Cys378 were not involved.
- the correctness of the mutant library was validated by DNA sequencing of 48 randomly selected clones.
- the sequenced variants in the so-obtained mutant library of ThlA comprised an average number of 2.5 amino acid substitutions in the region of residues 1 19-254.
- the present invention relates to a two-step process for making ThlA variants.
- Any ThlA enzyme from any organism (preferred are Clostridium species) can be used as starting sequence, which is aligned in the first step to the Z. ramigera thiolase shown in Figure 2.
- the alignment is done by ClustalW 2.1 .
- a preferred region into which the mutations are to be introduced is the region which is homologous to the region corresponding to residues 120-249 of the Z. ramigera thiolase shown in Figure 2 ("loop region").
- the term "loop region” is used without wishing to be bound to any theory simply to refer to a region that is homolgous to the region corresponding to residues 120-249 of the Z.
- CAC2873 (SEQ ID NO; 1 ; Figure 2) is the starting sequence for the mutagenesis approach, and more preferably, the region selected for mutagenesis is the loop region, i.e. the region corresponding to residues 1 19-249 of CAC2873 "Region selected for mutagenesis" can mean that mutations are preferably introduced into this region, or - in a preferred embodiment - that mutations are introduced exclusively into said region.
- the improved thioiases of the present invention are variants of the ThIA enzyme (CAC2873) of C, acetobutylicum ATCC 824,
- the thiolase gene thIA of C. acetobutylicum (CAC2873) is subjected to random mutagenesis.
- the CoA-SH binding loop domain is targeted for amino acid exchanges by random mutagenesis,
- any desired mutant my optionally also be obtained by directly synthesizing the desired polypeptide.
- the coding sequence of the enzyme to be mutagenized can oftentimes be obtained from public databases.
- the corresponding nucleotide can then be obtained by designing PGR primers as known in the art and amplifying from, a sample from the respective organism. Such a sample may for example be total genomic DNA or a colony of the respective microorganism (colony PGR).
- the coding sequence may be obtained by reverse-translating the amino acid sequence, and the respective oligonucleotide can be synthesized in vitro.
- Reverse translation may optionally be done by considering the codon usage of the organism in which expression is desired.
- Many methods for introducing mutations are known in the art.
- Random methods methods for obtaining random mutants
- specific mutants can be introduced by site-directed mutagenesis, A variety of random and site-directed mutagenesis approaches is described by Sambrock and Russell 2001 , and any such approach may be used.
- the random mutagenesis may be done by any method suitable for such purpose known in the art, for example by introducing site-directed mutations into said particular region, or by excising said region from a.
- nucleic acid construct comprising the entire coding sequence of the parental (e.g. wildtype) enzyme by means of unique restriction sites, followed by random mutagenesis of the excised region and by subsequent re-ligation into a nucleic acid construct, corresponding to the one resulting from said excision by unique restriction sites.
- the random mutagenesis is however done using synthetic oligonucleotides building the degenerated backbone, e.g. as described in Example 4 and Table!
- mutation can mean any one or more selected from substitution, deletion and insertion, although substitution may be preferred.
- a mutant protein is any variant of a starting protein (parental protein) having at least one (preferred) mutation with respect to the starting protein (parental protein).
- the obtained random mutants may be sequenced at this stage (for which the (plasmid) DNA encoding the variant may be isolated), although the sequencing at this stage is merely optional.
- the obtained variants (mutants of the starting sequence) are screened for thiolase activity.
- the obtained variants are expressed in E. coll.
- Expression of the desired variant can be induced as described in the art (e.g. Sambrock and Russell 2001 ), depending on the promoter.
- expression can be induced by anhydrotetracycline as described in Example 2.
- cells are further grown and subsequently harvested, e.g. by centrifugation. Crude extracts of the £. coli expressing the thiolase variants are prepared as described Example 3.
- the thiolase activity is tested in absence of the inhibitor. In another (preferred) embodiment, the thiolase activity is tested in presence of the inhibitor.
- a high-throughput screening is done, employing multititer plates, such as the 96-well microtifer piate format.
- thiolase activity measurements serves to identify improved thiolase variants.
- recombinant E coli strains are used as host cells for screening a plasmid-borne library of mutagenized thIA gene.
- the determination of thiolase activities is performed by a 3-hydroxybutyryl-CoA dehydrogenase-coupled spectrophotometric assay as follows.
- the 3-hydroxybutyryi-CoA dehydrogenase activity is provided by a common 3-hydroxyacyl-CoA dehydrogenase or by the hbd protein of C, acetobutylicum or by the PhaB protein of R. eutropha.
- 3-hydroxybutyryl-CoA dehydrogenase activity are provided either by purified enzymes or by crude extracts of native or recombinant host cells expressing the respective gene.
- the thiolase activities may be measured spectrophotometncally, such as for example in cuvettes or in (e.g. 96-well) microtiter plates.
- the assay for determination of the thiolase activity according to the present invention is as follows:
- Cell crude extracts of E. coli are prepared by addition of 5 ml of BugBuster 10x Protein Extraction Reagent (Merck Bioscience, Darmstadt, Germany) which has previously been diluted 1 :10 with 0.1 Tris/HC! buffer, pH 6.0, per gram cell wet weight and the suspension is incubated at room temperature for 20 min. To remove the cell debris, the suspension is centrifuged at 4°C and 13,000 rpm for 30 min. The supernatant is transferred to a fresh vial and subsequently used for enzyme activity measurements, and the protein content is determined according to Bradford (Bradford 1976).
- acetoacetyi-CoA reductase (PhaB') activity is provided by crude extracts of E. coli BL21 (DE3) pET30::pha8 [Said crude extract is obtainable as follows: The phaB gene is amplified from chromosomal DNA of R. eutropha H18 using primers phaB_fw and phaB_rv and cloned into the pET-30 Xa/LIC according the manufacturer's description (Merck Bioscience, Darmstadt, Germany, Cat. No. 69073-3). E.
- coli BL21 (DE3) pET30; :pftaSf is cultivated in LB containing 100 pg/ml amptd!iin and 25 pg/ml chloramphenicol at 37°C to an OD 6 oo of 0.7, 24 mg/ml isopropyl-p-D- thiogalactopyranoside (IPTG) is added and the culture is further incubated at 30°C for 4 h. Cells are harvested by centrifugation at 4°C and 5,000 * g for 10 min, and the cell pellets are stored at -20 °C when necessary.
- IPTG isopropyl-p-D- thiogalactopyranoside
- PhaB activity is measured spectrophotometrically: 30 ⁇ of crude extract are added to 0.9 ml of potassium, phosphate buffer (0.05 m , pH 6.0) containing 32 nM acetoacetyi-CoA and 100 nM NADPH, and the absorption is recorded at 340 nm (Haywood et ai. 1988).
- the condensation reaction of thiolase activity is determined in extracts of £. coli BL21 (DE3) pASK-IBA3::f/?//4 in 50 mM potassium phosphate buffer, pH 6.0, comprising 1 mM dithiothreito! (DTT), 0.2 mM NADPH and 2 U PhaB (in crude extracts of E coli BL21 (DE3) pET30::phaB1).
- the reaction is started by addition of 1 mM acetyl-CoA and monitored at 340 nm on an Ultrospec 3000 photometer ⁇ (Amersham Buchler GmbH & Co..
- an improved thiolase mutant is a thiolase mutant (variant of the parent, enzyme) having either (a) higher activity than the parent enzyme (the starting enzyme of the mutagenesis), (i.e.
- Improved thiolase varaints may also be referred to as thlA mp .
- improved thiolase variant of the invention shows 5% or higher, preferably 10% or higher, more preferably 20% or higher, even more preferably 30% or higher activity, as compared to the parental (e.g. wildtype) enzyme.
- parental (e.g. wildtype) enzyme e.g. a) enzyme.
- improved thiolase variant has 50% or higher, preferably 75% or higher, more preferably 100% ⁇ or higher, even more preferably 200% or higher activity in the presence of 10 ⁇ CoA-SH, as compared to the parental (e.g. wildtype) enzyme.
- the 10 ⁇ CoA-SH is added prior to performing the assay.
- parental (e.g. wildtype) enzyme refers to the polypeptide which served as basis for the mutagenesis.
- the parental (e.g. wildtype) enzyme can be any enzyme having thiolase activity, such as any variant of ThIA, particularly any (preferably wildtype) ThIA from a Clostridium species.
- the parental (e.g. wildtype) enzyme is the one shown as SE.Q ID NO: 1.
- the present invention comprises a polypeptide having thiolase activity characterized in that it has 70 % or more, preferably 75 % or more, more preferably 80 % or more, more preferably 85 % or more, more preferably 30 % or more, more preferably 95 % or more, such as 96 % or more, 97 % or more, 38 % or more, 99 % or more sequence identity with SEQ ID NO; 1 , provided that at least one, such as any combination of two, or all three of the residues 133, 156, 222 display a mutation with respect to SEQ ID NO: 1 .
- the term "mutation" refers to any mutation, selected from insertion, deletion and substitution, whereby substitution is preferred.
- Preferred substitutions of position 133 are the ones wherein the R residue is exchanged by a small residue, such as G or A or S or C, or a non-polar residue, such as particularly a hydrophobic residue as G, A, L, I, V, W, Y, F, wherein G is most preferred.
- Preferred substitutions of position 156 are the ones wherein the H residue is exchanged by an amide residue, such as N or Q, whereby N is preferred.
- Preferred substitutions of position 222 are the ones wherein the G residue is exchanged by a hydrophobic residue, such as G, A, L, I, V, W, Y, F, wherein V is most preferred. Any combination of these preferred substitutions is also comprised in the invention.
- said polypeptide is characterized in that said mutation(s) are selected among any one, any combination of two, and preferably all three of the following substitutions: R133G, H156IM, G222V.
- the embodiment wherein all these three substitutions are combined is shown in SEQ ID NO: 2, and also referred to herein as thIA OPJ .
- the genes of improved thiolase variants may be expressed in an industrial production organism for increasing the flux into an acetoacetyl-CoA-dependent metabolic pathway.
- the DNA sequence of improved thiolase variants described in the present invention may be adapted to the specific host organism, e. g, by changing the codon usage for enhanced recombinant gene expression.
- the improved thioiase enzymes may be employed in a process for producing technically important compounds deriving from an acetoacety!-CoA-related biosynthetic pathway. More specifically, the improved thioiase enzymes may be involved in a process for producing an isoprenoid compound involving the mevalonate pathway. In a preferred embodiment, the improved thioiase enzymes are employed in polyhydroxyatkanoate formation by innate or recombinant hosts for the production of thermoplastic polyesters from renewable resources.
- improved thioiase enzymes are employed in biofuel production.
- a biofuel production process is based on the conversion of carbohydrates such as mono-, di-, or polysaccharides, optionally including lignocetlulosic hydrolysafes, into biofuels.
- the improved thioiase enzymes of the present invention are used in such a process.
- the improved enzymes of the invention can be used in a process for producing a chemical along the acetoacetyl-CoA-depsndent metabolic pathway; this pathway requires a thioiase activity. Any process employing an enzyme of the invention is therefore also comprised in the invention.
- the thioiase of the invention ⁇ to be used in the process of the invention
- Physiological conditions are the conditions typically found in the organism in which the enzyme is (optionally recombinantiy) expressed. It can be expected that a higher activity of the enzyme will lead to higher yield of the product of the respective pathway (e.g. butanol). The product yield may thus serve to indirectly measure the activity.
- the enzyme is expressed as described above and the crude extract is tested for thioiase activity as described above.
- the thioiase of the invention (to be used in the process of the invention) has an activity which is (essentially) not inhibited by 10 ⁇ CoA-SH.
- the activity in presence of this concentration CoA-SH is at least 90 % of the activity in the absence of CoASH.
- said thioiase is obtainable by the above-described screening methods for selecting improved thioiase varaints among the mutant thioiase variants.
- Said screening may involve expression of the thioiase recombinantiy in bacteria, such as E, cols ' .
- the screening may be done by spectrophotometric measurements of thioiase activities in bacterial cell crude extracts.
- the screening can include butyric acid utilization for phenotype selection.
- Said screening may include monitoring of polyhydroxyalkanoate accumulation and viable colony staining for phenotype selection.
- the chemical produced in the process of the invention is a C4 alcohol. C4-aicoho!
- a C4 alcohol comprises on O atom as the only non-H atom, i.e. is butanoi ⁇ including n-butanol, 2 -butanoi and tert-butanol), preferably n-butanoi.
- the present invention also provides a nucleic acid encoding the improved enzyme of the invention.
- This includes the enzyme variant defined by the specific mutations as defiend above, as well as any enzyme having a thioiase activity with higher specific activity and/or reduced sensitivity towards the inhibitor coenzyme A, as defined above.
- the nucleic acid encoding the polypeptide defined by SEQ ID NO: 2.
- Said nucleic acids may be conveniently obtained by in siltco reverse translation.
- Said nucleic acid may have a sequence having 80 % or more, preferably 90 % or more, more preferably 95 % or more, more preferably 96 % or more (97 % or more, 98% or more) and most preferably 99 % or more sequence identity with SEQ ID NO: 13. in a particular embodiment of the said degree of sequence comprises of consists of the polynucleotide shown as SEQ ID NO: 13. SEQ ID NO: 13 encodes the polypeptide of SEQ ID NO: 2. In one embodiment the sequence of SEQ ID NO: 12 is excluded from the clouds of particular percentage identities mentioned in this paragraph; i.e. the invention also relates to a nucleic acid having 80 % or more (including all the more and most preferred embodiments listed above) identity to SEQ ID NO:13, provided that SEQ ID NO; 12 is excluded.
- Said nucleic acid may be in any form, although DNA (single-stranded or double-stranded, i.e. with the respective complementary strand) is preferred.
- the invention further relates to a vector comprising said nucleic acid.
- a vector comprising said nucleic acid.
- Any suitable vector is comprised in the invention, although circular nucleic acid vectors, particularly ptasmids are preferred.
- the vector will typically, although not necessarily contain a promotor for expression of the above-defined nucleic acid and/or an origin of replication allowing for replication in the ⁇ or each of the) host cell in which the vector is to be propagated and/or the above-defined nucleic acid is ot be expressed.
- the invention further relates to a host cell comprising the above-defined nucleic acid or the above-defined vector.
- the host cell is not particularly limited, although the criteria for its selection are based on the following considerations. It is preferred that the enzymes of the present invention are employed in microbial butanoi production. Organisms with a pronounced C 4 metabolism (preferably organisms capable of producing butanoi) are a preferred host for expressing optimized thiotase genes according to the present invention.
- the host cell may be selected from organisms comprising a relatively high metabolic flux into a C -specific pathway; this includes in particular bacteria belonging to the genus Clostridium. In the process of the invention, the host cell may belong to the genus Clostridium.
- the host ceil belongs to one of the following species: C, acetobutylicum, C. beijerinckii, C. saccharoperbutylacetonicum, C. butyricum, C, pasteurianum, C. saccharobutylicum, C. Ijungdahlit, C, thermocellum, C. thermobutyricum, C. cellulolyticum.
- the thiolase of the present invention may be expressed in any other host organism, preferably unicellular organism such as bacteria, archaea and unicellular fungi such as yeasts.
- further genes encoding enzymes of the butanol biosynthetic pathway are optionally expressed (optionally recombinant ⁇ ) in the host organism.
- microorganisms suitable for butanol production include, but are not limited to, organisms allowing heterologous gene expression such as Gram-negative bacteria (like Escherichia coli) or Gram positive bacteria (like Bacillus subtilis), or even eukaryotic organisms (like Saccharomyces cerevisiae).
- Gram-negative bacteria like Escherichia coli
- Gram positive bacteria like Bacillus subtilis
- eukaryotic organisms like Saccharomyces cerevisiae.
- butanol is produced by non-natural butanol producing strains, i.e a strain which does not naturally produce butanol.
- the enzyme of the invention is expressed by a strain belonging to the genus Escherichia, Bacillus, Lactobacillus, Pseudomonas, Ralstonia, Saccharomyces, provided that the further enzymes for butanol production are expressed in said strain, said strain can be used for butanol production according to the invention.
- the butanol is produced by a strain belonging to the species £. coli, B. subtilis, L. brevis, L plantarum, P. putida, P. fluorescens, P. aeruginosa, R. eutropha, S. cerevisiae.
- the host cell of the invention optionally also expresses a gene encoding for aldehyde/alcohol dehydrogenase, such as adhEI (adh) from a Clostridium species, such as Clostridium acetobutylicum.
- Said gene may be homologously or heterologously expressed, Overexpression is preferred.
- thiolase may be applied in vitro.
- the thiolase of the present invention as well as further enzymes of the butanol biosynthetic pathway (such as hydroxybutyril CoA dehydrogenease, crotonase, butyryi CoA dehydrogenase, acohol dehydrogenase)) are provided in vitro, together with the educts of the reaction and buffers.
- the enzymes of the invention may be used in a synthetic pathway.
- a synthetic pathway may be designed in silico for developing a process for producing a desired compound which requires a carbon-carbon bond formation, in one embodiment, the carbon- carbon bond formation proceeds via thiolase-caialyzed acetoacety!-CoA biosynthesis. This is particularly useful in embodiments wherein the thiolase-caialyzed reaction is the rate-limiting step of the synthetic pathway.
- thiolase enzymes as described in this invention may be used to achieve higher metabolic fluxes through the synthetic pathway by increased thiolase activity and/or alleviated feedback inhibition.
- E. coli was cultivated in LB medium comprising per liter 5 g yeast extract, 10 g tryptone and 10 g NaC!, antibiotics for plasmid maintenance were added as required (Sambrock and Russell 2001 ).
- C. acetobutylicum was cultivated anaerobically at 37°C without shaking in Hungate tubes or serum bottles.
- Resazurin (7-hydroxy-10-oxidophenoxazin-10-ium-3-one) was added as a redox indicator for anaerobiosis at a concentration of 1 mg/l and residual oxygen was removed by addition of 50-100 ⁇ titanium (111) nitrilotriacetic acid (NTA) solution ⁇ 1 .3 NaOH, 0.18 M NTA, 0.27 M Na 2 C0 3 and 1.3 % TiCI 3 ).
- NTA nitrilotriacetic acid
- Reinforced clostridial agar was used as solid medium, 40 pg/ml erythromycin was added for plasmid-containing strains of C, acetobutylicum. Procedures requiring strictly anaerobic conditions were conducted in an anaerobic chamber with 90 % N 2 and 10 % H 2 . All strains used in this example are listed in Table ⁇ .
- the thIA gene (CAC2873) was amplified by PGR from chromosomal DNA of C. acetobutylicum ATCC 824 (Fischer et al. 2006) using the primers ThlA_EcoRI_fw and ThlA_KpnI_rv and ligated via EcoRl and Kpnl restriction sites into the vector pASK-IBA3 resulting in plasmid pASK-IBA3::fh//4 WT , which was transformnd into £. coli BL21 (DE3).
- Ceil crude extracts of £ coli were prepared by addition of 5 ml of BugBuster 10x Protein Extraction Reagent ⁇ Merck Bioscience, Darmstadt, Germany) which was previously diluted 1 :10 with 0.1 M Tris/HCl buffer, pH 6.0, per gram cell wet weight and the suspension was incubated at room temperature for 20 min. To remove the cell debris, the suspension was centrifuged at 4°C and 13,000 rpm for 30 min. The supernatant was used for enzyme activity measurements and the protein content was determined according to Bradford (Bradford 1976).
- acetoacetyi-CoA reductase (PhaB) activity was provided by crude extracts of £ coli BL21 (DE3) pET30::pteBf .
- the phaB gene was amplified from chromosomal DNA of R. eutropha H 6 using primers phaB_fw and phaB_rv and cloned into the pET-30 Xa/LIC according the manufcturer's description (yerck Bioscience, Darmstadt, Germany, Cat. No. 69073-3). £.
- coli BL21 (DE3) pET3Q::pteBf was cultivated in LB containing 100 pg/ml ampiciliin and 25 pg/ml chloramphenicol at 37°C to an OD 6 oo of 0,6-0,8, 24 mg/ml isopropyl-p-D-thiogalactopyranoside (IPTG) was added and the culture was further incubated at 30°C for 4 h. Cells were harvested by centrifugation at 4°C and 5,000 * g for 10 min, and the cell pellets were stored at -20°C when necessary. Cell crude extracts were prepared as described above.
- PhaB activity was measured spectrophotometrically: 10-50 ⁇ of crude extract were added to 0.9 ml of potassium phosphate buffer (0,05 mM, pH 8,0) containing 32 nM acetoacetyl-CoA and 100 nM WADPH, and the absorption was recorded at 340 nm (Haywood et al. 1988), The condensation reaction of thioiase activities were determined in extracts of E.
- thIA mutant library designated as pASK-IBA3::tfj/ r u l
- synthetic oligonucteotides building the degenerated backbone of the library were assembled without any amplification reaction involved (non-amplified library), and the diversity of the library was directly correlated to the amount of DNA molecules produced, i.e. 67 fmol/ ⁇ corresponded to 4 x 10 10 molecules (Geneart AG, Regensburg, Germany).
- the total number of transformants was 5.7 x 10 4 colony forming units (CFU).
- Total celis from the transformation plates were harvested for plasmid preparation.
- the concentration of the cloned library was determined by UV spectroscopy as 0,48 pg/ ⁇ ,
- the piasmid preparations were sequenced with primers pASK_fw, pASK_rv and 1 107435.
- S1 _rv (Geneart AG, Regensburg, Germany)
- Total cells from the transformation plates were harvested, resupended in 50 vol% glycerol and aliquots of the cell suspension comprising 3.9 x 10 10 cefls/ml were stored at -70X.
- Ail strains, piasmids and oligonucleotides used in this example are listed in Table I,
- the E. coli pASK ⁇ IBA3;:fi3 ⁇ 44 MIJT library was plated on LB agar plates plus 1 00 pg/mf ampiciliin (LB + Ap) and incubated over night at 37°C. Colonies were transferred with sterile toothpicks into 96 -we 11 microtiter plates containing 200 pi LB + Ap and grown over night at 37°C. Each microtiter plate comprised two samples each of E. coli pASK-IBA3;:ftM WT and E. coli pASK- 1BA3 (empty vector) as controls.
- 150 ⁇ ! potassium phosphate buffer (50 mM pH 6.0) comprising 1 mM DTT and 0.2 mM NADPH were pipetted into the wells of fresh microtiter plates.
- the buffer contained 10 ⁇ free coenzyme A (Sigma-Aldrich Chemie, Deishofen, Germany).
- 20 ⁇ PhaB extract (2 U)
- 10 pi cell crude extracts the reaction was started by addition of 20 pi acetyl-CoA solution (20 mM).
- the absorption at 340 nm was recorded for 3 min in 3 s intervals on a SpectraMax M2e Multi-Mode Microplate Reader and the slope values were automatically calculated.
- the 14 positive clones were cultivated at a larger scale and thiolase activities were spectrophotometrically determined in the cuvette format (Tabie III). None of the ThlA ML ' T variants exhibited an increased overall thiolase activity, but differences to ThlA WT were detected in the presence of 10-50 ⁇ CoA-SH. Whereas 8 clones showed similar activities at various CoA-SH concentrations as the wiidtype ThIA, the clones 9G4, 13D7, 19C10, 21 B8, 25C8 and 28C9 revealed significantly increased thiolase activities when CoA-SH was added to the assay (Table III).
- SEQ ID NO: 1 Thi Wild type (Clostridium acetobutylicum)
- SEQ ID NO: 12 Nucleic acid encoding polypeptide of SEQ ID NO: 1
- SEQ ID NO: 1 3 Nucleic acid encoding polypeptide of SEQ ID NO: 2
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Gastroenterology & Hepatology (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Description
TITLE
ENGINEERED CLOSTRIDIUM STRAIN FOR BUTANOL PRODUCTION
DESCRIPTION FIELD OF INVENTION
The present invention is related to the field of industrial microbiology and genetic engineering of microorganisms. More specifically, the invention relates to a process for producing a chemical compound using an acetoacetyl coenzyme A-dependeni metabolic pathway in a microbial host, such as the genus Clostridium, the chemical being in particular n-butanol.
BACKGROUND OF THE INVENTION
1 -ButanoI (n-butanol or just butanol) is an important commodity chemical, produced today almost exclusively from petrochemical resources. The fermentative production of butanol is - in present understanding - restricted to the genus Clostridium, a group of Gram-positive, spore forming anaerobes comprising mainly species from terrestrial habitats (Durre 1998, Durre 201 1 ). The biosynthesis of butanol requires a C-specific biosynthetic pathway deviating from a central metabolic intermediate such as the activated C2 compound acetyl- CoA. Such a carbon-carbon bond formation constitutes an important metabolic step and the thiolase is a typical biocatalyst mediating this reaction.
Among solventogenic Clostridia, Clostridium acetobutylicum has been first discovered and to date is the best characterized solventogenic Clostridium species. Clostridium strain improvements for biotechnotogicai applications have been obtained with random mutagenesis and plate screening approaches (US 4,757,010; US 6,358,717), Considering the recent development of new metabolic engineering and analytical tools for members of the genus Clostridium, several rational approaches to improve butanol production were conducted (Lee, ef a/., 2008, Papoutsakis, 2008, Lutke-Eversloh & Bahl, 201 1 ) These are, however, limited to the manipulation of gene expression patterns such as gene knockout or downregulation, respectively, and/or gene overexpression to manipulate metabolic fluxes towards the desired product.
Thiolase (acetyl-coenzyme A [CoA] acetyltransferase, EC 2.3.1.19) plays a key role in the production of butanol and other metabolites in organisms including C. acetobutylicum and its
activity may determine the ratio of C3 & C4 products (e.g. butanol, acetone and butyrate) to {C2 products (e.g. ethanol and acetate); {Wiesenbom et al. (1988). iesenborn et al. (1988) further described that thiolase may be inhibited by micromolar levels of Coenzyme A [Co A].
In an attempt published by Stiller et al. (2008) that aimed to direct the flux from' acetate towards butanol formation, the aldehyde/alcohol dehydrogenase gene adhEI (adh) and the thioiase gene thIA (thl) were homologously overexpressed in the solvent-negative degenerated strain C. acetobuty!icum M5. Whereas adhEI overexpression resulted in increased titers of the sum of all alcohols (including ethanol and butanol) additional thIA overexpression could not alter the phenotype of acetate being the main fermentation product in the C, acetobutylicum M5 strain. Moreover, butanol production of a C. acetobutylicum ATCC 824 strain comprising a downregulated acetone pathway and adhEI overexpression could not be increased by simultaneous thIA overexpression (Sillers, et al , 2008, Sillers,, et a!. , 2009). These findings clearly indicated that increased amounts of thIA transcripts do not directly lead to an increased flux into the C4 pathway.
In conclusion, it is desired to obtain bacteria capable of producing more C3- and C4~ products (such as butanol), but altering gene expression is apparently not sufficient to satisfy this desire.
PROBLEM TO BE SOLVED
It is one object of the present invention to provide an improved process for the microbial production of butanol, as well as an improved enzyme suitable to be used in the process. It is particularly desired that said improved enzyme is useful as biocatalyst for microbial butanol production, and shows improved performance compared with enzymes of the present state of the art, particularly under physiological conditions i.e. when expressed in a strain capable of producing butanol and/or other C3-/ C4-products. Further goals of the invention that have been solved will become apparent from the following description of the invention.
BRIEF DESCRIPTION OF THE INVENTION
The invention provides an improved process for producing a chemical using an acetoacetyl-
CoA-dependent metabolic pathway. Said process is improved because it has a thiolase activity with higher specific activity and/or with reduced sensitivity towards the inhibitor coenzyme A compared to the activit and sensitivity of a wildtype enzyme, such as the polypeptide having SEQ ID NO: 1 , In a preferred embodiment, the thiolase variants of the invention show reduced sensitivity towards its physiological inhibitor coenzyme A (CoA-SH). The process of the invention can be performed by expressing the enzyme of the invention
recombinantly, leading to a recombinant (rnicro)organism, such as for example a recombinant Clostridium acetobutylicum expressing the thiolase of the invention. Said enzyme surprisingly shows improved productivity of butanoi.
The inventors achieved the invention by analyzing the polypeptide sequence of a wiidtype thiolase, generating a library of mutant thiolase genes, followed by ahigh-throughput screening assay, employing Escherichia coli as host cells for expression of the mutant thiolase gene library. Screening of this library resulted in the identification of various thiolase enzyme variants, including a thio!ase enzyme variant with significantly increased activity in the presence of free CoA-SH. The most preferred (optimized) thiolase variant has three amino acid substitutions {R.133G, H 158N, G222V) and its gene was expressed in C, acetobutylicum ATCC 824 to assess the effect of reduced feedback-inhibition on solvent production
In addition to a clearly delayed ethanol and aceton formation, the ethanol titer was increased by 46%, Butanoi titer was increased was increased by 18%, while the final acetone concentrations were similar to the vector control strain.
The invention also provides host cells expressing the enzyme of the invention and/or suitable in the process of the invention, as well as nucleic acids encoding the enzyme of the invention,
ITEMS
The following items are comprised in the present invention
[1] A process for producing a chemical using an acetoacetyl-CoA-dependent metabolic pathway which has a thiolase activity with higher specific activity and/or reduced sensitivity towards the inhibitor coenzyme A compared to the activity and sensitivity of the polypeptide having SEQ ID NO: 1.
[2] A process of item 1 , wherein said thiolase has 5% or higher, preferably 10% or higher, more preferably 20% or higher, even more preferably 30% or higher activity, as compared to the parental wiidtype enzyme under physiological conditions.
[3] A process of any one of item 1 or 2, wherein activity of said thiolase is not inhibited by 10 μΜ CoA-SH.
{4] A process of any one of item 1 -3, wherein said chemical is a C4 alcohol.
[5] A process of item 4, wherein said chemical is butanoi, preferably n-butanol.
[6] A process of any one of items 1 -5, wherein the production is done in a host cell belonging to the genus Clostridium,
[7] A process of item 6, wherein such host ceil belongs to one of the foilowing species: C. acetobutyiicum, C, beijerinckii, C, saccharoperbutytacetonicum, C. butyricum, C. pasteurianum, C, saccharobutylicum, C. Ijungdahlii, C. thermocellum, C, th ermob utyricum , C. ceilulolyiicum,
[S] A process of any one of items 1 -7, wherein butano! is produced by non-naturai butano! producing strains.
[9] A process of any one of items 1 -8, wherein butanol is produced by a strain belonging to the genus Escherichia, Bacillus, Lactobacillus, Pseudomonas, Ralstonia, Saccharomyces.
[10] A process of any one of items 1 -9, wherein butanol is produced by a strain belonging to the species E. coll, B. subttlis, L. brevis, L plantarum, P. putida, P, fluorescens, P. aeruginosa, R. eutropha, S. cerevisiae.
[11] A polypeptide having thiolase activity characterized in that it has 70 % or more, preferably 75 % or more, more preferably 80 % or more, more preferably 85 % or more, more preferably 90 % or more, more preferably 95 % or more, such as 98 % or more, 97 % or more, 98 % or more, 99 % or more sequence identity with SEQ ID NO: 1 , provided that at least one, such as any combination of two, or alt three of the residues 133, 156, 222 display a mutation (selected from substitution, deletion or insertion) with respect to SEQ ID NO: 1 ,
[12] The polypeptide of item 11 wherein said mutation(s) selected from
• any one,
• any combination of two, and
• preferably all three (SEQ ID NO: 2)
of the foilowing substitutions: R133G, H156N, G222V,
[13] The process of any one of item 1 to 10, characterized in that the thiolase activity is provided by the enzyme of any of claims 11 to 12.
[14] A nucleic acid encoding a polypeptide selected from the group consisting of (a) the polypeptide of any one of items 1 1 or 12 and (b) the enzyme having the thiolase activity defined in any one of claims 1 to 10.
A vector comprising the nucleic acid of item 14.
[16] A host cell carrying the nucleic acid of item 14 or the vector of claim 15.
Moreover, the present invention provides the following items;
[1 ] A process for producing a chemical using an acetoacetyl-CoA-dependent metabolic pathway which has a thioiase activity with higher specific activity and reduced sensitivity towards the inhibitor coenzyme A compared to the activity and sensitivity of the polypeptide having SEQ ID NO; 1 , and wherein the activity of said thioiase is not inhibited by 10 μ CoA- SH,
[2] A process for producing a chemical using an acetoacetyl-CoA-dependent metabolic pathway which has a thioiase activity with higher specific activity and/or reduced sensitivity towards the inhibitor coenzyme A compared to the activity and sensitivity of the polypeptide having SEQ ID NO: 1 , and wherein the thioiase is a mutant protein having at least one mutation selected from
any one,
any combination of two, and
preferably all three (SEQ ID NO: 2)
of the following substitutions: R133G, H156N, G222V.
[3] A process for producing a chemical using an acetoacetyl-CoA-de endent metabolic pathway which has a thioiase activity with higher specific activity and/or reduced sensitivity towards the inhibitor coenzyme A compared to the activity and sensitivity of the polypeptide having SEQ ID NO: 1 , and wherein the thioiase is a mutant protein having at least one mutation into the CoA-SH binding loop domain with respect to the parental wildtype enzyme.
[4] A process for producing a chemical using an acetoacety!-CoA-dependent metabolic pathway which has a thioiase activity with higher specific activity and/or reduced sensitivity towards the inhibitor coenzyme A compared to the activity and sensitivity of the polypeptide having SEQ ID NO: 1 , wherein the thioiase is a mutant protein having at least one mutation into the CoA-SH binding loop domain with respect to the parental wildtype enzyme, and wherein the determination of thioiase activity is performed by a 3-hydroxybutyyl-CoA dehydrogenase-coupled spectrophotometnc assay.
DESCRIPTION OF FIGURES
Figure 1. Thiolase assay development in 98-welI microtiter plates.
(a) , Cultures of recombinant E coli strains expressing wildtype T IA CAC2873 were used to prepare cell crude extracts which were subjected to spectrophotometric thiolase activity measurements according to NADPH decrease at 340 nm. Time course of absorbance at 340 mm (A34o nm) of the coupled ThfA/PhaB assay in crude extracts of E. coli BL21 (DE3) pASK-IBA3; ;ft T.
(b) » Reproducibility of the coupled ThlA/PhaB assay in crude extracts of E. coli BL21 (DE3) pASK-IBA3: ;tt/Al T. Distribution of 144 independent thiolase activity measurements; the dashed line indicates the mean value. The average thiolase activity of E, coli pASK-iBA3;;f 4WT was 71 ± 4 U/mg, exhibting a standard deviation of only 5.2 % (n = 144). In order to screen for ThIA mutants with reduced sensitivity towards free CoA-SH (the physiological inhibitor), the assay was repeated under the same conditions with the addition of 10 μΜ CoA-SH each, revealing 27 ± 1 U/mg of the wildtype ThIA activity. Hence, C. acetobutylicum wildtype thiolase activities in crude extracts of recombinant E. coli constituted the reference values for the subsequent library screening.
Figure 2. Amino acid sequence alignment of thiolases from C. acetobutylicum (wildtype) and Z. ramigera.
Sequence alignment was performed using ClustalW 2.1 ; "*" represents identical, ":" highly similar and "." similar amino acid residues. CAC2873, thiolase of C. acetobutylicum; Z.ram., thiolase of Z. ramigera. The catalytic histidine and cysteine residues are underlined, the residues of the loop domain involved in the CoA binding are shaded.
Figure 3. Screening of the E. coli AS - 1 B A3 ::thlAmT library.
Thiolase activities were measured in cell crude extracts without (a) and in the presence of 10 μΜ free CoA-SH (b). The relative distribution as percent of wildtype thiolase activity without (c) and in the presence of 10 μΜ free CoA-SH (d) are shown. A total of 1620 clones of the £ coli BL21 (DE3) AS K- 1 B A3 : i thlAm~T library were analyzed for thiolase activities and sensitivity towards free CoA-SH. As illustrated in the Figure, mutant thiolase activities exhibited a wide range of both increased and reduced values as compared to the wildtype ThIA activity (Figure 3a, c), and only 56 clones (< 4 %) revealed no thiolase activity. Interestingly, such wide-spread values were not observed when the same clones were subjected to thiolase activity measurements in the presence of 10 M CoA-SH, i. e. 80 % of the mutants showed activities within ± 20 % of the wildtype ThIA activity (Figure 3b, d). Finally, 14 ThlMUT variants were identified by significantly increased activity, i. e. > 150 % of the Thl,WT activity in the presence of free CoA-SH. It is noteworthy that increased activity
values of both assays detected during the screening did not correlate to each other. The arrow in (d) indicates the 14 positive clones (ThlAWUT variants with significantly increased activity) selected for further characterization.
Figure 4. Thiolase inhibition by free CoA-SH.
Open squares and dashed line, ThlA^; dosed circles and solid line, ThlA0PT. Mean values of six independent measurements are shown. The clearly reduced sensitivity of ThlA0FT towards free CoA-SH in comparison to Th!AWT is illustrated. Remarkably, at a concentration of 50 μΜ CoA-SH, ThlAOPT showed a more than 10-foid higher thiolase activity than ThlA T,
Figure 5. Fermentation profiles of recombinant C, acetobutylicum strains.
Closed circles, C. acetobutylicum pT::thlA0PT; open diamonds, C, acetobutylicum pT (vector control). Average data of three independent replicates for each strain are shown. C. acetobutylicum pJ:MA0Pr produced similar amounts of acetone but higher levels of ethanol and butanol as compared to the vector control strain. Acetone and ethanol formation was clearly delayed whereas butanol synthesis began at the same time as in the control culture. Expression of thlA0PT resulted in a significantly increased butanol production during the stationary growth phase, elevating the final butanol titer from 142 mM (10.5 g/l) to 168 mM (12.4 g/l).
DETAILED DESCRIPTION OF THE INVENTION
The present invention provides an improved process for the production of a chemical using an acetoacetyl-CoA-dependent metabolic pathway. The present invention thus relates to a process for the production of a chemical involving a higher flux into the acetoacetyl coenzyme A-dependent metabolic pathway.
The process of the invention is improved because it has a thiolase activity with higher specific activity and/or with reduced sensitivity towards the inhibitor coenzyme A compared to the activity and sensitivity of a wildtype enzyme, such as the polypeptide having SEQ ID NO; 1. Saidimproved variants of the enzyme thiolase thlA that have higher activity and/or reduced feedback inhibition are also comprised in the invention. Surprisingly microbial strains expressing such an enzyme variant show higher productivity and/or selectivity towards butanol production although prior art approaches em ploying microbial strains overexpressing such wildtype enzyme had not shown the respective effect Stiller et al. (2008).
In particular, high-throughput applications were developed to identify the thiolase variants of the invention.
It is considered in the art that random mutagenesis of enzymes often comes with the disadvantage that a large fraction if not all so-obtained mutants are not improved vis-a-vis the starting variant (which may be the wild type variant). Reasons may include for example that mutagenesis of catalytically or structurally important residues can oftentimes not be tolerated. On the other hand, detailed information on the role of each residue in catalysis or structure of an enzyme are often unknown. Researchers therefore oftentimes feel discouraged to employ random mutagenesis approaches, particularly if no comprehensive structural and functional studies on the starting variant (which may be the wildtype) exist.
In an attempt to circumvent the disadvantages often going along with random mutagenesis, or 'more precisely, in order to minimize the chance of generating mainly inactive mutants and maximize the chances of obtaining improved enzyme variants, the inventors of the present invention applied a two-step process In the first step, they aligned the amino acid sequence of CAC2873 with the Z. ramigera thiolase. This was done in view of the sequence homology of the Z. ramigera thiolase (for Alignment, see Figure 2), which had previously been subjected to detailed biochemical and crystallographic analyses. As a result from this alignment, the inventors expected that the amino acid residues 1 19-249 of CAC2873 form a large loop domain which interacts with the CoA moiety of the substrate (Merilainen et al, 2009; Merilainen et al. 2008).
In the second step, the inventors of the present invention designed a mutagenesis protocol aiming at introducing random mutations into the loop region, i.e. the region of residues 1 19- 254, i.e the catalytic residues Cys89, His348 and Cys378 were not involved. The correctness of the mutant library was validated by DNA sequencing of 48 randomly selected clones. The sequenced variants in the so-obtained mutant library of ThlA comprised an average number of 2.5 amino acid substitutions in the region of residues 1 19-254.
Thus, in one aspect, the present invention relates to a two-step process for making ThlA variants. Any ThlA enzyme from any organism (preferred are Clostridium species) can be used as starting sequence, which is aligned in the first step to the Z. ramigera thiolase shown in Figure 2. The alignment is done by ClustalW 2.1 . A preferred region into which the mutations are to be introduced is the region which is homologous to the region corresponding to residues 120-249 of the Z. ramigera thiolase shown in Figure 2 ("loop region"). The term "loop region" is used without wishing to be bound to any theory simply to refer to a region that is homolgous to the region corresponding to residues 120-249 of the Z. ramigera thiolase shown in Figure 2. In a preferred embodiment, CAC2873 (SEQ ID NO; 1 ; Figure 2) is the starting sequence for the mutagenesis approach, and more preferably, the region selected for mutagenesis is the loop region, i.e. the region corresponding to residues 1 19-249 of CAC2873 "Region selected for mutagenesis" can mean that mutations are
preferably introduced into this region, or - in a preferred embodiment - that mutations are introduced exclusively into said region. Thus, in a preferred embodiment, the improved thioiases of the present invention are variants of the ThIA enzyme (CAC2873) of C, acetobutylicum ATCC 824, In one embodiment, the thiolase gene thIA of C. acetobutylicum (CAC2873) is subjected to random mutagenesis. In a preferred embodiment, the CoA-SH binding loop domain is targeted for amino acid exchanges by random mutagenesis,
in a second step, mutations are introduced into the thiotase or into the loop region thereof. Although this is typically done my mutating the coding sequence, any desired mutant my optionally also be obtained by directly synthesizing the desired polypeptide. The coding sequence of the enzyme to be mutagenized can oftentimes be obtained from public databases. The corresponding nucleotide can then be obtained by designing PGR primers as known in the art and amplifying from, a sample from the respective organism. Such a sample may for example be total genomic DNA or a colony of the respective microorganism (colony PGR). Alternatively, the coding sequence may be obtained by reverse-translating the amino acid sequence, and the respective oligonucleotide can be synthesized in vitro. Reverse translation may optionally be done by considering the codon usage of the organism in which expression is desired. Many methods for introducing mutations are known in the art.. Random methods (methods for obtaining random mutants) include for example error-prone PGR. Alternatively, specific mutants can be introduced by site-directed mutagenesis, A variety of random and site-directed mutagenesis approaches is described by Sambrock and Russell 2001 , and any such approach may be used. In cases in which introduction of mutations into one particular region of the starting sequence is desired {i.e. the loop region) is desired, the random mutagenesis may be done by any method suitable for such purpose known in the art, for example by introducing site-directed mutations into said particular region, or by excising said region from a. nucleic acid construct comprising the entire coding sequence of the parental (e.g. wildtype) enzyme by means of unique restriction sites, followed by random mutagenesis of the excised region and by subsequent re-ligation into a nucleic acid construct, corresponding to the one resulting from said excision by unique restriction sites. Preferably, the random mutagenesis is however done using synthetic oligonucleotides building the degenerated backbone, e.g. as described in Example 4 and Table!
Within this specification, mutation can mean any one or more selected from substitution, deletion and insertion, although substitution may be preferred. Within this specification, a mutant protein is any variant of a starting protein (parental protein) having at least one (preferred) mutation with respect to the starting protein (parental protein).
The obtained random mutants may be sequenced at this stage (for which the (plasmid) DNA encoding the variant may be isolated), although the sequencing at this stage is merely
optional.
!n a third step, the obtained variants (mutants of the starting sequence) are screened for thiolase activity. To that end, the obtained variants are expressed in E. coll. Expression of the desired variant can be induced as described in the art (e.g. Sambrock and Russell 2001 ), depending on the promoter. For a tetracycline dependent system, expression can be induced by anhydrotetracycline as described in Example 2. After inducing expression, cells are further grown and subsequently harvested, e.g. by centrifugation. Crude extracts of the £. coli expressing the thiolase variants are prepared as described Example 3.
In one embodiment, the thiolase activity is tested in absence of the inhibitor. In another (preferred) embodiment, the thiolase activity is tested in presence of the inhibitor. Merely optionally, and to speed up the screening process, a high-throughput screening is done, employing multititer plates, such as the 96-well microtifer piate format.
The thiolase activity measurements serves to identify improved thiolase variants, In a preferred embodiment, recombinant E coli strains are used as host cells for screening a plasmid-borne library of mutagenized thIA gene.
The determination of thiolase activities is performed by a 3-hydroxybutyryl-CoA dehydrogenase-coupled spectrophotometric assay as follows. The 3-hydroxybutyryi-CoA dehydrogenase activity is provided by a common 3-hydroxyacyl-CoA dehydrogenase or by the hbd protein of C, acetobutylicum or by the PhaB protein of R. eutropha. The
3-hydroxybutyryl-CoA dehydrogenase activity are provided either by purified enzymes or by crude extracts of native or recombinant host cells expressing the respective gene. The thiolase activities may be measured spectrophotometncally, such as for example in cuvettes or in (e.g. 96-well) microtiter plates. In particular, the assay for determination of the thiolase activity according to the present invention is as follows:
Assay for determination of the thiolase activity:
Cell crude extracts of E. coli are prepared by addition of 5 ml of BugBuster 10x Protein Extraction Reagent (Merck Bioscience, Darmstadt, Germany) which has previously been diluted 1 :10 with 0.1 Tris/HC! buffer, pH 6.0, per gram cell wet weight and the suspension is incubated at room temperature for 20 min. To remove the cell debris, the suspension is centrifuged at 4°C and 13,000 rpm for 30 min. The supernatant is transferred to a fresh vial and subsequently used for enzyme activity measurements, and the protein content is determined according to Bradford (Bradford 1976).
For the NADPH-coupled thiolase assay, acetoacetyi-CoA reductase (PhaB') activity is provided by crude extracts of E. coli BL21 (DE3) pET30::pha8 [Said crude extract is obtainable as follows: The phaB gene is amplified from chromosomal DNA of R. eutropha
H18 using primers phaB_fw and phaB_rv and cloned into the pET-30 Xa/LIC according the manufacturer's description (Merck Bioscience, Darmstadt, Germany, Cat. No. 69073-3). E. coli BL21 (DE3) pET30; :pftaSf is cultivated in LB containing 100 pg/ml amptd!iin and 25 pg/ml chloramphenicol at 37°C to an OD6oo of 0.7, 24 mg/ml isopropyl-p-D- thiogalactopyranoside (IPTG) is added and the culture is further incubated at 30°C for 4 h. Cells are harvested by centrifugation at 4°C and 5,000 * g for 10 min, and the cell pellets are stored at -20 °C when necessary. Cell crude extracts are prepared as described above.] The PhaB activity is measured spectrophotometrically: 30 μΙ of crude extract are added to 0.9 ml of potassium, phosphate buffer (0.05 m , pH 6.0) containing 32 nM acetoacetyi-CoA and 100 nM NADPH, and the absorption is recorded at 340 nm (Haywood et ai. 1988).
The condensation reaction of thiolase activity is determined in extracts of £. coli BL21 (DE3) pASK-IBA3::f/?//4 in 50 mM potassium phosphate buffer, pH 6.0, comprising 1 mM dithiothreito! (DTT), 0.2 mM NADPH and 2 U PhaB (in crude extracts of E coli BL21 (DE3) pET30::phaB1). The reaction is started by addition of 1 mM acetyl-CoA and monitored at 340 nm on an Ultrospec 3000 photometer ■ (Amersham Buchler GmbH & Co.. KG, Braunschweig, Germany), The reverse thioiytic cleavage reaction is measured spectrophotometrically by acetoacety!-CoA decrease at 303 nm. as described by Hartmanis and Gate n beck (1964).
Cell extract preparation of C. acetobutylicum strains and thiolase activity measurements are conducted as described in detail previously (Hartmanis and Gatenbeck 1984; Lehmann and Lutke-Eversloh 201 1 ). The above assay for determination of the thiolase activity is done in order to identify improved thiolase variants (mutants) among all the obtained mutant thiolase variants. Mutant thiolase variants may also be referred to as thlAmi, Within the meaning of this specification, an improved thiolase mutant is a thiolase mutant (variant of the parent, enzyme) having either (a) higher activity than the parent enzyme (the starting enzyme of the mutagenesis), (i.e. without addition of CoA-SH) or (b) higher activity than the parent enzyme in the presence of >10 μΜ CoA-SH, or (c), a combination of (a) and (b) (i.e. both (a) and (b)). Improved thiolase varaints may also be referred to as thlAmp.
In a preferred embodiment of (a) improved thiolase variant of the invention shows 5% or higher, preferably 10% or higher, more preferably 20% or higher, even more preferably 30% or higher activity, as compared to the parental (e.g. wildtype) enzyme. When it is aimed at identifying enzymes of embodiment (a), then no CoASH is added to the assay for determining activity.
In preferred embodiment of (b), improved thiolase variant has 50% or higher, preferably 75% or higher, more preferably 100%· or higher, even more preferably 200% or higher activity in the presence of 10 μΜ CoA-SH, as compared to the parental (e.g. wildtype) enzyme. This
includes improved thiotase mutants which are not (in a measurable way) inhibited by free CoA-SH. When it is aimed at identifying enzymes of embodiment (b), the 10 μΜ CoA-SH is added prior to performing the assay.
In the two paragraphs above, parental (e.g. wildtype) enzyme refers to the polypeptide which served as basis for the mutagenesis. The parental (e.g. wildtype) enzyme can be any enzyme having thiolase activity, such as any variant of ThIA, particularly any (preferably wildtype) ThIA from a Clostridium species. In a preferred embodiment, the parental (e.g. wildtype) enzyme is the one shown as SE.Q ID NO: 1.
The approach applied by the present inventors has also shown lead to the identification of particularly preferred sites for mutagenesis, i.e. 133, 156, 222 with respect to SEQ ID NO: 1. It is understood that mutation of at least one, such as any combination of two (i.e. 133 and 156; 133, and 222; or 156 and 222), or all three of the residues 133, 156, 222 can lead to an improved enzyme of the invention. Thus, the present invention comprises a polypeptide having thiolase activity characterized in that it has 70 % or more, preferably 75 % or more, more preferably 80 % or more, more preferably 85 % or more, more preferably 30 % or more, more preferably 95 % or more, such as 96 % or more, 97 % or more, 38 % or more, 99 % or more sequence identity with SEQ ID NO; 1 , provided that at least one, such as any combination of two, or all three of the residues 133, 156, 222 display a mutation with respect to SEQ ID NO: 1 . Within the meaning of this specification, the term "mutation" refers to any mutation, selected from insertion, deletion and substitution, whereby substitution is preferred.
Preferred substitutions of position 133 are the ones wherein the R residue is exchanged by a small residue, such as G or A or S or C, or a non-polar residue, such as particularly a hydrophobic residue as G, A, L, I, V, W, Y, F, wherein G is most preferred. Preferred substitutions of position 156 are the ones wherein the H residue is exchanged by an amide residue, such as N or Q, whereby N is preferred. Preferred substitutions of position 222 are the ones wherein the G residue is exchanged by a hydrophobic residue, such as G, A, L, I, V, W, Y, F, wherein V is most preferred. Any combination of these preferred substitutions is also comprised in the invention. Thus, in the most preferred embodiment, said polypeptide is characterized in that said mutation(s) are selected among any one, any combination of two, and preferably all three of the following substitutions: R133G, H156IM, G222V. The embodiment wherein all these three substitutions are combined is shown in SEQ ID NO: 2, and also referred to herein as thIAOPJ.
The genes of improved thiolase variants may be expressed in an industrial production organism for increasing the flux into an acetoacetyl-CoA-dependent metabolic pathway. The DNA sequence of improved thiolase variants described in the present invention may be adapted to the specific host organism, e. g, by changing the codon usage for enhanced
recombinant gene expression.
The improved thioiase enzymes may be employed in a process for producing technically important compounds deriving from an acetoacety!-CoA-related biosynthetic pathway. More specifically, the improved thioiase enzymes may be involved in a process for producing an isoprenoid compound involving the mevalonate pathway. In a preferred embodiment, the improved thioiase enzymes are employed in polyhydroxyatkanoate formation by innate or recombinant hosts for the production of thermoplastic polyesters from renewable resources.
In another embodiment, improved thioiase enzymes are employed in biofuel production. In a preferred embodiment, a biofuel production process is based on the conversion of carbohydrates such as mono-, di-, or polysaccharides, optionally including lignocetlulosic hydrolysafes, into biofuels. The improved thioiase enzymes of the present invention are used in such a process.
The improved enzymes of the invention can be used in a process for producing a chemical along the acetoacetyl-CoA-depsndent metabolic pathway; this pathway requires a thioiase activity. Any process employing an enzyme of the invention is therefore also comprised in the invention.
Preferably, the thioiase of the invention {to be used in the process of the invention) has 5% or higher, preferably 10% or higher, more preferably 20% or higher, even more preferably 30% or higher activity, as compared to the parental wildtype enzyme under physiological conditions. Physiological conditions are the conditions typically found in the organism in which the enzyme is (optionally recombinantiy) expressed. It can be expected that a higher activity of the enzyme will lead to higher yield of the product of the respective pathway (e.g. butanol). The product yield may thus serve to indirectly measure the activity. For direct measurement of the activity, the enzyme is expressed as described above and the crude extract is tested for thioiase activity as described above.
Preferably, the thioiase of the invention (to be used in the process of the invention) has an activity which is (essentially) not inhibited by 10 μΜ CoA-SH. This means that the activity in presence of this concentration CoA-SH is at least 90 % of the activity in the absence of CoASH.
As described herein, said thioiase is obtainable by the above-described screening methods for selecting improved thioiase varaints among the mutant thioiase variants. Said screening may involve expression of the thioiase recombinantiy in bacteria, such as E, cols'. The screening may be done by spectrophotometric measurements of thioiase activities in bacterial cell crude extracts. Alternatively, the screening can include butyric acid utilization for phenotype selection. Said screening may include monitoring of polyhydroxyalkanoate accumulation and viable colony staining for phenotype selection.
Preferably, the chemical produced in the process of the invention is a C4 alcohol. C4-aicoho! means any alcohol having four carbon atoms, wherein the number or type of non-H atoms is not particularly limited. Preferably, a C4 alcohol comprises on O atom as the only non-H atom, i.e. is butanoi {including n-butanol, 2 -butanoi and tert-butanol), preferably n-butanoi.
The present invention also provides a nucleic acid encoding the improved enzyme of the invention. This includes the enzyme variant defined by the specific mutations as defiend above, as well as any enzyme having a thioiase activity with higher specific activity and/or reduced sensitivity towards the inhibitor coenzyme A, as defined above. In particular included is the nucleic acid encoding the polypeptide defined by SEQ ID NO: 2. The skilled person will understand that due to the degeneration of the genetic code, various nucleic acids may encode said polypeptide, and all of them are included in the invention. Said nucleic acids may be conveniently obtained by in siltco reverse translation.
Said nucleic acid may have a sequence having 80 % or more, preferably 90 % or more, more preferably 95 % or more, more preferably 96 % or more (97 % or more, 98% or more) and most preferably 99 % or more sequence identity with SEQ ID NO: 13. in a particular embodiment of the said degree of sequence comprises of consists of the polynucleotide shown as SEQ ID NO: 13. SEQ ID NO: 13 encodes the polypeptide of SEQ ID NO: 2. In one embodiment the sequence of SEQ ID NO: 12 is excluded from the clouds of particular percentage identities mentioned in this paragraph; i.e. the invention also relates to a nucleic acid having 80 % or more (including all the more and most preferred embodiments listed above) identity to SEQ ID NO:13, provided that SEQ ID NO; 12 is excluded.
Said nucleic acid may be in any form, although DNA (single-stranded or double-stranded, i.e. with the respective complementary strand) is preferred.
The invention further relates to a vector comprising said nucleic acid. Any suitable vector is comprised in the invention, although circular nucleic acid vectors, particularly ptasmids are preferred. The vector will typically, although not necessarily contain a promotor for expression of the above-defined nucleic acid and/or an origin of replication allowing for replication in the {or each of the) host cell in which the vector is to be propagated and/or the above-defined nucleic acid is ot be expressed.
The invention further relates to a host cell comprising the above-defined nucleic acid or the above-defined vector. The host cell is not particularly limited, although the criteria for its selection are based on the following considerations. It is preferred that the enzymes of the present invention are employed in microbial butanoi production. Organisms with a pronounced C4 metabolism (preferably organisms capable of producing butanoi) are a
preferred host for expressing optimized thiotase genes according to the present invention. Thus, the host cell may be selected from organisms comprising a relatively high metabolic flux into a C -specific pathway; this includes in particular bacteria belonging to the genus Clostridium. In the process of the invention, the host cell may belong to the genus Clostridium. More preferably, the host ceil belongs to one of the following species: C, acetobutylicum, C. beijerinckii, C. saccharoperbutylacetonicum, C. butyricum, C, pasteurianum, C. saccharobutylicum, C. Ijungdahlit, C, thermocellum, C. thermobutyricum, C. cellulolyticum.
In other embodiments, the thiolase of the present invention may be expressed in any other host organism, preferably unicellular organism such as bacteria, archaea and unicellular fungi such as yeasts. In this case, further genes encoding enzymes of the butanol biosynthetic pathway (such as any combination of enzymes selected from the following list, and preferably all of the following list: hydroxybutyril CoA dehydrogenease, crotonase, butyryi CoA dehydrogenase, acohol dehydrogenase) are optionally expressed (optionally recombinant^) in the host organism. Thus, microorganisms suitable for butanol production include, but are not limited to, organisms allowing heterologous gene expression such as Gram-negative bacteria (like Escherichia coli) or Gram positive bacteria (like Bacillus subtilis), or even eukaryotic organisms (like Saccharomyces cerevisiae). Thus, in this embodiment butanol is produced by non-natural butanol producing strains, i.e a strain which does not naturally produce butanol. This includes more preferred embodiments wherein the enzyme of the invention is expressed by a strain belonging to the genus Escherichia, Bacillus, Lactobacillus, Pseudomonas, Ralstonia, Saccharomyces, provided that the further enzymes for butanol production are expressed in said strain, said strain can be used for butanol production according to the invention. Preferably, the butanol is produced by a strain belonging to the species £. coli, B. subtilis, L. brevis, L plantarum, P. putida, P. fluorescens, P. aeruginosa, R. eutropha, S. cerevisiae.
The host cell of the invention optionally also expresses a gene encoding for aldehyde/alcohol dehydrogenase, such as adhEI (adh) from a Clostridium species, such as Clostridium acetobutylicum. Said gene may be homologously or heterologously expressed, Overexpression is preferred.
In addition to the metabolic in vivo pathways, improved thiolase may be applied in vitro. For in vitro synthesis of butanol for example, the thiolase of the present invention, as well as further enzymes of the butanol biosynthetic pathway (such as hydroxybutyril CoA dehydrogenease, crotonase, butyryi CoA dehydrogenase, acohol dehydrogenase)) are provided in vitro, together with the educts of the reaction and buffers.
Further, the enzymes of the invention may be used in a synthetic pathway. A synthetic
pathway may be designed in silico for developing a process for producing a desired compound which requires a carbon-carbon bond formation, in one embodiment, the carbon- carbon bond formation proceeds via thiolase-caialyzed acetoacety!-CoA biosynthesis. This is particularly useful in embodiments wherein the thiolase-caialyzed reaction is the rate-limiting step of the synthetic pathway. Thus, thiolase enzymes as described in this invention may be used to achieve higher metabolic fluxes through the synthetic pathway by increased thiolase activity and/or alleviated feedback inhibition.
EXAMPLES
Example 11 Bacterial strains and general cultivation conditions
E. coli was cultivated in LB medium comprising per liter 5 g yeast extract, 10 g tryptone and 10 g NaC!, antibiotics for plasmid maintenance were added as required (Sambrock and Russell 2001 ). C. acetobutylicum was cultivated anaerobically at 37°C without shaking in Hungate tubes or serum bottles. Resazurin (7-hydroxy-10-oxidophenoxazin-10-ium-3-one) was added as a redox indicator for anaerobiosis at a concentration of 1 mg/l and residual oxygen was removed by addition of 50-100 μΙ titanium (111) nitrilotriacetic acid (NTA) solution {1 .3 NaOH, 0.18 M NTA, 0.27 M Na2C03 and 1.3 % TiCI3). Reinforced clostridial agar was used as solid medium, 40 pg/ml erythromycin was added for plasmid-containing strains of C, acetobutylicum. Procedures requiring strictly anaerobic conditions were conducted in an anaerobic chamber with 90 % N2 and 10 % H2. All strains used in this example are listed in Table Ϊ.
Table I. Bacterial strains, plasmids and oligonucleotides used in this study.
Strain, plasmid or Relevant characteristics or sequence Reference
oligonucleotide
Strains:
C. acetobutylicum Wildtype Amercian
ATCC 824 Culture
Collection
£. coii BL21 F, ompT, hsdSs{rB ', mB "). gal, dcm (DE3) Studier
(DE3) Moffatt 1986
E co// DH5a F, φβΟ/βοΖΔ Ι δ, A(fecZYA), recAI , Grant et ai.
endA1 , hsdR17 {rk , mk *), pho , supE44 1990
Ihh , gyr A96, re/A1 , λ'
E, coli E 2275 mcrA, AmcrBC, hsdR. recA1 Mermefstein and
Papoutsakis
1993
E. coli BL21 Expression and purification of PhaB from this study (DE3) Ralstonia eutropha with C-termina! His6- pET30::pftaS tag, AmpR
Piasmids; pAN2 p15A, V071, Te Heap et al. 2007 pET-30 Xa-LIC Merck
Bioscience, Darmstadt (Germany) pASK-IBA3 F1 ori, P(tetA) ATG, tetR, StrepAagU (C- IBA GmbH, terminal), Am Gottingen
(Germany) pASK- F1 ori, P(tetA) ATG, tetR, Sirep-tagli (C- this study
IBA3::f 4 WT terminal), AmpR, thIA wildtype gene of
C. acetobtJtyiicum (GAC2873) pASK- F1 ori, P(tctA) ATG, tetR, Sirep-tagll (C- this study
HUT
IBA3;:ftM terminal), AmpR, thIA mutant library pASK- Fl ori, P(teiA) ATG, tetR, Sirep-tagll (C- this study
!BA3::fM4OPT terminal), AmpR, thIA mutant (R133G,
H156N, G222V)
PT ColE1 , repL, EryR, AmpR, P(thlA) Mann et al.
2012
OPT
pT-thIA ColE1 . repL, EryR, AmpR, P{thlA), fhlA0≠ this study
(R133G, H156N, G222V)
Oligonucleotides: thlAJw_EcoRI 5'-AAAAAGAATTCATGAAAGAAGTTG-3' (SEQ ID NO: 3) thlA_rv_Kpnl 5'- (SEQ ID NO: 4)
AAAAAGGTACCCTAGCACTTTTCTAGC-
3' phaB_fw 5'-
GGTATTGAGGGTCGCATGACTCAGCGC ATTG-3' (SEQ ID NO: 5) phaB_rv 5'-
AGAGGAGAGTTAGAGCCCAGCCCATAT GCAGGC-3' (SEQ ID NO: 6)
T7 fw 5'-TAATACGACTCACTATAGGG-3' (SEQ
ID NO: 7)
M13 rv 5'-CAAGGAAACAGCTATGAC-3' (SEQ ID
NO: 8) pASKJw 5'-GTTATTTTACCACTCCCTATC-3' (SEQ
ID NO: 9) pASK_rv 5'»GTGCGCCATTTTTCACTTCAC-3' (SEQ
ID NO: 10)
1 107435.S1 rv 5'-GTTGCATAAAAAGGTCCATATC-3'
(SEQ ID NO: 1 1 )
Example 2: Thiolase gene cloning and expression
General recombinant DNA techniques were conducted according to standard protocols
(Sambrock and Russell 2001 ), All cloning procedures were validated by DNA sequencing
(LGC Genomics GmbH, Berlin, Germany). The thIA gene (CAC2873) was amplified by PGR from chromosomal DNA of C. acetobutylicum ATCC 824 (Fischer et al. 2006) using the primers ThlA_EcoRI_fw and ThlA_KpnI_rv and ligated via EcoRl and Kpnl restriction sites into the vector pASK-IBA3 resulting in plasmid pASK-IBA3::fh//4WT, which was transformnd
into £. coli BL21 (DE3). For protein expression, E. coli BL21 (DE3) pASK-iBA3::tt/Aw l and £ coli BL21 (DE3) pASK-!BA3::fM MUT strains were cultivated in LB medium with 100 pg/ml ampiciliin at 37°C until an OD6oo of 0,8-0,8, After addition of 20 pg/ml anhydrotetracyciine
(AHT), the cultures were incubated over night at 20°C and 180 rpm prior to crude extract preparation for enzyme activity assays.
The optimized thlA mutant gene identified in the library screening, SEQQ ID NO:2; thlA0P' , was subcloned via EcoR\IKpn\ restriction of pASK-IBA3:: thIA0P1, agarose gel purification, T4 DNA polymerase treatment and ligation into the pT vector, yielding plasmid pT;:fWA0PT. After in vivo methylation in E. coli (Heap et al. 2007; ermelstein and Papoutsakis 1993), pT::f 40PT was eiectroporated into C, acetobutylicum ATCC 824 as described previously (Riebe et al. 2009). All plasmids and oligonucleotides used in this example are listed in Table I.
Exa.mp)e3: Enzyme activity measurements
Ceil crude extracts of £ coli were prepared by addition of 5 ml of BugBuster 10x Protein Extraction Reagent {Merck Bioscience, Darmstadt, Germany) which was previously diluted 1 :10 with 0.1 M Tris/HCl buffer, pH 6.0, per gram cell wet weight and the suspension was incubated at room temperature for 20 min. To remove the cell debris, the suspension was centrifuged at 4°C and 13,000 rpm for 30 min. The supernatant was used for enzyme activity measurements and the protein content was determined according to Bradford (Bradford 1976).
For the NADPH-coupled thiolase assay, acetoacetyi-CoA reductase (PhaB) activity was provided by crude extracts of £ coli BL21 (DE3) pET30::pteBf . For this, the phaB gene was amplified from chromosomal DNA of R. eutropha H 6 using primers phaB_fw and phaB_rv and cloned into the pET-30 Xa/LIC according the manufcturer's description (yerck Bioscience, Darmstadt, Germany, Cat. No. 69073-3). £. coli BL21 (DE3) pET3Q::pteBf was cultivated in LB containing 100 pg/ml ampiciliin and 25 pg/ml chloramphenicol at 37°C to an OD6oo of 0,6-0,8, 24 mg/ml isopropyl-p-D-thiogalactopyranoside (IPTG) was added and the culture was further incubated at 30°C for 4 h. Cells were harvested by centrifugation at 4°C and 5,000 * g for 10 min, and the cell pellets were stored at -20°C when necessary. Cell crude extracts were prepared as described above. The PhaB activity was measured spectrophotometrically: 10-50 μΙ of crude extract were added to 0.9 ml of potassium phosphate buffer (0,05 mM, pH 8,0) containing 32 nM acetoacetyl-CoA and 100 nM WADPH, and the absorption was recorded at 340 nm (Haywood et al. 1988),
The condensation reaction of thioiase activities were determined in extracts of E. coli BL21 (DE3) pASK-IBA3::i ?/A in 50 mM potassium phosphate buffer, pH 6,0, comprising 1 mM dithiotreitoi (DTT), 0,2 mM NADPH and 2 U PhaB (in crude extracts of E, coli BL21 (DE3) pET30::pliaSf), The reaction was started by addition of 1 mM acetyl-CoA and monitored at 340 nm on an Ultrospec 3000 photometer (Amersham Buchler GmbH & Co, KG, Braunschweig, Germany), The reverse thiolytic cleavage reaction was measured spectrophotometrically by acetoacetyi-CoA decrease at 303 nm as described (Hartmanis and Gatenbeck 1984), Cell extract preparation of C. acetobutylicum strains and thioiase activity measurements were conducted as described in detail previously (Hartmanis and Gatenbeck 1984; Lehmann and Lutke-Eversioh 2011 ). Enzyme activity measurements in E coli cell extracts are shown in table II,
Table II. Enzyme activites in cell extracts of E. coli hosts.
Acetoacetyl-CoA reductase
Thioiase ~ lA)
(PhaB)
Strain
Thiolytic
NADH NADPH Condensation cleavage
£ coli BL.21 (DE3)
pASK-!BA3 0.03 ± 0,02 0.02 + 0.01 0.08 ± 0.04 0.2 + 0.09
(control)
E. coli BL21 (DE3)
0,05 ± 0.03 0.73 ± 0.09 65.94 ± 4.61 68.96 ± 1 ,54 pASK-IBA3::ft/AWT
E. coli Tuner (DE3)
0.15 ± 0.02 34.27 ± 1 ,43 0.02 ± 0.003 0.3 ± 0, 1 1 pET30;ipteBf
Example 4; Thioiase library construction
To construct the thIA mutant library (designated as pASK-IBA3::tfj/ ru l ), synthetic oligonucteotides building the degenerated backbone of the library were assembled without any amplification reaction involved (non-amplified library), and the diversity of the library was directly correlated to the amount of DNA molecules produced, i.e. 67 fmol/μΙ corresponded to 4 x 1010 molecules (Geneart AG, Regensburg, Germany). To generate the amplified library, 4 pi (268 fmol or 1.6 x 1011 molecules) of the non-amplified library were amplified with the primers T7_fw and M13_rv, full length fragments were gel-purified and resuspended in 100 pf Tris/EDTA buffer. The concentration of the amplified library was determined by UV
spectroscopy as 400 ng/μΙ. The amplified library was digested with EcoRl and Kpn\ and ligated into the EcoRI/KpnI-restricted vector pASK-IBA3. Ligation reactions were transformed into E. coli BL21 (DE3) and the transformation rate was determined by plating of dilution, series. The total number of transformants was 5.7 x 104 colony forming units (CFU). Total celis from the transformation plates were harvested for plasmid preparation. The concentration of the cloned library was determined by UV spectroscopy as 0,48 pg/μΐ, The piasmid preparations were sequenced with primers pASK_fw, pASK_rv and 1 107435. S1 _rv (Geneart AG, Regensburg, Germany), Total cells from the transformation plates were harvested, resupended in 50 vol% glycerol and aliquots of the cell suspension comprising 3.9 x 1010 cefls/ml were stored at -70X. Ail strains, piasmids and oligonucleotides used in this example are listed in Table I,
Example 5: Screening procedure
The E. coli pASK~IBA3;:fi¾4MIJT library was plated on LB agar plates plus 1 00 pg/mf ampiciliin (LB + Ap) and incubated over night at 37°C. Colonies were transferred with sterile toothpicks into 96 -we 11 microtiter plates containing 200 pi LB + Ap and grown over night at 37°C. Each microtiter plate comprised two samples each of E. coli pASK-IBA3;:ftMWT and E. coli pASK- 1BA3 (empty vector) as controls. 10 μΐ Aliquots of the cultures were used to inoculate fresh LB + Ap and the grown microtiter plates were stored at -70°C after addition of 1 0 vol% glycerol. The inoculated microtiter piates were incubated at 37°C until the cultures exhibited an OD6 of 0.5-0.7. For induction of gene expression, 20 pg/ml AHT was added, and the cultures were Incubated over night at 20°C. Subsequently, cell crude extracts were prepared using BugBuster 10x Protein Extraction Reagent (Merck Bioscience, Darmstadt, Germany) as described above to determine the thiolase activities of the £ coli pASK-IBA3::i/7/AMUT library. For this, 150 μ! potassium phosphate buffer (50 mM pH 6.0) comprising 1 mM DTT and 0.2 mM NADPH were pipetted into the wells of fresh microtiter plates. When analyzing the CoA-SH sensitivity, the buffer contained 10 μΜ free coenzyme A (Sigma-Aldrich Chemie, Deishofen, Germany). After addition of 20 μΐ PhaB extract (2 U) and 10 pi cell crude extracts, the reaction was started by addition of 20 pi acetyl-CoA solution (20 mM). The absorption at 340 nm was recorded for 3 min in 3 s intervals on a SpectraMax M2e Multi-Mode Microplate Reader and the slope values were automatically calculated.
In order to validate the microtiter screening results, the 14 positive clones were cultivated at a larger scale and thiolase activities were spectrophotometrically determined in the cuvette format (Tabie III). None of the ThlAML'T variants exhibited an increased overall thiolase activity, but differences to ThlAWT were detected in the presence of 10-50 μΜ CoA-SH. Whereas 8 clones showed similar activities at various CoA-SH concentrations as the wiidtype ThIA, the clones 9G4, 13D7, 19C10, 21 B8, 25C8 and 28C9 revealed significantly
increased thiolase activities when CoA-SH was added to the assay (Table III). Subsequent DNA sequencing of the respective piasmids exhibited that all 6 positive clones had exactly the same genotype, indicating that in fact only one novel ThIAHLJT variant was isolated. Basically, the 8 independently identified hits confirmed the reliability of the screening procedure to find improved thiolase mutants. Thus, done 9G4 was chosen as a representative for subsequent experiments and was referred to as £ coli BL21 (DE3) pASK- IBA3::t«AOPT.
Table HI, Thiolase activities of putative positive ciones identified in the E. co!i BL21 (DE3) pASK-JBA3::fM4MlJT library screening.
ThIA Thiolase activity in the presence of free CoA-SH arrant Q μΜ ιο μΜ 20 pM 30 pM 40 μΜ 50 μΜ wiidtype 68,96 ± 25.80 ± 8.44 ± 0.67 1.30 ± 0.03 0.28 + 0.03 0.1.1 + 0.03
1.54 0.84
7D5 69.80 ± 26.23 ± 8.54 ± 0.13 1.33 ± 0.08 0.29 ± 0.04 0.13 + 0.01
3.41 1 .58
9G4 69.19 ± 34.60 ± 17.23 ± 9.83 + 0.25 2.06 ± 0.10 1.18 ± 0.08
0.55 1.67 1 .06 1 B9 69.39 ± 24.81 ± 8.38 ± 0.08 1 .22 ± 0.04 0.30 ± 0.05 0.10 ± 0.03
2.01 0.58
12B8 69.50 ± 25.23 ± 8.52 ± 0.09 1.30 ± 0.12 0.27 ± 0.03 0.1 1 ± 0.03
1.37 0.23
13D7 88.94 ± 36.45 ± 17.28 ± 1 1 .87 ± 1.98 ± 0.17 1 .17 ± 0.07
0.89 0.68 0.57 0.08
17C5 70.1 1 ± 24.58 ± 8.30 ± 0.41 1.06 ± 0.04 0.32 + 0.02 0.13 ± 0.02
1.27 0.77
19C10 69.76 + 37.89 ± 18.57 + 10.52 ± 1.86 ± 0.76 1.43 + 0.09
0.90 0.53 0.58 0.28
21 B8 68.72 ± 34.13 ± 16.79 ± 1 1.32 ± 2.37 ± 0.09 1.38 ± 0.15
0.12 1.06 0.43 0.20
8,4? ± 0,0'9 3,76 ± 4.83 0.32 ± 0,05 0.13 + 0.02
17.33 ± 9.95 ± 0.77 2.12 + 0.18 1.34 ± 0.19 0.53
8.90 ± 0.73 1 .02 ± 0.08 0.37 ± 0.02 0.15 ± 0.01
8.42 ± 0.30 1.12 ± 0.03 0.31 ± 0.05 0.14 ± 0.00
20.73 ± 9.83 ± 0.33 2.00 + 0.17 0.01 ± 1.23 4.51
8.41 ± 0.01 1 .32 ± 0.20 0.29 ± 0.04 0.12 ± 0.01
Example 5: Fermentation experiments for solvent production
Cultivation experiments of recombinant C. acetobutyiicum were performed in 200 ml S-MES comprising 40 pg/mt erythromycin as described previously in detail (Lehmann et al. 2012a; Lehmann and Lutke-Eversloh 201 1 ; Lehmann et al. 2012b), Samples were regulariy drawn to determine the pH with a pH meter (Wissenschaftlich-Technische Werkstatten
GmbH, Weilheim, Germany) and the Optical Density at 600 nm in a spectrophotometer (Zeiss Spekoi 1 100 photometer, Analytik Jena AG, Jena, Germany) using 1.5-ml plastic cuvettes with a light path of 1 cm. Cell-free supernatant samples were stored at -20°C until quantification of glucose (Bergmeyer 1983) and fermentation products. Acetate, butyrate, acetone, ethanol and butanol were determined according to Thormann et al. (Thormann et al. 2002) on an Agilent 7890A gas chromatograph (Agilent Technologies, Bob!ingen, Germany) equipped with a Chromosorb 101 (80/100 mesh, 2.0 m x 3.0 mm x 1.6 mm) glass column.
When the protein shown as SEQ ID NO; 2 was recombinantly expressed in the C. acetobutyiicum, the following results were obtained; In addition to a dearly delayed ethanol and aceton formation, the ethanol titer was increased by 46%. Butanol titer was increased by 18%, while the final acetone concentrations were similar to the vector control strain.
Protein sequences shown in the sequence listing
SEQ ID NO: 1 : Thi Wild type (Clostridium acetobutylicum)
SEQ ID NO: 2: Th!0PT
SEQ ID NO: 12: Nucleic acid encoding polypeptide of SEQ ID NO: 1
SEQ ID NO: 1 3: Nucleic acid encoding polypeptide of SEQ ID NO: 2
Further oligonucleotide sequences shown in the sequence listing are also listed in Table I,
REFERENCES CITED I THE DESCRIPTION PATENT DOCUMENTS CITED IN THE DESCRIPTION
US 4,757,010 Production of Clostridium acetobutylicum mutants of high butanol and acetone productivity, the resultant mutants and the use of these mutants in the joint production of butanol and acetone
US 8,358,717 Method of producing butanol using a mutant strain of Clostridium beijerinckii
US 201 1 /0027845 A1 , Enhanced ethanol and butanol producing microorganisms and method for preparing ethanol and butanol using the same
US0201 10281313 A1 , Improved production of acid and solvent in microorganisms
CN00010142381 3B Recombinant Clostridium and construction method and use thereof
NON-PATENT LITERATURE CITED IN THE DESCRIPTION
Durre P. 1998. New insights and novel developments in clostridial
acetone/butanol/isopropanol fermentation. Appl Microbiol Biotechno! 49:639-648. Durre P. 201 1 . Fermentative production of butanol - the academic perspective. Curr Opin
Biotechnol 22:331 -336,
Fischer RJ , Oehmcke S, Meyer U, Mix M, Schwarz K, Fiedler T, Bahl H. 2006. Transcription of the pst operon of Clostridium acetobutylicum is dependent on phosphate concentration and pH. J Bacteriol 188:5469-5478.
Hartmanls MG , Gatenbeck S, 1984. Intermediary metabolism in Clostridium acetobuiylicum: Levels of enzymes involved in the formation of acetate and butyrate.
Appl Environ Microbiol 47:1277-1283.
Haywood GW, Anderson AJ, Chu L, Dawes EA. 1988. The role of NADH- and NADPH-linked acetoacetyi-CoA reductases in the poly-3-hydroxybutyrate synthesizing organism
Alcaltgenes eutrophus. FE S Microbiol Lett 52:259-284.
Lee SY, Park JH, Jang SH, Nielsen LK, Kim J, Jung KS. 2008. Fermentative butanol
production by Clostridia. Biotechnol Bioeng 101 :209-228.
Lehmann D, Honicke D, Ehrenreich A, Schmidt M, Weuster-Botz. D, Bahl H, Lutke-Eversloh
T. 2012a. Modifying the product pattern of Clostridium acetobutylicum: Physiological effects of disrupting the acetate and acetone formation pathways. Appl Microbiol
Biotechnol 94:743-754.
Lehmann D, Lutke-Eversloh T. 201 1. Switching Clostridium acetobuiylicum to an ethanol producer by disruption of the butyrate/butanol fermentative pathway, etab Eng
13:464-473.
Lehmann D, Radomski N, Lutke-Eversloh T. 2012b. New insights into the butyric acid
metabolism of Clostridium acetobuiylicum, Appl Microbiol Biotechnol, in press.
Papoutsakis ET. 2008. Engineering solventogenic Clostridia. Curr Opin Biotechnol 19:420-
429.
Riebe O, Fischer RJ, Wampler DA, Kurtz DM, Jr., Bahl H. 2009. Pathway for H202 and 02 detoxification in Clostridium acetobuiylicum. Microbiology 155:16-24.
Sambrock J, Russe!l DW. 2001 . Molecular Cloning: A Laboratory Manual, 3rd Ed. Cold
Spring Harbor Laboratory Press, NY, USA.
Sillers R, Ai-Hinai MA, Papoutsakis ET. 2009. Aldehyde-alcohol dehydrogenase and/or thiolase overexpression coupled with CoA transferase downregulation lead to higher alcohol titers and selectivity in Clostridium acetobuiylicum fermentations. Biotechnol Bioeng 102:38-49.
Sillers R, Chow A, Tracy B, Papoutsakis ET. 2008, Metabolic engineering of the non- sporuiating, non-solventogenic Clostridium aceiobutylicum strain M5 to produce butanol. without acetone demonstrate the robustness of the acid -formation pathways and the importance of the electron balance, Metab Eng 10:321-332.
Thormann K, Feustei L, Lorenz K, Nakotte S, Diirre P. 2002. Control of butanol formation in Clostridium aceiobutylicum by transcriptional activation. J Bacterid 184(7):1966- 1973.
Wiesenborn et a!., , 1998, Appl, Environ. Microbiol, 54:1 1 , p. 2717-2722.
Claims
[I] A process for producing a chemical using an acetoacetyl-CoA-dependent metabolic pathway which has a thiolase activity with higher specific activity and/or reduced sensitivity towards the inhibitor coenzyme A compared to the activity and sensitivity of the polypeptide having SEQ ID NO: 1 , wherein the thiolase is a mutant protein having at least one mutation into the CoA-SH binding loop domain with respect to the parental wildtype enzyme, and wherein the determination of thiolase activity is performed by a 3-hydroxybutyyl-CoA dehydrogenase-coupied spectrophotometry assay.
[2] The process of claim 1 , wherein the thiolase has 5% or higher, preferably 10% or higher, more preferably 20% or higher, even more preferably 30% or higher activity, as compared to the parental wildtype enzyme under physiological conditions.
[3] The process of any one of claim 1 or 2, wherein activity of said thiolase is not inhibited by 10 μ CoA-SH.
[4] The process of any one of claims 1 -3, wherein said chemical is a C4 alcohol.
[5] The process of claim 4, wherein said chemical is butanol, preferably n-butanoi.
[6] The process of any one of claims 1 -5, wherein the production is done in a host cell belonging to the genus Clostridium,
[7] The process of ciaim 6, wherein such host cell belongs to one of the following species:
C. acetobutylicum, C. beijerinckit, C. saccharoperbutylacetonicum, C. butyricum, C. pasteunanum, C. saccharobutyiicum, C. Ijungdahlii, C. thermocellum. C, thermobutyricum, C. celluiolyticum.
[8] The process of any one of claims 5-7, wherein butanoi is produced by non-natural butanol producing strains.
[9] The process of any one of claims 5-8, wherein butanol is produced by a strain belonging to the genus Escherichia, Bacillus, Lactobacillus. Pseudomonas, Ralstonia,
Saccharomyces,
[10] The process of any one of claims 5-9, wherein butanol is produced by a strain belonging to the species E. coli, B. subfilis, L. brevis, L. plantarum, P. putida, P. fluorescens, P. aeruginosa, R, eutropha, S. cerevisiae.
[II] A polypeptide having thiolase activity characterized in that it has 70 % or more, preferably 75 % or more, more preferably 80 % or more, more preferably 85 % or
more, more preferably 90 % or more, more preferably 95 % or more, such as 96 % or more, 97 % or more, 98 % or more, 99 % or more sequence identity with SEQ ID NO: 1 , provided that at least one, such as any combination of two, or all three of the residues 133, 156, 222 display a mutation (selected from substitution, deletion or insertion) with respect to SEQ ID NO: 1 .
The polypeptide of claim 1 1 wherein said mutation(s) selected from
• any one,
• any combination of two, and
• preferably all three (SEQ ID NO: 2}
of the following substitutions: R133G, H156N, G222V.
The process of any one of claim 1 to 10, characterized in that the thiolase activity is provided by the enzyme of any of claims 1 1 to 12.
A nucleic acid encoding a polypeptide selected from the group consisting of (a) the polypeptide of any one of claims 1 1 or 12 and (b) the enzyme having the thiolase activity defined in any one of claims 1 to 10.
A vector comprising the nucleic acid of claim 14,
A host cell carrying the nucleic acid of claim 14 or the vector of claim 15.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DE112013003420.4T DE112013003420T5 (en) | 2012-07-06 | 2013-07-05 | Modified Clostridium strain for butanol production |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP12175385 | 2012-07-06 | ||
| EP12175385.9 | 2012-07-06 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2014006203A1 true WO2014006203A1 (en) | 2014-01-09 |
Family
ID=48748233
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2013/064302 Ceased WO2014006203A1 (en) | 2012-07-06 | 2013-07-05 | Engineered clostridium strain for butanol production |
Country Status (2)
| Country | Link |
|---|---|
| DE (1) | DE112013003420T5 (en) |
| WO (1) | WO2014006203A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017114897A1 (en) * | 2015-12-29 | 2017-07-06 | Repsol, S.A. | Modified thiolases capable of producing branched compounds and uses thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008072920A1 (en) * | 2006-12-15 | 2008-06-19 | Biofuelchem Co., Ltd. | Method for preparing butanol through butyryl-coa as an intermediate using bacteria |
| US20120088281A1 (en) * | 2010-10-11 | 2012-04-12 | Postech Academy-Industry Foundation | Thiolase with Improved Activity and Method of Producing Biobutanol Using the Same |
-
2013
- 2013-07-05 DE DE112013003420.4T patent/DE112013003420T5/en not_active Ceased
- 2013-07-05 WO PCT/EP2013/064302 patent/WO2014006203A1/en not_active Ceased
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008072920A1 (en) * | 2006-12-15 | 2008-06-19 | Biofuelchem Co., Ltd. | Method for preparing butanol through butyryl-coa as an intermediate using bacteria |
| US20120088281A1 (en) * | 2010-10-11 | 2012-04-12 | Postech Academy-Industry Foundation | Thiolase with Improved Activity and Method of Producing Biobutanol Using the Same |
Non-Patent Citations (7)
| Title |
|---|
| DATABASE UniProt [online] 5 October 2010 (2010-10-05), "SubName: Full=Acetyl-CoA acetyltransferase; EC=2.3.1.9;", XP002687427, retrieved from EBI accession no. UNIPROT:D9TPZ6 Database accession no. D9TPZ6 * |
| GITTE MERILÄINEN ET AL: "The sulfur atoms of the substrate CoA and the catalytic cysteine are required for a productive mode of substrate binding in bacterial biosynthetic thiolase, a thioester-dependent enzyme", FEBS JOURNAL, vol. 275, no. 24, 4 December 2008 (2008-12-04), pages 6136 - 6148, XP055085766, ISSN: 1742-464X, DOI: 10.1111/j.1742-4658.2008.06737.x * |
| KURSULA P ET AL: "High Resolution Crystal Structures of Human Cytosolic Thiolase (CT): A Comparison of the Active Sites of Human CT, Bacterial Thiolase, and Bacterial KAS I", JOURNAL OF MOLECULAR BIOLOGY, ACADEMIC PRESS, UNITED KINGDOM, vol. 347, no. 1, 18 March 2005 (2005-03-18), pages 189 - 201, XP004759229, ISSN: 0022-2836, DOI: 10.1016/J.JMB.2005.01.018 * |
| RYAN SILLERS ET AL: "Aldehyde-alcohol dehydrogenase and/or thiolase overexpression coupled with CoA transferase downregulation lead to higher alcohol titers and selectivity in Clostridium acetobutylicum fermentations", BIOTECHNOLOGY AND BIOENGINEERING, vol. 102, no. 1, 1 January 2009 (2009-01-01), pages 38 - 49, XP055044193, ISSN: 0006-3592, DOI: 10.1002/bit.22058 * |
| TAKAGI H ET AL: "Overproduction of L-cysteine and L-cystine by expression of genes for feedback inhibition-insensitive serine acetyltransferase from Arabidopsis thaliana in Escherichia coli", FEMS MICROBIOLOGY LETTERS, NO LONGER PUBLISHED BY ELSEVIER, vol. 179, no. 2, 15 October 1999 (1999-10-15), pages 453 - 459, XP027360481, ISSN: 0378-1097, [retrieved on 19991015] * |
| WIESENBORN D P ET AL: "Thiolase from Clostridium acetobutylicum ATCC 824 and Its Role in the Synthesis of Acids and Solvents.", APPLIED AND ENVIRONMENTAL MICROBIOLOGY NOV 1988, vol. 54, no. 11, November 1988 (1988-11-01), pages 2717 - 2722, XP055086063, ISSN: 0099-2240 * |
| YONGHONG MENG ET AL: "Cloning, Expression and Characterization of a Thiolase Gene from Clostridium pasteurianum", BIOTECHNOLOGY LETTERS, SPRINGER NETHERLANDS, DORDRECHT, vol. 28, no. 16, 27 June 2006 (2006-06-27), pages 1227 - 1232, XP019391576, ISSN: 1573-6776, DOI: 10.1007/S10529-006-9089-4 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017114897A1 (en) * | 2015-12-29 | 2017-07-06 | Repsol, S.A. | Modified thiolases capable of producing branched compounds and uses thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| DE112013003420T5 (en) | 2015-04-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Mann et al. | Thiolase engineering for enhanced butanol production in Clostridium acetobutylicum | |
| EP2222841B1 (en) | Ketol-acid reductoisomerase using nadh | |
| Garg et al. | Bioconversion of methane to C-4 carboxylic acids using carbon flux through acetyl-CoA in engineered Methylomicrobium buryatense 5GB1C | |
| CA3151146C (en) | Genetically engineered bacterium comprising energy-generating fermentation pathway | |
| KR102390716B1 (en) | Genetically engineered microorganisms for production of chorismate-derived products | |
| US8945899B2 (en) | Ketol-acid reductoisomerase using NADH | |
| Saunders et al. | Triacetic acid lactone production in industrial Saccharomyces yeast strains | |
| Liao et al. | Improving cellular robustness and butanol titers of Clostridium acetobutylicum ATCC824 by introducing heat shock proteins from an extremophilic bacterium | |
| Adeboye et al. | ALD5, PAD1, ATF1 and ATF2 facilitate the catabolism of coniferyl aldehyde, ferulic acid and p-coumaric acid in Saccharomyces cerevisiae | |
| JP2011500031A (en) | Microorganisms engineered to produce isopropanol | |
| US20160024532A1 (en) | Atp driven direct photosynthetic production of fuels and chemicals | |
| TWI659104B (en) | Enzyme-altered metabolite activity | |
| WO2014006203A1 (en) | Engineered clostridium strain for butanol production | |
| TWI811184B (en) | Genetically engineered bacterium comprising energy-generating fermentation pathway | |
| Wang et al. | Metabolic engineering of Clostridium tyrobutyricum for hexanoic acid and hexanol production | |
| Okonkwo et al. | Molecular inactivation of exopolysaccharide biosynthesis in Paenibacillus polymyxa DSM 365 for enhanced 2, 3-butanediol production | |
| Spencer | Metabolic engineering of the thermophile Geobacillus to produce the advanced biofuel N-butanol | |
| Tollin | The characterization of Clostridium beijerinckii NRRL B592 cells transformed with plasmids containing the butanol-production genes under the control of constitutive promoters | |
| EA043734B1 (en) | GENETICALLY ENGINEERED BACTERIA CONTAINING AN ENERGY-GENERATING ENZYMATIVE PATHWAY |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13734755 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1120130034204 Country of ref document: DE Ref document number: 112013003420 Country of ref document: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 13734755 Country of ref document: EP Kind code of ref document: A1 |