WO2013189047A1 - Identification de microarn végétal et son application - Google Patents

Identification de microarn végétal et son application Download PDF

Info

Publication number
WO2013189047A1
WO2013189047A1 PCT/CN2012/077234 CN2012077234W WO2013189047A1 WO 2013189047 A1 WO2013189047 A1 WO 2013189047A1 CN 2012077234 W CN2012077234 W CN 2012077234W WO 2013189047 A1 WO2013189047 A1 WO 2013189047A1
Authority
WO
WIPO (PCT)
Prior art keywords
mir
plant
microrna
probe
gene
Prior art date
Application number
PCT/CN2012/077234
Other languages
English (en)
Chinese (zh)
Inventor
张辰宇
曾科
张琳
梁湘樱
陈熹
朱凌云
Original Assignee
南京大学
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 南京大学 filed Critical 南京大学
Priority to PCT/CN2012/077234 priority Critical patent/WO2013189047A1/fr
Publication of WO2013189047A1 publication Critical patent/WO2013189047A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]

Definitions

  • the invention belongs to the field of biology, and in particular relates to the identification and application of functional plant microRNAs. Background technique
  • MicroRNAs are a class of evolutionarily conserved non-coding single-stranded small RNA molecules of about 19 to 23 nucleotides in length.
  • the tiny ribonucleic acid can completely pair with the target mRNA, mediate the degradation of the target mRNA or inhibit the translation of the protein encoded by the target mRNA, and act as a gene expression regulator to regulate gene expression at the post-transcriptional level.
  • microRNAs play a very important role in the regulation of the developmental timing of organisms and the occurrence of diseases.
  • MicroRNAs can control cell growth, differentiation, and apoptosis, and participate in many normal physiological activities, such as biological individual development, tissue differentiation, apoptosis, and energy metabolism. Meanwhile, microRNA expression is associated with cancer, and in tumors. It plays an important role in the formation process. About half of the micro-ribonucleotide upstream genes are located in the tumor-associated regions of the chromosome, and can play both oncogenes and tumor suppressor genes in the development and progression of tumors.
  • up-regulated microRNAs in tumor tissues may act as an oncogene, and the expression of down-regulated microRNA may act as a tumor suppressor gene.
  • MicroRNAs are not degraded by endogenous ribonuclease, are present in body fluids, especially in human serum, and their expression levels are sufficient for clinical testing. Therefore, specific microRNA molecules can help reveal The regulation mechanism of gene expression, and help prevent and treat human diseases, determine clinical pathological features and predict disease recurrence.
  • MicroRNAs are widely distributed in plant genomes. Numerous microRNAs have been found in Arabidopsis, rice, maize, sorghum, sugarcane, and bryophytes, and animal microRNAs have no open reading frame, showing evolutionary Conservative, with higher complementarity to its target gene sequence.
  • the binding site of the plant microRNA to the target gene is not limited to the 3' untranslated region (UT) of the target gene, but may also be located in the transcription region.
  • Plant microRNAs are a class of negative regulators of eukaryotic gene expression, which regulate the expression of plant genes by mediating the cleavage of mRNA target molecules or reducing the translation of target molecules at the post-transcriptional level, thereby regulating the morphogenesis of plant organs. Growth and development, hormone secretion and signal transduction, and the ability of plants to respond to external environmental stress factors.
  • microRNAs The foods ingested by humans and animals contain various plant microRNAs. When the animals ingest the food, whether the microRNAs of these plants absorb passive objects and affect the physiological state of the human body (such as regulating target genes), how to identify the ingested animals MicroRNAs in vivo are microRNAs that can regulate target genes, or how to screen microRNAs that affect animals. There are no reports yet. Summary of the invention
  • One of the objects of the present invention is to provide a method of screening functional plant microRNAs which are stably present in an animal body such as a circulatory system and which can be detected.
  • a method for identifying a functional plant microRNA comprising the steps of: (a) providing a test sample from a test subject ingesting a certain plant;
  • the method further comprises the steps of: (e) feeding the functional plant microRNA to the test subject, and observing physiological, physical, and/or pathological changes associated with the target gene in the subject, thereby determining A functional plant microRNA that can affect a certain physiological, physical, and/or pathological change.
  • the detection in the step (b) comprises: Real-time PCR, microarray chip, Solexa Sequencing, in situ hybridization, Northern Blotting, constant temperature rolling circle amplification, conjugated polymer-based miRNA Detection.
  • the sample comprises: a blood sample, a serum sample or a body fluid sample.
  • the gene comprises: a human gene or a gene that infects a human pathogen.
  • the gene comprises: a metabolic disease-related gene, a cardiovascular disease-related gene, an immune system disease-related gene, a cancer-related gene, a dysplasia-related gene, a central nervous system disease-related gene, a tumor-associated gene, Acute and chronic infectious diseases related genes, other acute and chronic diseases related genes, blood and hematopoietic diseases related genes, circulatory diseases related genes, endocrine system metabolic diseases related genes, digestive system disease related genes, nervous system disease related genes, urinary systems Disease-related genes, genes related to reproductive system diseases or diseases related to diseases of the motor system;
  • the acute and chronic infectious diseases include: viral diseases (such as viral influenza, viral hepatitis, AIDS, SARS, etc.), bacterial diseases (such as tuberculosis, bacterial pneumonia, etc.), and other pathogenic microorganisms
  • viral diseases such as viral influenza, viral hepatitis, AIDS, SARS, etc.
  • bacterial diseases such as tuberculosis, bacterial pneumonia, etc.
  • other acute and chronic diseases include: respiratory diseases, immune system diseases, and the like.
  • the circulatory system diseases include cardiovascular and cerebrovascular diseases and the like.
  • the gene comprises: a viral gene, a Chlamydia gene, a Rickettsia gene, a Mycoplasma gene, a bacterial gene or a spirochete gene.
  • the method further comprises comparing the detected plant microRNA level Lm with an average level La of the plant microRNA, and selecting Lm/La ⁇ 130% (preferably ⁇ 150%, more preferably ⁇ 200%, optimally ⁇ 250%) of plant microRNA species.
  • the plant microRNA comprises all of the microRNAs in the plant, or microRNAs present in the plant and present at detectable levels in the sample.
  • the plant microRNA detected in the sample as described in step (c) is a plant microRNA species having a higher level in the sample than the control level.
  • control level is the average concentration of total microRNA of the plant in the sample.
  • test subject in step (a) ingests a plant plant or an edible part thereof or an extract thereof.
  • the edible portion comprises: roots, stems, leaves, flowers, fruits, shoots, seeds, or a combination thereof.
  • the extract is an extract of the following: roots, stems, leaves, flowers, fruits, shoots, seeds, or a combination thereof.
  • the plant comprises: Gramineae, Camphoraceae, Compositae, Labiatae, Liliaceae, Amaryllidaceae, Comfrey, Araceae, Umbelliferae, Cruciferae, Primula Branch, Polygonaceae, Polygonaceae, Dianthus, Dioscorea, Castor, Plantain, Arbutaceae, Moraceae, Cannabis, Saxifragaceae, Leguminosae, Fernaceae, Amaranthaceae, Silver Tooth Lettuce, Polygonaceae, Fagaceae, Chlorella, Tea, Rubiaceae, Sycamore, Pine, Cucurbitaceae, Rhizoma, Podocarpaceae, Birch, Walnut, Piper, Magnoliaceae , Phytophthora, fungus, Tricholoma, Agaricaceae, Russula, Rhododendron, Rosaceae, Actinidia, Apricotacea
  • the plant is lettuce, rice, wheat, corn, peanut, sorghum, soybean, potato, buckwheat, alfalfa, alfalfa, pepper, star anise, fennel, peach, apricot, pear, apple, banana, monkey Head, fungus, yam, hawthorn, ginseng, angelica, tomato, pepper, eggplant, carrot, kale, broccoli, Chinese cabbage, Chinese cabbage, rapeseed, spinach, mustard greens, peas, squash, cucumber, watermelon, melon, stone cypress, onion, or a combination thereof.
  • a functional plant microRNA identified by the method of the first aspect of the invention.
  • a functional plant microRNA identified by the method of the first aspect of the invention for the preparation of a composition for regulating an animal (e.g., human) target gene, or for detecting a post-feeding A reagent or kit or biochip for plant microRNA levels in an animal.
  • the composition comprises: a pharmaceutical composition, a food composition or a health care product.
  • the functional plant microRNA (i) modulates expression of a functional plant microRNA target gene in an animal, or (ii) ameliorates or treats a functional plant microRNA target gene associated disease.
  • the functional plant microRNA target gene comprises an animal gene.
  • the disease comprises: a tumor, an acute or chronic infectious disease or other acute and chronic diseases; wherein the acute and chronic infectious diseases comprise diseases selected from the group consisting of: viral acute and chronic infectious diseases, bacterial acute diseases Acute and chronic infectious diseases caused by chronic infectious diseases and pathogenic microorganisms;
  • the other acute and chronic diseases include diseases selected from the group consisting of respiratory diseases, immune system diseases, blood and hematopoietic diseases, circulatory diseases, endocrine system metabolic diseases, digestive diseases, nervous system diseases, urinary diseases , reproductive system diseases and sports system diseases.
  • the viral acute and chronic infectious disease comprises a disease selected from the group consisting of: viral influenza, viral hepatitis, AIDS, SARS, and the like; the bacterial acute and chronic infectious disease includes a The following group of diseases: tuberculosis, bacterial pneumonia.
  • the circulatory system diseases include cardiovascular and cerebrovascular diseases and the like.
  • kits or biochip useful for detecting a functional plant microRNA the kit or biochip for detecting the type and/or level of a plant microRNA in an animal after ingesting the plant ;
  • the kit or biochip comprises some or all of the probes shown in Table 1 (SEQ ID NO: 1
  • the kit comprises a probe for the functional plant microRNA, a primer for the functional plant microRNA or other reagent capable of detecting the plant microRNA.
  • the biochip comprises a probe for the functional plant microRNA.
  • Figure 1 shows the results of Solexa sequencing of plant microRNA in normal Chinese serum. The microRNA content of each plant was normalized to the total mammalian microRNA content.
  • Figure 2 shows the results of Solexa sequencing of plant microRNAs in different organ tissues of mice.
  • Organ tissues detected include heart, liver, spleen, lung, kidney, stomach, small intestine, and brain.
  • Figure 3 shows the results of Real-time PCR of plant microRNAs in various mammalian sera. Animal endogenous microRNAs, miR-16 and miR-25 were used as controls.
  • Figure 4 shows Real-time PCR results of plant microRNA expression in fresh rice, Chinese cabbage, wheat, potato and cooked food.
  • Figure 5 shows synthetic microRNAs (synthetic MIR-156a, MIR-168a and miR-16), microRNA in rice (MIR-156a and MIR-168a) or microRNA in mouse liver at different time points of acidification ( miR-16) Real-time PCR results for expression levels.
  • the treatment conditions were as follows: pH 2.0, 37 °C, respectively, 0h, lh, 3h, 6h.
  • There are 6 sets of column diagrams in Figure 5 (MIR-156a group and its corresponding rice group; MIR-168a group and its corresponding rice group; and miR-16 group and its corresponding liver group), the column shape of each group The figure is 0h, lh, 3h, 6h from left to right.
  • Figure 6 shows Real-time PCR results of the expression levels of plant microRNAs in serum and liver at different times after feeding fresh rice or feed.
  • Figure 6A is a Real-time PCR result of the expression level of plant microRNA in feed and fresh rice. Animal endogenous miR-16 and miR-150 were used as controls.
  • Figure 6B is a Real-time PCR result of serum microRNA expression in serum at different time points after feeding fresh rice or feed. The detection time was 0.5h, 3h, 6h after feeding.
  • Figure 6C is a Real-time PCR result of the expression levels of plant microRNAs in the liver at different times after feeding fresh rice or feed. The detection time was 0.5h, 3h, 6h after feeding.
  • Fig. 6B and Fig. 6C show mice killed immediately after starvation for 12 hours (Oh group) as a positive control.
  • Figure 7 is a hypothetical schematic diagram showing the binding of plant MIR-168a to the fourth exon of LDL AP1.
  • Black ellipses and G:U indicate paired bases. The more paired bases, the higher the degree of binding.
  • Figure 8 shows the results of Real-time PCR of plant microRNA in HepG2 cells transfected with pre-MIR168a.
  • Figure 9 shows the results of Western blot of LDL AP1 protein in HepG2 cells transfected with pre-MIR168a.
  • Figure 9A is a Western blot analysis of LDLRAP 1 protein in HepG2 cells transfected with pre-MIRl 68a.
  • Figure 9B is a Western blot quantitative result of Figure 9A. Both Fig. 9A and Fig. 9B use pre-ncRNA as a positive control.
  • Figure 10 shows the results of Real-time PCR of cell microparticles and HepG2 cells after transfer of plant microRNA into human intestinal epithelial cells Caco-2, collection of transfected cell microparticles, and HepG2 cells. Transfection of ncRNA was used as a positive control.
  • Figure 11 shows the results of Western blot of LDLRAP 1 protein in HepG2 cells transfected with pre-MIRl 68a.
  • Figure 11A is a Western blot analysis of LDL AP1 protein in HepG2 cells transfected with pre-MIR168a.
  • Figure 1 IB is the Western blot quantitative result of Figure 11A.
  • Fig. 11A and Fig. 11B used HepG2 cells which were not treated as a positive control.
  • Figure 12 shows the expression levels of plant microRNA, LDL AP low-density lipoprotein cholesterol in the liver when mice were fed fresh rice or feed.
  • Figure 12A is a Real-time PCR result of MIR-168a expression in the liver by feeding fresh rice or feed to mice.
  • Figure 12B shows the results of Western blot analysis of LDLRAP1 in the liver by feeding fresh rice or feed to mice.
  • Figure 12C is a Western blot quantitative result of Figure 12B.
  • Figure 12D is the expression level of low density lipoprotein cholesterol in the liver when fresh rice or feed is fed to mice.
  • Figure 13 shows the expression levels of plant microRNA, LDLRAP low density lipoprotein cholesterol in the liver after 3 days of feeding different foods in mice.
  • Figure 13A is a Real-time PCR result of the amount of plant microRNA expressed in the liver by feeding fresh rice or feed to mice.
  • Figure 13B shows the results of Western blot analysis of LDLRAP1 in mouse liver 3 days after mice were fed different foods.
  • Figure 13C is a result of Western blot quantitative analysis of Figure 13B.
  • Figure 13D shows the expression level of low density lipoprotein cholesterol in the liver 3 days after the mice were fed different foods.
  • MIR-168a used in the present invention can also be expressed by “MIR168a”
  • MIR-156a can also be represented by “MIR156a”
  • MI-166a can also be represented by “MIR166a”.
  • the present inventors have unexpectedly discovered a method for identifying functional plant microRNAs which are stably present in an animal (e.g., in a circulating system) and which are capable of detecting and efficiently regulating related target genes.
  • the method can effectively screen out functional plant microRNAs, thereby facilitating the application of functional plant microRNAs in balanced diet, drug screening, drug efficacy evaluation, diet therapy and regulating physiological and pathological state, on the basis of which the inventor The present invention has been completed.
  • the term "functional plant microRNA target gene” or "target gene” refers to a gene whose expression is regulated by the plant microRNA (as follows) in an animal.
  • the present inventors conducted research on the identification and application of plant microRNAs, and first discovered that microRNAs of common food crops such as rice and cruciferous plants exist in the blood of mammals of humans and other feeding plants. By verifying that plant microRNAs are sufficiently stable to withstand extreme conditions such as food processing and the gastrointestinal acid-base environment, the inventors have demonstrated that plant microRNAs can be directly introduced into animals by ingestion.
  • microRNAs derived from plants can directly participate in the physiological and pathological activities of animals, and certain microRNAs can regulate (e.g., inhibit) the expression of one or more genes in an animal, thereby affecting certain physiological or pathological states.
  • the inventors Based on the screening method of the present invention and the selected plant functional plant microRNA, the inventors established a new method for guiding dietary balance, plant drug evaluation and screening, and regulating physiological and pathological conditions.
  • microRNA content in human and animal serum is used to guide dietary balance and optimize diet structure; to evaluate and screen drugs by detecting and analyzing functional microRNAs in plant drugs; to prepare new therapeutic plants by enriching functional plant microRNAs , used to regulate physiological and pathological conditions, to achieve the effect of prevention and adjuvant treatment of diseases.
  • the "functional plant microRNA” as used in the present invention refers to all mature plant microRNAs which are stably present in an animal (e.g., in the circulatory system or serum) and which efficiently regulate the microRNA target gene.
  • the functional plant microRNA may comprise all plant microRNAs that are stably present and detectable in the serum of an animal (eg, human, etc.), preferably including the microRNAs in the following group: MIR-156a, MIR-156b, MIR-156c, MIR-156d , MIR-156e, MIR-156f, MIR-156g, MIR-156h, MIR-156i, MIR-156j,
  • the invention provides a method for identifying a functional plant microRNA, comprising the steps of:
  • the sample comprises: a blood sample, a serum sample, or a body fluid sample.
  • the plant comprises: Gramineae, Camphoraceae, Compositae, Labiatae, Liliaceae, Amaryllidaceae, Comfrey, Araceae, Umbelliferae, Cruciferae, Primula Branch, Polygonaceae, Polygonaceae, Dianthus, Dioscorea, Castoraceae, Plantainaceae, Myrica rubra, Moraceae, Cannabisaceae, Saxifragaceae, Rosaceae, Leguminosae, Fernaceae, Amaranth Branch, Silver-toothed Lettuce, Polygonaceae, Fagaceae, Chlorella, Tea, Rubiaceae, Sycamore, Pine, Cucurbitaceae, Rhizoma, Podocarpaceae, Birch, Walnut, Piper , Magnoliaceae, Dentalaceae, Fungi, Tricholoma, Agaricaceae, Russula, Rhododendron
  • the plant is lettuce, rice, wheat, corn, peanut, sorghum, soybean, potato, buckwheat, alfalfa, alfalfa, pepper, star anise, fennel, peach, apricot, pear, apple, banana, monkey Head, fungus, yam, hawthorn, ginseng, angelica, tomato, pepper, eggplant, carrot, kale, broccoli, chinese cabbage, cabbage, rapeseed, spinach, mustard, peas, pumpkin, cucumber, watermelon, melon, stone cypress, Onions, or a combination thereof.
  • test subject in step (a) ingests a plant plant or an edible part thereof or an extract thereof.
  • the edible portion comprises: roots, stems, leaves, flowers, fruits, shoots, seeds, or a combination thereof.
  • the extract is an extract of the following: roots, stems, leaves, flowers, fruits, shoots, seeds, or a combination thereof.
  • the detection in the step (b) comprises: Real-time PCR, microarray chip, Solexa Sequencing, in situ hybridization, Northern Blotting, constant temperature rolling circle amplification, conjugated polymer-based miRNA Detection.
  • step (b) the method further comprises comparing the detected plant microRNA level Lm with an average level La of the plant microRNA, and selecting Lm/La ⁇ 130% (preferably ⁇ 150%, more preferably ⁇ 200%, optimally ⁇ 250%) of plant microRNA species.
  • the plant microRNA comprises all of the microRNAs in the plant, or microRNAs present in the plant and present at detectable levels in the sample. (c) aligning the sequence of the plant microRNA detected in the sample with a candidate target gene to determine whether the plant microRNA regulates the target gene, or performing the sequence and the genes in the gene database Aligning, thereby determining a target gene regulated by the plant microRNA; wherein the target gene is selected from the group consisting of: a mammalian gene, a gene that infects a mammalian pathogen;
  • the gene includes a human gene or a gene that infects a human pathogen.
  • the gene comprises: the gene comprises: a metabolic disease-related gene, a cardiovascular disease-related gene, an immune system disease-related gene, a cancer-related gene, a dysplasia-related gene, and a central nervous system disease-related gene.
  • the acute and chronic infectious diseases include: viral diseases (eg, viral influenza, viral hepatitis, AIDS, SARS, etc.), bacterial diseases (eg, tuberculosis, bacterial pneumonia, etc.), and others Acute and chronic infectious diseases caused by pathogenic microorganisms.
  • the other acute and chronic diseases include: respiratory diseases, immune system diseases, and the like.
  • the circulatory system diseases include cardiovascular and cerebrovascular diseases and the like.
  • the gene comprises: a viral gene, a Chlamydia gene, a Rickettsia gene, a Mycoplasma gene, a bacterial gene or a spirochete gene.
  • the plant microRNA detected in the sample as described in step (c), is significantly higher than the control level.
  • control level is the average concentration of total microRNA of the plant in the sample.
  • the method further comprises the step of: (e): feeding the functional plant microRNA to a test subject, and observing physiological, physical, and/or pathological changes associated with the target gene in the subject, thereby determining a significant influence A functional plant microRNA of a certain physiological, physical, and/or pathological change.
  • a functional plant microRNA identified by the methods of the present invention can be used to (i) modulate the expression of a functional plant microRNA target gene in an animal, or (ii) ameliorate or treat a disease associated with a functional plant microRNA target gene.
  • the functional plant microRNA target gene comprises an animal gene.
  • the disease comprises: a tumor, an acute or chronic infectious disease or other acute and chronic diseases; wherein the acute and chronic infectious diseases comprise diseases selected from the group consisting of: viral acute and chronic infectious diseases, bacterial acute diseases Acute and chronic infectious diseases caused by chronic infectious diseases and pathogenic microorganisms;
  • the other acute and chronic diseases include diseases selected from the group consisting of respiratory diseases, immune system diseases, blood and hematopoietic diseases, circulatory diseases, endocrine system metabolic diseases, digestive diseases, nervous system diseases, urinary diseases , reproductive system diseases and sports system diseases.
  • the viral acute and chronic infectious disease comprises a disease selected from the group consisting of: viral influenza, viral hepatitis, AIDS, SARS, and the like; the bacterial acute and chronic infectious disease includes a The following group of diseases: tuberculosis, bacterial pneumonia.
  • the circulatory system diseases include cardiovascular and cerebrovascular diseases and the like.
  • the functional plant microRNA can be used to prepare a composition (eg, a pharmaceutical composition, a food composition, or a health supplement) that modulates an animal (eg, human) target gene, or a reagent or reagent that detects the level of plant microRNA in an animal after ingestion of the plant.
  • a composition eg, a pharmaceutical composition, a food composition, or a health supplement
  • an animal eg, human
  • a reagent or reagent that detects the level of plant microRNA in an animal after ingestion of the plant.
  • a cassette the reagent or kit may comprise a probe for the plant microRNA, a primer or other reagent that detects the microRNA of the plant).
  • the present invention preferably provides and details the following uses of the functional plant microRNAs identified by the methods of the present invention:
  • the functional plant microRNA of the present invention can be used to evaluate the physiological and/or pathological state of an animal. Methods, the methods comprising determining the amount of a functional plant microRNA of the invention in an animal, including the circulatory system, whole body tissues and organs.
  • a functional plant microRNA according to the invention may be used for the preparation of a composition for modulating the physiological and/or pathological state of an animal, or for the preparation of a composition for regulating a target gene of an animal, such as a human, said composition comprising A functional plant microRNA according to the invention.
  • the composition may comprise: a pharmaceutical composition, a food composition or a health product.
  • a functional plant microRNA according to the invention for use in a method of modulating the physiological and/or pathological state of an animal, the method comprising regulating a functional plant of the invention by modulating the body of the animal, including the circulatory system, whole body tissues and organs
  • the microRNA content changes the expression level of the microRNA target gene, thereby regulating the physiological and/or pathological state of the animal.
  • the functional plant microRNA of the present invention can be used for the preparation of a kit for evaluating the physiological and/or pathological state of an animal, the kit comprising the invention for detecting the ingestion of plants (including circulatory system, whole body tissues and organs) of the present invention.
  • a tool for functional plant microRNAs Preferably, the kit may comprise one or more primers of the functional plant microRNA of the invention in the serum of an animal (eg human) for detecting the species or level of the functional plant microRNA in the animal. .
  • the functional plant microRNA of the present invention can be used to prepare a biochip for evaluating a physiological and/or pathological state of an animal, the biochip comprising a substance for detecting the in vivo (including circulatory system, whole body tissues and organs) of the animal after feeding the plant.
  • a probe for the functional plant microRNA of the invention may comprise a probe for detecting a functional plant microRNA of the invention in an animal serum for detecting the species or level of the functional plant microRNA in the animal.
  • the probe of the present invention is preferably all or part of the probes shown in Table 1, preferably 5, 10, or 20.
  • probe-MIR-156a MR-156a GTGCTCACTCTCTTCTGTCA (SEQ ID NO.: 1) probe-MIR-156b MR-156b GTGCTCACTCTCTTCTGTCA (SEQ ID NO.: 2) probe-MIR-156c MR-156c GTGCTCACTCTCTTCTGTCA (SEQ ID NO.: 3 probe-MIR-156d MR-156d GTGCTCACTCTCTTCTGTCA (SEQ ID NO.: 4) probe-MIR-156e MR-156e GTGCTCACTCTCTTCTGTCA (SEQ ID NO.: 5) probe-MIR-156f MR-156f GTGCTCACTCTCTTCTGTCA (SEQ ID NO.: 6) probe-MIR-156g MR-156g GTGCTCACTCTCTTCTGTCA (SEQ ID NO.: 7) probe-MIR-156h MR-156h GTGCTCACTCTCTTCTGTCA (SEQ ID NO.: 8) probe-MIR-156i MR
  • probe-MIR-808 MR-808 TTCTTACATTTCCCACATTCAT (SEQ ID NO.: 134) probe-MIR-809a MR-809a ATTCTAACATTTCTCACATTCA (SEQ ID NO.: 135) probe-MIR-809b MR-809b ATTCTAACATTTCTCACATTCA (SEQ ID NO .: 136) probe-MIR-809c MR-809c ATTCTAACATTTCTCACATTCA (SEQ ID NO.: 137) probe-MIR-809d MR-809d ATTCTAACATTTCTCACATTCA (SEQ ID NO.: 138) probe-MIR-809e MR-809e ATTCTAACATTTCTCACATTCA (SEQ ID NO.: 139) probe-MIR-809f MR-809f ATTCTAACATTTCTCACATTCA (SEQ ID NO.: 14 0) probe-MIR-809g MR-809g ATTCTAACATTTCTCACATTCA (SEQ ID NO.: 14 0)
  • the content of the plant microRNA selected from the group below can be preferentially detected or analyzed: MIR- 156a, MIR- 156b, MIR- 156c, MIR- 156d, MIR- 156e, MIR- 156f,
  • MIR-156g MIR-156h, MIR-156i, MIR-156j, MIR-157a, MIR-157b, MIR-157c, MIR-157d, MIR-158a, MIR-159a, MIR-160a, MIR-160b, MIR-160c, MIR-160d, MIR-161, MIR-162a, MIR-162b, MIR-163, MIR-164a, MIR- 164b, MIR-164c, MIR-165a, MIR-165b, MIR-166a, MIR-166b, MIR-166c, MIR-166d, MIR-166e, MIR-166f, MIR-166g, MIR-167a, MIR-167b, MIR-167c, MIR-167d, MIR-168a, MIR-168b, MIR-169a, MIR-169b, MIR-169c, MIR-169d, MIR-169e, MIR-169f, MIR-169g,
  • the changes of the plant microRNA in the serum of the animal are measured, thereby screening the plant microRNAs with specific changes related to diet or disease, and collecting the primers of the selected plant microRNAs into the PCR kit ( In RT-PCR or Real-time PCR, it is used to prepare real-time fluorescent quantitative PCR kits or biochips to detect the microRNA content in animal serum, which is used to guide dietary balance and regulate physiological and pathological conditions. It is also possible to enrich the therapeutic plant microRNA for the preparation of a pharmaceutical composition, a food composition or a health care product, and to assist in the treatment of a disease. miRNA chip
  • the miRNA chip of the present invention can be prepared by a conventional method or apparatus. Representative methods include, but are not limited to, spotting, direct synthesis, and the like.
  • the spotting method can be carried out using a commercially available spotting device, including: a fully automatic spotting device, a high-speed spotting device, etc. (for example, available from Affymetrix, Inc.).
  • the substrate (or solid phase carrier) suitable for use in the chip of the present invention is not particularly limited and includes, but is not limited to, glass sheets, silicon wafers, nylon films and the like.
  • the chip of the present invention can employ conventional dot size and dot matrix density.
  • signal acquisition and analysis is performed by detectable labels such as fluorescent labels, isotope labels.
  • Probes for detecting functional plant microRNAs of the invention in animal serum comprising the probes of the invention include the probes listed in Table 1, and may also include probes for other miRNAs.
  • the chip of the present invention contains all 195 or parts of the probes shown in Table 1, preferably 5, 10, 20, 30, or 50 probes. Experiment or test method
  • the experimental methods such as plant transfection, etc.
  • detection methods such as Solexa sequencing technology, T-PC, Real-time PC, biochip, Northern blotting, Western blot, etc.
  • the method includes, but is not limited to, the following steps.
  • the adaptor primer is ligated to the 3' and 5' ends of the small RNA molecule
  • RT-PCR method including steps:
  • the serum total RNA of the animal is extracted, and a cDNA sample is obtained by reverse transcription reaction of RNA;
  • a method of transfecting a plant with a microRNA comprising the steps of:
  • the cells were cultured for 24 or 48 hours.
  • the lysate is used to lyse the tissue sample or the cultured cell sample to collect the protein
  • Transfer film use polyvinylidene fluoride (PVDF) membrane; block overnight at 4 ° C; incubate the antibody at room temperature with a horseshrin peroxidase (HRP) labeled secondary antibody diluted in appropriate proportions;
  • PVDF polyvinylidene fluoride
  • HRP horseshrin peroxidase
  • Proteins are detected using enhanced chemiluminescent reagents.
  • Biochip method including steps:
  • a method for efficiently screening a functional plant microRNA is provided, which facilitates the application of the functional plant microRNA in a balanced diet, drug screening, pharmacodynamic evaluation, therapeutic regimen, and regulation of physiological and pathological conditions.
  • certain plant microRNAs can be stably present in animals (such as serum or organs) through feeding and other methods, and can be detected and effectively modulate their target genes, correspondingly significantly affecting the target genes.
  • Relevant physiological, physical, and/or pathological changes can be made such that the plant microRNA can be identified as a functional plant microRNA.
  • the minimal medium, Dulbecco's modified eagle medium, were purchased from Gibco, California; Anti-LDLRAP1 (LS-C20125) antibody was purchased from Lifespan Biosciences, Seattle, Washington, USA; synthetic RNA molecules pre-MIR168a, anti-MIR168a , pre-nc NA, antinc NA, all purchased from Ambion, Austin, Texas; synthetic mature MIR-168a oligonucleotide, mature ncRNA, purchased from Takara, Dalian, China; normal Chinese serum samples From the Shanghai Jinling Hospital Health Examination Center; Trizol reagent was purchased from Invitrogen, Carlsbad, California; TaqMan miRNA probe was purchased from Applied Biosystems, Foster City, California; AMV reverse transcriptase was purchased from Dalian, China.
  • FIG 1 shows the results of Solexa sequencing of plant microRNAs in normal Chinese serum. Solexa sequencing was used to detect the expression levels of 10 plant microRNAs in the serum of normal male samples, normal female samples and 8 mixed samples (ie pool1 ⁇ pool8), each mixed sample from 10 healthy animals. Each plant microRNA is normalized to mammalian total microRNAs.
  • FIG. 2 shows the results of Solexa sequencing of plant microRNAs in different organ tissues of mice. The results showed that plant microRNAs were detectable in the heart, liver, spleen, lung, kidney, stomach, small intestine, and brain of mice.
  • MIR168a group and MIR156a group. The column chart in each group is heart, liver, spleen, lung, kidney, stomach, small intestine and brain from left to right.
  • Example 2 Real-time PCR was used to detect plant microRNAs stably present in the serum and organs of humans and animals.
  • Real-time PCR experiment includes the following steps:
  • tissue samples such as serum, cells, heart, liver, spleen, lung, kidney, stomach, small intestine, brain, etc.; (2) extracting total RNA from the sample by Trizol or Trizol LS reagent;
  • RNA was reverse transcribed into cDNA using TaqMan microRNA probe, AMV reverse transcriptase, and stem loop RT primer.
  • Quantitative PCR was performed using a TaqMan PCR kit and an Applied Biosystems 7300 fluorescence quantitative PCR machine.
  • the data processing method is AACT method
  • CT is set to the number of cycles when the reaction reaches the domain value
  • a series of known concentrations of synthetic microRNA are reverse transcribed and amplified
  • the absolute amount of each microRNA is plotted as a standard curve.
  • the RNA in the sample was sampled and subjected to reverse transcription reaction, and the amount of microRNA contained in the plant was compared by Real-time PCR reaction.
  • the Real-time PCR experiment (Fluorescent Dye Method) consists of the following steps:
  • RNA was reverse transcribed into cDNA using AMV reverse transcriptase and stem loop RT primers.
  • the data processing method is ⁇ method
  • CT is set to the number of cycles when the reaction reaches the domain value
  • a series of known concentrations of synthetic microRNA are reverse transcribed and amplified
  • the absolute amount of each microRNA is plotted as a standard curve.
  • the RNA in the serum samples was extracted and subjected to reverse transcription reaction, and the serum microRNA content in the serum was compared by Real-time PCR reaction.
  • Figure 3 shows the results of Real-time PCR of plant microRNAs in mammalian serum. Animal endogenous microRN As, mi-16 and miR-25 were used as controls.
  • Example 3 uses Real-time PCR to detect plant microRNAs in extreme environments.
  • This example demonstrates the stability of plant microRNAs and high temperature resistance.
  • Real-time PCR was used to detect microRNA content in fresh rice, Chinese cabbage, wheat, potato and cooked food. The specific steps of the Real-time PCR experiment are as described in Example 2.
  • Figure 4 shows the results of Real-time PCR of plant microRNA expression in fresh rice, Chinese cabbage, wheat, potato and cooked food. Plants MIR-168a, MIR-156a, MIR-166a are detectable in Chinese cabbage, wheat, and potatoes, and plant microRNAs are also detected in cooked food.
  • This example also demonstrates the stability and acid-tolerant environment of plant microRNAs.
  • Synthetic microRNAs including synthetic mammalian miRNA: miR- 16, and synthetic plant miRNAs: MIR-156a and MIR-168a), total RNA extracted from rice or mouse liver at pH 2.0, 37. Under the condition of C, treatment was carried out for 0h, lh, 3h, 6h, and then RNA was purified. The expression of microRNA in synthetic microRNAs, rice microRNA or mouse liver was detected by Real-time PCR. The specific steps of the Real-time PCR experiment are as described in Example 2.
  • Figure 5 is a Real-time PCR result of microRNA expression in synthetic microRNA, rice microRNA or mouse liver at different time points of acidification.
  • the degradation rate of mammalian microRNA in the liver is similar to that of synthetic mammalian microRNA. Mammalian microRNA can survive for at least 6 hours under acidic conditions, but after 6 hours, its relative content is less than the initial content. 0.8. As shown in Figure 5B. After acidification, the degradation rate of plant microRNA is lower than that of synthetic plant microRNA. The degradation rate of plant microRNA is very low. It can survive for at least 6 hours under acidic conditions. After 6 hours, the relative content of plant microRNA exceeds the initial content. 0.9, stability is far superior to mammalian microRNAs. As shown in Figure 5A.
  • Example 4 The real-time PCR method was used to detect exogenous plant microRNA matures entering the serum and organs through the gastrointestinal tract (GI) pathway of the animal.
  • GI gastrointestinal tract
  • mice were fed fresh rice or feed and the expression levels of plant microRNAs in serum and liver were examined.
  • the specific steps are:
  • mice C57BL/6J mice, purchased from the Model Animal Research Institute of Nanjing University
  • the mice were first starved for 12 hours, then fed fresh rice or feed, and fed for 0.5 h, 3 h, and 6 h, and then the plant microRNA was detected in serum by Real-time PCR. And the level of expression in the liver.
  • the specific steps of the Real-time PCR experiment are as described in Example 2.
  • Figure 6A is a Real-time PCR result of the expression levels of plant microRNAs in feed and fresh rice. Two endogenous genes, miR-16 and miR-150, were used as positive controls. It can be seen that fresh rice and feed contain plant microRNA, and the content of plant microRNA in fresh rice is higher than that in feed.
  • Fig. 6B is a Real-time PCR result of the expression level of plant microRNA MIR-168a in serum after feeding mice with fresh rice or feed for 0.5 h, 3 h, and 6 h.
  • Figure 6C shows the results of Real-time PCR of the expression of plant microRNA MIR-168a in the liver after feeding the fresh rice or feed for 0.5 h, 3 h, and 6 h.
  • Figures 6B and 6C show mice (Oh) sacrificed immediately after starvation for 12 hours as a control. As can be seen from the results, the expression level of plant microRNA in serum and liver was steadily increased after feeding and rice; and the expression level of plant microRNA in serum and liver was more significantly increased by feeding rice than feed.
  • plant microRNAs can enter the circulatory system and organs through the gastrointestinal tract of animals.
  • plant microRNAs such as plant microRNA MIR-168a
  • plant microRNAs can be stably present in the circulatory system or organs of animals through the feeding route, tolerant to harsh conditions such as acidity of the gastrointestinal tract, and are detected. Therefore, plant microRNAs can be used in the identification method of the functional plant microRNAs described in the present invention.
  • Example 5 Plant microRNAs can enter animal cells and regulate animal physiological activities.
  • plant microRNAs can enter animal cells, and plant microRNAs that enter animal cells can modulate animal physiological activities.
  • Bioinformatics was used to predict the matching of multiple target genes to the target gene sequence of MIR-168a. The specific results are shown in
  • Figure 7 is a hypothetical schematic diagram showing the binding of plant MIR-168a to the fourth exon of LDL AP1.
  • the dark portion indicates the paired base. The more paired bases, the higher the degree of binding.
  • the results showed that the target gene of plant MIR-168a binds to the fourth exon of LDLRAP1, and the target gene of plant MIR-168a may be located in the fourth of LDLRAP1. On the show. Plant MIR-168a is likely to act on LDL AP1 and inhibit LDL AP1 expression.
  • plant microRNAs or precursors were transferred to HepG2 cells.
  • the animal's physical ability cuts the plant microRNA precursor into a mature body. The specific steps are:
  • Hepatocyte cell line HepG2 is inoculated into a 12-well plate or a 10 mm culture dish overnight;
  • pre-micro NA pre-ncRNA as a control
  • pre-MIR168a transfected HepG2 cells pre-micro NA (pre-ncRNA as a control), pre-MIR168a transfected HepG2 cells
  • Figure 8 shows the results of Real-time PCR of plant microRNA in HepG2 cells transfected with pre-MIR168a. Using transfected pre-ncRNA as a control, plant MIR-168a increased expression in HepG2 cells transfected with pre-MIR168a. The results indicate that plant microRNAs can enter animal cells.
  • Tissue samples or cultured cell samples were lysed using lysate (50 mM Tris-HCl pH 7.4, 150 mM NaCl, 1% ⁇ -40, 0.1% SDS), sonicated, and centrifuged at 12000 x g for 10 minutes at 4 °C. The supernatant was removed and the protein concentration was determined by the BCA method.
  • Electrophoresis Separation by electrophoresis on a 10% SDS-polyacrylamide gel (SDS-PAGE); (3) Transfer film: using polyvinylidene fluoride (PVDF) film
  • Protein detection Proteins were detected using enhanced chemiluminescence reagents; Band Auto software was used to scan and quantify the autoradiography intensity of each band.
  • Figure 9 shows the results of Western blot of LDLRAP1 protein in HepG2 cells transfected with pre-MIR168a.
  • Figure 9A is a Western blot analysis of LDLRAP1 protein in HepG2 cells transfected with pre-MIR168a. The results showed that with pre-ncRNA as a control, HepG2 cells were transfected with pre-MIR168a, and the expression of LDLRAP1 protein was decreased in these HepG2 cells.
  • Figure 9B is a Western blot quantitative result of Figure 9A.
  • the results showed that with pre-ncRNA as a control, HepG2 cells were transfected with pre-MIR168a, and the expression of LDLRAP1 protein was significantly decreased in these HepG2 cells.
  • the transduction of plant microRNA into mammalian HepG2 cells results in down-regulation of LDL AP1 protein in these HepG2 cells, and the entry of plant microRNA into the animal can affect the expression of LDLRAP1 protein and decrease its expression level.
  • a plant microRNA such as plant microRNA MIR-168a
  • a candidate target gene thereof eg, low density lipoprotein receptor adaptor protein 1 (LDL AP1)
  • LDL AP1 low density lipoprotein receptor adaptor protein 1
  • Plant microRNA enters the circulatory system and organs of the animal through the intestinal epithelial cells Caco-2 cell microparticles (MVs), regulating physiological activities
  • plant microRNAs can enter the animal's organs through the intestinal epithelial cells Caco-2 cell microparticles, such as the liver, and plant microRNAs that enter the liver regulate animal physiological activities.
  • the differentially centrifuged method is then used to separate the cell microparticles released by the intestinal epithelial cell Caco-2:
  • the cultured intestinal epithelial cell Caco-2 is first centrifuged at 300 g for 5 minutes, and the supernatant is taken; (2) Centrifuge the supernatant at 1200 g for 20 minutes, and take the supernatant;
  • HepG2 cells were treated with microparticles containing plant microRNA, and the expression level of plant microRNA in cell microparticles or HepG2 cells was measured by Real-time PCR.
  • the specific steps of the Real-time PCR experiment are as described in Example 2.
  • Figure 10 shows the transfer of plant microRNA into human intestinal epithelial cell Caco-2, collection of transfected microparticles, treatment of HepG2 cells, transfection of ncRNA as a control, expression of plant microRNA in cell microparticles and HepG2 cells.
  • Figure 11A shows the microparticles collected by plant microRNA transfected Caco-2 cells. After treatment of HepG2 cells, the results of Western blot analysis of LDLRAP1 protein in HepG2 cells transfected with pre-MIR168a were used as non-treated HepG2 cells as positive control. It can be seen that plant microRNA enters humans and animals, affecting the expression of LDLRAP1 protein and decreasing its expression level.
  • Figure 11B is a Western blot quantitative result of Figure 11A.
  • mice were fed fresh rice or feed to study the expression levels of plant microRNAs and LDL AP low-density lipoprotein cholesterol in the liver.
  • mice were starved for 12 hours, then fed fresh rice or feed, and after 0d, ld, 3d, and 7d, Real-time PCR was used to detect the expression level of plant microRNA MIR-168a in the liver.
  • the specific steps of the Real-time PCR experiment are as described in Example 2.
  • Figure 12A is a quantitative result of the amount of plant microRNA MIR-168a expressed in the liver by feeding fresh rice or feed to mice. After feeding rice for 1 day, the expression level of plant microRNA MIR-168a increased continuously in the liver of mice with the fasting 12h mice as a positive control, indicating that MIR-168a can enter the liver organs through the feeding pathway.
  • Figure 12B shows the results of Western blot analysis of LDL AP1 in the liver by feeding fresh rice or feed to mice.
  • Figure 12C is a result of Western blot quantitative analysis of Figure 12B.
  • Fig. 12B and Fig. 12C showed that the expression of LDL AP1 was significantly decreased in mice fed the rice group, indicating that the substance contained in rice could inhibit the expression of LDL AP1, which inhibits LDLRAP1. Most likely it is MIR-168a.
  • Figure 12D is the feeding of fresh rice or feed to mice.
  • the expression level of low-density lipoprotein cholesterol in the liver is increased. It can be seen that low-density lipoprotein cholesterol is significantly increased, indicating that rice contains a substance that can raise low-density lipoprotein.
  • the concentration of cholesterol, which is likely to increase the concentration of low-density lipoprotein cholesterol, is likely to be MIR-168a.
  • Example 8 Effect of plant microRNA on plasma low density lipoprotein cholesterol in animals after 3 days of feeding different foods to mice.
  • mice Feed the mice with feed, fresh rice, fresh rice while injecting anti-ncRNA, fresh rice and injecting anti-MIR- 168a ASO. After feeding different foods for 3 days, study the plant microRNA MIR-168a. LDL AP Low Density Lipoprotein Cholesterol Expression Level in the Liver.
  • Real-time PCR was used to detect the expression level of plant microRNA in the liver. Real-time PCR experiments The specific steps are as described in Example 2.
  • Figure 13A is a Real-time PCR result of the amount of plant microRNA MIR-168a expressed in the liver by feeding fresh rice or feed to mice. It can be seen from the results that after feeding 3 days of rice, compared with the control group (chow diet 3d group), the expression of plant microRNA MIR-168a increased in the liver of mice after feeding fresh rice (rice 3d group), indicating that MIR-168a entered Liver; fed fresh rice and injected with anti-MI-168a ASO (anti-MI 168a ASO for antisense RNA, degradable MIR-168a), compared with rice3d and rice 3d+anti-ncRNA, rice 3d+anti- MIR-168a expression was decreased in the liver of mice in the MIR-168a group, indicating that MIR-168a in the liver has been degraded.
  • control group chow diet 3d group
  • anti-MI-168a ASO anti-MI 168a ASO for antisense RNA, degradable MIR-168a
  • Figure 13B shows the results of Western blot analysis of LDLRAP1 in mouse liver 3 days after the mice were fed different foods. From the results, it can be seen that compared with the control group (chow diet 3d group), the expression of LDL AP1 in the liver of the mice was decreased after feeding fresh rice (rice 3d group), indicating that a certain molecule in rice can inhibit the expression of LDL AP1; Feeding fresh rice and injecting anti-MIR-168a ASO (this antisense RNA degradable MIR-168a), mice in the rice 3d+anti-MI-168a group compared with the rice3d group and the rice 3d+anti-nc NA group The expression of LDLRAP1 in the liver increased and returned to normal levels.
  • Fig. 13C is a result of Western blot analysis of Fig. 13B. It can be seen that LDLRAP1 was significantly decreased in the liver of mice after feeding rice, and LDLRAP1 expression in the liver of mice was restored to a normal level after degradation of MIR-168a in rice. These results indicate that exogenous plant microRNA can inhibit LDLRAP1 expression in animals by feeding into mammalian circulatory systems and organs.
  • Figure 13D shows the expression level of low density lipoprotein cholesterol in the liver 3 days after the mice were fed different foods.
  • the expression of low-density lipoprotein cholesterol in the liver of the mice was increased after feeding fresh rice (rice 3d group); feeding fresh rice and injecting anti-MIR-168a ASO (This antisense NA degradable MIR-168a), compared with the rice3d group and the rice 3d+anti-nc NA group, the expression of LDLRAP 1 in the liver of the rice 3d+anti-MI-168a group was decreased.
  • Each of the plant microRNA probes described in Table 1 was printed on a substrate surface (silicon wafer) by a gene chip spotting instrument to prepare a miRNA biochip (containing 195 miRNA probes), which was used.
  • probes SEQ ID NO.: 1 to SEQ ID NO.: Probe
  • miRNA biochips of the probes SEQ ID NO.: l to SEQ ID NO.: 150
  • the plant microRNA is selectively adsorbed to the silicon matrix membrane in the spin column under high unsalted salt state, and then through a series of rapid rinsing-centrifugation steps, the rinsing liquid will metabolize the cell metabolite, protein and the like. Removal, and finally purifying the purified plant microRNA from the silicon matrix membrane with low-salt RNase free water, thereby effectively separating the plant microRNA;

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Virology (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne un procédé d'identification de microARN végétal fonctionnel. Le procédé permet d'obtenir efficacement, par filtration, un microARN végétal fonctionnel qui peut exister de manière stable dans le corps d'un animal, peut être détecté, et peut ajuster des états physiologiques et pathologiques de l'animal. L'invention concerne aussi un microARN végétal fonctionnel identifié par le procédé et une application de celui-ci.
PCT/CN2012/077234 2012-06-20 2012-06-20 Identification de microarn végétal et son application WO2013189047A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/CN2012/077234 WO2013189047A1 (fr) 2012-06-20 2012-06-20 Identification de microarn végétal et son application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/CN2012/077234 WO2013189047A1 (fr) 2012-06-20 2012-06-20 Identification de microarn végétal et son application

Publications (1)

Publication Number Publication Date
WO2013189047A1 true WO2013189047A1 (fr) 2013-12-27

Family

ID=49768032

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2012/077234 WO2013189047A1 (fr) 2012-06-20 2012-06-20 Identification de microarn végétal et son application

Country Status (1)

Country Link
WO (1) WO2013189047A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107058525A (zh) * 2017-03-21 2017-08-18 济南大学 一种基于基因表达量与性状动态相关性预测玉米未知基因功能的方法
CN107164489A (zh) * 2017-06-07 2017-09-15 苏州市李良济健康产业有限公司 一种用于鉴定中药材泽泻的引物对及其应用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004066183A2 (fr) * 2003-01-22 2004-08-05 European Molecular Biology Laboratory Microarn

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004066183A2 (fr) * 2003-01-22 2004-08-05 European Molecular Biology Laboratory Microarn

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
WANG, LEI ET AL.: "Progress of MicroRNA in Plants", JOURNAL OF AGRICULTURAL SCIENCE AND TECHNOLOGY, vol. 9, no. 3, 30 June 2007 (2007-06-30), pages 18 - 23 *
ZHOU, LIJING ET AL.: "Characteristics and Research Methods of MicroRNA in Plant", BIOTECHNOLOGY BULLETIN, no. 5, 31 May 2011 (2011-05-31), pages 15 - 20 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107058525A (zh) * 2017-03-21 2017-08-18 济南大学 一种基于基因表达量与性状动态相关性预测玉米未知基因功能的方法
CN107058525B (zh) * 2017-03-21 2020-12-29 济南大学 一种基于基因表达量与性状动态相关性预测玉米未知基因功能的方法
CN107164489A (zh) * 2017-06-07 2017-09-15 苏州市李良济健康产业有限公司 一种用于鉴定中药材泽泻的引物对及其应用

Similar Documents

Publication Publication Date Title
Chen et al. Downregulation of the circadian rhythm regulator HLF promotes multiple-organ distant metastases in non-small cell lung cancer through PPAR/NF-κb signaling
Pan et al. Berberine influences blood glucose via modulating the gut microbiome in grass carp
Wen et al. iTRAQ-based quantitative proteomic analysis of Takifugu fasciatus liver in response to low-temperature stress
US9903002B2 (en) Non-coding RNA of Salmonella and identification and use thereof
CN106011303B (zh) 一种与儿童肥胖相关的血清或血浆miRNA标志物及其应用
CN104818334B (zh) 与肺腺癌转移相关的微小rna
Zhao et al. Transcriptome analysis reveals that high temperatures alter modes of lipid metabolism in juvenile turbot (Scophthalmus maximus) liver
CN105886648A (zh) 用于检测egfr基因t790m突变的试剂盒
Guo et al. Tissue-overlapping response of half-smooth tongue sole (Cynoglossus semilaevis) to thermostressing based on transcriptome profiles
Tian et al. Systematic identification of key genes and pathways in clear cell renal cell carcinoma on bioinformatics analysis
Jin et al. Methylation‑associated silencing of miR‑128 promotes the development of esophageal cancer by targeting COX‑2 in areas with a high incidence of esophageal cancer
Zhang et al. Transcriptomics integrated with metabolomics reveals the effect of Lycium barbarum polysaccharide on apoptosis in Nile tilapia (Oreochromis niloticus)
Han et al. Mechanisms of coix seed compositions in the treatment of spleen deficiency and wet dampness zheng
Wang et al. A new insight into the intestine of pacific white shrimp: Regulation of intestinal homeostasis and regeneration in litopenaeus vannamei during temperature fluctuation
CN107236817A (zh) LncRNA ENST00000424523.1及其基因在诊断和治疗药物中的应用
Hu et al. Energy consumption and intestinal microbiome disorders of yellow catfish (Pelteobagrus fulvidraco) under cold stress
Zhu et al. Effects of Enterocytozoon hepatopenaei single-infection or co-infection with Vibrio parahaemolyticus on the hepatopancreas of Penaeus vannamei
CN109055564B (zh) 用于慢性淋巴细胞白血病诊断及预后评估的CircRNA标志物
Huang et al. Identification and expression analysis of cobia (Rachycentron canadum) liver-related miRNAs under hypoxia stress
Tian et al. Identification of genes related to stress affecting thymus immune function in a chicken stress model using transcriptome analysis
WO2013189047A1 (fr) Identification de microarn végétal et son application
Heminger et al. Altered gene expression induced by ionizing radiation and glycolytic inhibitor 2-deoxy-glucose in a human glioma cell line: implications for radio sensitization
JP5990871B2 (ja) 疲労の判定方法
US20190002983A1 (en) Serum mirna marker for opll diagnosis and application thereof
Wang et al. Integration of small RNAs and mRNAs by high-throughput sequencing reveals a complex regulatory network in Chinese sea cucumber, Russian sea cucumber and their hybrids

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12879305

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 12879305

Country of ref document: EP

Kind code of ref document: A1