WO2013175358A1 - Cassettes d'expression procaryotes régulées par le stress. - Google Patents
Cassettes d'expression procaryotes régulées par le stress. Download PDFInfo
- Publication number
- WO2013175358A1 WO2013175358A1 PCT/IB2013/053983 IB2013053983W WO2013175358A1 WO 2013175358 A1 WO2013175358 A1 WO 2013175358A1 IB 2013053983 W IB2013053983 W IB 2013053983W WO 2013175358 A1 WO2013175358 A1 WO 2013175358A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- expression cassette
- nucleotide sequence
- bacterium
- promoter
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/746—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for lactic acid bacteria (Streptococcus; Lactococcus; Lactobacillus; Pediococcus; Enterococcus; Leuconostoc; Propionibacterium; Bifidobacterium; Sporolactobacillus)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/19—Cytokines; Lymphokines; Interferons
- A61K38/20—Interleukins [IL]
- A61K38/2066—IL-10
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/52—Bacterial cells; Fungal cells; Protozoal cells
- A61K2039/523—Bacterial cells; Fungal cells; Protozoal cells expressing foreign proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/20011—Papillomaviridae
- C12N2710/20034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
Definitions
- the invention relates to the production of heterologous proteins in Gram-positive bacteria, especially lactic acid bacteria.
- lactic acid bacteria especially lactococci and lactobacilli
- Recombinant lactic acid bacteria serve as living vectors for mucosally delivering molecules of interest to health (for reviews: Daniel et al., Trends Biotechnol., 29 (10), 409-508, 2011, and Bermudez-Humaran et al. al., Microb Cell Fact., 10 (Suppl 1): S4, 2011).
- Lactococcus lactis in particular is a non-invasive and non-pathogenic bacterium, widely used in the manufacture of dairy products, in particular cheeses. It resists up to 90% in gastric passage in humans and in mice.
- L. lactis is the model lactic acid bacterium and is one of the best characterized bacteria with Escherichia coli and Bacillus subtilis. As a result, L. lactis is considered an excellent candidate for the expression of proteins of interest for health (antigens, cytokines, hormones, etc.) in the mucous membranes.
- 17 could be subcloned to test their ability to control the expression of a heterologous protein: they are the promoters of the genes rpoB, dpsA, glnA, glnR, pepV, atpD, pgk, fabF , fabG, rpoA, pepQ, rpsD, sodA, luxS, rpsK, rpIL, and hlIA (so named in L. lactis MG1363). 4 of these promoters actually achieved the desired level of expression: the promoters of the genes dpsA, pepV, sodA, and hlIA.
- the promoters described in the documents cited above are all constitutive promoters. In some cases, it is preferable to use inducible promoters to trigger or stop the expression at the desired time. Indeed, some proteins, such as cytokines, can accumulate within the cytoplasm of the bacterium and degrade the host cell. Expression systems incorporating an inducible promoter make it possible to better control the expression of the heterologous protein and to prevent the negative effects that may result from its overproduction.
- this use requires not only that the promoters concerned be inducible, but still that there exists a sufficient differential of expression between the different states of induction; ideally, the expression should reach a high level under induction conditions, and be absent or weak under non-induction conditions.
- the NICE system (Nilsin Controlled Expression System) (Kuipers et al., J. of Biol Chem., 270 (45): 27299-27304, 1995; de Ruyter et al., Appl. Environ. Microbiol., 62 Kuipers et al., J. of Biotechnol., 64 (1): 15-21, 1998; Mierau et al., Appl Microbiol Biotechnol., 68 (6): 705-17, 2005); is today the most widely used to express a gene of interest depending on the presence or absence in the external medium of a bacteriocin, nisin.
- the inventors have sought to implement an inducible expression system suitable for the expression of heterologous proteins of interest in lactic acid bacteria intended to be used as a therapeutic or vaccine vector, and have had the idea to look for an expression system that would be induced when administering bacteria to the subject that one wishes to treat.
- this administration which places the bacteria in conditions very different from their usual living conditions, could induce in them various types of stress: it can be notably thermal stress, if the temperature body of the subject to be treated is sufficiently high compared to the optimum temperature of growth of the bacterium administered; in case of oral administration, heat stress can be accompanied by acid stress during passage into the stomach (where the pH is about 1.5 to 2), then a biliary stress in the duodenum.
- the inventors have investigated whether it is possible to identify, among the promoters, the numerous genes identified as being induced by one or more of these stresses (for a review see for example Van de Guchte et al., Antonie van Leeuwenhoek, 82, 187-216, 2002), a promoter actually useful in practice for controlling the inducible expression of heterologous proteins.
- the GroES and GroEL proteins present in many bacteria, are chaperonins and heat-shock proteins (hsp).
- the GroESL operon of Lactococcus lactis subsp. lactis has been described by Kim et al. (Gene, 127 (1): 121-126, 1993), who reported that its transcription was inducible by heat shock.
- Arnau et al. (Microbiology, 142, 1685-1691, 1996) studied the transcriptional induction kinetics of the dnaK, dnaJ and groEL genes of Lactococcus lactis subsp.
- cremoris during thermal shock caused by a temperature rise of 30 ° C (optimum growth temperature of Lactococcus lactis) at 43 ° C. They observed a level of transcription ranging from 10 times (for dnaJ and groEL) to 100 times (for dnaK) the basal level during the first 15 minutes of the heat shock, and decreasing after 20 minutes.
- the inventors cloned the promoter of the Lactococcus lactis operon GroESL, and tested its ability to control the expression of a heterologous protein and its inducibility under conditions that reproduce those of in vivo administration in humans.
- the PGroESL promoter allowed the expression of a heterologous protein, at a low level, and a temperature rise at 37 ° C, although lower than the temperatures (above 40 ° C) usually used for the induction of heat stress in L. lactis, was sufficient to increase the amount of heterologous protein produced by 1.3 to 5 times.
- the subject of the present invention is therefore an expression cassette comprising:
- heterologous nucleotide sequence encoding a polypeptide of interest placed under transcriptional control of said promoter.
- PGPRSL promoter of L. lactis is defined herein as a polynucleotide of 82 to 150 bp constituting a functional promoter in L. lactis, and comprising a nucleotide sequence having at least 90%, and in order of increasing preference, at least 90%. %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%, of identity with the following sequence:
- the PGroESL promoter contains the following cis-regulatory elements, exemplified on SEQ ID NO. : 1:
- a Ribosome Binding Site (RBS), at positions 78-82.
- sequence SEQ ID NO. : 1 is derived from the model strain Lactococcus lactis subsp. cremoris MG1363 (GenBank NC_009004).
- PGroESL promoters that can be used for the construction of an expression cassette according to the invention can also be isolated and cloned from any L. lactis strain by conventional techniques of genetic engineering.
- PGroESL promoter of the A76 strain (GenBank CP003132) of Lactococcus lactis subsp. cremoris, which comprises the sequence SEQ ID NO. : 1;
- heterologous nucleotide sequence denotes any nucleotide sequence other than that naturally located in L. lactis downstream of the PGroESL promoter, and in particular any nucleotide sequence that does not include those coding for the GroES and GroEL proteins of L. lactis. Preferably, it will be a sequence that does not come from L. lactis.
- polypeptide of interest in particular of therapeutic or vaccinal interest, that it is desired to express by the host bacterium.
- Said polypeptide may optionally be a chimeric polypeptide, associating polyptopic sequences of various origin.
- said heterologous nucleotide sequence may be:
- a nucleotide sequence coding for a cytokine for example interleukin-10 (IL-10), IL-12, IL-2, IL-4, GM-CFS ("Granulocyte-macrophage colony” - stimulating factor "), or TGF- ⁇ (" Transforming growth factor-beta ");
- IL-10 interleukin-10
- IL-12 IL-12
- IL-2 IL-2
- IL-4 GM-CFS
- GNF-CFS Granulocyte-macrophage colony
- TGF- ⁇ Transforming growth factor-beta
- the antigen is for example one of the type 16 human papillomavirus (HPV) proteins E6, E7, or L1, the Rhodococcus equi VapA protein, the Brucella abortus L7 / L12 protein, or the Staphylococcus aureus Naked protein.
- HPV human papillomavirus
- a nucleotide sequence coding for a protease inhibitor for example elafine (or trappin-2), the secretory leukocyte protease inhibitor (SLPI), or one of the serine protease inhibitors (family of serpins); a nucleotide sequence coding for a hormone, for example leptin, insulin, growth hormone, IGF-1 ("insulin-like growth factor"), IGF-2, or the growth factor epidermal (EGF);
- a protease inhibitor for example elafine (or trappin-2), the secretory leukocyte protease inhibitor (SLPI), or one of the serine protease inhibitors (family of serpins)
- a nucleotide sequence coding for a hormone for example leptin, insulin, growth hormone, IGF-1 ("insulin-like growth factor"), IGF-2, or the growth factor epidermal (EGF);
- nucleotide sequence coding for an enzyme of bacterial or eukaryotic origin for example a catalase, a superoxide dismutase, a lipase, a polymerase, an isomerase, or a ligase.
- An expression cassette according to the invention may, if necessary, furthermore comprise the elements necessary to enable the targeting of the protein of interest to the cell surface, or its secretion in the external medium.
- the expression cassette according to the invention may comprise a nucleotide sequence coding for an extracellular targeting peptide placed under the transcriptional control of the PGroESL promoter, said expression cassette allowing the cloning of the heterologous nucleotide sequence of interest. in translational fusion with said peptide for addressing.
- the targeting peptide can be, for example, a secretion signal peptide, a transmembrane domain, an anchoring signal to the wall, etc.
- MKKINLALLTLATLMGVSSTAVVFA SEQ ID NO: 5
- the peptides respectively identified in Poquet et al. J. Bacteriol., 180, 1904-1912, 1998), from Le Loir et al. (Appl., Microbiol., 67, 4119-4127, 2001), and Ravn et al. (Gene, 242, 347-356, 2000).
- the invention also relates to a recombinant vector comprising an insert constituted by a cassette expression according to the invention.
- Recombinant vectors according to the invention can be obtained, in a conventional manner, by insertion of an expression cassette according to the invention into a functional vector in L. lactis.
- the subject of the invention is also a bacterium of the Lactococcus lactis species, transformed by at least one expression cassette according to the invention.
- it may be a bacterium from a strain of L. lactis with one or more modifications of its genome. These may be, for example, modifications intended to improve the production and / or the secretion of proteins expressed in said bacterium, and / or to prevent their degradation.
- modifications intended to improve the production and / or the secretion of proteins expressed in said bacterium, and / or to prevent their degradation.
- PCT application WO00 / 39309 or a bacterial strain overproducing a protein making it possible to stabilize the exported proteins, such as the Nlp4 protein of Lactococcus lactis, or one of its homologs (Poquet et al., 1998, publication cited above), or a bacterial strain modified by addition of a heterologous gene responsible for the secretion of proteins, such as the secDF gene of Bacillus subtilis (Nouaille et al., Appl., Microbiol., 72 (3): 2272-9, 2006).
- a bacterium including a defective auxotrophic gene can also be used to make the survival of this bacterium dependent on the presence of one or more specific compounds.
- the target auxotrophic gene may be the thyA gene (PCT Application WO2011 / 086172), which encodes thymidylate synthase, an enzyme that generates thymidine monophosphate (dTMP) which is then phosphorylated to thymidine triphosphate, which is involved in DNA synthesis and repair. or the air gene encoding alanine racemase (Bron et al., Environ Microbiol., 5663-5370, 2002).
- the auxotrophic gene chosen may be inactivated by any known method, for example by insertion of the heterologous nucleotide sequence at the locus of this gene into the bacterial chromosome.
- the subject of the present invention is also the use of a transformed bacterium according to the invention for producing a polypeptide of interest when said bacterium is subjected to a heat shock, resulting from its exposure to a temperature greater than its normal temperature. growth.
- the transformed bacteria according to the invention may optionally be used to produce in vitro a polypeptide of interest.
- they can be used especially as medicaments or as vaccines, as delivery vectors for a protein of therapeutic or vaccinal interest.
- the subject of the present invention is a process for producing a polypeptide of interest by a transformed bacterium according to the invention containing a sequence coding for said polypeptide of interest placed under the transcriptional control of the PGroESL promoter, characterized in that for inducing the expression of said polypeptide said bacterium is exposed to a temperature greater than 36 ° C, and less than or equal to 40 ° C.
- said temperature will be equal to or greater than 36.5 ° C, and most preferably equal to or greater than 37 ° C.
- said polypeptide is a protein of therapeutic or vaccinal interest
- the exposure of said bacterium to the temperature for inducing the expression of said polypeptide is carried out by administering said bacterium to a subject, which may be preferably a human, or where appropriate an animal, especially a mammal, whose body temperature is greater than 37 ° C.
- the bacteria in accordance with the invention may be administered in particular by the mucosal route, more particularly by the intranasal, oral, rectal or vaginal routes, and preferably by the intranasal route or orally.
- Their use allows the expression in situ of the protein of interest, at the level of the mucous membranes concerned.
- the use of the transformed bacteria according to the invention is particularly advantageous in the context of the treatment of diseases such as inflammatory bowel disease (IBD), because it makes it possible to locally deliver the protein of interest directly into the body. intestine, during the passage of the bacteria in the duodenum, thus allowing a very localized action of the protein and therefore a greater effectiveness.
- IBD inflammatory bowel disease
- they can in particular be used for the administration of anti-inflammatory cytokines, such as interleukin-10.
- IBD inflammatory bowel disease
- anti-inflammatory molecules such as cytokine IL-10 or elafine
- allergy therapy by intranasal administration of proinflammatory molecules such as cytokine IL-12 or TGF- ⁇ .
- the transformed bacteria in accordance with the invention may be administered at a dose of between 1.10 8 and 1.10 10 CFU (Colony Forming Units), preferably between 5.10 8 and 1.10 10 CFU, advantageously between 5.10 8 and 5.10 9 CFU. for intranasal administration and between 1.10 9 and 1.10 10 CFU for oral administration.
- CFU Cold Forming Units
- they can be administered at a dose of 1.10 9 CFU intranasally or 5.10 9 CFU orally.
- a DNA region upstream of the GroESL gene was amplified by PCR from genomic DNA of the strain Lactococcus lactis MG1363.
- the primers used are the BglII-ProGroEL sense primer of the CCAAGATCTAAATGTTTTCTCTTGACTAAATCTGACC sequence (SEQ ID NO: 6) and the N el-ProGroEL antisense primer of the AGCTAGCGTTAATAAAGCAAGGTTTATTTTTTTCATATAC sequence (SEQ ID NO: 7). These primers were designed to clone, using the BglII and N el restriction sites (underlined), the PCR product in the pLB141 vector (Morello et al., 2008, cited above). In addition, the antisense primer was chosen so as to introduce the PCR product into this vector during the reading phase with the coding sequence for the first 12 amino acids of the signal peptide PSExp4.
- the PCR product was digested, purified and cloned into the pCR®2.1 intermediate vector (TOPO®, Invitrogen).
- the sequence of the plasmid obtained, pLB263 (pCR: TOPO: PGroESL) (Fig. 1A) was confirmed by enzymatic digestion and sequencing (Eurofins).
- the amplified fragment containing the PGroESL promoter, has the following sequence:
- the PGroESL promoter was isolated from the plasmid pLB263, by digestion with the enzymes BglII and NheI, and cloned into the vector pLB141 (FIG 1B), previously digested with the same enzymes, replacing the promoter (PnisA) initially present in this vector .
- FIG. 1C contains an expression cassette expressing PSExp4 in fusion with the mature form of a model secreted protein, Staphylococcus aureus nuclease (Nue), under the control of the PGroESL promoter.
- Plasmid pLB333 has an NsiI restriction site, between the sequence coding for PSExp4 and the naked reporter gene encoding the Naked nuclease, and a multiple cloning site at the end of the naked gene and before the trpA (ter) transcription terminator, to allow the replacement of this gene by a gene of interest.
- This plasmid was then introduced into L. lactis MG1363 to obtain the MG recombinant strain (pLB333).
- the expression of the naked reporter gene was tested by Western Blot after inducing heat shock in the recombinant strain MG (pLB333) obtained in Example 1.
- a pre-overnight culture of the strain MG (pLB333) was diluted to l / 100th the morning until an optical density (OD) between 0.4 and 0.6. Then three 6 ml volumes of the diluted pre-culture were poured into three tubes.
- three tubes of 6 ml of GM17 culture medium containing 10 ⁇ g / ml of chloramphenicol (Cm) were prepared and incubated respectively at 30 ° C and 37 ° C.
- the three cultures were each centrifuged for 5 min at 4700 rpm and then taken up in the 6 ml of fresh medium GM17 + Cm previously heated. The tubes thus obtained were incubated for 5 and 30 min at 30 ° C and 37 ° C.
- the tubes were then centrifuged for 10 min at 13000 rpm, and pellet and supernatant were separated. The supernatant was precipitated with 10% TCA and taken up in load blue NaOH + (obtaining fraction S). The pellet was taken up in 150 ⁇ PBS + protease inhibitor IX, a bead volume was added thereto, and the whole was passed FastPrep ® system to break the bacteria and liberate cytoplasmic proteins (obtaining the fraction C) . The production and secretion of the Nue protein was analyzed by Western blotting using anti-Naked antibodies. The results, illustrated in Figure 2, demonstrate that after heat shock (5 min at 37 ° C), strain MG (pLB333) is able to very strongly produce the Nue protein.
- Interleukin-10 is an anti-inflammatory cytokine previously proposed for use in the treatment of inflammatory bowel disease (IBD).
- pLB350 The gene coding for murine IL-10 was inserted into the vector pLB333 instead of the naked gene.
- the resulting plasmid, pLB350 (pPGroESL: PSExp4: IL-10), was introduced into L. lactis MG1363 to obtain the MG recombinant strain (pLB350).
- HPV-16 Human papillomavirus type 16
- HPV-16 E7 antigen a protein consistently found in carcinomas caused by HPV infection
- has been proposed as a prophylactic or therapeutic vaccine against cervical cancer (Bermudez et al. al., J. of Medicrobiol., 53, 427-433, 2004).
- the gene coding for the E7 antigen was inserted into the vector pLB333 instead of the naked gene.
- the resulting plasmid, pLB356 (pPGroEL: PSExp4: E7), was introduced into L. lactis MG1363 to obtain the recombinant strain MG (pLB356).
- E7 antigen was confirmed by Western Blot after inducing heat shock in the MG recombinant strain (pLB356).
- Example 4 The effect of intranasal (in) administration of the recombinant strain MG (pLB356) obtained in Example 4 was tested in a mouse model developing cancer tumors induced by a tumor line (TC-1) expressing the HPV-16 E7 antigen.
- mice Groups of 12 mice, 6 to 8 weeks of age, were immunized in with PBS, or with the wild strain MG1363 (MG), or with the strain. recombinant MG (pLB356).
- the volume of tumors developed in these mice was measured once a week for 5 weeks. The results of the measurements are shown in FIG. 5.
- the volume of the tumors in the mice vaccinated with the MG strain (pLB356) is 1 cm 3 lower on average than that of the tumors developed by the mice vaccinated with the control strain MG or with PBS, which is 2.7 cm 3 and 2.9 cm 3, respectively .
- the volume of the tumors is therefore significantly reduced in the mice vaccinated with the MG recombinant strain (pLB356).
- mice vaccinated with the MG strain there was no mortality (the 6 mice survived), while the control mice (MG or PBS) showed a mortality of 16% (5%). out of 6 mice survived in each lot).
- the splenocytes of the sacrificed mice were also isolated, then cultured and re-stimulated with a polyhistidine tagged E7 protein ("His-tag”), and purified at from Escherichia coli.
- His-tag polyhistidine tagged E7 protein
- the re-stimulated splenocytes were transferred to a culture plate containing viable TC-1 cells, and incubated for 5 days.
- TC-1 cells Lysis of TC-1 cells by splenocytes was then observed under a microscope (Fig. 6, x100 magnification micrographs). After 5 days of co-culture, the splenocytes of mice immunized with the MG strain (pLB356) clearly proliferated (Fig. 6C, white arrows), unlike the control treatments (Figs 6A and 6B). On the other hand, TC-1 cells, which formed a dense and well-adherent layer in the presence of splenocytes from control mice vaccinated with PBS (Fig. 6A) or with control strain MG (Fig. 6B), have almost completely disappeared.
- Crohn's disease and ulcerative colitis are the two main forms of chronic inflammatory bowel disease (IBD).
- IBD chronic inflammatory bowel disease
- the inflammation observed in ulcerative colitis still affects the rectum and sometimes the colon. It does not affect other segments of the digestive tract, whereas in the case of Crohn's disease, inflammation can reach all parts of the digestive tract (from the mouth to the anus), but preferentially located on the terminal part of the small intestine (ileum) and on the colon.
- probiotics for the treatment of these inflammatory diseases has been suggested for several years and different studies have shown the beneficial effect of such bacterial products tested alone or in combination. These results suggested that probiotic bacteria could be used as carriers of a beneficial gene in the gut, in addition to their inherent and intrinsic powers as an anti-inflammatory agent.
- the recombinant strain MG (pLB350) showed a protective role in two different models of mice, in which acute colitis was caused by DSS (Dextran sulfate sodium) (model used by Steidler et al., 2000, cited above) or by trinitrobenzene sulfonic acid (TNBS) (model used by Foligne et al., Gastroenterology, 133 (3): 862-7, 2007) (results not shown).
- DSS Dist sulfate sodium
- TNBS trinitrobenzene sulfonic acid
- the recombinant strain MG (pLB350) is tested in a model of chronic colitis.
- mice Male C57BL / 6 mice, 6 to 8 weeks old, divided into 4 groups of 8 mice, first received (J1 to 3) a first dose of 2 mg of DNBS (Groups 1 to 3) or ethanol. (Group 4) as a control. A recovery period followed, between D4 and D14. Then, between day 14 and day 23, 5.10 9 CFU of recombinant MG bacteria (pLB350) (Group 1), oral dexamethasone (Group 2), or PBS (Groups 3 and 4). Dexamethasone is a glucocorticoid hormone used in particular to treat various inflammatory diseases such as IBD. A second episode of inflammation was induced on D21 by administration of 1 mg of DNBS. The mice were sacrificed on D24.
- DNBS 2,4-dinitrobenzene sulfonic acid
- the inflammation was evaluated according to the Wallace criteria, and the Wallace score (score 0 to 10 according to macroscopic lesions of the colon) was assigned to each mouse.
- FIG. 7 demonstrate the protective effect of strain MG (pLB350) after the reactivation of colitis by the second administration of DNBS (DNBS + IL10). This effect is greater than that observed after treatment with dexamethasone (DNBS + DEX).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- Public Health (AREA)
- Epidemiology (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Virology (AREA)
- Animal Behavior & Ethology (AREA)
- Molecular Biology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Mycology (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Description
CASSETTES D ' EXPRESSION PROCARYOTES REGULEES PAR LE STRESS
L'invention concerne la production de protéines hétérologues chez des bactéries à Gram-positif, notamment des bactéries lactiques.
A côté de leurs usages traditionnels dans l'industrie agro-alimentaire, qui ont prouvé leur innocuité, les bactéries lactiques, notamment les lactocoques et lactobacilles, sont actuellement de plus en plus utilisées en tant que cellules hôtes pour la production de protéines hétérologues d'intérêt. Des bactéries lactiques recombinantes servent de vecteurs vivants pour délivrer par voie mucosale des molécules d'intérêt pour la santé (pour revues : Daniel et al., Trends Biotechnol. , 29(10), 409-508, 2011 ; et Bermudez- Humarân et al., Microb. Cell Fact., 10 (Suppl 1):S4, 2011).
Parmi les bactéries lactiques, Lactococcus lactis en particulier est une bactérie non invasive et non pathogène, largement utilisée dans la fabrication de produits laitiers, en particulier de fromages. Elle résiste jusqu'à 90% au passage gastrique chez l'homme et chez la souris. L. lactis est la bactérie lactique modèle et fait partie des bactéries les mieux caractérisées avec Escherichia coli et Bacillus subtilis . De ce fait, L. lactis est considérée comme une excellente candidate pour l'expression de protéines d'intérêt pour la santé (antigènes, cytokines, hormones, etc.) au niveau des muqueuses .
Steidler et al. {Science, 289, 1352-1355, 2000) décrivent par exemple l'utilisation d'une souche de L. lactis recombinante exprimant la cytokine interleukine- 10 (IL-10) sous contrôle du promoteur constitutif Pl de L. lactis.
La même équipe a par la suite cherché à identifier des promoteurs constitutifs forts pouvant être utilisés pour exprimer des protéines d'intérêt thérapeutique dans des bactéries du genre Lactococcus
(Demande PCT WO2008/084115) , ces promoteurs étant définis comme étant plus forts que le promoteur du gène de la thymidylate synthase (thyA) de L. lactis. 53 promoteurs candidats répondant potentiellement à cette définition ont été identifiés par analyses transcriptomique et protéomique. Parmi ceux-ci, 17 ont pu être sous-clonés pour tester leur capacité à contrôler l'expression d'une protéine hétérologue : il s'agit des promoteurs des gènes rpoB, dpsA, glnA, glnR, pepV, atpD, pgk, fabF, fabG, rpoA, pepQ, rpsD, sodA, luxS, rpsK, rpIL, et hlIA (ainsi nommés chez L. lactis MG1363) . 4 de ces promoteurs ont effectivement permis d'atteindre le niveau d'expression espéré : les promoteurs des gènes dpsA, pepV, sodA, et hlIA.
Les promoteurs décrits dans les documents cités ci-dessus sont tous des promoteurs constitutifs. Dans certains cas, il est préférable d'utiliser des promoteurs inductibles, permettant de déclencher ou d'arrêter l'expression au moment souhaité. En effet, certaines protéines, telles que les cytokines, peuvent s'accumuler au sein du cytoplasme de la bactérie et dégrader la cellule hôte. Des systèmes d'expression intégrant un promoteur inductible permettent de mieux contrôler l'expression de la protéine hétérologue et de prévenir les effets négatifs qui pourraient résulter de sa surproduction.
Bien que l'on connaisse chez les bactéries lactiques et chez L. lactis en particulier, un très grand nombre de gènes dont l'expression est régulée par divers facteurs, on ne dispose à l'heure actuelle que d'un choix restreint de promoteurs inductibles utilisables en pratique pour la construction de cassettes d'expression de gènes d'intérêt (pour revues : De Vos, Curr. Op. Microbiol., 2, 289-295, 1999 ; Morello et al., J. Mol. Microbiol. Biotechnol., 14 ( 1-3 ): 48-58 , 2008 ; Nouaille et al., Genêt. Mol. Res., 2 (1) : 102-111, 2003). En effet, cette utilisation demande non seulement que les promoteurs concernés soient
inductibles, mais encore qu'il existe un différentiel d'expression suffisant entre les différents états d'induction ; idéalement, l'expression doit atteindre un niveau élevé en conditions d'induction, et être absente ou faible en conditions de non-induction.
Le système NICE (« Nlsin Controlled Expression System ») (Kuipers et al., J. of Biol. Chem. , 270 (45) : 27299-27304, 1995 ; de Ruyter et al., Appl . Environ. Microbiol., 62:3662-3667, 1996 ; Kuipers et al., J. of Biotechnol., 64(1): 15-21, 1998; Mierau et al., Appl Microbiol Biotechnol., 68 ( 6) : 705-17, 2005) est aujourd'hui le plus largement utilisé pour exprimer un gène d' intérêt en fonction de la présence ou non dans le milieu extérieur d'une bactériocine, la nisine. Cependant, les inconvénients inhérents à ce système sont, d'une part, la nécessité de la présence de gènes régulateurs de ce système (apportés par des plasmides, ou clonés et intégrés dans le chromosome bactérien), et d'autre part, la contrainte d'une étape constituée par la mise en présence de la bactérie avec la nisine .
Dans ce contexte, les Inventeurs ont cherché à mettre en œuvre un système d'expression inductible convenant pour l'expression de protéines hétérologues d' intérêt au sein de bactéries lactiques destinées à être utilisées comme vecteur thérapeutique ou vaccinal, et ont eu l'idée de rechercher un système d'expression qui serait induit lors de l'administration des bactéries au sujet que l'on souhaite traiter. Ils sont partis de l'hypothèse que cette administration, qui place les bactéries dans des conditions très différentes de leurs conditions de vie habituelles pouvait induire chez celles-ci différents types de stress : il peut s'agir notamment de stress thermique, si la température corporelle du sujet à traiter est suffisamment élevée par rapport à la température optimale de croissance de la bactérie administrée ; en cas d'administration orale, le stress thermique peut être
accompagné d'un stress acide lors du passage dans l'estomac (où le pH est d'environ 1,5 à 2), puis d'un stress biliaire au niveau du duodénum.
Les Inventeurs ont recherché s'il était possible d'identifier, parmi les promoteurs des nombreux gènes identifiés comme étant induits par un ou plusieurs de ces stress (pour revue cf. par exemple Van de Guchte et al., Antonie van Leeuwenhoek, 82, 187-216, 2002), un promoteur effectivement utilisable en pratique pour contrôler l'expression inductible de protéines hétérologues .
Ils se sont intéressés au promoteur de l'opéron GroESL de Lactococcus lactis. Les protéines GroES et GroEL, présentes dans de nombreuses bactéries, sont des chaperonines et des protéines de réponse au choc thermique ou hsp (pour « heat-shock proteins ») . L'opéron GroESL de Lactococcus lactis subsp. lactis a été décrit par Kim et al. (Gene, 127(1) : 121-126, 1993), qui ont rapporté que sa transcription était inductible par un choc thermique. Arnau et al. {Microbiology, 142, 1685-1691, 1996) ont étudié la cinétique d'induction de la transcription des gènes dnaK, dnaJ et groEL de Lactococcus lactis subsp. cremoris pendant un choc thermique provoqué par une élévation de température, de 30 °C (température optimale de croissance de Lactococcus lactis) à 43°C. Ils ont observé un niveau de transcription allant de 10 fois (pour dnaJ et groEL) à 100 fois (pour dnaK) le niveau de base pendant les 15 premières minutes du choc thermique, et diminuant après 20 minutes.
Les Inventeurs ont cloné le promoteur de l'opéron GroESL de Lactococcus lactis, et ont testé ses capacités à contrôler l'expression d'une protéine hétérologue et son inductibilité dans des conditions reproduisant celles d'une administration in vivo chez 1' homme .
Ils ont constaté qu'en conditions basales (c'est-à-dire en conditions optimales de croissance pour
L. lactis) , le promoteur PGroESL permettait l'expression d'une protéine hétérologue, à un niveau faible, et qu'une élévation de température à 37 °C, bien que plus faible que les températures (supérieures à 40°C) habituellement utilisées pour l'induction d'un stress thermique chez L. lactis, suffisait pour augmenter de 1,3 à 5 fois la quantité de protéine hétérologue produite.
La présente invention a donc pour objet une cassette d'expression comprenant :
- le promoteur (PGroESL) de Lactococcus lactis, et
- une séquence nucléotidique hétérologue codant pour un polypeptide d'intérêt, placée sous contrôle transcriptionnel dudit promoteur.
On définit ici comme : « promoteur PGroESL de L. lactis » un polynucléotide de 82 à 150 pb constituant un promoteur fonctionnel chez L. lactis, et comprenant une séquence nucléotidique présentant au moins 90%, et par ordre de préférence croissante, au moins 91%, au moins 92%, au moins 93%, au moins 94%, au moins 95%, au moins 96%, au moins 97%, au moins 98%, au moins 99%, ou 100%, d'identité avec la séquence suivante :
CTTGACTAAATCTGACCATTGAGAT^AAATAAGAATATGTTAGCACTCAACTATT^GA GTGCTAAAAATAAAAAATGGAGG (SEQ ID NO. : 1) .
Le promoteur PGroESL contient les éléments de cis-régulation suivants, positionnés à titre d'exemple sur la SEQ ID NO. : 1 :
Un site de liaison pour la protéine régulatrice CtsR, aux positions 1-17, la protéine CtsR étant impliquée dans la régulation de différents gènes intervenant dans la réponse au choc thermique ;
Un élément CIRCE (pour l'anglais
« Controlling Inverted Repeat of Chaperone Expression ») , aux positions 40-66, qui est une séquence répétée inversée impliquée dans la régulation de l'expression des protéines chaperonnes ;
Une boîte -35, aux positions 41-46 ;
Une boîte -10, aux positions 64-69 ;
Une boîte ACD (ou ACiD) (cf. Madsen et al., Molec. Microbiol. , 56(3), 735-746, 2005), aux positions 29- 42, impliquée dans la réponse au pH acide ; et
Un site de liaison des ribosomes (RBS, pour l'anglais « Ribosome Binding Site ») , aux positions 78-82.
La séquence SEQ ID NO. : 1, indiquée ici comme séquence de référence, est issue de la souche modèle de Lactococcus lactis subsp. cremoris MG1363 (GenBank NC_009004) .
D' autres promoteurs PGroESL utilisables pour la construction d'une cassette d'expression conforme à l'invention peuvent également être isolés et clonés à partir de n'importe quelle souche de L. lactis, par les techniques classiques du génie génétique.
A titre d'exemples non-limitatifs, on citera : le promoteur PGroESL de la souche A76 (GenBank CP003132) de Lactococcus lactis subsp. cremoris, qui comprend la séquence SEQ ID NO. : 1 ;
le promoteur PGroESL de la souche NZ9000 (GenBank CP002094) de Lactococcus lactis subsp. cremoris, qui comprend la séquence SEQ ID NO. : 1 ;
le promoteur PGroESL de la souche SK11 (GenBank NC_008527) de Lactococcus lactis subsp. cremoris, qui comprend la séquence suivante :
CTTGAC AAATC GACCATTGAGATAAAATAAGAATATGTTAGC CACAAC AT AAGA GTGCTAAAAATAAAAAATGGAGT (SEQ ID NO. : 2) ;
les promoteurs PGroESL des souches IL1403 (GenBank NC_002662) ou CV56 (GenBank CP002365) de Lactococcus lactis subsp. lactis, qui comprennent la séquence :
CTTGACTAAATCTGACCATTGAGATAAAATAAGAATATGTTAGCACTCGTTTAATAAGA GTGCTAAAAAATAAAAAATGGAGG (SEQ ID NO. : 3) ;
le promoteur PGroESL de la souche KF147 (GenBank NC 013656) de Lactococcus lactis subsp. lactis,
qui comprend la séquence suivante :
CTTGACTAAATCTGACCATTGAGATAAAATAAGAATATGTTAGCACTCGTTTAACAAGA GTGCTAAAAAATAAAAAATGGAGG (SEQ ID NO. : 4) .
On définit ici comme « séquence nucléotidique hétérologue » toute séquence nucléotidique autre que celle naturellement située chez L. lactis en aval du promoteur PGroESL, et notamment toute séquence nucléotidique ne comprenant pas celles codant pour les protéines GroES et GroEL de L. lactis. De préférence, il s'agira d'une séquence qui n'est pas issue de L. lactis.
Il peut s'agir de toute séquence codant pour un polypeptide d'intérêt, notamment d'intérêt thérapeutique ou vaccinal, que l'on souhaite faire exprimer par la bactérie hôte. Ledit polypeptide peut le cas échéant être un polypeptide chimérique, associant des séquences polypep- tidiques d'origine diverse.
A titre d'exemples non limitatifs, ladite séquence nucléotidique hétérologue peut être :
- une séquence nucléotidique codant pour une cytokine, par exemple l' interleukine-10 (IL-10), l'IL-12, l'IL-2, l'IL-4, le GM-CFS (« Granulocyte-macrophage colony- stimulating factor ») , ou le TGF-β (« Transforming growth factor-beta ») ;
une séquence nucléotidique codant pour un antigène vaccinal, d'origine virale ou bactérienne, ou d'origine eucaryote, tel qu'un antigène fongique, ou un antigène parasitaire ; l'antigène est par exemple une des protéines E6, E7, ou Ll du virus du papillome humain (VPH) de type 16, la protéine VapA de Rhodococcus equi, la protéine L7/L12 de Brucella abortus, ou la protéine Nue de Staphylococcus aureus ;
une séquence nucléotidique codant pour un inhibiteur de protéase, par exemple l'élafine (ou trappine- 2) , le SLPI (« Secretory leukocyte protease inhibitor ») , ou un des inhibiteurs de protéase à sérine (famille des serpines) ;
- une séquence nucléotidique codant pour une hormone, par exemple la leptine, l'insuline, l'hormone de croissance, l' IGF-1 (« Insulin-like growth factor ») , l'IGF-2, ou le facteur de croissance épidermique (EGF) ;
- une séquence nucléotidique codant pour une enzyme d'origine bactérienne ou eucaryote, par exemple une catalase, une superoxyde dismutase, une lipase, une polymérase, une isomérase, ou une ligase.
Une cassette d'expression conforme à l'invention peut, le cas échéant, comprendre en outre les éléments nécessaires pour permettre l'adressage de la protéine d'intérêt à la surface cellulaire, ou sa sécrétion dans le milieu extérieur.
Dans ce cadre, la cassette d'expression selon l'invention peut comprendre une séquence nucléotidique codant pour un peptide d'adressage extracellulaire placée sous contrôle transcriptionnel du promoteur PGroESL, ladite cassette d'expression permettant le clonage de la séquence nucléotidique hétérologue d' intérêt en fusion traductionnelle avec ledit peptide d'adressage. Le peptide d'adressage peut être par exemple un peptide signal de sécrétion, un domaine transmembranaire, un signal d'ancrage à la paroi, etc.
De nombreux peptides d'adressage utilisables dans le cadre de la présente invention sont connus en eux mêmes. A titre d'exemples non limitatifs, on citera le peptide signal de la protéine Exp4 de L. lactis, défini par la séquence :
MKKINLALLTLATLMGVSSTAVVFA (SEQ ID NO. : 5), ou les peptides identifiés respectivement dans les publications de Poquet et al. (J. Bacteriol., 180, 1904- 1912, 1998), de Le Loir et al. (Appl. Environ. Microbiol., 67, 4119-4127, 2001), et de Ravn et al. (Gène, 242, 347- 356, 2000) .
L'invention concerne aussi un vecteur recombinant comprenant un insert constitué par une cassette
d'expression selon l'invention.
Des vecteurs recombinants conformes à l'invention peuvent être obtenus, de façon classique, par insertion d'une cassette d'expression conforme à l'invention dans un vecteur fonctionnel chez L . lactis.
De très nombreux vecteurs fonctionnels chez L. lactis sont connus en eux-mêmes. L'homme du métier choisira le vecteur le plus approprié (vecteur intégratif ou extra-chromosomique, vecteur à nombre de copies plus ou moins important) en fonction notamment de la nature de la protéine hétérologue à exprimer, et l'usage particulier à laquelle elle est destinée.
L'invention a également pour objet une bactérie de l'espèce Lactococcus lactis, transformée par au moins une cassette d'expression conforme à l'invention.
Le cas échéant, il peut s'agir d'une bactérie provenant d'une souche de L. lactis comportant une ou plusieurs modifications de son génome. Il peut s'agir par exemple de modifications visant à améliorer la production et/ou la sécrétion de protéines exprimées dans ladite bactérie, et/ou à éviter leur dégradation. Par exemple, dans le cadre de la production de protéines exportées, on peut utiliser une souche bactérienne dans laquelle l'activité protéasique PrtP et/ou le cas échéant l'activité protéasique HtrA et/ou ClpP sont inactives, telle que celle décrite dans la Demande PCT WO00/39309, ou une souche bactérienne surproduisant une protéine permettant de stabiliser les protéines exportées, telle que la protéine Nlp4 de Lactococcus lactis, ou un de ses homologues (Poquet et al. 1998, publication précitée), ou encore une souche bactérienne modifiée par ajout d'un gène hétérologue responsable de la sécrétion des protéines, tel que le gène secDF de Bacillus subtilis (Nouaille et al., Appl . Environ. Microbiol., 72(3) :2272-9, 2006).
On peut aussi utiliser une bactérie incluant un gène auxotrophique défectueux, afin de rendre la survie de
cette bactérie dépendante de la présence d'un ou plusieurs composés spécifiques. Le gène auxotrophique visé peut être le gène thyA (Demande PCT WO2011/086172 ) , codant pour la thymidylate synthase, enzyme générant la thymidine monophosphate (dTMP) qui est ensuite phosphorylée en thymidine triphosphate, impliquée dans la synthèse et la réparation de l'ADN, ou le gène air, codant pour l'alanine racémase (Bron et al., Environ. Microbiol., 5663-5370, 2002). Le gène auxotrophique choisi pourra être inactivé par toute méthode connue, et par exemple, par insertion de la séquence nucléotidique hétérologue au niveau du locus de ce gène, dans le chromosome bactérien.
La présente invention a également pour objet l'utilisation d'une bactérie transformée conforme à l'invention pour produire un polypeptide d'intérêt lorsque ladite bactérie est soumise à un choc thermique, résultant de son exposition à une température supérieure à sa température normale de croissance.
Dans ce cadre, les bactéries transformées conformes à l'invention peuvent le cas échéant être utilisées pour produire in vitro un polypeptide d'intérêt. De manière préférée, elles peuvent être utilisées notamment comme médicaments ou comme vaccins, en tant que vecteurs d'administration d'une protéine d'intérêt thérapeutique ou vaccinal .
En particulier la présente invention a pour objet un procédé pour faire produire un polypeptide d' intérêt par une bactérie transformée conforme à l'invention contenant une séquence codant pour ledit polypeptide d' intérêt placée sous contrôle transcriptionnel du promoteur PGroESL, caractérisé en ce que pour induire l'expression dudit polypeptide l'on expose ladite bactérie à une température supérieure à 36°C, et inférieure ou égale à 40°C. De préférence, ladite température sera égale ou supérieure à 36,5°C, et de manière tout à fait préférée égale ou supérieure à 37°C.
Selon un mode de mise en œuvre préféré de ce procédé, ledit polypeptide est une protéine d'intérêt thérapeutique ou vaccinal, et l'exposition de ladite bactérie à la température permettant d'induire l'expression dudit polypeptide est effectuée en administrant ladite bactérie à un sujet, qui peut être de préférence un humain, ou le cas échéant un animal, notamment un mammifère, dont la température corporelle est supérieure à 37 °C.
Les bactéries conformes à l'invention peuvent être administrées en particulier par voie mucosale, plus particulièrement par voies intra-nasale, orale, rectale, ou vaginale, et de préférence par voie intra-nasale ou par voie orale. Leur utilisation permet l'expression in situ de la protéine d'intérêt, au niveau des muqueuses concernées.
L'utilisation des bactéries transformées conformes à l'invention est particulièrement intéressante dans le cadre du traitement de maladies telles que les maladies inflammatoires chroniques de l'intestin (MICI), car elle permet de délivrer localement la protéine d'intérêt, directement dans l'intestin, lors du passage de la bactérie au niveau du duodénum, permettant ainsi une action très localisée de la protéine et donc une efficacité plus importante. Dans ce cadre, elles peuvent notamment être utilisées pour l'administration de cytokines antiinflammatoires, comme l' interleukine-10.
A titre d'autres exemples non-limitatifs d'utilisation de bactéries transformées conformes à l'invention, on citera :
- la vaccination contre le cancer du col de l'utérus, par l'administration intranasale de l'antigène E7 du papillomavirus humain de type 16 ;
une thérapie contre les maladies inflammatoires chroniques de l'intestin (MICI), par l'administration orale de molécules anti-inflammatoires telles que la cytokine IL-10 ou l'élafine ;
une thérapie contre les allergies, par l'administration intranasale de molécules proinflammatoires telles que la cytokine IL-12 ou le TGF-β.
A titre indicatif, les bactéries transformées conformes à l'invention peuvent être administrées à une dose comprise entre 1.108 et 1.1010 UFC (Unités Formant Colonies), de préférence entre 5.108 et 1.1010 UFC, avantageusement entre 5.108 et 5.109 UFC pour une administration intranasale et entre 1.109 et 1.1010 UFC pour une administration orale. Par exemple, elles peuvent être administrées à une dose de 1.109 UFC par voie intranasale ou de 5.109 UFC par voie orale.
La présente invention sera mieux comprise à l'aide du complément de description qui va suivre, qui se réfère à des exemples non-limitatifs, illustrant la construction et l'utilisation de cassettes d'expression conformes à l'invention.
EXEMPLE 1 : CLONAGE DU PROMOTEUR GROESL ET CONSTRUCTION DU SYSTÈME D'EXPRESSION RÉGULÉ PAR LE STRESS.
Une région d'ADN en amont du gène GroESL a été amplifiée par PCR à partir d'ADN génomique de la souche de Lactococcus lactis MG1363.
Les amorces utilisées sont l'amorce sens BglII- ProGroEL de séquence CCAAGATCTAAATGTTTTCTCTTGACTAAATCTGACC (SEQ ID NO. : 6) et l'amorce antisens N el-ProGroEL de séquence AGCTAGCGTTAATAAAGCAAGGTTTATTTTTTTCATATAC (SEQ ID NO. : 7) . Ces amorces ont été conçues de façon à cloner, grâce aux sites de restriction BglII et N el (soulignés) , le produit de la PCR dans le vecteur pLB141 (Morello et al., 2008, précité). De plus, l'amorce antisens a été choisie de manière à introduire le produit de la PCR dans ce vecteur en phase de lecture avec la séquence codant pour les 12 premiers acides aminés du peptide signal PSExp4.
Le produit de la PCR a été digéré, purifié et cloné dans le vecteur intermédiaire pCR®2.1 (TOPO®, Invitrogen) . La séquence du plasmide obtenu, pLB263
(pCR: TOPO: PGroESL) (Fig. 1A) , a été confirmée par digestion enzymatique et par séquençage (Eurofins) .
Le fragment amplifié, contenant le promoteur PGroESL, a la séquence suivante :
ATCTAAATGTTTTCTCTTGACTAAATCTGACCATTGAGATAAAATAAGAATATGTTAGC ACTCAACTATTAAGAGTGCTAAAAATAAAAAATGGAGGAAAGTATA (SEQ ID NO. : 8) .
Le promoteur PGroESL a été isolé du plasmide pLB263, par digestion avec les enzymes BglII et Nhel , et cloné dans le vecteur pLB141 (Fig. 1B) , préalablement digéré avec les mêmes enzymes, en remplacement du promoteur (PnisA) initialement présent dans ce vecteur.
Le plasmide résultant, pLB333
(pPGroESL: PSExp4 :Nuc) (Fig. 1C) , contient une cassette d'expression exprimant PSExp4 en fusion avec la forme mature d'une protéine sécrétée modèle, la nucléase de Staphylococcus aureus (Nue) , sous le contrôle du promoteur PGroESL.
Le plasmide pLB333 présente un site de restriction Nsil, entre la séquence codant pour PSExp4 et le gène rapporteur nue codant pour la nucléase Nue, et un site de clonage multiple à la fin du gène nue et avant le terminateur de transcription trpA (ter) , pour permettre le remplacement de ce gène par un gène d'intérêt.
Ce plasmide a ensuite été introduit chez L. lactis MG1363 pour obtenir la souche recombinante MG(pLB333) .
EXEMPLE 2 : EXPRESSION IN VITRO DE LA PROTEINE NUC .
L'expression du gène rapporteur nue a été testée par Western Blot après avoir induit un choc thermique chez la souche recombinante MG(pLB333) obtenue à l'Exemple 1.
Pour cela, une pré-culture de nuit de la souche MG(pLB333) a été diluée au l/100eme le matin, jusqu'à une densité optique (DO) comprise entre 0,4 et 0,6. Ensuite, trois volumes de 6 ml de la pré-culture diluée ont été
versés dans trois tubes. En parallèle, trois tubes de 6 ml de milieu de culture GM17 contenant 10 μq/ml de chloramphénicol (Cm) ont été préparés et incubés respectivement à 30°C et 37°C. Les trois cultures ont chacune été centrifugées 5 min à 4700 rpm, puis reprises dans les 6 ml de milieu frais GM17+Cm préalablement chauffé. Les tubes ainsi obtenus ont été incubés pendant 5 et 30 min à 30°C et 37°C.
Les tubes ont ensuite été centrifugés 10 min à 13000 rpm, et culot et surnageant ont été séparés. Le surnageant a été précipité au TCA 10% et repris dans du NaOH+bleu de charge (obtention de la fraction S) . Le culot a été repris dans 150 μΐ de PBS+antiprotéase IX, un volume de bille y a été ajouté, et le tout a été passé au système FastPrep® afin de casser les bactéries et libérer les protéines cytoplasmiques (obtention de la fraction C) . La production et la sécrétion de la protéine Nue a été analysée par Western blot à l'aide d'anticorps anti-Nue. Les résultats, illustrés à la Figure 2, démontrent qu'après le choc thermique (5 min à 37°C), la souche MG(pLB333) est capable de produire très fortement la protéine Nue.
EXEMPLE 3 : PRODUCTION IN VITRO D' INTERLEUKINE-10.
L' interleukine-10 (IL-10) est une cytokine anti-inflammatoire précédemment proposée pour son utilisation dans le traitement des maladies inflammatoires chroniques de l'intestin (MICI).
Le gène codant pour l' IL-10 murine a été inséré dans le vecteur pLB333 en remplacement du gène nue. Le plasmide obtenu, pLB350 (pPGroESL : PSExp4 : IL-10 ) , a été introduit chez L. lactis MG1363 pour obtenir la souche recombinante MG(pLB350).
Selon le même protocole que celui décrit dans l'Exemple 2, la production d' IL-10 a été confirmée par Western Blot après avoir induit un choc thermique chez la souche recombinante MG(pLB350). Les résultats, illustrés à la Figure 3, démontrent qu'après le choc thermique, la
souche MG(pLB350) est capable de produire très fortement la protéine IL-10.
EXEMPLE 4 : PRODUCTION IN VITRO DE L'ANTIGÈNE E7 DU VPH DE TYPE 16.
Le papillomavirus humain de type 16 (VPH-16) est un des principaux virus responsables du cancer du col de l'utérus. L'utilisation de l'antigène E7 du VPH-16, protéine retrouvée systématiquement dans les carcinomes provoqués par une infection par un VPH, a déjà été proposée comme vaccin, prophylactique ou thérapeutique, contre le cancer du col de l'utérus (Bermudez et al., J. of Med. Microbiol., 53, 427-433, 2004).
Le gène codant pour l'antigène E7 a été inséré dans le vecteur pLB333 en remplacement du gène nue. Le plasmide obtenu, pLB356 (pPGroEL : PSExp4 : E7 ) , a été introduit chez L. lactis MG1363 pour obtenir la souche recombinante MG(pLB356).
Selon le même protocole que celui décrit dans l'Exemple 2, la production d'antigène E7 a été confirmée par Western Blot après avoir induit un choc thermique chez la souche recombinante MG(pLB356). Les résultats, illustrés à la Figure 4, démontrent qu'après le choc thermique (30 min à 37°C), la souche MG(pLB350) est capable de produire très fortement et dé sécréter efficacement la protéine E7.
EXEMPLE 5 : UTILISATION DES BACTERIES RECOMBINANTES PRODUISANT L'ANTIGÈNE E7 POUR IMMUNISER DES SOURIS.
L'effet de l'administration intranasale (i.n.) de la souche recombinante MG(pLB356) obtenue à l'Exemple 4 a été testé dans un modèle de souris développant des tumeurs cancéreuses induites par une lignée tumorale (TC-1) exprimant l'antigène E7 du VPH-16.
Des groupes de 12 souris, de 6 à 8 semaines d'âge, ont été immunisés par voie i.n. avec du PBS, ou avec la souche sauvage MG1363 (MG) , ou avec la souche
recombinante MG(pLB356) .
Pour cela, un total de 1.109 UFC (Unité formant colonies) de chaque souche a été resuspendu dans 10 pL de PBS. Il a été déterminé que 1.109 UFC de bactéries recombinantes contenaient environ 15 pg d'antigène E7. 5 L de la suspension ainsi obtenue ont été administrés à l'aide d'une micropipette dans chaque narine des souris, aux jours 0, 14 et 28. Au jour 35, soit 7 jours après la dernière immunisation, la moitié de chaque lot de souris (n=6) a été sacrifiée pour l'analyse de la réponse immunitaire, et on a administré à l'autre moitié (n=6) , par injection sous- cutanée (s.c), une lignée tumorale TC-1.
Le volume des tumeurs développées chez ces souris a été mesuré une fois par semaine pendant 5 semaines. Les résultats des mesures sont montrés à la Figure 5. Le volume des tumeurs chez les souris vaccinées avec la souche MG(pLB356) est inférieur de 1 cm3 en moyenne à celui des tumeurs développées par les souris vaccinées avec la souche témoin MG ou avec du PBS, qui est respectivement de 2,7 cm3 et 2,9 cm3. Le volume des tumeurs est donc significativement réduit chez les souris vaccinées avec la souche recombinante MG(pLB356) .
Par ailleurs, chez les souris vaccinées avec la souche MG(pLB356), il n'y a pas eu de mortalité (les 6 souris ont survécu) , alors que les souris témoins (MG ou PBS) présentent une mortalité de 16% (5 souris sur 6 ont survécu dans chaque lot) .
Pour l'analyse de la réponse immunitaire, des prélèvements sanguins ont été effectués au sinus rétro- orbital chez les souris avant leur sacrifice. A partir de ces prélèvements, les sérums ont été récupérés après centrifugation, et stockés à -80°C jusqu'à analyse des anticorps IgG et IgA spécifiques de l'antigène E7 et de différentes cytokines .
Afin de pouvoir déterminer la production de cytokines caractéristiques d'une réponse immune de type Thl
et de déterminer leur activité cytotoxique in vitro, les splénocytes des souris sacrifiées ont également été isolés, puis cultivés et re-stimulés avec une protéine E7 marquée à l'aide d'une étiquette polyhistidine (« His-tag ») , et purifiée à partir d' Escherichia coli. Pour l'essai de cytotoxicité, les splénocytes re-stimulés ont été transférés sur une plaque de culture contenant des cellules TC-1 viables, et incubés pendant 5 jours.
La lyse des cellules TC-1 par les splénocytes a ensuite été observée au microscope (Fig. 6, micrographies au grossissement xlOO) . Après 5 jours de co-culture, les splénocytes des souris immunisées avec la souche MG(pLB356) ont clairement proliféré (Fig. 6C, flèches blanches), contrairement aux traitements témoins (Fig. 6A et 6B) . Par ailleurs, les cellules TC-1, qui ont formé une couche dense et bien adhérente en présence des splénocytes de souris témoins vaccinées avec du PBS (Fig. 6A) ou avec la souche témoin MG (Fig. 6B) , ont presque complètement disparu en présence des splénocytes de souris vaccinées avec la souche recombinante MG(pLB356) (Fig. 6C, cercles blancs), confirmant que les splénocytes de ces souris immunisées induisent une lyse très efficace des cellules tumorales TC-1 in vitro.
EXEMPLE 6 : UTILISATION DES BACTERIES RECOMBINANTES PRODUISANT IL-10 POUR TRAITER DES SOURIS .
La maladie de Crohn et la rectocolite hémorragique sont les deux formes principales de Maladies inflammatoires chroniques de l'intestin (MICI) . L'inflammation observée dans la rectocolite hémorragique atteint toujours le rectum et parfois le côlon. Elle ne touche en aucun cas d'autres segments du tractus digestif, alors que dans le cas de la maladie de Crohn, l'inflammation peut atteindre toutes les parties du tractus digestif (depuis la bouche jusqu'à l'anus), mais se situe préférentiellement sur la partie terminale de l'intestin grêle (iléon) et sur le côlon.
L'utilisation de probiotiques pour le traitement de ces maladies inflammatoires est suggéré depuis plusieurs années et différentes études ont montré l'effet bénéfique de tels produits bactériens testés seuls ou en combinaison. Ces résultats ont suggéré que les bactéries probiotiques pourraient être utilisées comme porteurs d'un gène bénéfique dans l'intestin, en plus de leurs pouvoirs propres et intrinsèques comme agent antiinflammatoire. Cette stratégie a été utilisée pour exprimer l' IL-10 dans des bactéries L. lactis sous contrôle du promoteur PI (Steidler et al., 2000, précité). Des essais cliniques de phase I conduits avec ces bactéries recombinantes ont montré que leur administration n'occasionne pas d'effet délétère chez les patients mais ne permet d'obtenir qu'un effet protecteur de courte durée.
La souche recombinante MG(pLB350) a montré un rôle protecteur dans deux modèles différents de souris, dans lesquels une colite aiguë était engendrée par du DSS (Dextran sulfate sodium) (modèle utilisé par Steidler et al., 2000, précité) ou par de l'acide trinitrobenzène sulfonique (TNBS) (modèle utilisé par Foligne et al., Gastroenterology, 133 (3) : 862-7 , 2007) (résultats non montrés). Dans le présent exemple, la souche recombinante MG(pLB350) est testée dans un modèle de colite chronique.
Le modèle utilisé reproduit les périodes de récupération et de récurrence observées chez les patients atteints de la maladie de Crohn. Pour ce faire, la colite a été induite chez la souris par l'injection intrarectale d'acide 2 , 4-dinitrobenzène sulfonique (DNBS). Des souris mâles C57BL/6 âgées de 6 à 8 semaines, réparties en 4 groupes de 8 souris, ont d'abord reçu (Jl à 3) une première dose de 2 mg de DNBS (Groupes 1 à 3) ou de l'éthanol (Groupe 4) à titre de contrôle. Une période de récupération a suivi, entre J4 et J14. Puis, entre J14 et J23, on leur a administré quotidiennement par voie orale 5.109 UFC de bactéries recombinantes MG(pLB350) (Groupe 1), de la
dexaméthasone (Groupe 2), ou du PBS (Groupes 3 et 4). La dexaméthasone est une hormone glucocorticoïde utilisée notamment pour traiter diverses maladies inflammatoires telles que les MICI. Un second épisode d'inflammation a été induit à J21 par administration d' 1 mg de DNBS . Les souris ont été sacrifiées à J24.
L'inflammation a été évaluée selon les critères de Wallace, et le score de Wallace (note de 0 à 10 selon les lésions macroscopiques du côlon) a été attribué à chaque souris.
Les résultats obtenus (Figure 7) démontrent l'effet protecteur de la souche MG(pLB350) après la réactivation de la colite par la seconde administration de DNBS (DNBS+IL10) . Cet effet est supérieur à celui observé après traitement avec la dexaméthasone (DNBS+DEX) .
Claims
REVENDICATIONS
1) Cassette d'expression comprenant :
- le promoteur (PGroESL) de l'opéron GroESL de Lactococcus lactis, et
- une séquence nucléotidique hétérologue codant pour un polypeptide d'intérêt, placée sous contrôle transcriptionnel dudit promoteur.
2) Cassette d'expression selon la revendication
1, caractérisée en ce qu'elle comprend en outre une séquence nucléotidique codant pour un peptide d'adressage extracellulaire, sous contrôle transcriptionnel du promoteur, ladite cassette d'expression permettant le clonage de la séquence nucléotidique hétérologue en fusion traductionnelle avec ledit peptide d'adressage.
3) Cassette d'expression selon la revendication
2, caractérisée en ce que ledit peptide d'adressage extracellulaire est le peptide signal de la protéine Exp4 de Lactococcus lactis, et a la séquence suivante :
MKKINLALLTLATLMGVSSTAVVFA (SEQ ID NO. : 5) .
4) Vecteur recombinant comprenant un insert constitué par une cassette d'expression selon une quelconque des revendications 1 à 3.
5) Bactérie lactique du genre Lactococcus , transformée par une cassette d'expression selon une quelconque des revendications 1 à 3.
6) Bactérie selon la revendication 5, caractérisée en ce qu'il s'agit d'une bactérie de l'espèce Lactococcus lactis.
7) Bactérie selon la revendication 5 ou 6, pour son utilisation comme médicament ou comme vaccin, comme vecteur d'administration d'une protéine thérapeutique ou vaccinale d'intérêt.
8) Bactérie selon la revendication 7, caractérisée en ce qu'elle est administrée par voie mucosale, de préférence par voie intra-nasale ou par voie orale .
9) Bactérie selon la revendication 7 ou 8, pour le traitement des maladies inflammatoires chroniques de l'intestin, dans laquelle la séquence nucléotidique hétérologue code pour l' interleukine-10.
10) Bactérie selon la revendication 7 ou 8, pour son utilisation comme vaccin contre le cancer du col de l'utérus, dans laquelle la séquence nucléotidique hétérologue code pour l'antigène E7 du papillomavirus humain (VPH) de type 16.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US14/402,282 US20150139940A1 (en) | 2012-05-21 | 2013-05-15 | Stress-regulated prokaryotic expression cassettes |
| EP13737378.3A EP2852407A1 (fr) | 2012-05-21 | 2013-05-15 | Cassettes d'expression procaryotes régulées par le stress. |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| FR1254613 | 2012-05-21 | ||
| FR1254613A FR2990699B1 (fr) | 2012-05-21 | 2012-05-21 | Cassettes d'expression procaryotes regulees par le stress |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2013175358A1 true WO2013175358A1 (fr) | 2013-11-28 |
Family
ID=48793322
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IB2013/053983 Ceased WO2013175358A1 (fr) | 2012-05-21 | 2013-05-15 | Cassettes d'expression procaryotes régulées par le stress. |
Country Status (4)
| Country | Link |
|---|---|
| US (1) | US20150139940A1 (fr) |
| EP (1) | EP2852407A1 (fr) |
| FR (1) | FR2990699B1 (fr) |
| WO (1) | WO2013175358A1 (fr) |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016141108A1 (fr) * | 2015-03-02 | 2016-09-09 | Synlogic, Inc. | Bactéries modifiées pour traiter des maladies pour lesquelles une diminution de l'inflammation intestinale et/ou une plus grande imperméabilité de la muqueuse intestinale s'avèrent bénéfiques |
| EP3081227A1 (fr) | 2015-04-15 | 2016-10-19 | Institut National De La Recherche Agronomique | Lactococcus lactis produisant du tslp ou il-25 et leurs utilisations comme probiotiques et thérapeutiques |
| US10273489B2 (en) | 2014-12-22 | 2019-04-30 | Synlogic Operating Company, Inc. | Bacteria engineered to treat diseases that benefit from reduced gut inflammation and/or tightened gut mucosal barrier |
| US11060073B2 (en) | 2014-12-05 | 2021-07-13 | Synlogic Operating Company, Inc. | Bacteria engineered to treat diseases associated with hyperammonemia |
| US11618894B2 (en) | 2015-11-16 | 2023-04-04 | Synlogic Operating Company, Inc. | Bacteria engineered to reduce hyperphenylalaninemia |
| US11685925B2 (en) | 2015-10-30 | 2023-06-27 | Synlogic Operating Company, Inc. | Bacteria engineered to treat diseases that benefit from reduced gut inflammation and/or tightened gut mucosal barrier |
| US11766463B2 (en) | 2020-03-20 | 2023-09-26 | Synlogic Operating Company, Inc. | Microorganisms engineered to reduce hyperphenylalaninemia |
| US12409195B2 (en) | 2015-05-13 | 2025-09-09 | Synlogic Operating Company, Inc. | Bacteria engineered to reduce hyperphenylalaninemia |
| US12545886B2 (en) | 2017-06-21 | 2026-02-10 | Synlogic Operating Company, Inc. | Bacteria for the treatment of disorders |
Families Citing this family (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080124355A1 (en) | 2006-09-22 | 2008-05-29 | David Gordon Bermudes | Live bacterial vaccines for viral infection prophylaxis or treatment |
| US8241623B1 (en) | 2009-02-09 | 2012-08-14 | David Bermudes | Protease sensitivity expression system |
| US9597379B1 (en) | 2010-02-09 | 2017-03-21 | David Gordon Bermudes | Protease inhibitor combination with therapeutic proteins including antibodies |
| US8524220B1 (en) | 2010-02-09 | 2013-09-03 | David Gordon Bermudes | Protease inhibitor: protease sensitivity expression system composition and methods improving the therapeutic activity and specificity of proteins delivered by bacteria |
| US8771669B1 (en) | 2010-02-09 | 2014-07-08 | David Gordon Bermudes | Immunization and/or treatment of parasites and infectious agents by live bacteria |
| US9593339B1 (en) | 2013-02-14 | 2017-03-14 | David Gordon Bermudes | Bacteria carrying bacteriophage and protease inhibitors for the treatment of disorders and methods of treatment |
| US10676723B2 (en) | 2015-05-11 | 2020-06-09 | David Gordon Bermudes | Chimeric protein toxins for expression by therapeutic bacteria |
| US11180535B1 (en) | 2016-12-07 | 2021-11-23 | David Gordon Bermudes | Saccharide binding, tumor penetration, and cytotoxic antitumor chimeric peptides from therapeutic bacteria |
| US11129906B1 (en) | 2016-12-07 | 2021-09-28 | David Gordon Bermudes | Chimeric protein toxins for expression by therapeutic bacteria |
| CN113637703B (zh) * | 2021-08-06 | 2023-08-25 | 河北科技师范学院 | 一种布鲁氏菌L7/L12和GroES真核表达载体的构建方法及其应用 |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008084115A2 (fr) | 2007-01-12 | 2008-07-17 | Actogenix N.V. | Promoteurs lactococcus et leurs utilisations |
| WO2011086172A1 (fr) | 2010-01-14 | 2011-07-21 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Bactéries probiotiques recombinantes pour la prévention et le traitement du syndrome abdominal inflammatoire (ibd) et du syndrome du côlon irritable (ibs) |
-
2012
- 2012-05-21 FR FR1254613A patent/FR2990699B1/fr not_active Expired - Fee Related
-
2013
- 2013-05-15 EP EP13737378.3A patent/EP2852407A1/fr not_active Withdrawn
- 2013-05-15 US US14/402,282 patent/US20150139940A1/en not_active Abandoned
- 2013-05-15 WO PCT/IB2013/053983 patent/WO2013175358A1/fr not_active Ceased
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008084115A2 (fr) | 2007-01-12 | 2008-07-17 | Actogenix N.V. | Promoteurs lactococcus et leurs utilisations |
| WO2011086172A1 (fr) | 2010-01-14 | 2011-07-21 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Bactéries probiotiques recombinantes pour la prévention et le traitement du syndrome abdominal inflammatoire (ibd) et du syndrome du côlon irritable (ibs) |
Non-Patent Citations (24)
| Title |
|---|
| ARNAU ET AL., MICROBIOLOGY, vol. 142, 1996, pages 1685 - 1691 |
| BAHEY-EL-DIN MOHAMMED ET AL: "Lactococcus lactis as a Cell Factory for Delivery of Therapeutic Proteins", CURRENT GENE THERAPY, BENTHAM SCIENCE PUBLISHERS LTD, NL, vol. 10, no. 1, 1 February 2010 (2010-02-01), pages 34 - 45, XP009153380, ISSN: 1566-5232, DOI: 10.2174/156652310790945557 * |
| BERMUDEZ ET AL., J. OF MED. MICROBIOL., vol. 53, 2004, pages 427 - 433 |
| BERMÙDEZ- HUMARÀN ET AL., MICROB. CELL FACT., vol. 10, no. 1, 2011, pages 4 |
| BRON ET AL., ENVIRON. MICROBIOL., 2002, pages 5663 - 5370 |
| DANIEL ET AL., TRENDS BIOTECHNOL., vol. 29, no. 10, 2011, pages 409 - 508 |
| DE LE LOIR ET AL., APPL. ENVIRON. MICROBIOL., vol. 67, 2001, pages 4119 - 4127 |
| DE RUYTER ET AL., APPL. ENVIRON. MICROBIOL., vol. 62, 1996, pages 3662 - 3667 |
| DE VOS, CURR. OP. MICROBIOL., vol. 2, 1999, pages 289 - 295 |
| FOLIGNE ET AL., GASTROENTEROLOGY, vol. 133, no. 3, 2007, pages 862 - 74 |
| KIM ET AL., GENE, vol. 127, no. L, 1993, pages 121 - 126 |
| KIM S G ET AL: "Cloning and sequencing of the Lactococcus lactis subsp. lactis groESL operon", GENE, ELSEVIER, AMSTERDAM, NL, vol. 127, no. 1, 15 May 1993 (1993-05-15), pages 121 - 126, XP023539742, ISSN: 0378-1119, [retrieved on 19930515], DOI: 10.1016/0378-1119(93)90626-E * |
| KUIPERS ET AL., J. OF BIOL. CHEM., vol. 270, no. 45, 1995, pages 27299 - 27304 |
| KUIPERS ET AL., J. OF BIOTECHNOL., vol. 64, no. 1, 1998, pages 15 - 21 |
| MADSEN ET AL., MOLEC. MICROBIOL., vol. 56, no. 3, 2005, pages 735 - 746 |
| MIERAU ET AL., APPL MICROBIOL BIOTECHNOL., vol. 68, no. 6, 2005, pages 705 - 17 |
| MORELLO E ET AL: "Lactococcus lactis, an efficient cell factory for recombinant protein production and secretion.", JOURNAL OF MOLECULAR MICROBIOLOGY AND BIOTECHNOLOGY 2008 LNKD- PUBMED:17957110, vol. 14, no. 1-3, 2008, pages 48 - 58, XP002682709, ISSN: 1464-1801 * |
| MORELLO ET AL., J. MOL. MICROBIOL. BIOTECHNOL., vol. 14, no. 1-3, 2008, pages 48 - 58 |
| NOUAILLE ET AL., APPL. ENVIRON. MICROBIOL., vol. 72, no. 3, 2006, pages 2272 - 9 |
| NOUAILLE ET AL., GENET. MOL. RES., vol. 2, no. 1, 2003, pages 102 - 111 |
| POQUET ET AL., J. BACTERIOL., vol. 180, 1998, pages 1904 - 1912 |
| RAVN ET AL., GENE, vol. 242, 2000, pages 347 - 356 |
| STEIDLER ET AL., SCIENCE, vol. 289, 2000, pages 1352 - 1355 |
| VAN DE GUCHTE ET AL., ANTONIE VAN LEEUWENHOEK, vol. 82, 2002, pages 187 - 216 |
Cited By (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11845964B2 (en) | 2014-12-05 | 2023-12-19 | Synlogic Operating Company, Inc. | Bacteria engineered to treat diseases associated with hyperammonemia |
| US11060073B2 (en) | 2014-12-05 | 2021-07-13 | Synlogic Operating Company, Inc. | Bacteria engineered to treat diseases associated with hyperammonemia |
| US10273489B2 (en) | 2014-12-22 | 2019-04-30 | Synlogic Operating Company, Inc. | Bacteria engineered to treat diseases that benefit from reduced gut inflammation and/or tightened gut mucosal barrier |
| US11384359B2 (en) | 2014-12-22 | 2022-07-12 | Synlogic Operating Company, Inc. | Bacteria engineered to treat diseases that benefit from reduced gut inflammation and/or tightened gut mucosal barrier |
| AU2016226234B2 (en) * | 2015-03-02 | 2022-02-17 | Synlogic Operating Company, Inc. | Bacteria engineered to treat diseases that benefit from reduced gut inflammation and/or tightened gut mucosal barrier |
| CN107636146A (zh) * | 2015-03-02 | 2018-01-26 | 同生公司 | 被工程化为治疗受益于降低的消化道炎症和/或收紧的消化道粘膜屏障的疾病的细菌 |
| WO2016141108A1 (fr) * | 2015-03-02 | 2016-09-09 | Synlogic, Inc. | Bactéries modifiées pour traiter des maladies pour lesquelles une diminution de l'inflammation intestinale et/ou une plus grande imperméabilité de la muqueuse intestinale s'avèrent bénéfiques |
| WO2016166104A1 (fr) | 2015-04-15 | 2016-10-20 | Ares Trading S.A. | Lactococcus lactis produisant de la tslp ou de l'il-25 et leurs utilisations comme probiotiques et agents thérapeutiques |
| EP3081227A1 (fr) | 2015-04-15 | 2016-10-19 | Institut National De La Recherche Agronomique | Lactococcus lactis produisant du tslp ou il-25 et leurs utilisations comme probiotiques et thérapeutiques |
| US12409195B2 (en) | 2015-05-13 | 2025-09-09 | Synlogic Operating Company, Inc. | Bacteria engineered to reduce hyperphenylalaninemia |
| US11685925B2 (en) | 2015-10-30 | 2023-06-27 | Synlogic Operating Company, Inc. | Bacteria engineered to treat diseases that benefit from reduced gut inflammation and/or tightened gut mucosal barrier |
| US11618894B2 (en) | 2015-11-16 | 2023-04-04 | Synlogic Operating Company, Inc. | Bacteria engineered to reduce hyperphenylalaninemia |
| US12545886B2 (en) | 2017-06-21 | 2026-02-10 | Synlogic Operating Company, Inc. | Bacteria for the treatment of disorders |
| US11766463B2 (en) | 2020-03-20 | 2023-09-26 | Synlogic Operating Company, Inc. | Microorganisms engineered to reduce hyperphenylalaninemia |
| US12171790B2 (en) | 2020-03-20 | 2024-12-24 | Synlogic Operating Company, Inc. | Microorganisms engineered to reduce hyperphenylalaninemia |
Also Published As
| Publication number | Publication date |
|---|---|
| EP2852407A1 (fr) | 2015-04-01 |
| FR2990699B1 (fr) | 2016-02-05 |
| FR2990699A1 (fr) | 2013-11-22 |
| US20150139940A1 (en) | 2015-05-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2013175358A1 (fr) | Cassettes d'expression procaryotes régulées par le stress. | |
| US12252516B2 (en) | Mucoadhesive microorganism | |
| JP6175428B2 (ja) | 細菌のポリシストロン性発現系 | |
| EP1921149A1 (fr) | Microorganimses portant des séquences nucléotidiques codant pour des antigènes et des toxines, procédé de fabrication, et leurs utilisations | |
| US12359210B2 (en) | Genetically modified bacteria stably expressing IL-10 and insulin | |
| JP2023523214A (ja) | 血管作動性腸ペプチドを発現する微生物、及びその用途 | |
| CN106434679A (zh) | 人防御素mHD‑5基因及其相关应用 | |
| CN120464662A (zh) | 一种表达环二腺苷酸的乳酸乳球菌重组菌及其应用 | |
| HK1244033B (zh) | 用於细菌的多顺反子表达系统 | |
| HK1257050B (en) | Polycistronic expression system for bacteria |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13737378 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14402282 Country of ref document: US |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REEP | Request for entry into the european phase |
Ref document number: 2013737378 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2013737378 Country of ref document: EP |