WO2013164359A1 - Combination vaccine for the treatment of leishmaniasis - Google Patents

Abstract

The invention relates to a combination of Leishmania antigens, DNA expression constructs encoding therefor and their use for the prophylactic and therapeutic treatment of Leishmaniasis. A Combination of at least three Leishmania antigens selected from the group comprising KMP-11, P74, TSA, CPA, and CPB is provided.

Description

COMBINATION VACCINE FOR THE TREATMENT OF LEISHMANIASIS

Description

FIELD OF THE INVENTION

[0001] The invention relates to a combination of Leishmania antigens, DNA expression constructs encoding therefore and their use for the prophylactic and therapeutic treatment of Leishmaniasis. Moreover, the invention comprises methods for the manufacture of pharmaceuticals comprising the combination.

BACKGROUND OF THE INVENTION

[0002] The term "Leishmaniasis" covers diverse diseases caused by several species of the protozoan parasite Leishmania, which is transmitted by female phlebotomine sand- flies. Important species causing human Leishmaniasis are e.g. Leishmania (L.) donovani,

L. infantum, L. major, and L. tropica. The sand flies inoculate the parasite into the skin of mammalian hosts during a blood meal. Depending on Leishmania species and host, clinical manifestations range from cutaneous to mucosal and visceral forms of leishmaniasis. While cutaneous lesions tend to heal spontaneously, visceral leishmaniasis (VL) is almost always fatal if untreated (Seaman et al. (1996), Int J Epidemiol 25(4): 862-871).

[0003] Leishmaniasis is endemic in more than 80 countries, resulting in about 2 million new cases annually of which 500,000 show a visceral manifestation. Leishmaniasis is closely related to poverty and constitutes a major health problem in many developing countries. The situation in these countries is impaired as drugs for treatment are few, toxic and/or expensive. An increasing number of drug resistant Leishmania strains hampers the treatment programs additionally (Croft et al. (2006), Clin Microbiol Rev 19: 111-126) and augments the need for a vaccine. [0004] In general, following recovery from disease, there is a strong immunity to the disease and significant T cell responses can be demonstrated in immune individuals (Kemp et al. (1994), Clin Exp Immunol 96(3): 410-415; Gaafar et al. (1995), Clin Exp Immunol 100(2): 239-245). Therefore, it should be feasible to develop an effective vac- cine that predominantly induces a strong and protective T cell response in the vaccinees. However, no efficacious vaccine has reached the market until now.

[0005] Several types of Leishmaniasis vaccines have been evaluated in pre-clinical studies, including killed parasites, live attenuated Leishmania parasites, extracts of parasites, defined subunit vaccines like purified or recombinant proteins and DNA vaccines as well as components of sand fly saliva and immunomodulators. Mice, hamsters and dogs can be protected against experimental live challenge by vaccination. Many leishmanial antigens have been identified but only a few have been tested in humans with a highly variable outcome and/or low efficacy (Okwor and Uzonna (2009), Hum Vaccin 5(5): 291-301; Modabber (2010), International Journal of Antimicrobial Agents 36S: 58-61; Nagill and Kaur (2011), Int Immunopharmacol 11(10): 1464-88).

[0006] There is still no Leishmaniasis vaccine for humans marketed worldwide. The limited commercial potential of such a vaccine and the difficulties related to the complexity and diversity of the disease, have so far significantly impaired the necessary developmental efforts (Modabber (2010), International Journal of Antimicrobial Agents 36S: 58- 61). A vaccine is needed that is safe, efficacious against predominant Leishmania strains, affordable, producible with minimal batch-to-batch variations and preferably stable under tropical conditions without cold chain.

[0007] The state of the art of experimental vaccines against Leishmaniasis is currently represented by defined synthetic or recombinant subunits of Leishmania parasites and DNA vaccines, also as part of a heterologous prime-boost regimen (Palatnik de Sousa (2008), Vaccine 26(14): 1709-1724; Modabber et al. (2010), New generation vaccines (New York/London): 790-807); Nagill and Kaur (2011), Int Immunopharmacol 11(10): 1464-88; Working Group on Research Priorities for Development of Leishmaniasis Vaccines, Costa et al. (2011), PLoS Negl Trop Dis 5(3): e943).

[0008] DNA vaccines against Leishmaniasis are usually designed with plasmids, which in most cases carry the genetic information of only one antigen. The plasmids were injected into animals, either single or as a cocktail of plasmids. Protection was reported in mouse, hamster and/or dog models e.g. for the following antigens: gp63, PSA-2, A2, LACK, CPA, CPB, KMP-11, P4, NH36 and TSA (Modabber et al. (2010), New generation vaccines (New York/London): 790-807). Almost all antigens selected for DNA vaccines have been tested before as a protein vaccine in animal models. Although results varied between experiments, these protein vaccines were protective in at least some animal studies.

[0009] Antigen conservation: There is an extensive antigenic cross-reactivity amongst Leishmania species that is based on conserved antigens. Thus, a vaccine consisting of conserved antigens theoretically protects vaccinees against several species of Leishmania parasites. Additionally, these conserved antigens are expected not to vary over time. For example, the antigens LACK, TSA and KMP-11 are conserved antigens of Leishmania and consequently were used for protein and DNA vaccines. However, depending on the host-parasite relation, the type of vaccine and mode of vaccination, the degree of protection achieved with the same antigen differed dramatically, as shown for the LACK- antigen (Nagill and Kaur (2011), Int Immunopharmacol 11(10): 1464-88). Diverse and even contradicting results were obtained with CPA and CPB, two other (partially) conserved antigens, as well (Rafati et al. (2001), Vaccine 19(25-26): 3369-3375; Poot et al. (2006), Vaccine 24(14): 2460-2468). [0010] Presence of antigens on/in amastigotes: To be successful not only in prophylactic but also in therapeutic approaches against Leishmaniasis, the host^'s immune response must be directed against antigen(s) expressed by the Leishmania parasite stage in the mammalian host, the amastigote. Thus, in the past several amastigote antigens like Gp63, LACK, FML-gp36, L-like cystein proteinases CPA and CPB, P4, P8 and A2, HASPB1 and KMP-11 as well as TSA and LeLFl were studied for potential vaccines (Modabber et al. (2010), New generation vaccines (New York/London): 790-807; Nagill and Kaur (2011), Int Immunopharmacol 11(10): 1464-88). There was not fully reproducible success, again depending on factors like type of vaccine and immunization schedule or host- parasite model employed.

[0011] Recognition of antigens by effector T-cells: Cellular immunity is considered to be the key mediator of resistance to Leishmaniasis by means of Interferon gamma (IFN-γ), which up regulates the production of nitric oxide that leads to oxidative burst of phagocytes harboring Leishmania parasites (Working Group on Research Priorities for Development of Leishmaniasis Vaccines, Costa et al. (2011), PLoS Negl Trap Dis 5(3): e943). Thus, the induction of an efficacious immune response against Leishmaniasis relies on a sufficiently immunogenic antigen, which is presented properly to the T cells. Howev- er, there is no clear picture yet about the immune correlates of protection, as also a strong

Thl type of immune response provides no definite guarantee for prevention or resolution of symptoms (Follador et al. (2002), Clinical infectious diseases 34(11): E54-58; Anderson et al. (2005), Journal of Immunology 174(5): 2934-2941). The role of antibodies has been discussed controversially too, as function, subclass and specificity of antibodies are probably influencing the outcome of an infection as well (Working Group on Research

Priorities for Development of Leishmaniasis Vaccines, Costa et al. (2011), PLoS Negl Trap Dis 5(3): e943).

[0012] Multiple gene or sequence-fusion DNA vaccines: Multiple gene DNA vaccines are considered to be a promising approach for Leishmaniasis vaccines (Palatnik de Sousa

(2008), Vaccine 26(14): 1709-1724). Multiple antigen vaccines can offer two advantages: First, the use of multiple antigens is likely to induce a broader immune response and thus induce more different T cell clones with different specificities. Second, T cellular immune responses are MHC restricted (HLA in humans), so restricted by the MHC (HLA) poly- morphism, all with different specificities for the antigenic peptides. Thus, a multiple antigen vaccine implies a much larger number of T cell epitopes as well as much better chance of providing the right epitopes for the target populations. However, in subunit or recombinant protein vaccines as well as in DNA vaccines, multiple antigens were employed up to now only rarely. To evaluate the efficacy of vaccines comprising a cocktail of antigens encoded by DNA molecules, studies with the following combinations have been reported:

• CPA and CPB, both wild-type sequences of L. major (Rafati et al. (2001), Vaccine 19(25-26): 3369-3375)

· TSA and LmSTIl, both wild-type sequences of L. major (Campos-Neto et al.

(2002), Infect Immun 70(6): 2828-2836)

• LACK, LmSTI l and TSA, all wild-type sequences of L. major (Mendez et al.

(2002), Vaccine 20(31-32): 3702-3708) • LACK, HI, H2A, H2B, H3, H4, PSA-2, TSA, STI1, ARP, all wild-type sequences of L. donovani (Saldarriaga et al. (2006), Vaccine 24(11): 1928-1940)

• LACK, KMP-11, TSA (TRYP), Gp63, all wild-type sequences of L. infantum (Rodriguez-Cortes et al. (2007), Vaccine 25(46): 7962-7971)

· LACKp36, TSA, LmSTIl, LeIF, all wild-type sequences against L. braziliensis

(Salay et al. (2007), Clinical and Vaccine Immunology 14(9): 1 173-1181)

• CPA, LmSTIl, TSA, LACKp24, all wild-type sequences of L. major (Ahmed et al. (2009), Vaccine 27(1): 99-106) [0013] Based on sequence comparison and computer based prediction or in vitro / ex vivo identification of epitopes, design of artificial, i.e. non wild-type DNA sequences has been performed for vaccines against diseases other than Leishmaniasis and in some cases resulted in multi-epitope vaccines (Livingston et al. (2001), Vaccine 19(32): 4652-4660). [0014] DNA sequences optimized for codon-usage and mRN A- stability: Related to diseases other than Leishmaniasis, there are a number of DNA vaccines incorporating sequences that are codon-usage optimized to the target species (Gao et al. (2003), AIDS Res Hum Retroviruses 19(9): 817-823; Ko et al. (2005), Infect Immun 73(9): 5666-5674). Those optimized sequences often outperformed the wild-type sequences in terms of im- munogenicity and elicited an increased CTL response in animal studies.

[0015] Use of immunological adjuvants: Most vaccines marketed today contain one or more adjuvants, which are understood to be non-antigenic molecules having the potential of stimulating the immune system by their mere presence. Thus, they are added to vac- cines in order to strengthen the response of the immune system caused by an antigenic compound and shall facilitate the vaccination's efficacy.

[0016] Protein- or peptide-based vaccines are regularly adjuvated with aluminum hydroxide. While several particle-based adjuvants are currently in clinical development, the use of DNA molecules containing unmethylated CG motifs has recently gained track

(Higgins et al. (2007), Expert Rev. Vaccines 6(5): 747-759). One example of such a compound is "dSLIM", a non-coding, dumbbell-shaped immunostimulatory molecule, as de- scribed in EP 1 196 178. Its potential as an adjuvant has been shown by its application in several vaccines, as described e.g. in EP 1 699 480.

BRIEF SUMMARY OF THE INVENTION

[0017] According to the disclosure, a combination for the treatment of Leishmaniasis is provided comprising at least one nucleotide sequence encoding for at least three Leishma- nia antigens selected from the group comprising KMP-11, P74, TSA, CPA, and CPB. [0018] The antigens may be encoded by at least one DNA expression construct.

[0019] Each antigen may also be encoded by a separate DNA expression construct.

[0020] The DNA expression constructs according to the disclosure may consist of cova- lently closed, linear DNA molecules, which have a linear double-stranded region, wherein the double strand is formed by single strands which are linked by short single-stranded loops, or circular double-stranded DNA molecules.

[0021] A combination is further provided, wherein the double-stranded region only con- sists of the coding sequence under the control of a promoter that is operable in mammals and a termination sequence.

[0022] Furthermore, at least one DNA expression construct may be coupled to a peptide and the peptide may be a Thl -peptide.

[0023] It is also intended that the Thl -peptide may comprise the amino acid sequence PKKKR VEDPYC, wherein the sequence is coupled to one of the hairpin loops via an amino-linker.

[0024] According to the disclosure, a combination is also provided comprising at least one nucleotide sequence selected from the group comprising SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5. [0025] A combination for the treatment of Leishmaniasis is further provided comprising at least three Leishmania antigenic peptides selected from the group comprising KMP-11 , P74, TSA, CPA, and CPB. [0026] At least one antigenic peptide may be encoded by a sequence selected from the group comprising SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5.

[0027] Furthermore, according to the disclosure a pharmaceutical for the treatment of Leishmaniasis is provided comprising a combination as described above.

[0028] The pharmaceutical may additionally comprise a pharmaceutically acceptable carrier. [0029] The pharmaceutical can be a vaccine.

[0030] The vaccine may be solid, liquid, solid/liquid or gaseous.

[0031] The vaccine can be administered orally, by intramuscular injection, by intrader- mal injection, by subcutaneous injection, by puncture, transdermally or intranasally.

[0032] The vaccine may additionally comprise an adjuvant.

[0033] It is also intended that the adjuvant can be a DNA molecule comprising at least one unmethylated CG motif.

[0034] The DNA molecule comprising an unmethylated CG motif can be a partially single-stranded, dumbbell-shaped, covalently closed DNA molecule, comprising one or more sequences with the formula N¹N²CGN³N⁴ wherein N^JN² is selected from the group con- sisting of GT, GG, GA, AT, and AA; and N³N⁴ is selected from the group consisting of

CT or TT, and C is deoxycytidine, G is deoxyguanosine, A is deoxyadenosine, and T is deoxythymidine . [0035] A further object of the present disclosure is the use of the above-described combinations for the manufacture of a pharmaceutical for the treatment of Leishmaniasis.

[0036] The above-described pharmaceutical may also be used and the pharmaceutical may be a vaccine. The vaccine may be solid, liquid, solid/liquid or gaseous and can be administered orally, by intramuscular injection, by intradermal injection, by subcutaneous injection, by puncture, transdermally or intranasally.

[0037] It is further object of the present disclosure that the vaccine which is used additionally comprises an adjuvant. The adjuvant can be a DNA molecule comprising an un- methylated CG motif. The DNA molecule comprising an unmethylated CG motif may be a partially single- stranded, dumbbell-shaped, covalently closed DNA molecule, comprising one or more sequences with the formula N¹N²CGN³N⁴ wherein N^JN² is selected from the group consisting of GT, GG, GA, AT, and AA; and N³N⁴ is selected from the group consisting of CT or TT, and C is deoxycytidine, G is deoxyguanosine, A is deoxyadeno- sine, and T is deoxythymidine.

DETAILED DESCRIPTION OF THE INVENTION

[0038] It is an object of the present disclosure to provide a novel therapeutic and prophylactic vaccine against Leishmaniasis in mammals, which is suitable for treatment and prophylaxis of Leishmaniasis caused by different strains of Leishmania parasites and for target populations of diverse genetic background.

[0039] The term "Leishmaniasis" covers diverse diseases caused by several species of the protozoan parasite Leishmania, which is transmitted by female phlebotomine sandflies. Important species causing human Leishmaniasis are e.g. Leishmania (L.) donovani, L. infantum, L. major, and L. tropica.

[0040] The disclosure provides a novel vaccine for the prevention and treatment of Leishmaniasis in mammals, particularly humans. It is to convey protection against different types of Leishmaniasis, caused by diverse strains of Leishmania parasites, and for target populations of diverse genetic background. The vaccine shall be used for prophylactic and therapeutic indications of Leishmaniasis. The production is standardized with low batch-to-batch variations.

[0041] The term "vaccination" used in this disclosure refers to the administration of material ("a vaccine") to produce immunity to a disease. Vaccines can prevent or ameliorate the effects of infection by many pathogens such as viruses, fungi, protozoan parasites, bacteria but also of allergic diseases and asthma, as well as of tumors. Vaccines typically contain one or more adjuvants, e.g. immunostimulatory nucleic acids, used to boost the immune response. Vaccination is generally considered to be the most efficacious and cost- effective method of preventing infectious and other diseases.

[0042] The material administered can, for example, be viable but attenuated forms of pathogens (such as fungi, bacteria or viruses), killed or inactivated forms of these pathogens, purified material such as proteins, nucleic acids encoding antigens, or cells such as tumor cells or dendritic cells. In particular, DNA vaccination has recently been developed. DNA vaccination works by introduction of DNA encoding antigens into cells of vertebrates. Specific cells of the immune system that recognize the antigens expressed will mount an attack against these proteins and against cells expressing them. One advantage of DNA vaccines is that they are very easy to produce and to store. In addition, DNA vaccines have a number of advantages over conventional vaccines, including the ability to induce an extended range of immune response types.

[0043] Vaccination can be used as a prophylactic approach, leading to immunity against the antigen in the vaccinated, healthy individual upon exposure to the antigen. Alternatively, a therapeutic vaccination can cause an improved response of the immune system of the vaccinated, but previously infected or already diseased individual, by guiding the critical part of the immune system of the individual towards the antigens. Both prophylactic and therapeutic vaccination can be applied to humans as well as animals.

[0044] A few experimental vaccines have been tested therapeutically in mice without being developed further. For example the most recently published attempt (Datta et al, 2012) comprises a vaccine consisting of radio-attenuated Leishmania promastigotes. The vaccine was generated by first obtaining amastigotes directly from spleens of infected animals and transforming them into promastigotes under laboratory small-scale cell culture conditions, including antibiotics and material from animal origin, and subsequent irradiation. Thus, large scale production of this vaccine is almost impossible and not standardis- able, so it likely will remain in experimental stage as other vaccines against Leishmaniasis based on whole parasites. In addition, diagnostic differentiation of vaccinated and infected individuals is impossible, thus the vaccine would increase diagnostic problems and impede control of human infection.

[0045] Another experimental therapeutic vaccine Ad5-KH tested in mice is based in on an adenoviral vector, employing the two antigens HASP-B and Kmpl l only. Although a single vaccination with Ad5-KH inhibited splenic parasite growth in mice by ~66%

(Maroof et al, 2012), the inclusion of only two antigens induces a considerably less comprehensive immune response than the vaccine of invention and in addition, anti-vector immunity is likely to compromise repeated vaccination schedules. [0046] In addition, the application of a pharmaceutical can be used as a therapeutic approach. A "pharmaceutical" within the present disclosure refers to a medicine or a remedy that treats a disease or prevents or alleviates the symptoms of a disease.

[0047] Therapeutic treatment of humans suffering from visceral Leishmaniasis with chemotherapeutics is under constant discussion because of severe side effects, a considerable number of relapses and the development of multi-resistant Leishmania strains (Duth- ie et al, 2011). Currently, a liposomal formulation of Amphotericin B (AmBisome®) is the drug of choice for treatment of visceral Leishmaniasis. The usefulness of Amphotericin B is limited especially due to severe nephrotoxicity, which could result in kidney fail- ure (Chattopadhyay and Jafurulla, 2011). Amphotericin B -related side effects are dose dependent, so there is high interest in reducing the dose. Although as a first success, side effects of Amphotericin B have been reduced to a certain extent by liposomal formulation (AmBisome®), a dose reduction or replacement of this and other chemotherapeutics is still highly favorable. Thus, the concept of immuno-chemotherapy and therapeutic vac- cines has been developed.

[0048] The disclosure provides a DNA vaccine comprising an absolutely novel combination of five Leishmania antigens. The sequences of the antigens have been created as consensus sequences of corresponding antigens of various Leishmania species and have been optimized for improved immune responses (see Table 1 for sequences).

Table 1. Antigens and their nucleotide sequences.

SEQ ID Name antigen Nucleotide Sequence (5 '-3')

NO:

1 kinetoplast ATGGCCACCACCTACGAGGAATTCAGCGCCAAGCTGG membrane ACCGGCTGGACGAAGAGTTCAACCGGAAGATGCAGG protein (KMP- AACAGAACGCCAAGTTCTTCGCCGACAAGCCCGACGA

11) GAGCACCCTGAGCCCCGAGATGAAAGAGCACTACGA

GAAGTTCGAGCGGATGATCAAAGAGCACACCGAGAA

ATTCAACAAGAAGATGCACGAGCACAGCGAGCACTTC

AAGCAGAAGTTCGCCGAGCTGCTGGAACAGCAGAAG

GCCGCCCAGTACCCCAGCAAGTGA

2 thiol- specific ATGAGCTGCGGCAACGCCAAGATCAACAGCCCTGCCC antioxidant CCCCATTCGAAGAGGTGGCCCTGATGCCCAACGGCAG

(TSA) CTTCAAGAAGATCAGCCTGAGCGCCTACAAGGGCAAG

TGGGTGGTGCTGTTCTTCTACCCCCTGGACTTCAGCTT

CGTGTGCCCCACCGAGATCATTGCCTTCAGCGACAAC

GTGTCCCGGTTCAACGAGCTGAACTGCGAGGTGCTGG

CCTGCAGCATGGACAGCGAGTACGCCCATCTGCAGTG

GACCCTGCAGGACCGGAAGAAGGGCGGACTGGGCGC

CATGGCCATCCCCATGCTGGCCGACAAGACCAAGTCT

ATCGCCCGGTCCTACGGCGTGCTGGAAGAGTCTCAGG

GCGTGGCCTACCGGGGCCTGTTCATCATCGACCCCCA

CGGCATGGTCCGCCAGATCACCGTGAACGACATGCCC

GTGGGCCGGAACGTGGAAGAGGTGCTGCGGCTGCTCG

AAGCCTTTCAGTTCGTGGAAAAGCACGGCGAAGTGTG

CCCCGCCAACTGGAAGAAAGGCGCCCCTGCCATGAAG

CCCGAGCCCAATGCCAGCGTGGAAGGCTACTTCAGCA

AGCAGTGA

3 P74/elongation ATGGGCAAGGACAAGGTGCACATGAACCTGGTGGTG factor- 1 alpha GTCGGACACGTGGACGCCGGCAAGAGCACAGCCACC

(P74/EF-l ) GGCCACCTGATCTACAAGTGCGGCGGCATCGACAAGC

GGACCATCGAGAAGTTCGAGAAAGAGGCCGCCGAGA

TCGGCAAGGCCAGCTTTAAGTACGCCTGGGTGCTGGA

CAAGCTGAAGGCCGAGAGAGAGCGGGGCATCACCAT

CGATATCGCCCTGTGGAAGTTCGAGTCCCCCAAGAGC

GTGTTCACCATCATCGACGCCCCTGGCCACCGGGACT

TCATCAAGAACATGATCACCGGCACCAGCCAGGCCGA

CGCCGCCATCCTGATGATCGATAGCACCCACGGCGGC

TTCGAGGCCGGCATCAGCAAGGACGGCCAGACCAGA

GAGCACGCCCTGCTGGCCTTCACCCTGGGCGTGAAGC

AGATGGTGGTCTGCTGCAACAAGATGGACGACAAGAC

CGTGACCTACGCCCAGAGCAGATACGACGAGATCAGC

AAAGAAGTGGGCGCCTACCTGAAGAGAGTGGGCTAC

AACCCCGAGAAAGTGCGGTTCATCCCCATCAGCGGCT

GGCAGGGCGACAACATGATCGAGAGATCCGACAACA

TGCCCTGGTACAAGGGCCCCACACTGCTGGACGCCCT

GGACATGCTGGAACCCCCCGTGCGGCCCGTGGACAAG

CCTCTGAGACTGCCCCTGCAGGACGTGTACAAGATCG

GCGGAATCGGCACCGTGCCCGTGGGCAGAGTGGAAA

CCGGCATCATGAAGCCCGGCGACGTGGTCACATTCGC

CC CTGCC AAC GTG AC C ACC G AAGTG AAGTC CATC GAG

ATGCACCACGAGCAGCTGGCCGAGGCCCAGCCTGGCG

ACAACGTGGGCTTCAACGTGAAGAACGTGTCCGTGAA

GGACATCAGACGGGGCAACGTGTGCGGCAACAGCAA

GAACGACCCCCCCAAAGAAGCCGCCGACTTCACAGCC

CAGGTCATCGTGCTGAACCACCCCGGCCAGATCAGCA

ACGGCTACGCCCCCGTGCTGGACTGCCACACCAGCCA

CATTGCCTGCAGATTTGCCGAGATCGAGAGCAAGATC

GACCGGCGGAGCGGCAAAGAGCTGGAAAAGAACCCC

AAGGCCATCAAGAGCGGCGACGCTGCTATCGTGAAGA

TGGTGCCCCAGAAACCTATGTGCGTGGAAGTGTTCAA CGATTACGCCCCCCTGGGCAGATTCGCCGTGCGGGAC ATGAGACAGACAGTGGCCGTGGGCATCATCAAGGGC GTGAACAAGAAAGAGGGCAGCGGCGGCAAAGTGACC AAGGCCGCTGCCAAGGCCGCCAAGAAGTGA

cystein ATGGCCAGACGGAACCCCTTCCTGTTCGCTATCGTGGT proteinase A CACAATCCTGTTCGTCGTGTGCTACGGCAGCGCCCTG (CPA) ATCGCCCAGACACCCCTGGGCGTGGACGACTTTATCG

CCAGCGCTCACTACGGCCGGTTCAAGAAGCGGCACGG

CAAGCCTTTCGGCGAGGACGCCGAGGAAGGCAGACG

GTTCAACGCCTTCAAGCAGAATATGCAGACCGCCTAC

TTCCTGAACGCCCACAACCCCCACGCCCACTACGACG

TGTCCGGCAAGTTCGCCGACCTGACCCCCCAGGAATT

TGCCAAGCTGTACCTGAACCCCAACTACTACGCCAGA

CACGGCAAGGACTACAAAGAACATGTGCACGTGGAC

GACAGCGTGCGGAGCGGCGTGATGAGCGTGGACTGG

CGGGAAAAGGGCGTGGTCACCCCCGTGAAGAACCAG

GGAATGTGCGGCAGCTGCTGGGCCTTCGCCACCACCG

GCAATATCGAGGGCCAGTGGGCCCTGAAGAACCACA

GCCTGGTGTCCCTGAGCGAACAGGTGCTGGTGTCCTG

CGACAATATCGACGACGGCTGCAACGGCGGCCTGATG

GAACAGGCTATGCAGTGGATTATCAACGACCACAACG

GCACCGTGCCCACCGAGGACAGCTACCCTTACACCTC

TGCTGGCGGCACCAGACCCCCCTGTCACGATAACGGC

ACCGTGGGCGCCAAGATCGCCGGCTATATGAGCCTGC

CCCACGACGAGGAAGAGATCGCCGCCTACGTGGGCA

AGAACGGACCTGTGGCCGTGGCCGTGGACGCCACCAC

CTGGCAGCTGTACTTCGGCGGCGTCGTGACCCTGTGCT

TCGGCCTGAGCCTGAACCACGGCGTGCTGGTCGTGGG

CTTCAACAGACAGGCCAAGCCCCCCTACTGGATCGTG

AAGAACAGCTGGGGCAGCTCTTGGGGCGAGAAGGGC

TATATCCGGCTGGCTATGGGCAGCAACCAGTGCCTGC

TGAAGAACTACGCCGTGACCGCCACAATCGACGACAG CAACACCAGCCACGTGCCCACCACCGCCGCCTAA cystein ATGGCCACAAGCAGAGCCGCCCTGTGTGCCGTGGCCG proteinase B TCGTGTGTGTGGTGCTGGCTGCCGCTTGTGCCCCTGCC (CPB) AGAGCAATCTACGTGGGCACACCAGCCGCCGCTCTGT

TCGAGGAATTCAAGCGGACCTACAGACGGGCCTACGG

CACCCTGGCCGAGGAACAGCAGCGGCTGGCCAACTTC

GAGCGGAACCTGGAACTGATGAGAGAGCACCAGGCC

CGGAACCCCCACGCCAGATTCGGTATCACCAAGTTCT

TCGACCTGAGCGAGGCCGAGTTCGCCGCCAGATACCT

GAACGGCGCTGCCTACTTCGCCGCTGCCAAACAGCAC

GCCGGCCAGCACTACAGAAAGGCCAGGGCCGATCTG

AGCGCCGTGCCTGACGCCGTGGACTGGCGGGAAAAG

GGCGCCGTGACCCCCGTGAAAGATCAGGGCGCCTGCG

GCAGCTGCTGGGCCTTTTCTGCCGTGGGCAATATCGA

GTGA

[0049] All five antigens are conserved amongst many Leishmania species, abundant in amastigotes, present on infected macrophages, recognized by effector T cells and protective in in vivo models. They are derived from and thus present in recent and old Leishmania isolates from endemic target foci and contain a multitude of T cell epitopes recognized by target populations. They represent contemporary and conserved antigenicity.

[0050] One antigen is the kinetoplast membrane protein (KMP-11), which was found to be highly conserved in different Leishmania species and highly immunogenic for T cell- mediated immune responses as established with human T cells in vitro (Basu et al. (2007), J Infect Dis 195(9): 1373-1380). KMP-11 is expressed in both pro- and amastigote stages of the parasites with higher levels in promastigotes. It has been shown to induce protective as well as curative immune responses in a mouse model for L. donovani infection (Basu et al. (2005), J Immunol 174(11): 7160-7171; Basu et al. (2007), Infect Immun 75(12): 5956-5966; Bhaumik et al. (2009), Vaccine 27(9): 1306-1316). [0051] The second antigen is the thiol- specific antioxidant (TSA) (Webb et al. (1998), Infect Immun 66(7): 3279-3289). TSA is expressed in the promastigote and amastigote stage of Leishmania. The recombinant protein induced strong cellular immune responses in mice and protection against parasite challenge (Webb et al. (1998), Infect Immun 66(7): 3279-3289). A protein vaccine was recently shown to be safe and well tolerated in humans

(Velez et al. (2009), Vaccine 28(2): 329-337). Our studies have shown that TSA induces strong T cell responses in human Leishmaniasis patients. TSA is relatively well conserved among Leishmania species but contains some species-specific amino acids variations. [0052] The third antigen selected is P74, the elongation factor- 1 alpha (EF-l ), a completely conserved protein in Leishmania parasites. P74 was found by analysing excreted/secreted proteins in culture supernatant of axenic amastigotes of L. major (WO 2006/108720; therein described as "Clone 74"). Excreted/secreted proteins are assumed to be delivered efficiently to the antigen processing machinery of the host and by- stander antigen-presenting cells, which results in a better presentation to the cells of the immune system. We could demonstrate that P74 induces a T-cellular immune response in humans.

[0053] The fourth and the fifth antigen are the cystein proteinases A and B (CPA and CPB). Both antigens are involved in eukaryotic autophagy processes which are part of a catabolic system whereby eukaryotic cells can degrade and recycle proteins and organelles (Levine and Klionsky, 2004; Reggiori and Klionsky, 2005). Cathepsin L-like cysteine proteinases (CPs), which are predominantly expressed and active in amastigotes have been considered as a virulence factor. Three classes of CPs have been identified which are conserved in many Leishmania species. Both native and recombinant forms of the cysteine proteinases are recognized by the immune system of individuals recovered from leishmaniasis (Rafati et al. 2003, Mottram et al. 2004). Recombinant CPB, in combination with different adjuvants, induces long lasting immunity against L. major infection in BALB/c mice, while DNA vaccination was more efficient when a cocktail of plasmids encoding CPA and CPB has been used (Rafati et al. 2001).

[0054] All currently known DNA vaccines against Leishmaniasis employ wild-type DNA sequences of one Leishmania species. In the vaccine according to the present disclo- sure, no wild-type DNA sequences are present. In contrast to all other vaccines comprising one or two of the above listed five antigens, the inventors have optimized all DNA sequences for expression in humans.

[0055] Moreover, the amino acid sequences of the antigens TSA, CPA and CPB in the vaccine of the present disclosure are different from any known wild-type amino acid sequence. By comparing and adjusting wild-type amino acid sequences of different recent Leishmania isolates of various Leishmania species, concensus amino acid sequences and thereby universal antigens have been created, ensuring an efficacious immune response against a broad variety of Leishmania pathogens. In case of CPB the variable C-terminal section of the protein has been removed, leaving only the conserved N-terminal portion. This enriches for antigenic determinant because these antigenic portions are located in the conserved part. The chosen sequences include the identified active epitopes, yielding artificial sequences and a certain degree of enrichment for antigenicity.

[0056] "Wild-type" sequences within the meaning of the present disclosure refer to the non-mutated version of a gene common in nature or the allele required to produce the wild-type phenotype. The wild type phenotype is the most common form or phenotype in nature or in a natural breeding population. In genetics, the wild-type organisms serve as the original parent strain before a deliberate mutation is introduced.

[0057] The optimized DNA sequences of the five antigens are incorporated into separate MIDGE-Thl vectors that induce and support T cell responses. MIDGE vectors are linear, double stranded DNA molecules covalently closed at both ends by single-stranded loops of DNA (Schakowski et al. (2001), Mol Ther 3(5 Pt 1): 793-800). The closed structure protects the molecule from rapid degradation by exonucleases. MIDGE vectors contain the CMV immediate-early enhancer/promoter region (PCMV) for strong constitutive gene expression. A chimeric intron (I) precedes the coding sequence of the antigens. The intron comprises the 5 ^' donor splice site of the first intron of the human β-globulin gene and the 3 ^' acceptor splice site of an intron of the variable region of the immunoglobulin heavy chain gene. The polyadenylation (pA) site is the late protein pA site of the Simian Virus 40 (SV40). [0058] MIDGE-Thl vectors are MIDGE vectors with a peptide attached (Thl-peptide) (Schirmbeck et al. (2001), J Mol Med 79(5-6): 343-350). The peptide has the amino acid sequence PKKKR VEDPYC derived from the polyomavirus large T antigen and is coupled to a thymidine of one of the hairpin loops via an amino-linker (Figure 1).

[0059] Amino-linkers can be used to incorporate an active primary amino group onto the 5 '-end of an oligonucleotide. The amino group is usually separated from the 5 '-end nucleotide base by a carbon spacer arm of varying lengths to minimize steric interaction between the amino group and the oligonucleotide. The presence of the amino group allows the user to label the oligonucleotide at the 5 '-end with a variety of different affinity, reporter or protein/peptide moieties, depending on the application. Examples include biotin, digoxigenin, and fluorescent dyes or quenchers, enzymes and peptides (for example, the Thl-peptide). BRIEF DESCRIPTION OF THE FIGURES

Figure 1 : Schematic depiction of a MIDGE-Thl vector with attached Thl peptide

Figure 2: Parasite burden in vaccinated animals after challenge

Figure 3a: T-cell proliferation as detected by IL-2 production

Figure 3b: T-cell proliferation as detected by the MTS assay

Figure 4: Comparison of the antibody titers against 4 of the 5 antigens before and after vaccination

Figure 5 : Vaccination efficacy in animal experiments using single antigen vaccination approach

Figure 6: Lesion size in challenged C57BL/6 mice

Figure 7: Parasite burden in vaccinated hamsters after challenge

Figure 8: Spleen parasite burden (LDU) by groups, 31 days post infection i.v. with L. do- novani

EXAMPLES

EXAMPLE 1 : Study of the prophylactic effect against Leishmania donovani [0060] To study the effect of the vaccine of the invention, mouse model experiments were performed to determine the protective efficacy against the parasite, as well as to prove immunogenicity by detection of serum antibodies and specific T-cells. Briefly, 6-8 weeks old male BALB/cJ mice were injected with 25 μΐ of the vaccine containing varying concentrations of the MIDGE vectors encoding the 5 antigens of the present invention

(animal groups B-E), or with PBS buffer (group A) as placebo control, with each group containing around 16 animals. Vaccination was performed intra-dermally at the base of the tail.

[0061] The vaccines applied to groups B-E were prepared as follows:

Table 2. Preparation of vaccines applied in mouse studies.

[0062] All groups were vaccinated 3 times, at day 0 (day of first vaccination), day 14, and day 28 of the experiment.

[0063] To assess the immunogenicity of the vaccine, six animals per group were sacrificed about a week after the third immunization at day 36, without prior challenge. Blood samples were collected before the vaccination (day -2), and at day of sacrifice (day 36). Additionally, spleen samples were taken after the sacrifice on day 36. T-cell proliferation using the spleen samples was analyzed by performing the MTS assay as well as by measuring the IL-2 production, in both cases after stimulation of splenocytes with 15mer pep- tides corresponding to the antigens encoded by the vaccine, and using conventional detection techniques.

[0064] Serum antibody titers raised against each individual antigen except CPA were quantified by ELISA, employing recombinant proteins corresponding to individual antigens encoded by the MIDGE -vectors of the vaccine for the detection of the corresponding antibodies.

[0065] On day 38, approximately 10 animals of each group were challenged with the parasite by intravenous injection of 10 million parasites (Leishmania donovani BI2302 in the amastigote stage). On day 59, animals were sacrificed, and the parasite burden in the liver was assessed by counting parasites in stained impression smear samples.

[0066] Figure 2 shows the liver parasite burden found in the challenged animals as a function of the vaccine doses applied. The y-axis shows the LDU, i.e. the so-called Leishman-Donovan Unit, which is obtained by multiplying the number of parasites per liver cell nucleus with the organ weight in mg. Table 3 shows the liver parasite burden in the vaccinated groups (groups B-E) as a percentage of the value found in the control group (group A).

Table 3. Liver parasite burden in the vaccinated groups (groups B-E) as a percentage of the value found in the control group (group A).

[0067] These data show a clear dose-dependent protection of the animals against the parasite. While the two higher doses (groups B and C) show a protection efficacy of more than 94%) or 84%, respectively, versus control, the lower DNA doses in groups D and E lead to a correspondingly lower protection, as evidenced by the higher number of parasites found in the liver. These experiments show an overwhelming protection using the higher doses of the novel vaccine as compared to the control, and thus prove the efficiency of the novel vaccine. Furthermore, a clear dose-dependency of the vaccination efficacy can be seen. [0068] Figures 3a and 3b show the T-cell proliferation experiments performed with spleen cells from un-challenged animals. In both the IL-2 production as well as the MTS assays, a clear dose-dependent response to the vaccine is shown, while the control group (group A) shows no response to the vaccination schedule. [0069] Figure 4 displays the individual antibody titers against the antigens KMP-11

(SEQ ID NO: 1), TSA (SEQ ID NO: 2), CPB (SEQ ID NO: 5), and P74 (SEQ ID NO: 3) in the serum of all vaccinated, un-challenged animal groups. These results show a dose- dependent antibody production against each antigen contained in the mixture, proving the immunogenicity of the novel vaccine. Clearly, raising antibodies against every antigen contained in the vaccine is an important advantage compared to conventional single- antigen vaccines as described in the state of the art.

[0070] Figure 5 shows the parasite load obtained in mice vaccinated with only single- antigen vaccines (encoding KMP-11 (SEQ ID NO: 1), TSA (SEQ ID NO: 2), or P74 (SEQ ID NO: 3), respectively), using the protocol described above.

[0071] Table 4 shows the parasite load obtained in animals vaccinated with single antigens encoded by MIDGE-Thl vectors (KMP-11 (SEQ ID NO: 1), TSA (SEQ ID NO: 2), or P74 (SEQ ID NO: 3), respectively) of Figure 5 and the percental reduction vs. PBS.

Table 4. Parasite load obtained in animals vaccinated with only single-antigen vaccines (encoding KMP-11, TSA, or P74, respectively) and the percental reduction vs. PBS.

PBS M-KMP-l l-Thl M-TSA-Thl M-P74-Thl Mean LDU 213.2 44.5 86.98 123.4

% Reduction

- 79.1 59.1 42.1

vs. PBS

[0072] In all cases, the vaccines do confer a certain amount of protection against the parasite challenge. Clearly, however, the efficacy of the 5 -antigen mixture is vastly superior to the use of single antigens.

[0073] Thus, the use of 5 carefully selected and designed, highly immunogenic antigens allows for a superior response when faced with differing strains and species sig(see Example 2 for comparison) of the parasite originating from different geographical regions. Furthermore, it is well known that human vaccinees show a significant variation in the strength of the immune response to an administered antigen. In this regard, the novel 5- antigen vaccine can overcome a poor individual response to a certain antigen due to the presence of 5 different, highly immunogenic antigens, and thereby insure a higher success rate in a given population, as compared to single-antigen vaccines. EXAMPLE 2: Protection against cutaneous Leishmaniasis in C57BL/6 mice

[0074] The protective effect against cutaneous Leishmaniasis, which is predominantly caused by Leishmania major, can be measured by examining the lesions appearing in the skin of infected animals. Briefly, 2 groups of each around 10 C57BL/6 mice were injected with 25 μΐ of the 5 antigen vaccine (Group B) or PBS buffer (Group A, placebo-control) intra-dermally 3 times in bi-weekly intervals. The total DNA content per injection in Group B was 100 μg (with 20 μg for each of the five antigen vectors). 10 days after the final vaccine injection, the animals were challenged by subcutaneous injection of 2 million Leishmania major parasites (promastigote stage). The appearance and size of dermal lesions was monitored and measured for the following 2 weeks.

[0075] Figure 6 shows the size of the lesions measured and calculated by adding the sagittal length and transverse length and dividing the sum by two. Lesions were evaluated on days 12 and 14 after the challenge, for the mice vaccinated with the 5 antigen mix (Group B), or with PBS buffer (Group A), respectively. While on both days mice of Group A suffered from significant lesions caused by the parasite, in the vaccinated animals of Group B no lesions were observed. Thus, the fivefold antigen vaccine conferred a complete protection against cutaneous Leishmaniasis, as caused by Leishmania major.

EXAMPLE 3 : Optimized sequences of the vaccine antigens

[0076] Moreover, the sequences of the vaccine antigens have been confirmed for T-cell epitopes recognized by individuals of the target population, thereby ensuring the devel- opment of a protective immune response elicited by specific T-cells. The peptide antigen sequences have been created as consensus sequences covering the corresponding wild- type sequences of various Leishmania species and isolates. The DNA sequences have been optimized to ensure a high protein yield resulting from expression in vivo.

EXAMPLE 4: Prophylactic efficacy of adjuvanted vaccine against Leishmania donovani

[0077] To study the effect of the vaccine of the invention in conjunction with an adjuvant, hamster model experiments were performed to determine the protective efficacy against the parasite. In earlier experiments, protection in hamsters was not achieved with the same dose of vaccine as used in mice, although the vaccine was immunogenic in hamsters too. In order to increase efficacy, the vaccine was formulated with the immunomodulatory DNA molecule dSLIM (double-Stem Loop ImmunoModulator) and compared to the non-adjuvated vaccine. Briefly, 5 to 6 weeks old female Syrian hamsters were injected with 25 μΐ of the test item containing either PBS (group A, negative control), the vaccine (group B) or the vaccine formulated with the adjuvant dSLIM (group F). Each group consisted of 12 animals. Vaccination was performed intra-dermally in the flank, three times in biweekly intervals.

[0078] The vaccines applied to groups A, B and F were prepared as follows: Table 5. Preparation of vaccines applied in hamster studies. Group Dose per each individual antigen encoding vector Total DNA con(KMP-11 (SEQ ID NO: 1), TSA (SEQ ID NO: 2), tent of vaccine P74 (SEQ ID NO: 3), CPA (SEQ ID NO: 4), CPB

(SEQ ID NO: 5))

A 0 μg - PBS only 0 μg

B 20 μg of each MIDGE-Thl vector 100 μ_§

F 20 μg of each MIDGE-Thl vector, 10 μg dSLIM 110 μ_§

[0079] All animals were vaccinated 3 times, at day 0 (day of first vaccination), day 14, and day 28 of the experiment. [0080] On day 51 (13 days after third immunization), approximately 8 to 9 animals of each group were challenged with the parasite by intravenous injection of 6 million parasites (Leishmania donovani BI2383 in the amastigote stage). On day 103 post infection, animals were sacrificed, and the parasite burden in the liver was assessed by counting parasites in stained impression smear samples.

[0081] Figure 7 shows the liver parasite burden found in the challenged animals. The y- axis shows the LDU, i.e. the so-called Leishman-Donovan Unit, which is obtained by multiplying the number of parasites per liver cell nucleus with the organ weight in mg. These results are summarized in Table 6.

Table 6. Liver parasite burden in the vaccinated groups (groups B and F) as a percentage of the value found in the control group (group A).

[0082] These data show a clear effect of the adjuvant dSLIM on the protection of the animals against the parasite. Surprisingly, the formulation of the vaccine even with a very low dose of dSLIM adjuvant (10 ug per dose) resulted in a very strong protection of 87 per cent in comparison to the negative control group, as evidenced by the lower number of parasites found in the liver of hamsters. This experiment demonstrates that by formulation of the vaccine with an adjuvant, the protection against Leishmania parasites can be multiplied.

EXAMPLE 5: Therapeutic efficacy of the vaccine in combination with chemotherapy

[0083] The vaccine of the present invention can be used for therapy of visceral Leishmaniasis following administration of a moderate dose of AmBisome®. In addition, the specific immune response induced by the vaccine can reduce the number of relapses as well as the anticipated development of resistance.

[0084] To study the effect of the vaccine of the invention after treatment with a relatively low dose of a chemotherapeutic, a mouse model experiment was performed to determine the therapeutic efficacy against the parasite.

[0085] Briefly, 7 to 8 weeks old female C57BL/6 mice, randomized into five treatment groups and one no-treatment control group, were infected with Leishmania donovani 20 pro- and/or amastigotes intravenously. Each group contained seven mice. At day 7 after infection, mice of three groups (designated as AmB+20, AmB+40 and AmB) were treated with a low dose of AmBisome intravenously. At day 21 post infection, after AmBisome had been cleared from the body, the treatment groups AmB+20 and 20 received an intradermal injection of 100 ug the 5-antigen vaccine of the present invention (20μg of each MIDGE-Thl encoded antigen; see group B in Table 5 for details), while the groups AmB+40 and 40 received an intradermal injection of 200 μg vaccine (40μg of each MIDGE-Thl encoded antigen). Injection was performed in all cases at the root of the tail. The untreated control group as well as group AmB did not receive the vaccine of invention. Details of the experimental schedule are listed in Table 7.

Table 7. Schedule of the experiment.

Group Day 7 post infection Day 21 post infection Day 31 post infection

AmB + 20 1 x AmBisome i.v. 100 μg vaccine i.d. Sacrifice AmB + 40 1 x AmBisome i.v. 200 μg vaccine i.d. Sacrifice

AmB 1 x AmBisome i.v. Sacrifice

20 100 μg vaccine i.d. Sacrifice

40 200 μg vaccine i.d. Sacrifice

untreated Sacrifice

[0086] At day 31 post infection, mice of all groups were sacrificed. The parasite burden in spleen was assessed by counting parasites (amastigotes) in stained impression smear samples.

[0087] Figure 8 shows the spleen parasite burden found in the animals. The y-axis shows the LDU, i.e. the so-called Leishman-Donovan Unit, which is obtained by multiplying the number of parasites per spleen cell nucleus with the organ weight in mg. Group designa- tions and treatments are listed in Table 7. These results are summarized in Table 8.

Table 8. Spleen parasite burden in individual groups as percentage of the inhibition of parasite growth compared to the untreated control group, calculated on the base of LDU values.

[0088] These data show a clear therapeutic effect of the vaccine when administered after treatment with one of the chemo therapeutics currently used in therapy of human visceral Leishmanisis. Surprisingly, a single vaccination with the vaccine of the present invention induced an inhibition of parasite growth of up to 88 per cent compared to the untreated control group. The application of the vaccine leads to a highly significant enhancement of the therapeutic effect of the current therapeutical standard. Thus, the application of the vaccine after a low, less toxic dose of chemotherapeutic is proved to be highly efficacious in a therapeutic setting.

ACKNOWLEDGEMENTS

[0089] The work leading to this invention has received funding from the European Community's Seventh Framework Programme (FP7/2007-2013) under grant agreement n° 223189.

References

Ahmed, S. B., L. Touihri, et al. (2009). "DNA based vaccination with a cocktail of plasmids encoding immunodominant Leishmania (Leishmania) major antigens confers full protection in BALB/c mice." Vaccine 27(1): 99-106.

Anderson, C. F., S. Mendez, et al. (2005). "Nonhealing infection despite Thl polarization produced by a strain of Leishmania major in C57BL/6 mice." Journal of Immunology 174(5): 2934-2941.

Basu, R., S. Bhaumik, et al. (2005). "Kinetoplastid membrane protein-11 DNA vaccination induces complete protection against both pentavalent antimonial-sensitive and - resistant strains of Leishmania donovani that correlates with inducible nitric oxide synthase activity and IL-4 generation: evidence for mixed Thl- and Th2-like responses in visceral leishmaniasis." J Immunol 174(11): 7160-7171.

Basu, R., S. Bhaumik, et al. (2007). "Hybrid cell vaccination resolves Leishmania donovani infection by eliciting a strong CD8+ cytotoxic T-lymphocyte response with concomitant suppression of interleukin-10 (IL-10) but not IL-4 or IL-13." Infect Immun 75(12): 5956-5966.

Basu, R., S. Roy, et al. (2007). "HLA class I-restricted T cell epitopes of the kinetoplastid membrane protein-11 presented by Leishmania donovani- infected human

macrophages." J Infect Pis 195(9): 1373-1380.

Bhaumik, S., R. Basu, et al. (2009). "KMP-11 DNA immunization significantly protects

against L. donovani infection but requires exogenous IL-12 as an adjuvant for comparable protection against L. major." Vaccine 27(9): 1306-1316.

Campos-Neto, A., J. R. Webb, et al. (2002 ). "Vaccination with plasmid DNA encoding

TSA/LmSTIl leishmanial fusion proteins confers protection against Leishmania major infection in susceptible BALB/c mice." Infect Immun 70(6): 2828-2836.

Chattopadhyay A., and Jafurulla M (2011). "A novel mechanism for an old drug:

Amphotericin B in the treatment of visceral leishmaniasis" Biochem Biophys Res 416(1-2): 7-12

Chenik, M., Lakhal, S., et. al. WO 2006/10870 "Polypeptides of Leishmania Major and

Polynucleotides encoding same and Vaccinal, Therapeutical and Diagnostic

Applications thereof

Croft, S. L., S. Sundar, et al. (2006). "Drug resistance in Leishmaniasis." Clin Microbiol Rev

19: 111-126.

Datta S., Manna M., et.al (2012). "Therapeutic immunization with radio-attenuated

Leishmania parasites through i.m. route revealed protection against the experimental murine visceral leishmaniasis" Parasitol Res DOI 10.1007/s00436-012-2847-4 Duthie, M. S., et al (2012). "The development and clinical evaluation of second-generation leishmaniasis vaccines" Vaccine 30(2): 134-141

Follador, I., C. Araujo, et al. (2002). "Epidemiologic and immunologic findings for the

subclinical form of Leishmania braziliensis infection." Clinical infectious diseases 34(11): E54-58.

Gaafar, A., A. Kharazmi, et al. (1995). "Dichotomy of the T cell response to Leishmania antigens in patients suffering from cutaneous leishmaniasis; absence or scarcity of Thl activity is associated with severe infections." Clin Exp Immunol 100(2): 239-245.

Gao, F., Y. Li, et al. (2003). "Codon usage optimization of HIV type 1 subtype C gag, pol, env, and nef genes: in vitro expression and immune responses in DNA- vaccinated mice." AIDS Res Hum Retroviruses 19(9): 817-823. Higgins, D., J.D. Marshall, et al. (2007). "Immunostimulatory DNA as a vaccine adjuvant."

Expert Rev. Vaccines 6(5): 747-759.

Kemp, M., A. S. Hey, et al. (1994). "Dichotomy of the human T cell response to Leishmania antigens. I. Thl-like response to Leishmania major promastigote antigens in individuals recovered from cutaneous leishmaniasis." Clin Exp Immunol 96(3): 410-

415.

Ko, H. J., S. Y. Ko, et al. (2005). "Optimization of codon usage enhances the immunogenicity of a DNA vaccine encoding mycobacterial antigen Ag85B." Infect Immun 73(9): 5666-5674.

Levine, B., and Klionsky, D.J. (2004) " Development by Self-Digestion: Molecular mechanisms and biological functions of autophagy" Dev. Cell. 6: 463-477.

Livingston, B. D., M. Newman, et al. (2001). "Optimization of epitope processing enhances immunogenicity of multiepitope DNA vaccines." Vaccine 19(32): 4652-4660.

Maroof A., Brown N., et.al. (2012) "Therapeutic Vaccination With Recombinant Adenovirus Reduces Splenic Parasite Burden in Experimental Visceral Leishmaniasis" J. Infect. Pis. 205(5): 853-863.

Mendez, S., Y. Belkaid, et al. (2002). "Optimization of DNA vaccination against cutaneous leishmaniasis." Vaccine 20(31-32): 3702-3708.

Modabber, F. (2010). "Leishmaniasis vaccines: past, present and future." International Journal of Antimicrobial Agents 36S: 58-61.

Modabber, F., R. Coler, et al. (2010). Vaccines against Leishmania. New generation vaccines.

D. M. Levine MM, Nabel G, Good MF, Nataro J, Liu MA, et al. New York

London, Informa Healthcare: 790-807.

Nagill, R. and S. Kaur (2011). "Vaccine candidates for Leishmaniasis: A review." Int

Immunopharmaco 1.

Okwor, I. and J. Uzonna (2009). "Vaccines and vaccination strategies against human

cutaneous leishmaniasis." Hum Vaccin 5(5): 291-301.

Palatnik de Sousa, C. B. (2008). "Vaccines for leishmaniasis in the fore coming 25 years." Vaccine 26(14): 1709-1724.

Poot, J., K. Spreeuwenberg, et al. (2006). "Vaccination with a preparation based on

recombinant cysteine peptidases and canine IL-12 does not protect dogs from infection with Leishmania infantum." Vaccine 24(14): 2460-2468.

Rafati, S., A. H. Salmanian, et al. (2001). "A protective cocktail vaccine against murine

cutaneous leishmaniasis with DNA encoding cysteine proteinases of Leishmania major." Vaccine 19(25-26): 3369-3375.

Reggiori, F., and Klionsky, D.J. (2005). "Autophagosomes: biogenesis from scratch?" Curr.

Opin. Cell Biol, 17: 415-422.

Rodriguez-Cortes, A., A. Ojeda, et al. (2007). "Vaccination with plasmid DNA encoding KMPII, TRYP, LACK and GP63 does not protect dogs against Leishmania infantum experimental challenge." Vaccine 25(46): 7962-7971.

Salay, G., M. L. Dorta, et al. (2007). "Testing of four Leishmania vaccine candidates in a mouse model of infection with Leishmania (Viannia) braziliensis, the main causative agent of cutaneous leishmaniasis in the New World." Clinical and Vaccine

Immunology 14(9): 1173-1181.

Saldarriaga, O. A., B. L. Travi, et al. (2006). "Immunogenicity of a multicomponent DNA vaccine against visceral leishmaniasis in dogs." Vaccine 24(11): 1928-1940. Schakowski, F., M. Gorschluter, et al. (2001). "A novel minimal-size vector (MIDGE) improves transgene expression in colon carcinoma cells and avoids transfection of undesired DNA." Mol Ther 3(5 Pt 1): 793-800.

Schirmbeck, R., S. A. Konig-Merediz, et al. (2001). "Priming of immune responses to

hepatitis B surface antigen with minimal DNA expression constructs modified with a nuclear localization signal peptide." J Mol Med 79(5-6): 343-350.

Seaman, J., A. J. Mercer, et al. (1996). "The epidemic of visceral leishmaniasis in western Upper Nile, southern Sudan: course and impact from 1984 to 1994." Int J Epidemiol 25(4): 862-871.

The_Working_Group_on_Research_Priorities_for_Development_of_Leishmaniasis_Vaccines

, C. H. N. Costa, et al. (2011). "Vaccines for the Leishmanises: Proposal for a

Research Agenda." PLoS Negl Trop Pis 5(3): e943.

Velez, I. D., K. Gilchrist, et al. (2009). "Safety and immunogenicity of a defined vaccine for the prevention of cutaneous leishmaniasis." Vaccine 28(2): 329-337.

Webb, J. R., A. Campos-Neto, et al. (1998). "Human and murine immune responses to a

novel Leishmania major recombinant protein encoded by members of a multicopy gene family." Infect Immun 66(7): 3279-3289.

Claims

Claims

1. A combination for the prophylactic or therapeutic treatment of Leishmaniasis comprising at least one nucleotide sequence encoding for at least three Leishmania antigens selected from the group comprising KMP-11, P74, TSA, CPA, and CPB.

2. The combination according to claim 1 , which is encoded by at least one DNA expression construct.

3. The combination according to claims 1 or 2, wherein each antigen is encoded by a separate DNA expression construct.

4. The combination according to any of the preceding claims, wherein the DNA expression constructs consist of covalently closed, linear DNA molecules, which have a linear double-stranded region, wherein the double strand is formed by single strands which are linked by short single-stranded loops, or circular double-stranded DNA molecules.

5. The combination according to claim 4, wherein the double-stranded region only consists of the coding sequence under the control of a promoter that is operable in mammals and a termination sequence.

6. The combination according to any of the claims 1 to 5, wherein at least one DNA expression construct is coupled to a peptide.

7. The combination according to claim 6, wherein the peptide is a Thl -peptide.

8. The combination according to claim 7, wherein the Thl-peptide comprises the amino acid sequence PKKKRKVEDPYC, wherein the sequence is coupled to one of the hairpin loops via an amino-linker.

9. The combination according to any of the preceding claims, comprising at least one nucleotide sequence selected from the group comprising SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5.

10. A combination for the prophylactic or therapeutic treatment of Leishmaniasis comprising at least three Leishmania antigenic peptides selected from the group comprising KMP-11, P74, TSA, CPA, and CPB.

11. The combination according to claim 10, wherein at least one antigenic peptide is en- coded by a sequence selected from the group comprising SEQ ID NO: 1 , SEQ ID NO:

2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5.

12. A pharmaceutical for the treatment of Leishmaniasis comprising a combination according to any one of claims 1 to 11.

13. The pharmaceutical according to claim 12, additionally comprising a pharmaceutically acceptable carrier.

14. The pharmaceutical according to claim 12 or 13, wherein the pharmaceutical is a vac- cine.

15. The pharmaceutical according to claim 14, wherein the vaccine is solid, liquid, solid/liquid or gaseous.

16. The pharmaceutical according to claim 14 or 15, wherein the vaccine is administered orally, by intramuscular injection, by intradermal injection, by subcutaneous injection, by puncture, transdermally or intranasally.

17. The pharmaceutical according to any of the claims 14 to 16, wherein the vaccine additionally comprises an adjuvant.

18. The pharmaceutical according to claim 17, wherein the adjuvant is a DNA molecule comprising at least one unmethylated CG motif.

19. The pharmaceutical according to claim 18, wherein the DNA molecule comprising an unmethylated CG motif is a partially single-stranded, dumbbell-shaped, covalently closed DNA molecule, comprising one or more sequences having the formula:

NVCGNV

wherein:

N^JN² is selected from the group consisting of GT, GG, GA, AT, and AA; and N³N⁴ is selected from the group consisting of CT or TT, and C is deoxycytidine, G is deoxyguanosine, A is deoxyadenosine, and T is deoxythymidine.

20. Use of a combination according to any of the claims 1 to 9 for the manufacture of a pharmaceutical for the treatment of Leishmaniasis.

21. Use according to claim 19, wherein the pharmaceutical is a vaccine.

22. Use according to claim 21, wherein the vaccine is solid, liquid, solid/liquid or gaseous.

23. Use according to claim 21 or 22, wherein the vaccine is administered orally, by intramuscular injection, by intradermal injection, by subcutaneous injection, by puncture, transdermally or intranasally.

24. Use according to any of the claims 21 to 23, wherein the vaccine additionally comprises an adjuvant.

25. Use according to claim 24, wherein the adjuvant is a DNA molecule comprising an unmethylated CG motif.

26. Use according to claim 25, wherein the DNA molecule comprising an unmethylated CG motif is a partially single-stranded, dumbbell- shaped, covalently closed DNA molecule, comprising one or more sequences having the formula:

NVCGNV

wherein:

N^JN² is selected from the group consisting of GT, GG, GA, AT, and AA; and N³N⁴ is selected from the group consisting of CT or TT, and C is deoxycytidine, G is deoxyguanosine, A is deoxyadenosine, and T is deoxythymidine.