WO2013157020A1

WO2013157020A1 - A method of measuring bmp signalling using bmp responsive reporter cell line

Info

Publication number: WO2013157020A1
Application number: PCT/IN2013/000254
Authority: WO
Inventors: Amitabha BANDYOPADHYAY; Paritosh PRASHAR; Prem Swaroop YADAV
Original assignee: Indian Institute Of Technology, Kanpur
Priority date: 2012-04-17
Filing date: 2013-04-17
Publication date: 2013-10-24

Abstract

A dual reporter plasmid construct for measuring Bone Morphogenetic Proteins (BMP) Signalling is provided. The dual reporter construct includes a BMP Responsive element of Sequence ID No 1 a minimal promoter gene cloned downstream of the BMP responsive element, a firefly luciferase reporter gene of Sequence ID No 3 cloned downstream of the BMP responsive element and the first minimal promoter gene, a constitutive promoter cloned downstream of the firefly luciferase reporter gene, a renilla luciferase reporter gene of Sequence ID No 7 cloned downstream of the constitutive promoter. The renilla luciferase reporter gene acts as an internal control that normalises any altered activity of the firefly luciferase gene in presence or absence of BMP or BMP agonist. The firefly luciferase reporter gene activity provides a quantitative measure of activity of the BMP responsive element.

Description

A METHOD OF MEASURING BMP SIGNALLING USING BMP RESPONSIVE REPORTER

CELL LINE

Field of Invention

The present invention relates to a method of measuring Bone Morphogenetic Proteins (BMP) signalling using a BMP responsive reporter cell line, more particularly to method of measuring BMP signalling using BMP responsive reporter cell line expressing: a single expression dual reporter construct.

Background and the prior art

Bone fracture and injuries are common in accidents. Bone fractures are associated with difficulties in healing of fractured bones. Bone fracture healing involves de-novo bone formation. Initially, the standard methods of healing complicated fractures used to be surgery that holds bone pieces with metallic nails. This method may result in non-union or delayed union of fractured bones. Such failures led to secondary intervention which, in turn, led to higher morbidity and reduced quality of life. Therefore, in order to overcome the delay union of fractured bones, process such as bone grafting has become a standard method of healing complicated fractures. Bone grafting is a surgical procedure that replaces missing bone with a new bone or a bone replacement material into spaces between or around broken fractures in order to repair and heal complex bone fractures. The three ways by which a bone graft may help heal the fracture are:

a. Osteogenesis in which a new bone is formed from the cells in the graft;

b. Osteoinduction in which molecules in the graft (such as Bone Morphogenetic Proteins (BMPs)) converts patient's cells into cells that are capable of bone formation; and c. Osteocohduction in which matrix of the graft configures a scaffold on which patient's cells form new bone. In general, osteoinductive process is used mostly as a bone graft procedure. As mentioned above, osteoinductive tissue include use of patient's cells in formation of new bone. This method gives best results when autogenous graft is available which has limited availability which combined with higher donor morbidity limits its applications in healing complex fractures.

The osteoinductive capacity of bones is due to a family of secreted glycoproteins or growth factors called Bone Morphogenetic Proteins (B MPs). The BMPs family consists of at least 15 BMP with BMP2 and BMP7 having proven clinical application in treatment of complex fractures of bones. BMP2 and BMP7 are both commercially produced as recombinant human BMP2 (rhBMP2) and recombinant human BMP7 (rhBMP7). Though recombinant production of BMP2 and BMP7 have made it possible to treat complex bone fractures with higher success rates with increased efficacy; it still presents several limitations. BMPs cannot be administered systematically; they are required to be applied in situ by soaking in collagen patch. This is because BMPs interact with BMP receptors which are present on variety of cell types that are involved in formation of various other important tissues. Further, systemic administration may lead to unwarranted consequences and at the same time in situ application involves invasive procedures. In addition, half-life of BMPs in vivo is short and thus requires many in situ applications. With current costs of BMP dosage per spinal fusion ranging between US $5000 to US $10000; BMPs application is indeed a costly therapy as compare to bone grafting.

The above set of limitations has necessitated a replacement of expensive BMP therapy with novel molecules such as a chemical - agonist of BMP receptors which will activate BMP signalling pathway in absence of BMP. This may circumvent above set of limitations in many ways such as by bringing down the costs of therapy as synthesizing a chemical is cheaper than producing a highly labile protein; the agonist may be administered in non-invasive manner at the site of fracture by using novel drug delivery techniques available; the chemical agonists may be administered over a long period of time via sustained release mechanisms which will not only be efficacious but cost effective as well.

In order to screen chemical agonists with potential as BMP application therapy; there is a need to develop efficient assays and systems which can measure BMP signalling efficiently with higher sensitivity and specificity. There exist many assays, both in vitro and in vivo that are currently being used to measure BMP signalling activity. Assays that are used under in vivo conditions is Alkaline Phosphatase (AP) Assay whereas assays used under in vitro conditions include, BMP responsive element (BRE) activity assays, Enzyme Linked Immunosorbent Assay (ELISA) and Enzyme Linked Immuno -Receptor Assay (ELIRA). Alkaline Phosphatase Assay includes adding BMP to mesenchymal cells which drives these cells to osteogenic lineage marked by deposition of mineralised matrix associated with expression of Alkaline Phosphatase gene. The Alkaline Phosphatase activity is measured through various colorimetric methods that are available or by staining. This method is, clearly, time consuming, labour intensive and moreover is not much sensitive and rapid enough to measure BMP activity at low level since Alkaline Phosphatase is not a direct target of BMP signalling. Also, though AP is commonly referred to as readout of BMP signalling but in fact AP is a measure of bone formation.

In in vitro assays, the activity of phosphorylated SMAD transcription factor is used as measure of active BMP signalling. The activity of phosphorylated SMAD transcription factor is measured by antibody staining by western blotting; making it as cumbersome and time consuming. ELISA assays are also used to measure BMP signalling activity but it measures both biologically active and inactive BMP. ELIRA assay enables detection of active BMP that binds to its receptors but does not confirm if BMP signalling has been activated. Moreover, both of these methods are very expensive for large scale investigations.

To combat the disadvantages of the above stated experiments, method based on activity of BMP responsive element (BRE) is used to measure BMP signalling. This method requires transfecting cells with BRE-Luciferase construct and measuring BMP activity in real time. BMP ligands bind to type I and type II serine/threonine kinase cell surface receptors. Upon ligand binding, the type II receptors phosphorylate type I receptors which in turn phosphorylate a group of transcription factors known as receptor-regulated SMADs (R-SMADs) i.e. SMAD1, SMAD5 or SMAD8. Phosphorylated R-SMADs form a heterodimer with SMAD4 and translocate into the nucleus and regulate transcription of a host of BMP downstream target genes. One well characterized BMP downstream target is inhibitor of differentiation- 1 (Id 1). The promoter of this gene has a minimal DNA sequence responsive to BMP signalling and is called as BMP responsive element (BRE). BRE consists of SMAD binding elements (SBEs) along with a GGCGCC palindrome. Multimerisation of these elements generates a sensitive, BMP-specific enhancer. It has been demonstrated that BRE responds specifically to BMP signalling but not to the related pathways. However, method of measuring BMP signalling based on BRE activity includes co-transfection of dual luciferase reporter assay constructs in efficient and competent cell lines which in turn make the process time consuming. Beside, co-transfection process also leads to the requirement of efficient and competent cell lines. Therefore, this method is disadvantageous in light of low co-transfection efficiency and corresponding sensitivity in most cell lines and therefore, despite, being highly specific and sensitive for BRE activity this method has not been used in mainstream because of long duration of assays.

Additionally, BMP signalling pathway is critical for vertebrate development and tissue homeostasis. High throughput molecular assays and screening may reveal novel molecules that regulate BMP signalling and may have clinical significance. Accordingly, there remains a need for developing efficient, sensitive, specific, time saving and cost-effective assay systems and methods to measure BMP signalling and enable rapid detection and discovery of chemical agonists of BMP.

Object of the Invention

It is an object of the invention to provide a method of measuring BMP signalling.

It is another object of the invention to provide a single expression construct comprising two reporter systems and a method for constructing the same for measuring BMP signalling.

It is yet another object of the invention to provide a BMP responsive immortal reporter

(BRITER) cell line for measuring BMP signalling.

It is still another object of the invention to provide a method of developing BMP responsive reporter cell line to measure BMP signalling.

It is still another objective of the invention to develop a cell line such that the endogenous level of BMP signalling in the cell line may be controlled. It is still another object of the invention to develop a cell line that is responsive to changes in BMP signalling pathway only.

Brief Description of the Figures

It is to be noted, however, that the appended figures illustrate only typical embodiments of this invention and are therefore not to be considered for limiting of its scope, for the invention may admit to other equally effective embodiments.

Figure 1 illustrates a dual reporter construct transfected in a cell line to develop a stably- transfected BMP responsive reporter cell line according to an embodiment herein;

Figure 2 is a plot illustrating relative luciferase activity over a period of time, according to an embodiment herein;

Figure 3 is a table illustrating comparison of the BMP responsive reporter cell line with existing cell lines; and

Figure 4 illustrates luciferase activity of the BMP responsive reporter cell line when the cell lines was treated with different morphogenetic proteins.

Summary of the Invention

The present invention provides a method of measuring BMP signalling using a BMP responsive reporter cell line expressing a single, dual reporter construct.

In an aspect, a single dual -reporter plasmid construct for measuring Bone Morphogenetic Proteins (BMP) Signalling is provided. The plasmid construct includes a BMP Responsive element of Sequence ID No 1 ; a minimal promoter gene cloned downstream of the BMP responsive element; first reporter gene cloned downstream of the BMP responsive element and the first minimal promoter gene, a constitutive promoter cloned downstream of the first reporter gene ; a second reporter gene cloned downstream of the constitutive promoter.

The dual reporter plasmid construct further includes an antibiotic resistant selection marker gene cloned downstream of the constitutive promoter; an internal ribosome entry site (IRES) of Sequence ID No 6 cloned downstream of the antibiotic selection marker gene; and a late Poly(A) signal sequence cloned downstream of the renilla luciferase gene of Sequence ID No 7. The IRES translates renilla luciferase giving basal and constitutive expression of renilla luciferase;

In another aspect, the invention provides a BMP responsive reporter cell line exhibiting the controllable amount of BMP and a method for preparing the same is provided.

The BMP responsive reporter cell line transformed with and express the single dual reporter construct. The BMP responsive reporter cell line is derived from osteoblasts or a host mammalian cell line selected from C2C12, CHOOR HeLa.

In yet another aspect, a method for screening a candidate agent capable of modulating the gene expression and/or replication, regulated by BMP responsive element is provided. The method includes treating a BMP responsive reporter cell line expressing the single expression dual reporter construct with the candidate agent; and (b) independently assaying levels of expression of said first reporter gene and second reporter gene; and (c) comparing and evaluating said level of expression of said first reporter gene and second reporter gene with the levels of expression of said first reporter gene and second reporter gene of a second BMP responsive reporter cell line that is not contacted with said candidate agent wherein evaluating herein describes the fold change in the level of expression of the first reporter gene in case when the BMP responsive cell is contacted with the candidate agent as compared to the level of expression of the first reporter gene of the BMP responsive cell that is not contacted with the candidate agent after normalising the respective expression of the first reporter assay with the level of expression of the second reporter assay ; the candidate agent capable of exhibiting fold change in the expression of the first reporter gene similar to the BMP molecule consider as the potential agent.

Detailed Description of the Invention

At the outset of the description that follows, it is to be understood that the ensuing description only illustrates a particular form of this invention. However, such a particular form is only an exemplary embodiment and is not intended to be taken restrictively to imply any limitation on the scope of the present invention.

The present invention provides a single expression dual reporter construct as illustrated in Figure 1 for measuring BMP signalling. The single expression dual reporter construct is submitted at the depository Institution Microbial Type Culture Collection and Gene Bank, Chandigarh, India and the number allotted to the deposited dual reporter construct (plasmid) is MTCC 5789. The dual reporter construct includes a BMP Responsive element of Sequence ID No 1 ; a minimal promoter gene cloned downstream of the BMP responsive element; a first reporter gene cloned downstream of the BMP responsive element and the first minimal promoter gene, a constitutive promoter cloned downstream of the second reporter gene; a second reporter gene cloned downstream to the constitutive promoter. The second reporter gene acts as an internal control that normalises any altered activity of the first reporter gene in presence or absence of BMP or BMP agonist. The activity of first reporter gene provides a quantitative measure of activity of the BMP responsive element.

The first and second reporter gene may be selected from the group comprising green fluorescence protein, GUS reporter system, peroxidise reporter system etc, preferably the first and second reporter gene may be luciferase gene, more preferably, the first reporter gene may be firefly luciferase (FFLuc) of sequence id 3 and the second reporter gene is renilla luciferase (RRLuc) gene of sequence id 7. The minimal promoter may be selected from the group comprising minimal SV40 promoter, a minimal CaMV35S, or any minimal promoter that includes binding site for RNA polymerases.

The constitutive promoter may be selected from the group comprising Opine promoters, CAMV 35s promoter, plant ubiquitin promoter (ubi), rice actin 1 promoter (act-1) and maize alcohol dehydrogenase 1 promoter (adh-1), preferably the constitutive promoter is CAMV 35s promoter.

The dual reporter plasmid construct of the cell line further includes an antibiotic resistant selection marker gene cloned downstream of the constitutive promoter; an internal ribosome entry site (IRES) of Sequence ID No 6 cloned downstream of the antibiotic selection marker gene; and a late Poly(A) signal sequence cloned downstream of the second reporter gene. The IRES translates second reporter gene giving basal and constitutive expression of renilla luciferase.

The antibiotic resistant selection marker gene may be selected from the group comprising hygromycin or puromycin or neuromycin resistant selection marker gene.

In an aspect, the present invention provides a BMP responsive- reporter cell line exhibiting a controllable amount of endogenous BMP for measuring the BMP signalling. The BMP responsive reporter system is transformed with said single expression dual reporter construct.

The BMP responsive reporter cell line used for transfecting the single expression dual reporter construct may be derived from osteoblasts or a mammalian cell line, preferably, the BMP responsive reporter cell line is Osteoblast.

The mammalian cell line may be selected from the group comprising C2C12, CHO OR HeLa cells. Osteoblast cells have an active BMP signalling pathway and they themselves produce several BMPs. The endogenous production of BMPs may reduce the sensitivity of the cell line towards exogenously added BMPs or BMP agonists. Therefore, an osteoblast cell line is first created from immortalised calvarial osteoblast cells isolated from tamoxifen-inducible BMP2 and BMP4 double knockout mouse strain.

The BMP responsive reporter cell line is highly specific and sensitive in responding to exogenously added BMP protein or a chemical BMP agonist with easily detectable reporter activity. The BMP responsive reporter cell line, therefore, may be used to assay BMP signalling and screen small molecular or chemical agonists of BMP.

The dual reporter construct transfected in BMP responsive cell line and used for measuring BMP signal includes a BMP Responsive element of Sequence ID No 1 ; a minimal promoter gene cloned downstream of the BMP responsive element; a first reporter gene cloned downstream of the BMP responsive element and the first minimal promoter gene, a constitutive promoter cloned downstream of the second reporter gene; a second reporter gene cloned downstream to the constitutive promoter. The second reporter gene acts as an internal control that normalises any altered activity of the second gene in presence or absence of BMP or BMP agonist.

The first and second reporter gene may be selected from the group comprising Green Fluorescence Protein, GUS reporter system, peroxidise reporter system etc, preferably the first and second reporter gene may be luciferase gene, more preferably, the first reporter gene may be Firefly luciferase (FFLuc) of sequence id 3 and the second reporter gene is Renilla Luciferase (RRLuc) gene of sequence id 7. The use of two luciferase reporter genes enables quantification of results.

The minimal promoter may be selected from the group comprising minimal SV40 promoter, a minimal CaMV35S, or any minimal promoter that includes binding site for RNA polymerases.

The constitutive promoter may be selected from the group comprising Opine promoters, CaMV 35 S promoter, Plant ubiquitin promoter (Ubi), Rice actin 1 promoter (Act-1) and Maize alcohol dehydrogenase 1 promoter (Adh-1), preferably the constitutive promoter is CaMV 35S promoter. The dual reporter plasmid construct of the cell line further includes an antibiotic resistant selection marker gene cloned downstream of the constitutive promoter; an internal ribosome entry site (IRES) of Sequence ID No 6 cloned downstream of the antibiotic selection marker gene; and a late Poly(A) signal sequence cloned downstream of the second reporter gene. The IRES translates second reporter gene giving basal and constitutive expression of second reporter gene.

The antibiotic resistant selection marker gene may be selected from from the group comprising hygromycin or puromycin or neuromycin resistant selection marker gene.

The Applicant herein after intensive research has now unexpectedly, found that if he make a single construct with first reporter gene cloned downstream to BRE gene along with an internal control system that normalises altered expression of first reporter gene and transfect the construct into a BMP2/BMP4 double knock osteoblast cell, then a system may be developed for specific and sensitive detection of the BMP signalling.

The First reporter gene activity provides quantitative readout and is amenable to high throughput assays and is used as readout of BRE activity in osteogenic cells. Therefore, First reporter gene is cloned downstream of BRE enhancer.

The expression of second reporter gene is driven by a constitutive promoter/enhancer and is cloned into the construct to act as an internal control to normalise altered First reporter activity in BMP or BMP agonist treated cell line compared to an untreated cell line. In absence of second reporter gene, when a chemical or molecular genetic screen is performed, cellular components other than. BMP signalling pathway may also be activated e.g. basic transcription, translation, cell proliferation etc. giving rise to altered First reporter gene activity in treated cells compared to untreated cells leading to false-positive indications. The advantage of using a single dual reporter construct overcomes low co-transfection efficiency of osteoblast cell line.

Also, the second reporter gene is kept at a greater distance from BRE through sites such as SV40 transcription terminator, SV40 promoter/enhancer, SV40 promoter IRES, hygromycin gene, in order to ensure BRE does not influence expression of second reporter gene. The SV40 promoter drives expression of both hygromycin resistant genes along with second reporter gene whereas second reporter gene is translated by IRES that gives basal and constitutive expression of the second reporter gene. Presence of hygromycin resistant gene enables development of stable cell line.

In yet another aspect, the invention provides a method for screening a candidate agent capable of modulating the Bone Morphogenetic Proteins (BMP) Signalling, the method comprising:

(a) treating a BMP responsive reporter cell transformed with a single expression dual reporter construct with the candidate agent; and

(b) independently assaying levels of expression of said first reporter gene and second reporter gene; and

(c) comparing and evaluating level of expression of said first reporter gene and second reporter gene with the levels of expression of said first reporter gene and second reporter gene of the second BMP responsive reporter cell line that is not contacted with said candidate agent wherein evaluating herein describes the fold change in the level of expression of the first reporter gene in case when the BMP responsive cell is contacted with the candidate agent as compared to the level of expression of the first reporter gene of the BMP responsive cell that is not contacted with the candidate agent after normalising the respective expression of the first reporter assay with the level of expression of the second reporter assay ; the candidate agent capable of exhibiting fold change in the expression of the first reporter gene similar to the BMP molecule consider as the potential agent.

The dual reporter construct that is used in measuring BMP signalling includes a BMP Responsive element of Sequence ID No 1 ; a minimal promoter gene cloned downstream of the BMP responsive element; a first reporter gene cloned downstream of the BMP responsive element and the first minimal promoter gene, a constitutive promoter cloned downstream of the second reporter gene; a second reporter gene cloned downstream to the constitutive promoter. The second reporter gene acts as an internal control that normalises any altered activity of the second gene in presence or absence of BMP or BMP agonist. The activity of first reporter gene provides a quantitative measure of activity of the BMP responsive element.

The first and second reporter gene may be selected from the group comprising Green Fluorescence Protein, GUS reporter system, peroxidise reporter system etc, preferably the first and second reporter gene may be luciferase gene, more preferably, the first reporter gene may be Firefly luciferase (FFLuc) of sequence id 3 and the second reporter gene is Renilla Luciferase (RRLuc) gene of sequence id 7.

The dual reporter plasmid construct of the cell line further includes an antibiotic resistant selection marker gene cloned downstream of the constitutive promoter; an internal ribosome entry site (IRES) of Sequence ID No 6 cloned downstream of the antibiotic selection marker gene; and a late Poly(A) signal sequence cloned downstream of the second reporter gene. The IRES translates second reporter gene giving basal and constitutive expression of second reporter gene.

The minimal promoter may be selected from the group comprising minimal S V40 promoter, a minimal CaMV35S, or any minimal promoter that includes binding site for RNA polymerases.

The BMP responsive reporter cell line that exhibit controllable amount of BMP and specific and sensitive response towards exogenous BMP is derived either from osteoblasts or a mammalian cell line, preferably, the BMP responsive reporter cell line is Osteoblast more preferably the BMP responsive reporter cell line is obtained by knocking off the BMP4 and BMP7 of the Osteoblast.

For assessing the potential of candidate agent, the expression of first and second reporter gene is evaluated concurrently. The activity of the first and second gene may be evaluated by colorimetric, fluorometric and/or luminometric assay.

Figure 2 illustrates measure of BMP signalling by the single expression dual reporter construct expressed by the BMP responsive reporter cell line. As per the figure 2, in presence of exogenous BMP with concentration as low as 10 ng/ml a 15-20 fold stimulation was observed in the stably transfected cell line.

Figure 3 illustrates comparison chart of the BMP reporter systemn disclosed in the present invention as compared to the existing system for measuring BMP signalling. As observed, the system disclosed in the present invention provides superior advantages over existing cell lines in terms of normalised FFLuc fold induction, relative RRLuc fold induction and assay time with advantage of internal control and normalisation.

The normalised FFLuc fold induction in the present cell line is between 35-50 fold at a concentration of exogenous BMP as low as 100 ng/ml whereas relative FFLuc/RRLuc fold induction reads between 45-100 fold with time taken for assay being only 3 hours which is substantially lower than the other compared assays systems.

Advantages:

1. The BMP signalling measuring system disclosed in the present invention is sensitive and can respond to small amount of exogenous BMP.

2. The BMP signalling measuring system disclosed in the present invention is specific to BMP ligand and is non- responsive in presence of any other ligand other than BMP. 3. The BMP signalling measuring system disclosed in the present invention has less assay time than existing system.

4. The BMP signalling measuring system disclosed in the present invention has an internal control and normalisation system which normalises altered FFLuc activity in BMP or BMP agonist treated cell line compared to an untreated cell line.

5. The BMP responsive reporter cell line of the present invention has controllable endogenous level of BMP signalling.

6. The BMP responsive reporter cell line of the present invention is responsive to changes in BMP signalling pathway only.

7. The present invention provides a single expression construct comprising two reporter systems that is efficiently transfected into the cell line as compared to the co- transfectionm of the two reporter assay system.

Examples

Example 1: Generation of BMP2/BMP4 double knock out mouse strain

1. BMP2 and BMP4 limp-specific conditional knockout mouse strain.

Mice carrying floxed BMP2 allele were constructed by introducing LoxP sites flanking the entire protein coding region in exon 3 of the BMP2 gene. Similarly, generation of BMP4 conditional allele was achieved using established methods. In these mice so obtained, the entire protein coding region of exon 4, that encodes a mature peptide of BMP4, was flanked with LoxP sites permanently. By crossing BMP2^c/c mice with BMP4^c/c mice; BMP2^c/wt and BMP4^{c wt} mice were obtained which were further crossed with BMP2^{c c} or BMP4^c/c mice to obtain BMP2^c/c, BMP4^c/wt or BMP4^C/C' BMP2^{C Wt} mice respectively. BMP2^c/c, BMP4^c/wt or BMP4^c/c' BMP2^c/wt micewere crossed with each other to generate BMP2^c/c and BMP4^c/c. These mice were phenotypically wild type but can be made devoid of BMP2 and BMP4 activity in any tissues upon crossing with mice strain expressing Cre recombinase gene.

2. Tamoxifen inducible ubiquitous-cre-recombinase expressing mouse strain

Gt(ROSA)26Sor^tml(cr7Esrl)NatGt(ROSA) 26Sor^tml(cr7Esrl)Nat mouse strain was used. These mice have a tamoxifen inducible cre-mediated recombinant system driven by endogenous mouse Gt(ROSA)26Sor promoter. The mutant allele consists of a fusion product involving ere recombinase and an altered version of the mouse estrogen receptor ligand binding domain. The mutant ligand binding domain does not bind natural ligand at physiological concentrations but will bind the synthetic ligand, 4-hydroxytamoxifen. Restricted to the cytoplasm, the CRE/ESR1 protein can only gain access to the nuclear compartment to mediate recombination after exposure to tamoxifen. Tamoxifen administration will also include CRE recombination in developing embryos of treated mice.

3. Generation of chemically inducible BMP2-BMP4 DCKO strain

Gt(ROSA)26Sor^tml(cr7Esrl)NatGt(ROSA) 26Sor^tml(cre/Esrl)Nat strain of mouse was crossed with BMP2^C/C and BMP4^c/c to generate BMP2^c/c, ΒΜΡ4^ε/ and Gt(ROSA)26Sor^tml(cr7Esrl)NatGt(ROSA) 26Sor^tml(cr7Esrl)Nat mouse in two generation. The mouse strain may be referred to as Tamoxifen inducible BMP2-BMP4 DCKO.

Example 2: Construction of BMP responsive reporter vector

The BRE sequence (Sequence ID No 1) was cloned in pGL3 -Promoter vector (Promega). Briefly, two oligos as described below were synthesized :

BRE For Nhel 5 '-3'

CTAGCTCAGACCGTTAGACGCCAGGACGGGCTGTCAGGCTGGCGCCGGATCTAGCT CAGACCGTTAGACGCCAGGACGGGCTGTCAGGCTGGCGCCGA

With Nhel overhang and BRE Rev Bglll 5 '-3 '

GATCTCGGCGCCAGCCTGACAGCCCGTCCTGGCGTCTAACGGTCTGAGCTAGATCCG

GCGCCAGCCTGACAGCCCGTCCTGGCGTCTAACGGTCTGAG

with Bglll overhang.

The oligos were annealed and cloned in pGL3-Promoter vector between Nhel and Bglll sites to create pGL3-BRE-FFLuc vector. BRE-FFLuc cassette was excised from pGL3-BRE-FFLuc using Nhel and BamHI restriction enzymes and cloned into pGL4.28 vector (Promega) between Nhel and BamHI restriction sites to create pGL4.28-BRE-FFLuc vector.

Internal Ribosomal Entry Site (IRES) was PCR amplified from pCAGIG vector (Addgene No. 1 1 159) using Pfu DNA polymerase with primers

AB383-Forward (5 ' -AATAGCCGCT ACGT AAATTCCG-3 ' ) and

AB384-reverse (5'-ACGCGTTAGCCGTCATATGATATTATCATCGTGTTTT-3') where nucleotides denoted in bold letters indicate IRES specific sequence and reverse primer contains Mlul and Ndel restriction enzyme sites. The blunt ended PCR product was cloned into Pmel linearized pGL4.28-BRE-FFLuc and the construct was named pGL4.28-BRE-FFLuc- IRES. Subsequently Renilla luciferase coding region was PCR amplified from pGL4.84 vector (Promega, U.S.A.) using primers

AB381 -Forward (ATAATAGCATATGGCTTCCAAGGTGTACGAC)

containing Ndel restriction enzyme site and

AB382-reverse (ATAAATTACGCGTTTAGACGTTGATCCTGGCG)

containing Mlul restriction enzyme site

Purified PCR product was digested and cloned into Ndel and Mlul site of pGL4.28-BRE-FFLuc- IRES construct resulting in the creation of BMP responsive dual luciferase reporter construct pGL4.28-BRE-FFLuc-IRESRRLuc or pBFIR (Figure 1).

Example 3: Isolation of Calvarial osteoblast cells

Primary calvarial osteoblasts were isolated from 2-3 day old neonatal mice, washed with phosphate buffered saline (PBS) followed by digestion with 0.1% collagenase and 0.2% dispase at 37°C (five times for 10 minutes each). The last three groups of fractionated cells were collected and maintained in a-Minimum Essential Medium (Sigma Aldrich) containing 10% fetal bovine serum (FBS) (Invitrogen, U.S.A.) with 100 U/ml penicillin G and 100 μg ml streptomycin and cultured at 37° C in a humidified atmosphere of air containing 5% C02.

Example 4: Retroviral Immortalization of primary osteoblast cells

Isolated primary calvarial osteoblast cells were immortalized through infection with a retrovirus expressing SV40 large T-Antigen. Briefly, 293T cells were co-transfected with pBabe-Puro- SV40 LT retroviral vector and pCL-lOAl packaging vector using Superfect transfection reagent following manufacturer's protocol. Fresh media was added 24 hours after transfection and the culture supernatant containing retrovirus was collected every 24 hours, filtered and was directly used to infect the primary osteoblast cells at passage three. 48 hours after infection, virus containing media was replaced with fresh media. 72 hours post-infection, osteoblast cells were cultured in standard medium supplemented with 2μg/ml of puromycin (Sigma Aldrich) for another two weeks. Well isolated drug resistant colonies were further re-plated at very low density to obtain single cell derived colonies. Several colonies were

expanded into cell lines and eventually the one displaying osteogenic activity comparable to uninfected primary osteoblasts was chosen for further manipulation. This Tamoxifen inducible Bmp2; Bmp4 double conditional knockout osteoblast cell line was named BD017 (Bmp2/4 Depletable Osteoblast Clone #17) cell line.

Example 5: Generation of BMP responsive reporter osteoblast cell line

BMP responsive dual luciferase reporter vector, pBFIR (Figure 1), was linearized with BamHI and transfected into BD017 cells. Briefly, 20 ig of linearized pBFIR was transfected into the BD017cells in a 100 mm plate using standard calcium phosphate method. 24 hours later, cells were replenished with fresh media and allowed to grow for 48 hours. Transfected osteoblast cells were cultured in standard medium supplemented with 100μg/ml of Hygromycin B (Invitrogen, U.S.A.) for another two weeks. Well isolated drug resistant colonies were further replated at very low density to obtain single cell derived colonies. Several clones were expanded into cell lines and checked for their BMP responsiveness after several passages and freeze thaw cycles. Based on maximal responsiveness of FFLuc and minimal responsiveness of RRLuc to exogenously added BMP, clone number 7 was used for further study. Example 6: Screening BMP agonists using BMP responsive reporter cell line

BMP responsive reporter osteoblast cell lines will be grown in multi-well format and potential BMP agonist were screened by adding chemicals from a small molecule library. The Firefly and Renilla values were obtained and compared with the values obtained by addition of a BMP protein which acted as a positive control. Any small molecule showing similar activity of Firefly and Renilla values was scored as potential agonist of BMP ligand.

Example 7: Screening BMP agonists using BMP responsive reporter cell line

A normal cell line was transfected with a vector that expresses Noggin. Noggin a known inhibitor of BMP ligand and is also a morphogenetic protein like BMP. The Noggin protein was secreted out of the transfected cells in culture media. The media was then used as conditioned^■ media containing Noggin protein. The BMP responsive reporter cell lines of the current invention were then treated with recombinant BMP-2 protein alone and with the Noggin conditioned media. As shown in Figure 4, the firefly luciferase activity increased with BMP-2 but decreased to basal level when Noggin conditioned media was added. This proved that the cell lines of current invention were specifically responsive to BMP signalling and were not non- specifically stimulated by any other morphogenetic similar protein to BMP like Noggin.

Claims

We claim:

1. A single expression dual reporter construct for measuring Bone Morphogenetic Proteins (BMP) Signalling comprising:

i. a BMP Responsive element of Sequence ID No 1 or a sequence having 90% homology;

ii. a minimal promoter gene cloned downstream to the BMP responsive element; iii. a first reporter gene cloned downstream to the BMP responsive element and the minimal promoter gene;

iv. a constitutive promoter cloned downstream to the first reporter gene; and v. a second reporter gene cloned downstream of the constitutive¹ promoter wherein the first and second reporter gene is selected from the group comprising Green Fluorescence Protein, GUS reporter system, peroxidise reporter system etc, preferably the first and second reporter gene is luciferase gene, more preferably, the first reporter gene is Firefly luciferase (FFLuc) of sequence id 3 and the second reporter gene is Renilla Luciferase (RRLuc) gene of sequence id 7.

2. The single expression dual reporter construct as claimed in claim 1 wherein the minimal promoter is selected from the group comprising SV40 promoter, a minimal CaMV35S, or any minimal promoter that includes binding site for RNA polymerases, preferably minimal promoter is SV40 promoter.

3. The single expression dual reporter construct as claimed in claim 1 wherein the constitutive promoter is selected from the group comprising Opine promoters, CaMV 35S promoter, Plant ubiquitin promoter (Ubi), Rice actin 1 promoter (Act-1) and Maize alcohol dehydrogenase 1 promoter (Adh-1), preferably the constitutive promoter is CaMV 35S promoter.

4. The single expression dual reporter construct as claimed in claim 1 wherein the expression of the first reporter gene is controlled by bmp responsive element and the activity of second reporter gene acts as an internal control that normalises any altered activity.

5. The single expression dual reporter construct as claimed in claim 1 wherein said single expression dual reporter construct further comprising:

i. an antibiotic resistant selection marker gene cloned downstream of the constitutive promoter;

ii. an internal ribosome entry site (IRES) of Sequence ID No 6 cloned downstream of the antibiotic selection marker gene; and

iii. a late Poly(A) signal sequence cloned downstream of the renilla luciferase gene of Sequence ID No 7.

6. The single expression dual reporter construct as claimed in claim 5 wherein the antibiotic resistant selection marker gene is selected from the group comprising hygromycin, puromycin, neuromycin resistant selection marker gene, preferably the antibiotic resistant selection marker gene is hygromycin.

7. A BMP responsive reporter cell line exhibiting controllable endogenous level of BMP for measuring Bone Morphogenetic Proteins (BMP) Signalling comprising: the single expression dual reporter construct as claimed in claim 1 wherein said BMP responsive reporter cell line is derived either from osteoblasts or a mammalian cell line, preferably, the BMP responsive reporter cell line is Osteoblast.

8. The BMP responsive reporter cell line as claimed in claim 7 wherein said Osteoblast exhibiting controllable amount of BMP is created by knocking out of BMP gene, preferably by knocking out of BMP2 and BMP 4.

9. The BMP responsive reporter cell line as claimed in claim 7 wherein the minimal promoter is selected from the group comprising SV40 promoter, a minimal CaMV35S, or any minimal promoter that includes binding site for RNA polymerases, preferably minimal promoter is SV40 promoter.

10. The BMP responsive reporter cell line as claimed in claim 7 wherein the constitutive promoter is selected from the group comprising Opine promoters, CaMV 35S promoter, Plant ubiquitin promoter (Ubi), Rice actin 1 promoter (Act-1) and Maize alcohol dehydrogenase 1 promoter (Adh-1), preferably the constitutive promoter is CaMV 35S promoter.

1 1. The BMP responsive reporter cell line as claimed in claim 7 wherein said single expression dual reporter construct further comprising:

i. an antibiotic resistant selection marker gene cloned downstream of the constitutive promoter; ii. an internal ribosome entry site (IRES) of Sequence ID No 6 cloned downstream of the antibiotic selection marker gene; and

12. The BMP responsive reporter cell line as claimed in claim 11 wherein the antibiotic resistant selection marker gene is selected from the group comprising hygromycin, puromycin, neuromycin resistant selection marker gene, preferably the antibiotic resistant selection marker gene is hygromycin.

13. A method for screening a candidate agent capable of modulating the. Bone Morphogenetic Proteins (BMP) Signalling, the method comprising:

(a) treating a BMP responsive reporter cell line as claimed in claim 7 and expressing the single expression dual reporter construct as claimed in claim 1 with the candidate agent; and

(b) independently assaying levels of expression of said first reporter gene and second reporter gene by any known method such as colorimetric, fluorometric and/or luminometric assay; and

(c) comparing and evaluating said level of expression of said first reporter gene and second reporter gene that is in contact with said candidate agent with the levels of expression of said first reporter gene and second reporter gene of a second BMP responsive reporter cell line as claimed in claim 7 that is not contacted with said candidate agent wherein evaluating herein describes the fold change in the level of expression of the first reporter gene in case when the BMP responsive cell is contacted with the candidate agent as compared to the level of expression of the first reporter gene of the BMP responsive cell that is not contacted with the candidate agent after normalising the respective expression of the first reporter assay with the level of expression of the second reporter assay ; the candidate agent capable of exhibiting fold change in the expression of the first reporter gene similar to the BMP molecule consider as the potential agent.

14. The method as claimed in claim 13 wherein the minimal promoter is selected from the group comprising SV40 promoter, a minimal CaMV35S, or any minimal promoter that includes binding site for RNA polymerases, preferably minimal promoter is SV40 promoter.

15. The method as claimed in claim 13 wherein the constitutive promoter is selected from the group comprising Opine promoters, CaMV 35S promoter, Plant ubiquitin promoter (Ubi), Rice actin 1 promoter (Act-1) and Maize alcohol dehydrogenase 1 promoter (Adh-1), preferably the constitutive promoter is CaMV 35S promoter.

16. The method as claimed in claim 13 wherein said Osteoblast exhibiting controllable amount of BMP is created by knocking out of BMP gene, preferably by knocking out of BMP2 and BMP 4.

17. The method as claimed in claim 13 wherein said single expression dual reporter construct further comprising:

18. The method as claimed in claim 17 wherein the antibiotic resistant selection marker gene is selected from the group comprising hygromycin, puromycin, neuromycin resistant selection marker gene, preferably the antibiotic resistant selection marker gene is hygromycin.