CN109207517B - Drug-inducible CRISPR/Cas9 systems for genome editing and transcriptional regulation - Google Patents

Abstract

The invention relates to the field of molecular biology, and specifically discloses a drug-inducible CRISPR/Cas9 system for genome editing, comprising a 16-22nt sgRNA targeting a specific gene site and a Cas9 fusion protein, wherein the Cas9 fusion protein is composed of Cas9 is composed of 2-5 ER T2s in series with its C-terminus, and 1 or 2-10 tandem ^NESs are inserted between the Cas9 and the tandem ER ^T2s . After a series of experiments, the present invention develops and optimizes a scheme with the highest activity and the lowest background activity, and applies it to the editing of endogenous genes. In addition, the present invention also provides genome editing and transcriptional activation in a single system, so as to maximize the function of the drug-inducible system for manipulating the genome with richer and more diverse designs. The establishment of such a drug-inducible system with multiple activities will provide a more powerful tool for precise genome engineering research and clinical research and applications in the field of gene therapy.

Description

Drug-inducible CRISPR/Cas9 systems for genome editing and transcriptional regulation

technical field

The present invention relates to the field of molecular biology, in particular to a variety of drug-inducible CRISPR/Cas9 systems for genome editing and transcriptional regulation.

Background technique

CRISPR/Cas9 system, derived from the immune mechanism of bacteria to degrade invading viral DNA or other foreign DNA. Using RNA-mediated DNA-binding and endonuclease activities, this system can be regulated in the genome in a sequence-dependent manner. Cas9 protein binds and cleaves double-stranded DNA in a sequence-specific manner, and this sequence-specific binding is achieved through a guide RNA (gRNA) complementary to the target sequence and the adjacent protospacer-adjacent motif (PAM). The complex formed by Cas9 and gRNA mediates DNA double-strand breaks and completes targeted gene editing through two DNA repair mechanisms, NHEJ and HDR. The CRISPR/Cas9 system can also be combined with different effector molecules to expand its functions, enabling transcriptional activation, repression, genomic DNA labeling, or epigenetic regulation. To this end, the Cas9 protein was further engineered to mutate the nuclease functional domain to produce a dead Cas9 (dCas9) form that lost its activity, while still retaining the DNA-binding activity to facilitate the recruitment of the corresponding effector molecules to the target site to function.

With the increasing awareness of CRISPR/Cas9, this technology has been widely used in various fields of biological research. However, the study of dynamic biological systems often requires more precise regulation methods. Establishing a drug-induced CRISPR/Cas9 system and realizing the switch of effector protein functions at any time to meet practical application requirements is one of the important goals pursued by people. A possible solution is to make the expression of Cas9 protein regulated by a drug-inducible promoter or a tissue-specific promoter, and control the occurrence of genome editing or transcription by controlling the transcription of effector proteins. The disadvantage of this scheme is that the effector protein needs to go through the process of transcription and translation to become active, the response time to drug induction is usually slow, and the operation method may be cumbersome, and there are certain obstacles in in vivo application.

At present, some laboratories have established different drug-inducible systems based on CRISPR/Cas9 technology, including regulatory systems at the transcriptional level and post-translational regulatory systems. There are two types of regulation at the transcriptional level: special promoters or Doxycycline-inducible systems. Shen et al. used CRISPR/Cas9 technology to establish an inducible conditional knockout system in a nematode model, which was designed to control the transcription of Cas9 and sgRNA through the heat shock protein promoter Phsp. When this system is introduced into nematodes, the knockout of specific endogenous genes can be initiated under appropriate thermal stimulation. Dow et al. established a Cas9-inducible system regulated by doxycycline, so that the expression of Cas9 was regulated by the TRE3G promoter, and successfully achieved genome editing in multiple tissues in a drug-treated mouse model. Gonzalez et al. also used the doxycycline regulation mode to establish a rapid and multiplex drug-induced genome editing system based on the CRISPR platform. Using this system, stage-specific inducible gene knockout can be achieved during the differentiation of human pluripotent stem cells. The post-translational regulatory system mainly controls genome editing or transcriptional activation by regulating the activity of effector proteins. Polstein et al. and Nihongaki et al. used Cas9 technology to establish a light-induced activation system to dynamically regulate the transcriptional activation of endogenous genes. Due to its large molecular weight, the Cas9 protein is relatively inefficient when introduced into cells. Therefore, some researchers split Cas9 into two parts and added control devices to each half of the Cas9 protein, so that the combination of mature and functional Cas9 proteins can be used in drugs (Rapamycin ) or under the control of light, thereby realizing the regulation of Cas9 activity to achieve the purpose of regulating genome editing or transcriptional activation. Another design scheme is to insert an intein into Cas9 that can be cleaved by the small molecule 4-OHT. The intein changes the conformation of Cas9 protein and inactivates it. The activity is restored after the peptide is contained.

Although there have been some successful reports on the study of drug-induced genome editing and transcriptional activation systems, each protocol has its own limitations. Regulation at the transcriptional level is usually slow in response and has relatively few choices of tissue-specific promoters. In contrast, regulation of post-translational protein activity may be a more desirable approach. However, most of the existing successful schemes are unilateral studies on genome editing or transcriptional activation, and the selected regulatory drugs or methods are not suitable for all fields. The design of split Cas9 makes the drug-induced results irreversible. Therefore, , it is necessary to develop new drug-inducible systems.

SUMMARY OF THE INVENTION

In order to solve the problems existing in the prior art, the present invention proposes to establish a new drug induction system based on ^Cas9 technology on the basis of synthesizing the research results of the predecessors. Achieve 4-OHT-induced genome editing and transcriptional activation that can be concurrent with genome editing.

The present invention performs various optimizations on the design of different drug induction systems, selects the scheme with the highest activity and the lowest background activity, and applies it to the editing of endogenous genes. The present invention also attempts to simultaneously perform genome editing and transcriptional activation in a single system, so as to maximize the function of the drug-inducible system to manipulate the genome with a richer and more diverse design. The establishment of such a drug-inducible system with multiple activities will provide a more powerful tool for precise genome engineering studies.

The technical scheme of the present invention is as follows:

In the first aspect, the present invention first provides a drug-inducible CRISPR/Cas9 system for genome editing, which is different from the prior art in that the system includes 16-22nt sgRNA and Cas9 targeting specific gene loci A fusion protein, wherein the Cas9 fusion protein is composed of Cas9 and 2-5 ER T2s in series with its C-terminus, namely ^{Cas9-(ER T2 )} n, n=2-5.

When the Cas9 fusion protein consists of Cas9 and two ER T2s in series with its C-terminus, it is ^{Cas9-2ER T2 (} C2E for short).

The ER ^T2 is an estrogen receptor with three amino acid mutations G400V/M543A/L544A (Feil, R., Wagner, J., Metzger, D. & Chambon, P. Regulation of Cre recombinase activity by mutated estrogen receptor ligand-binding domains. Biochemical and biophysical research communications 237, 752-757, 1997).

The present invention fuses Cas9 with ER ^T2 so that Cas9 is regulated by 4-OHT, and by fusing one or two ER ^T2s to the N-terminus or C-terminus of Cas9, four different forms of drug-induced genome editing systems (ie EC, 2EC, CE, C2E). At the same time, the present invention uses multiple chimeric single-stranded guide RNAs (sgRNAs) for different gene loci, combined with different Cas9-ER ^T2 fusion proteins, and utilizes a single-strand annealing (single strand annealing, SSA) based repair mechanism. The luciferase reporter system compares the cleavage activity of four different forms of drug-induced genome editing systems. In this luciferase reporter system, the DNA double-strand nick of the target site can reconstruct the luciferase coding sequence through SSA, and then the cleavage activity of Cas9 can be reflected by detecting the activity of luciferase. It was found that only when ER ^T2 was fused to the C-terminus of Cas9 (CE and C2E) had little effect on the endonuclease activity of Cas9.

Further, the present invention selects the cell surface protein CD201, which is highly expressed in human embryonic kidney epithelial cells HEK293T, as the target gene, designs sgRNA targeting the 5' end of the CD201 coding region, and detects genome editing induced by different drugs by flow cytometry. NHEJ-induced gene knockout efficiency by system (CE and C2E). Using Cas9 fused with NLS as a positive control, the cell population shifted to the CD201-negative region, indicating that CD201 was successfully knocked out. Sanger sequencing results demonstrated that NHEJ events occurred in CD201-negative cells. The experimental results showed that the background activity of Cas9(C2E) fused with two ER ^T2s was lower in the absence of 4-OHT.

However, although Cas9 (C2E) fused with two ER ^{T2s has lower background activity without 4-OHT compared with Cas9 (CE) fused with one ER T2 ,} it still does not reach a very ideal state. There were still a certain proportion of CD201-negative cells in the 4-OHT group, which still had adverse effects on its application.

For those skilled in the art, it can be inferred without doubt based on the conventional technical knowledge in the art that when 2 serially connected ER ^T2s are replaced by 3-5 serially connected ER ^T2s , the same/similar technical effect can also be obtained.

In order to reduce the background activity of the system without adding 4-OHT to a greater extent, and realize the absolute control of the genome editing event by the drug, the present invention further inserts 1 or 2-10 tandem nuclear export at different positions of C2E The nuclear export signal (NES), which can guide the protein fused to it to move from the nucleus to the cytoplasm, can control the dynamic balance of Cas9 protein in the nucleus/plasma to a certain extent, so as to achieve the purpose of eliminating the background. Through a luciferase reporter system based on the SSA repair mechanism, it was found that when a NES (Cas9-NES-2ER ^T2 , CN2E) was inserted between Cas9 and 2ER ^T2 , the Cas9 protein could still maintain a high endonuclease activity. Consistently, in another fluorescent reporter system (Traffic Light Repoter, TLR) TLR experiment (this TLR system can detect the frequency of NHEJ and HDR events by analyzing the percentage of mCherry fluorescent protein and GFP fluorescent protein positive cells) , CN2E also showed significant drug-induced effects and insignificant background activity. In contrast, NES at either end of Cas9-2ER ^T2 impairs its drug-inducible effects, suggesting that the structure of this protein complex is critical for its function.

Further, the present invention uses a fluorescence conversion reporter (fluorescence conversion reporter, FCR) system with higher sensitivity than TLR for research. In this system, HDR mediated the substitution of a key amino acid site resulting in a shift of fluorescence from BFP to GFP, and the efficiency of the HDR event was reflected by analyzing the percentage of GFP-positive cells. In this experiment, the background activity of CN2E was detected, and it was also detected that the background activity after the insertion of two NESs (C2N2E) was significantly reduced.

For those skilled in the art, it can be inferred without doubt according to the conventional technical knowledge in the art that when 1 or 2 NESs in series are replaced by 3-10 NESs in series, the same/similar technical effects can also be obtained. Therefore, the drug-inducible CRISPR/Cas9 system for genome editing can also be the insertion of 1 or 2-10 tandem ^NESs between the Cas9 and 2-5 tandem ER T2s, namely Cas9-( NES)m-(ER ^T2 )n, m=1-10.

Preferably, the drug-inducible CRISPR/Cas9 system for genome editing includes sgRNA targeting a specific gene locus and Cas9-NES-2ER ^T2 /Cas9-2NES-2ER ^T2 , most preferably targeting a specific gene locus sgRNA and Cas9-2NES-2ER ^T2 (this system is called HIT-Cas9).

Further, when the system is applied, it is necessary to construct a vector capable of translating the sgRNA and expressing the aforementioned Cas9 fusion protein, the Cas9-(ER ^T2 )n/Cas9-(NES)m-(ER ^T2 )n and The sgRNAs can be present separately in different vectors or in the same vector.

Wherein, the fusion protein is N-terminal to C-terminal from left to right, and each element can be connected by a linker of 3-20 amino acids.

It should be understood that, due to the freedom of the linker, the encoding gene of the fusion protein is not limited to a specific nucleotide sequence.

Further, the encoding gene of the fusion protein and the vector containing the encoding gene also belong to the protection scope of the present invention.

The vector can be a DNA vector, an RNA vector, a protein vector, a lentiviral vector, an adenoviral vector or a common plasmid vector and the like.

In the experimental study of the present invention, the lentivirus pRRL.sin-18.ppy was used as a vector.

Based on the aforementioned research, the present invention provides the application of the system in drug-inducible genome editing. The application can be embodied in various aspects, as long as the system described in the present invention is used for drug-induced genome editing, it all falls within the protection scope of the present invention.

More specifically, the application can be embodied as a method of genome editing utilizing drug induction. Transfection of the system (the vector containing the system) into cells or tissues, translation/expression, and drug treatment with 4-OHT and/or TAM and/or their derivatives when genome editing is required , induces the translated Cas9 fusion protein to enter the nucleus, and performs genome editing for specific gene loci.

The system can strictly and effectively regulate the activity of Cas9 protein under the action of 4-OHT and/or TAM and/or their derivatives, so that it can enter the nucleus to achieve genome editing function, and no background activity will be generated without drug treatment . The present invention proves the drug dose-dependent response and selection specificity of the drug-inducible genome editing system, so as to ensure that the system can be more widely used in research in various fields of biomedicine.

In a second aspect, the present invention provides a drug-inducible CRISPR/Cas9 system that can perform genome editing and transcriptional activation at the same time, including a 16-22nt sgRNA for genome editing targeting a specific gene locus A, targeting a specific gene locus 10-16nt sgRNA for transcriptional activation of B, Cas9-(NES)m-(ER ^T2 )n-GCN4 and scFv-(ER ^T2 )n-ADs, m=1-10, n=2-5, ADs For the combination of transcription factors, the transcription factors are selected from one or more of V, P, R, H. The Cas9-(NES)m-(ER ^T2 )n-GCN4 that plays a major role in this system is called HIT2.

Cas9 in this system is wild-type Cas9, NES is nuclear export signal, (NES)m is m NES in tandem, V is VP64, P is P65, R is Rta, H is HSF1, ER ^T2 It is an artificial mutant with three amino acid mutations G400V/M543A/L544A (the amino acid sequence is shown in SEQ ID NO.1), (ER ^T2 ) n is n tandem ER ^T2 , and scFv is a single anti-GCN4 peptide. Chain antibody variable region, GCN4 is a segment of epitope short peptide from yeast transcription activator GCN4 with 5-30 copies, preferably 10 copies of GCN4 short peptide. Sequence references for scFv and GCN4 (Tanenbaum et al., A protein-tagging system for signal amplification in gene expression and fluorescence imaging. Cell 159, 635-646 (2014). The above elements are all protein/gene elements known in the art.

In the present invention, sgRNAs with different lengths (from 12bp to 22bp) are designed, and the pSSA assay is used to determine the optimal length that will cause wild-type Cas9 to lose the activity of cutting double-stranded DNA, and finally 10-16nt sgRNA is preferably obtained. Therefore, in a drug-inducible system for simultaneous genome editing and transcriptional activation, 10-16nt sgRNAs were designed to perform gene-specific transcriptional activation, while still using 16-22nt sgRNAs to perform gene-specific genome editing.

In application, the 10-16nt sgRNA and 16-22nt sgRNA can exist in different vectors or in the same vector, and Cas9-(NES)m-(ER ^T2 )n-GCN4 and scFv-(ER ^T2 )n-ADs exist respectively in different carriers.

Wherein, the fusion protein is N-terminal to C-terminal from left to right, and each element can be connected by a linker of 3-20 amino acids.

It should be understood that, due to the freedom of the linker, the encoding gene of the fusion protein is not limited to a specific nucleotide sequence.

Further, the encoding gene of the fusion protein and the vector containing the encoding gene also belong to the protection scope of the present invention.

Based on this system, the present invention provides a method for simultaneously performing genome editing and transcriptional activation by drug induction. The vector containing the system is co-transfected into cells or tissues for translation/expression, and genome editing and transcription are performed when needed. Upon activation, drug treatment with 4-OHT and/or TAM and/or their derivatives induces translation of the Cas9 fusion protein into the nucleus for genome editing at specific loci targeted by 16-22nt sgRNA, targeting 10 - Transcriptional activation by specific gene loci targeted by 16nt sgRNA.

Further, the present invention also provides a method for reversible drug-induced transcriptional activation when genome editing and transcriptional activation are performed simultaneously, when 4-OHT and/or TAM and/or their derivatives are used for drug treatment , the transcription of specific genes can be rapidly activated; when 4-OHT and/or TAM and/or their derivatives are withdrawn, the transcriptional activity of specific genes decreases to the background level, and when 4-OHT and/or TAM and/or their derivatives are withdrawn again, Transcriptional activity of specific genes can be re-increased upon treatment with/or their derivatives.

In the third aspect, in the drug regulation system established by the present invention, in addition to ensuring the strict control of the function of the whole system by the drug, the drug dose-dependent response of the constructed system is also detected to determine the most effective drug control system. optimal dose. The present invention also tests the selective specificity of the system to the drug 4-OHT and the endogenous estrogen ligand β-estradiol, to ensure that the system only acts on 4-OHT and/or TAM and/or their derivatives function without interference from endogenous ligands.

The operations involved in the present invention are routine operations in the art unless otherwise specified.

On the basis of common knowledge in the art, the above preferred conditions can be combined with each other to obtain specific embodiments.

The present invention can also be used to develop other drug-inducing systems with different functions based on CRISPR/Cas9 technology. For example, if drug-induced Cas9 protein is used in combination with transcriptional repressors or epiregulators, it is also possible to achieve functions such as drug-induced transcriptional repression or drug-induced epigenetic regulation.

Further, the Cas9 protein used in the present invention is SpCas9, and can also be replaced with other SpCas9 variants with different PAM recognition sequences, or replaced with different types of Cas9 proteins such as SaCas9, to promote the applicability of the drug inducible system, to achieve Broader and more complex functional regulation.

The beneficial effects of the present invention are:

The present invention develops a drug-inducible genome editing system, and on this basis, through a series of experiments, a program with the highest activity and the lowest background activity is developed and optimized, and applied to the endogenous gene editing system. edit.

Not only that, the present invention also provides genome editing and transcriptional activation in a single system, so as to maximize the function of the drug-inducible system for manipulating the genome with richer and more diverse designs. The establishment of such a drug-inducible system with multiple activities will provide a more powerful tool for precise genome engineering studies.

Description of drawings

FIG. 1 is a graph showing the results of a TLR experiment in Example 2 of the present invention.

FIG. 2 is a graph showing the results of a TLR experiment in Example 2 of the present invention.

FIG. 3 is a graph showing the results of an FCR experiment in Example 2 of the present invention.

FIG. 4 is a graph showing the results of CD201 knockout experiments in Example 2 of the present invention.

Figure 5 is a schematic diagram of the carrier in Comparative Example 1 of the present invention.

6 is a schematic diagram of intracellular localized fluorescence in Comparative Example 1 of the present invention.

FIG. 7 is a graph showing the experimental results of pSSA in Comparative Example 1 of the present invention.

FIG. 8 is a graph showing the experimental results of pSSA in Comparative Example 2 of the present invention.

FIG. 9 is a graph showing the results of flow cytometry in Example 4 of the present invention.

FIG. 10 is a graph showing the results of the FCR experiment in Comparative Example 3 of the present invention.

FIG. 11 is a graph showing the results of TLR experiments in Comparative Example 3 of the present invention.

FIG. 12 is a graph showing the results of TLR experiments in Comparative Example 3 of the present invention.

FIG. 13 is a graph showing the results of the Surveyor experiment in Comparative Example 3 of the present invention.

FIG. 14 is an analysis diagram of flow cytometry detection results in Example 5 of the present invention.

FIG. 15 is a graph showing the detection results of luciferase in Example 6 of the present invention.

16 is an analysis diagram of flow cytometry detection results in Example 7 of the present invention.

FIG. 17 is a graph showing the detection results of luciferase in Example 7 of the present invention.

FIG. 18 is an analysis diagram of flow cytometry detection results in Example 7 of the present invention.

Detailed ways

The preferred embodiments of the present invention will be described in detail below with reference to the examples. It should be understood that the following examples are given for illustrative purposes only, and are not intended to limit the scope of the present invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from the spirit and spirit of the present invention.

The experimental methods used in the following examples are conventional methods unless otherwise specified.

The materials, reagents, etc. used in the following examples can be obtained from commercial sources unless otherwise specified.

Example 1 Drug-inducible CRISPR/Cas9 system for genome editing

This example is used to illustrate the construction of the drug-inducible CRISPR/Cas9 system for genome editing according to the present invention.

Build method:

The drug-inducible genome editing system constructed by the present invention includes the following two parts:

(1) It consists of Cas9 and two ER T2s in series with its C-terminus, namely ^{Cas9-2ER T2 .}

(2) Insert one/two tandem NESs in the Cas9-2ER ^T2 plasmid, namely Cas9-NES-2ER ^T2 /Cas9-2NES-2ER ^T2 .

The source of each part of the plasmid is as follows:

The Cas9 element was amplified from plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 (from Feng Zhang's laboratory, Addgene plasmid #42230 40). The ER ^T2 element was amplified from plasmid pAd-CreER (a gift from the THe laboratory of the University of Chicago). NES sequences were reported according to Ding et al. (Ding, Y., Ai, HW, Hoi, H. & Campbell, REForster resonance energy transfer-based biosensors for multiparameterratiometric imaging of Ca2+dynamics and caspase-3activity in single cells.Analytical chemistry 83, 9687-9693 (2011).) were synthesized by Shanghai Shenggong Company and inserted into different Cas9 expression vectors.

The construction of the reporter plasmid in the TLR system was accomplished by replacing the Sce site in the pCVL TrafficLight Reporter 1.1 (Sce target) Ef1a Puro plasmid (Addgene plasmids #31482) from the laboratory of Andrew Scharenberg with the targeting sequence of the sgRNA. The GFP donor plasmid used was from the laboratory of Andrew Scharenberg (Addgene plasmids #31475).

The reporter plasmid in the FCR system is obtained by mutating a single amino acid of the GFP protein, and the plasmid is constitutively expressed.

Example 2

This embodiment is used to illustrate the application of the system described in Embodiment 1.

1. Experimental materials

Cas9-2ER ^T2 , Cas9-NES-2ER ^T2 and Cas9-2NES-2ER ^T2 plasmids, sgRNAs targeting different sites, donor plasmids for use in TLR systems and single-stranded DNA donors for FCR experiments ( ssDNA donor).

2. Experimental method

HEK293T cells (ATCC) were cultured in Dulbecco's modified Eagle's medium supplemented with 10% FBS, 2 mM GlutaMAX (Thermo Fisher), 100 U/ml penicillin and 100 μg/ml streptomycin and placed in a 37°C, 5% _CO incubator cultivated in. Monoclonal TLR and FCR stably transfected cell lines were obtained by lentiviral packaging and infection. The cell transfection reagent was a DNA transfection reagent from Biotool, and the transfection method was carried out according to the instructions. The total amount of DNA transfected in each well was the same in each experiment. The cell medium was changed 5 hours after transfection. 4OHT with a final concentration of 100-500 nM was added to the experimental group after 24 hours of transfection, and the same volume of absolute ethanol was added to the control group, and the genome editing was detected after culturing for 48 hours.

For TLR experiments, TLR reporter cell lines were pre-seeded in 24-well plates, and then each well was transfected with 250 ng Cas9-ERT2 fusion protein expression vector, 150 ng sgRNA, and 400 ng GFP donor plasmid (Addgene plasmids #31475 ¹⁷ ) (or no transfection). GFP donor plasmid). Cells were digested with 0.25% trypsin (Thermo Fisher) and at least 50,000 cells per well were collected and analyzed for HDR efficiency using a CytoFLEX flow cytometer (Beckman Coulter). The efficiency of HDR was tested by the percentage of GFP positive cells. For analysis of NHEJ events, cells were transferred to 96-well plates, fixed with 4% paraformaldehyde and stained with Hochest 33342 (Thermo Fisher), and then the images were scanned using an Operetta high-content imaging system (Perkin-Elmer), and the fluorescence signal of mCherry was detected with Harmony3 .5 (Perkin-Elmer) for analysis.

For CD201 knockout experiments, cell culture and transfection were performed in the same manner. Twenty-four hours after transfection, the cells were resuspended in medium containing 125ug/ml Zeocin and 100ug/ml G418, and then changed to medium containing only 125nM 4OHT after culturing for 24 hours. After the cells were cultured for several days to a sufficient number, the cells were incubated with antibodies using PE-Vio770 (Miltenyi Biotec) and analyzed by a flow cytometer CytoFLEX (Beckman Coulter).

For FCR experiments, stably transfected cell lines were pre-seeded in 24-well plates. Afterwards, each well was transfected with 300ng Cas9-ERT2 fusion protein expression vector, 300ng BFP sgRNA and 10pmol ssDNA donor (5'-GCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACGTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGA-3', which was synthesized in production). At least 30,000 cells were collected per well and analyzed for HDR efficiency using a CytoFLEX flow cytometer (Beckman Coulter). The efficiency of HDR was tested by the percentage of GFP positive cells.

3. Experimental results

We first used traffic-light reporter (TLR) experiments to simultaneously examine the efficiency of Cas9-2ER ^T2 (C2E)-induced NHEJ and HDR. The reporter system contains two fluorescent proteins, GFP and mCherry. Because the drug-induced effect of C2E is achieved through nuclear transport, a stably transfected cell line with the reporter gene stably integrated into the genome was established for experiments. In this reporter system, the targeting sequence of the sgRNA targeting human hOct-4 was inserted into the coding region of GFP, so that neither GFP nor mCherry could read correctly. The correct reading frame of mCherry can be restored when the target sequence forms a double-strand DNA break (DSB) due to the activity of the Cas9 protein, and then a frameshift mutation of 3n+2 bases caused by the repair mode of NHEJ. The repair mode of HDR is detected by co-transforming the GFP template plasmid in the system, so that GFP can obtain a complete reading frame. Therefore, the fluorescence signals of mCherry and GFP can represent the efficiency of NHEJ and HDR events, respectively. Through TLR experiments, C2E-mediated NHEJ and HDR events were found to have significant 4OHT-inducing effects (Figure 1). At the same time, however, it was found that there was also a certain proportion of background activity in the absence of 4OHT treatment (Figure 1).

It is assumed that the background effect is due to some C2E localization in the nucleus in the absence of 4OHT. Therefore, to reduce background effects, one or two nuclear export signals (NES) were inserted in C2E to form Cas9-NES-2ER ^T2 (CN2E) and Cas9-2NES-2ER ^T2 (C2N2E). Consistent with the performance of the C2E design, CN2E and C2N2E also showed significant drug-induced effects in TLR experiments, and this design indeed further reduced background effects while maintaining drug-induced genome editing activity (Figure 2). . Considering the low sensitivity of TLR assay in detecting HDR efficiency, fluorescence conversion assay (FCR) was used to study. In this system, after Cas9 cleaved the target DNA to generate DSBs, a key amino acid site was changed by HDR repair, which in turn led to the change of fluorescence from BFP to GFP. This assay is more sensitive than TLR and can detect the background effect of CN2E and the reduction of the background effect of C2N2E after inserting an additional NES (Figure 3).

Furthermore, for a cell surface protein CD201 that is highly expressed in HEK293T cells, an sgRNA targeting the 5' end of the CD201 coding region was designed, and the NHEJ-induced gene knockout efficiency was detected by flow cytometry. The results also showed that both CN2E and C2N2E could achieve 4OHT-induced knockdown of the CD201 gene, and the insertion of two NESs could further reduce the background activity without 4OHT treatment (Figure 4).

The above results prove that the constructed drug-induced genome editing system can achieve the editing of specific gene loci under the induction of 4OHT.

Comparative Example 1

Considering the different numbers of ER ^{T2s and their effects on the endonuclease activity of Cas9 when they exist in different positions of Cas9, a series of combinations of ER T2 and} Cas9 were designed and the corresponding plasmids were constructed (Fig. 5).

First, the effects of different designs on the intracellular localization of Cas9 were examined. The results showed that when ER ^T2 was located at the N-terminus of Cas9, 4-OHT could not effectively induce Cas9 to enter the nucleus. Only when ER ^T2 was located at the C-terminus of Cas9, 4-OHT could obviously induce its nuclear entry, but there was also a high background activity (Fig. 6).

In order to test whether the endonuclease activity of Cas9 is affected when different combinations of Cas9 and ER ^T2 are used, different sgRNAs were designed for human telomere and Oct4 genes, respectively, and the efficiency of different sgRNAs was detected by pSSA luciferase reporter system. , select the sgRNA with the highest activity, and verify the activity of different drugs induced by Cas9 design. It was found that, consistent with the results of intracellular localization, when ER ^T2 was located at the C-terminus of Cas9 (CE and C2E), the activity of Cas9 was higher (Fig. 7).

Comparative Example 2

To further reduce background effects, one or two nuclear export signals (NES) were inserted at different positions in C2E (Fig. 8A). Through single-strand annealing (SSA) luciferase experiments, it was found that the activity of the Cas9 endonuclease was best preserved when a NES (Cas9-NES-2ER ^T2 , CN2E) was inserted between Cas9 and 2ER ^T2 (Fig. 8B). In contrast, NES at either end of Cas9-2ER ^T2 impairs its drug-inducible effects, suggesting that the structure of this protein complex is critical for its function.

Example 3 A drug-inducible CRISPR/Cas9 system for simultaneous genome editing and transcriptional activation

This example uses genome editing of BFP gene and transcriptional activation of CD43 gene as an example to illustrate the construction of a drug-inducible CRISPR/Cas9 system that performs genome editing and transcriptional activation at the same time.

Build method:

The drug-inducible CRISPR/Cas9 system for simultaneous genome editing and transcriptional activation of the present invention includes Cas9-2NES-2ER ^T2 -GCN4 and scFv-2ER ^T2 -VPH, wherein Cas9-2NES-2ER ^T2 is constructed in Example 1 Plasmid, GCN4 is a short peptide of 10 copies of yeast transcription activator GCN4, V is VP64, P is P65, and H is HSF1. The source and construction method of each element of the plasmid are as follows:

VP64 was amplified using the pLenti-EF1a-SOX2 plasmid (Addgene plasmid#35388) from Zhang Feng's laboratory as a template; P65 and Rta were amplified using the George Church laboratory's SP-dCas9-VPR plasmid (Addgene plasmid#63798) as a template Obtained; HSF1 was amplified using the lenti MS2-P65-HSF1_Hygro plasmid (Addgeneplasmid#61426) of Zhang Feng's laboratory as a template. scFv-sfGFP-GB1 and 10xGCN4 were prepared according to Tanenbaum M.E.et.al. (Tanenbaum, M.E., Gilbert, L.A., Qi, L.S., Weissman, J.S. & Vale, R.D.A protein-tagging system for signal amplification in gene expression and fluorescenceimaging. Cell 159, 635-646 ( 2014).) The reported sequence was synthesized in Goldwisdom. For the scFv expression vector used in the simultaneous genome editing and transcriptional activation, the sfGFP in the scFv vector was removed so as not to interfere with the editing of BFP, and it was marked as GFP.

Example 4

This embodiment is used to illustrate the application of the system described in Embodiment 3.

1. Experimental materials

Cas9-2NES-2ER ^T2 -GCN4 (C2N2E-GCN4) and scFv-2ER ^T2 -VPH plasmids, targeting sgRNAs at different sites, were used as single-stranded DNA donors (ssDNA donors) in FCR experiments. APC-labeled anti-CD43 antibody for detection of CD43 expression. Stably transfected cell line incorporating the BFP reporter gene for FCR experiments.

The Cas9-NLS-GCN4 plasmid served as a control.

2. Experimental method

Simultaneous BFP editing and CD43 activation experiments were performed using BFP-stable cell lines. Cells were grown in 24-well plates and transfected according to the protocol in Example 1. During transfection, ensure that the total amount of DNA transfected in each well is the same, and the sgRNA targeting CD43 and BFP, the Cas9 fusion protein carrier and the activator carrier are carried out in an equimolar ratio. In addition, 10pmol ssDNA donor needs to be added to each well. After 48 hours of 4OHT, cells were harvested and incubated with the CD43-specific antibody CD43-APC (Miltenyi Biotec) as indicated, followed by CytoFLEX (Beckman Coulter) for flow cytometry. The efficiency of genome editing and transcriptional activation was obtained by the percentage of GFP and CD43 positive cells.

3. Experimental results

It has been reported that sgRNAs shortened to less than 16 nt in length can guide Cas9 to reach and bind to target DNA without cleavage (Kiani, S. et al. Cas9 gRNA engineering for genome editing, activation and repression. Nature methods 12, 1051- 1054 (2015). Dahlman, JE et al. Orthogonalgene knockout and activation with a catalytically active Cas9nuclease. Nat Biotechnol 33, 1159-1161 (2015).). Based on this characteristic, the present invention establishes the use of the same CRISPR/Cas9 system to simultaneously achieve drug-induced genome editing and transcriptional activation. A 20nt sgRNA targeting BFP and a 14nt sgRNA targeting CD43 were selected for co-transfection with C2N2E-GCN4 and scFv-2ER ^T2 -VPH, and after treatment with 4OHT for a period of time, flow cytometry proved that in the same system, both An event in which BFP was edited to GFP occurred, followed by an event in which CD43 transcriptional activation occurred (Fig. 9). Whereas when this experiment was performed with Cas9-NLS-GCN4, as expected, genome editing events were not regulated by drug induction (Figure 9).

Comparative Example 3

Some drug-inducible CRISPR/Cas9 systems have been reported (Gonzalez, F. et al. AniCRISPR Platform for Rapid, Multiplexable, and Inducible Genome Editing in Human Pluripotent Stem Cells. Cell stem cell (2014).

Dow, L.E. et al. Inducible in vivo genome editing with CRISPR-Cas9. Nat Biotechnol 33, 390-394 (2015). Zetsche, B., Volz, S. E. & Zhang, F. A split-Cas9architecture editing for inducible genome editing and transcription modulation. Nat Biotechnol 33, 139-142 (2015). Davis, K.M., Pattanayak, V., Thompson, D.B., Zuris, J.A. & Liu, D.R. Small molecule-triggered Cas9protein with improved genome-editing specificity. Nat Chem Biol 11, 316-318 (2015)), included in Cas9 291 Intein-Cas9 design of inserting intein at serine position; split-Cas9 design of dividing Cas9 protein into two parts; TRE3G-Cas9 design of regulating Cas9 from the transcriptional level, etc. This comparative example compares the functions of the HIT-Cas9 and HIT2 systems and these published inducible systems in genome editing one by one. First, compared with the C2N2E of the HIT-Cas9 system and the C2N2E-GCN4 of the HIT2 system, the intein-S219-Cas9, Split-Cas9 and TRE3G-Cas9 systems have obvious background effects, and TRE3G-Cas9 was most pronounced (Figure 10). The comparative example also compares the design of an intein-inserted mutant (G512R) in Cas9, which renders it insensitive to endogenous β-estradiol but selectively responsive to exogenous 4-OHT. Intein-S219-G512R-Cas9 has no obvious background effect, but its drug-induced effect is also significantly reduced compared with HIT2. The lower efficiency of Intein-S219-G512R-Cas9 was further confirmed by TLR experiments with lower sensitivity than that of the HIT system, while the background effect of the Tet-on system was higher (Fig. 11, 12). The two off-target sites of EMX1 were detected by Surveyor assay, and it was found that the off-target effects of Cas9 design induced by HIT-Cas9, HIT2 system and other drugs were very low (Fig. 13). In contrast, the Cas9 vector with NLS had higher off-target effects, which further suggested the advantage of the drug-inducible system. In conclusion, compared with the existing drug induction schemes, the HIT-Cas9 and HIT2 designs not only better maintain the Cas9 activity, but also ensure a lower background effect in the absence of the inducer.

Example 5

On the basis of Examples 2 and 4, this example is used to illustrate how to demonstrate the dose-dependent drug response of the drug-inducing system established by the present invention and the specificity of drug selection.

The dose-dependent effects of HIT-Cas9 and HIT2 systems on 4-OHT and β-estradiol were first tested. Genome editing was tested by FCR experiments (FIG. 14), and the selection specificity of 4-OHT was observed in all HIT systems. In addition, a dose-dependent effect that is closely related not only to drug treatment time but also to drug concentration was observed. As expected, only mutant inteins containing G512R, but not wild-type inteins, exhibited selection specificity for 4-OHT upon genome editing (Figure 14).

Example 6

This example is used to illustrate how to demonstrate the reversible regulation of the drug-induced transcriptional activation system established by the present invention.

The reversibility of drug regulation is an important factor for dynamically regulating the expression of specific genes. A reversible detection experiment was carried out using a cell line stably integrated with the HIT-SunTag system-related expression vector, luciferase reporter plasmid and sgRNA expression vector in the genome. The luciferase signal weakened to the background level, and when 4-OHT was added back, the luciferase signal recovered (Fig. 15A), which was consistent with the continuous drug addition, continuous drug withdrawal and no 4-OHT treatment groups. There is a clear difference compared to. Similar results were also observed with different concentrations of 4-OHT (FIG. 15B). These data indicate that the transcriptional activation caused by the HIT-SunTag system established by the present invention is reversible.

Although the present invention has been described in detail above with general description and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made on the basis of the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention fall within the scope of the claimed protection of the present invention.

Example 7

This example is used to illustrate the application of the drug-inducible system established by the present invention in the genome editing and transcriptional regulation functions of different types of Cas9 proteins.

SaCas9 is derived from Staphylococcus aureus, and its PAM sequence is highly variable (NNGRR). Using SaCas9 instead of SpCas9, the SaCas9-2NES-2ER ^T2 vector for genome editing was constructed. When used with a BFP-targeting sgRNA, this design successfully converted the fluorescence from BFP to GFP. Although SaCas9 has a higher background effect compared to SpCas9 and needs further optimization, it does show strong drug inducibility (Figure 16).

In order to use the HIT2 system based on SaCas9 for simultaneous genome editing and transcriptional activation, it was first verified whether changes in the length of sgRNA could cause changes in Cas9 editing or DNA binding ability. SaCas9 was co-transfected with sgRNAs of different lengths, and the activity of genome editing was verified by pSSA assay (FIG. 17A) and the transcriptional activation activity by luciferase reporter assay (FIG. 17B). It was found that reducing the length of the sgRNA by 1 nt almost resulted in the loss of its genome editing ability, while transcriptional activation was best when the sgRNA was 15 nt to 18 nt in length. Therefore, the SaCas9-2NES-2ER ^T2 -GCN4 vector was constructed and co-transfected with 21nt BFP sgRNA, 15nt or 18nt CD43 sgRNA. The experiment found that the combination of HIT2-SaCas9 and two shortened sgRNAs can achieve drug-induced genome editing and transcriptional activation (Figure 18), which proves that the HIT system designed in the present invention can be applied to Cas9 from different species, and then expand its application.

sequence listing

<110> Institute of Zoology, Chinese Academy of Sciences

<120> Drug-inducible CRISPR/Cas9 systems for genome editing and transcriptional regulation

<130> KHP171112373.6

<160> 1

<170> PatentIn version 3.5

<210> 1

<211> 313

<212> PRT

<213> ERT2

<400> 1

Ala Gly Asp Met Arg Ala Ala Asn Leu Trp Pro Ser Pro Leu Met Ile

1 5 10 15

Lys Arg Ser Lys Lys Asn Ser Leu Ala Leu Ser Leu Thr Ala Asp Gln

20 25 30

Met Val Ser Ala Leu Leu Asp Ala Glu Pro Pro Ile Leu Tyr Ser Glu

35 40 45

Tyr Asp Pro Thr Arg Pro Phe Ser Glu Ala Ser Met Met Gly Leu Leu

50 55 60

Thr Asn Leu Ala Asp Arg Glu Leu Val His Met Ile Asn Trp Ala Lys

65 70 75 80

Arg Val Pro Gly Phe Val Asp Leu Thr Leu His Asp Gln Val His Leu

85 90 95

Leu Glu Cys Ala Trp Leu Glu Ile Leu Met Ile Gly Leu Val Trp Arg

100 105 110

Ser Met Glu His Pro Val Lys Leu Leu Phe Ala Pro Asn Leu Leu Leu

115 120 125

Asp Arg Asn Gln Gly Lys Cys Val Glu Gly Met Val Glu Ile Phe Asp

130 135 140

Met Leu Leu Ala Thr Ser Ser Arg Phe Arg Met Met Asn Leu Gln Gly

145 150 155 160

Glu Glu Phe Val Cys Leu Lys Ser Ile Ile Leu Leu Asn Ser Gly Val

165 170 175

Tyr Thr Phe Leu Ser Ser Thr Leu Lys Ser Leu Glu Glu Lys Asp His

180 185 190

Ile His Arg Val Leu Asp Lys Ile Thr Asp Thr Leu Ile His Leu Met

195 200 205

Ala Lys Ala Gly Leu Thr Leu Gln Gln Gln His Gln Arg Leu Ala Gln

210 215 220

Leu Leu Leu Ile Leu Ser His Ile Arg His Met Ser Asn Lys Gly Met

225 230 235 240

Glu His Leu Tyr Ser Met Lys Cys Lys Asn Val Val Pro Leu Tyr Asp

245 250 255

Leu Leu Leu Glu Ala Ala Asp Ala His Arg Leu His Ala Pro Thr Ser

260 265 270

Arg Gly Gly Ala Ser Val Glu Glu Thr Asp Gln Ser His Leu Ala Thr

275 280 285

Ala Gly Ser Thr Ser Ser His Ser Leu Gln Lys Tyr Tyr Ile Thr Gly

290 295 300

Glu Ala Glu Gly Phe Pro Ala Thr Ala

305 310

Claims (8)

1. a drug-inducible CRISPR/Cas9 system that can carry out genome editing and transcriptional activation simultaneously, is characterized in that, comprises the 16-22nt sgRNA used for genome editing targeting specific gene site A, targeting specific gene site 10-16nt sgRNA for transcriptional activation of B, Cas9-(NES)m-(ER ^T2 )n-GCN4 and scFv-(ER ^T2 )n-ADs, m=1-2, n=2, 10 for GCN4 One copy of a short epitope peptide from the yeast transcription activator GCN4, ScFv is the variable region of a single-chain antibody against GCN4 peptide, ADs is a combination of transcriptional effectors VPH, V is VP64, P is P65, and H is HSF1; The fusion protein is N-terminal to C-terminal from left to right, and each element can be connected by a linker of 3-20 amino acids. 2. The system of claim 1, wherein the 10-16nt sgRNA, 16-22nt sgRNA, Cas9-(NES)m-(ER ^T2 )n-GCN4 and scFv-(ER ^T2 )n- ADs can be present in different vectors or in the same vector. 3. Use of the system of claim 1 or 2 in drug-inducible genome editing and/or transcriptional activation. 4. A gene encoding the system of claim 1 or 2. 5. A vector containing the encoding gene of claim 4. 6. A method for simultaneously carrying out genome editing and transcriptional activation by drug induction, characterized in that the vector containing the system of claim 1 or 2 is co-transfected into cells or tissues for translation/expression, and genome editing is performed when needed. During editing and transcriptional activation, drug treatment with 4-OHT and/or TAM and/or their derivatives induces translation of the Cas9 fusion protein into the nucleus for genome editing at specific loci targeted by 16-22nt sgRNAs , for transcriptional activation at specific loci targeted by 10-16nt sgRNAs. 7. The application of the system of claim 1 or 2 in developing other drug-inducing systems with different functions based on CRISPR/Cas9 technology, including systems using other Cas9 proteins and systems using other functional regulators. 8. A method for reversible drug-induced transcriptional activation when genome editing and transcriptional activation are simultaneously performed, wherein the vector containing the system of claim 1 or 2 is co-transfected into cells or tissues, and translated /Expression, when drug treatment with 4-OHT and/or TAM and/or their derivatives, transcription of specific genes can be rapidly activated; when 4-OHT and/or TAM and/or their derivatives are withdrawn , the transcriptional activity of a specific gene is reduced to a background level, and the transcriptional activity of a specific gene can be increased again when treated with 4-OHT and/or TAM and/or their derivatives again.

Images