CN109207517B

CN109207517B - Drug-inducible CRISPR/Cas9 system for genome editing and transcriptional regulation

Info

Publication number: CN109207517B
Application number: CN201710553178.2A
Authority: CN
Inventors: 王宇; 赵晨; 卢佳; 赵迎泽; 张竞方
Original assignee: Institute of Zoology of CAS
Current assignee: Institute of Zoology of CAS
Priority date: 2017-07-07
Filing date: 2017-07-07
Publication date: 2020-12-01
Anticipated expiration: 2037-07-07
Also published as: CN109207517A

Abstract

The invention relates to the field of molecular biology, and particularly discloses a drug-induced CRISPR/Cas9 system for genome editing, which comprises a sgRNA (16-22 nt) and a Cas9 fusion protein targeting a specific gene locus, wherein the Cas9 fusion protein consists of Cas9 and 2-5 ER (ER) connected with the C end of the Cas9 in series^T2Composition of Cas9 and tandem ER^T2Between 1 or 2-10 NES in series. Through a series of experimental researches, the invention develops and optimizes a scheme with the highest activity and the lowest background activity, and applies the scheme to the editing of endogenous genes. In addition, the invention also provides a method for simultaneously editing and activating the transcription of the genome in a single system, so that the function of controlling the genome by a drug induction system is exerted to the maximum extent by more diversified designs. The establishment of such a drug induction system with multiple activities will provide a more powerful tool for accurate genome engineering studies and clinical research and applications in the field of gene therapy.

Description

Drug-inducible CRISPR/Cas9 system for genome editing and transcriptional regulation

Technical Field

The invention relates to the field of molecular biology, in particular to a plurality of drug-induced CRISPR/Cas9 systems for genome editing and transcription regulation.

Background

CRISPR/Cas9 system, derived from the immune mechanism of bacteria to degrade invading viral DNA or other foreign DNA. Using RNA-mediated DNA binding activity and endonuclease activity, the system can be regulated in the genome in a sequence-dependent manner. The Cas9protein binds and cleaves double-stranded DNA in a sequence-specific manner, and this sequence-specific binding is achieved by guide RNA (gRNA) complementary to the target sequence and adjacent protospacer-adjacent motif (PAM). The complex formed by Cas9 and gRNA mediates DNA double strand breaks, completing targeted gene editing through both NHEJ and HDR DNA repair mechanisms. The CRISPR/Cas9 system can also combine with different effector molecules to expand the functions of the effector molecules, so that the effector molecules have the capabilities of transcriptional activation, inhibition, genomic DNA labeling or appearance regulation and the like. To this end, the Cas9protein was further engineered to mutate the nuclease domain to produce an inactive form of dead Cas9(dCas9), while still retaining DNA-binding activity to facilitate recruitment of the corresponding effector molecule to the target site.

With the increasing knowledge of CRISPR/Cas9, this technology has been widely applied in various fields of biological research. However, the research on dynamic biological systems often needs a more precise regulation mode, a drug-induced CRISPR/Cas9 system is established, and the realization of the timely switching of effector protein functions to meet the requirements of practical application is one of the important targets pursued by people. One possible approach is to have the expression of Cas9protein regulated by a drug-inducible promoter or a tissue-specific promoter, controlling the occurrence of genome editing or transcription by controlling the transcription of effector proteins. The disadvantage of this approach is that the effector protein needs to be active through the process of transcription and translation, the response time to drug induction is usually slow, and the procedure may be cumbersome, and certain obstacles exist for in vivo application.

Currently, several laboratories have established different drug inducible systems based on CRISPR/Cas9 technology, including regulatory systems at the transcriptional level and post-translational regulatory systems, among others. The regulation of transcription levels can be divided into two categories: specific promoters or Doxycyline induction systems. Shen et al established an inducible conditional knockout system in nematode models using CRISPR/Cas9 technology, and designed to control the transcription of Cas9 and sgRNA through heat shock protein promoter Phsp. When the system is introduced into a nematode body, the knockout of a specific endogenous gene can be started under proper thermal stimulation. Dow et al established a doxycline-regulated Cas9 inducible system, so that the expression of Cas9 was regulated by a TRE3G promoter, and genome editing was successfully achieved in multiple tissues in a drug-treated mouse model. Gonzalez and the like establish a rapid and multiple drug-induced genome editing system based on a CRISPR platform by using a doxycycline regulation mode. By using the system, the phase-specific induced gene knockout can be realized in the differentiation process of the human pluripotent stem cells. The post-translational regulatory system controls genome editing or transcriptional activation mainly through regulation of effector protein activity. Polstein et al and Nihongaki et al established a light-induced activation system using Cas9 technology to dynamically regulate the transcriptional activation of endogenous genes. The Cas9protein has a relatively low efficiency when introduced into cells due to a large molecular weight, so researchers split Cas9 into two parts, and add a control device to each half of Cas9protein, so that the combination of the mature functional Cas9protein is completed under the control of a drug (Rapamycin) or light, and the regulation of Cas9 activity is realized to achieve the purpose of regulating genome editing or transcriptional activation. Yet another design approach is to insert into Cas9a small molecule 4-OHT-inducible cleaved intein (intein) that causes the Cas9protein to undergo a conformational change and lose activity, and that recovers activity after excision of the intein by drug-administration.

Although some success has been reported in the study of drug-induced genome editing and transcriptional activation systems, each approach has its own limitations. Regulation of the transcriptional level is generally slower and tissue-specific promoters are relatively less selected, in contrast to regulation of posttranslational protein activity, which may be more desirable. However, most of the existing successful schemes are unilaterally studied on genome editing or transcriptional activation, and the selected regulation drug or mode is not applicable to all fields, and the design of Cas9 is divided, so that the drug induction result is not reversible, and therefore, a new drug induction system needs to be developed.

Disclosure of Invention

In order to solve the problems in the prior art, the invention provides a new drug induction system based on Cas9 technology on the basis of the comprehensive results of previous researches, and the ER of estrogen receptor mutant is used^T2Binding to effector proteins, 4-OHT-induced genome editing and transcriptional activation that can occur simultaneously with genome editing is achieved.

The invention optimizes different drug induction system designs, selects a scheme with the highest activity and the lowest background activity, and applies the scheme to the editing of endogenous genes. The invention also tries to simultaneously carry out genome editing and transcriptional activation in a single system, so as to play the function of controlling the genome by a drug induction system to the maximum extent by more diversified designs. The establishment of such a drug induction system with multiple activities will provide a more powerful tool for accurate genome engineering studies.

The technical scheme of the invention is as follows:

in a first aspect, the present invention provides first a drug-inducible CRISPR/Cas9 system for genome editing, which differs from the prior art in that the system comprises a 16-22nt sgRNA targeted to a specific gene locus and a Cas9 fusion protein, wherein the Cas9 fusion protein consists of Cas9 and 2-5 ERs in tandem with its C-terminus^T2Composition, Cas9- (ER)^T2)n，n＝2-5。

When the Cas9 fusion protein consists of Cas9 and two ERs connected with the C terminal of the Cas9 in series^T2When composed, i.e. Cas9-2ER^T2(abbreviated as C2E).

The ER^T2Is an estrogen receptor with three amino acid mutations G400V/M543A/L544A (Feil, R., Wagner, J., Metzger, D).&Chambon，P.Regulation of Cre recombinase activity by mutated estrogen receptor ligand-binding domains.Biochemical and biophysical research communications237，752-757，1997)。

The invention combines Cas9 with ER^T2The fusion allows Cas9 to be regulated by 4-OHT by fusing one or two ERs^T2To the N-or C-terminus of Cas9, forming fourDifferent forms of drug-induced genome editing systems (i.e., EC, 2EC, CE, C2E). Meanwhile, the invention uses a plurality of chimeric single-stranded guide RNAs (sgRNAs) aiming at different gene loci and different Cas9-ER^T2Fusion protein combinations, using a luciferase reporter system based on Single Strand Annealing (SSA) repair mechanism, compare the cleavage activity of four different forms of drug-induced genome editing systems. In this luciferase reporter system, DNA double strand nicking at the target site can reconstitute the luciferase coding sequence by SSA, which in turn reflects the cleavage activity of Cas9 by detecting the activity of luciferase. The detection finds that only ER is available^T2Fused to the C-terminus of Cas9(CE and C2E) had less effect on endonuclease activity of Cas9.

Furthermore, the invention selects a cell surface protein CD201 highly expressed in human embryonic kidney epithelial cells HEK293T as a target gene, designs sgRNA targeting the 5' end of a CD201 coding region, and detects the gene knockout efficiency induced by NHEJ (human embryonic kidney) caused by different drug-induced genome editing systems (CE and C2E) by a flow cytometer. With Cas9 fused to NLS as a positive control, the cell population shifted towards the CD 201-negative region, indicating that CD201 was successfully knocked out. Sanger sequencing results demonstrated that the NHEJ event occurred in CD 201-negative cells. The experimental results show that two ERs are fused^T2Cas9(C2E) of (5) had lower background activity in the absence of 4-OHT.

However, despite fusing two ERs^T2Cas9(C2E) fused to an ER^T2Compared with the Cas9(CE), the background activity is lower in the case of adding no 4-OHT, but the situation is still not completely ideal, and a certain proportion of CD201 negative cells still exist in the case of adding no 4-OHT, so that the application of the CD201 negative cells is still adversely affected.

For those skilled in the art, it can be concluded without any doubt from the conventional technical knowledge in the art that when 2 ERs are connected in series^T2Replacement by 3-5 ERs in series^T2The same/similar technical effect is also possible.

In order to reduce the background activity of the system to a greater extent in the absence of 4-OHT and to achieve absolute control of the genome editing events by drugs, the present invention is further distinguished by C2E1 or 2-10 tandem Nuclear Export Signals (NES) are inserted into the position, the NES can guide the protein fused with the NES to move from nucleus to cytoplasm, and the dynamic balance of the Cas9protein in nucleus/cytoplasm can be controlled to a certain extent, so that the aim of eliminating background is fulfilled. Through a luciferase reporter system based on SSA repair mechanism, it was found that when Cas9 and 2ER are involved^T2Inserted with an NES (Cas9-NES-2 ER)^T2CN2E), Cas9protein still can maintain high endonuclease activity. In line with this, CN2E also showed significant drug-induced effects and insignificant background activity in another TLR assay, which can detect the frequency of NHEJ and HDR events by analyzing the percentage of mCherry fluorescent protein and GFP fluorescent protein positive cells. In contrast, when NES is in Cas9-2ER^T2Either end of the protein impairs its drug-induced effects, indicating that the structure of the protein complex is critical for its function.

Further, the present invention was studied using a Fluorescence Conversion Reporter (FCR) having higher sensitivity than TLR. In this system, HDR mediates the replacement of one key amino acid site resulting in the conversion of fluorescence from BFP to GFP, reflecting the efficiency of HDR events by analyzing the percentage of GFP positive cells. In this experiment, background activity of CN2E was detected, as well as a significant decrease in background activity after insertion of two NES (C2N 2E).

It is obvious to those skilled in the art that the same/similar technical effects can be obtained when 1 or 2 of the NES in series are replaced with 3 to 10 NES in series, as would be understood by those skilled in the art without any doubt. Thus, the drug-inducible CRISPR/Cas9 system for genome editing can also be based on the Cas9 and 2-5 ER concatemers^T2Between 1 or 2-10 NES in series, i.e. Cas9- (NES) m- (ER)^T2)n，m＝1-10。

Preferably, the drug-inducible CRISPR/Cas9 system for genome editing comprises sgRNA and Cas9-NES-2ER targeting specific gene sites^T2/Cas9-2NES-2ER^T2Most preferred are sgRNA and Cas9-2NES-2ER that target specific genetic loci^T2(this system is called HIT-Cas 9).

Further, in the application of the system, it is necessary to construct a vector that can translate the sgRNA and express the aforementioned Cas9 fusion protein, the Cas9- (ER)^T2)n/Cas9-(NES)m-(ER^T2) n and sgRNA can be present in separate vectors or in the same vector.

The fusion protein is from the N end to the C end from left to right, and all elements can be connected through a linker of 3-20 amino acids.

It is understood that the fusion protein is not limited to a specific nucleotide sequence of the encoding gene due to the freedom of linker.

Furthermore, the encoding gene of the fusion protein and the vector containing the encoding gene also belong to the protection scope of the invention.

The vector may be a DNA vector, an RNA vector, a protein vector, a lentiviral vector, an adenoviral vector, a general plasmid vector, or the like.

In the experimental study of the present invention, the lentivirus pRRL.sin-18.ppy was used as a vector.

On the basis of the aforementioned studies, the present invention provides the use of the system in drug-induced genome editing. The application can be embodied in various aspects, and the system provided by the invention is used for drug-induced genome editing, and belongs to the protection scope of the invention.

More specifically, the application may be embodied as a method for genome editing using drug induction. The system (vector containing the system) is transfected into cells or tissues for translation/expression, and when genome editing is required, drug treatment is performed by using 4-OHT and/or TAM and/or derivatives thereof, and translated Cas9 fusion protein is induced to enter the nucleus for genome editing aiming at specific gene loci.

The system can strictly and effectively regulate the activity of Cas9protein under the action of 4-OHT and/or TAM and/or derivatives thereof, so that the Cas9protein enters a cell nucleus to realize a genome editing function, and no background activity is generated without drug treatment. The invention proves the drug dose-dependent response and the selection specificity of the drug-inducible genome editing system so as to ensure that the system can be widely applied to the research in various fields of biomedicine.

In a second aspect, the present invention provides a drug-inducible CRISPR/Cas9 system capable of simultaneous genome editing and transcriptional activation, comprising 16-22nt sgRNA for genome editing targeted to specific genomic site a, 10-16nt sgRNA for transcriptional activation targeted to specific genomic site B, Cas9- (NES) m- (ER) for simultaneous genome editing and transcriptional activation^T2) n-GCN4 and scFv- (ER)^T2) n-ADs, m-1-10, n-2-5, ADs are transcription factor combination, and the transcription factor is selected from one or more of V, P, R, H. Cas9- (NES) m- (ER) playing a major role in this system^T2) n-GCN4 is called HIT 2.

Cas9 in the system is wild-type Cas9, NES is Nuclear Export Signal (NES), m is m-numbered NES connected in series, V is VP64, P is P65, R is Rta, H is HSF1 and ER is^T2Is an artificial mutant (the amino acid sequence is shown as SEQ ID NO. 1), (ER) with three amino acid mutations G400V/M543A/L544A^T2) n is n ER's connected in series^T2The scFv is the variable region of single-chain antibody of anti-GCN 4 peptide, and GCN4 is 5-30 copies of short peptide of antigen epitope from yeast transcription activator GCN4, preferably 10 copies of short peptide GCN 4. sequence references for scFv and GCN4 (Tanenbaum et al, A protein-tagging system for signal amplification in gene expression and fluorescence imaging. cell 159,635-646(2014) the above elements are all protein/gene elements known in the art.

The invention determines the optimal length which can cause the wild type Cas9 to lose the activity of cutting double-stranded DNA by designing sgRNAs with different lengths (from 12bp to 22bp) by using pSSA assay, and finally obtains 10-16nt sgRNAs preferably. Thus, in a drug-induced system with simultaneous genome editing and transcriptional activation, 10-16nt sgrnas are designed to perform transcriptional activation for a specific gene while still performing genome editing for the specific gene using 16-22nt sgrnas.

When in useThe 10-16nt sgRNA and the 16-22nt sgRNA can be present in different vectors or in the same vector, Cas9- (NES) m- (ER)^T2) n-GCN4 and scFv- (ER)^T2) n-ADs are present in separate vectors.

Based on the system, the invention provides a method for simultaneously carrying out genome editing and transcriptional activation by drug induction, wherein a vector containing the system is co-transfected to a cell or a tissue for translation/expression, when the genome editing and transcriptional activation are required, 4-OHT and/or TAM and/or derivatives thereof are utilized for drug treatment, a translated Cas9 fusion protein is induced to enter a cell nucleus, the genome editing is carried out aiming at a specific gene site targeted by 16-22nt sgRNA, and the transcriptional activation is carried out aiming at a specific gene site targeted by 10-16nt sgRNA.

Further, the present invention also provides a transcriptional activation method that can achieve reversible drug induction when genome editing and transcriptional activation are simultaneously performed, and transcription of a specific gene can be rapidly activated when drug treatment is performed with 4-OHT and/or TAM and/or their derivatives; when the 4-OHT and/or TAM and/or their derivatives are inactivated, the transcriptional activity of the specific gene is reduced to a background level, and when treated again with the 4-OHT and/or TAM and/or their derivatives, the transcriptional activity of the specific gene may be increased again.

In a third aspect, in the drug regulation system established by the invention, besides the strict control of the whole system function by the drug is required to be ensured, the drug dose-dependent response of the established system is also detected to determine the optimal dose required for regulating the function of the system. The invention also examines the selective specificity of the system for the drug 4-OHT and the endogenous estrogen ligand β -estradiol to ensure that the system only functions under the action of 4-OHT and/or TAM and/or their derivatives and is not interfered by endogenous ligands.

The operations involved in the present invention are those conventional in the art unless otherwise specified.

The above-described preferred conditions may be combined with each other to obtain a specific embodiment, in accordance with common knowledge in the art.

The invention can also be used for developing other drug induction systems with different functions based on CRISPR/Cas9 technology. For example, when the drug-induced Cas9protein is used in combination with a transcription repressing factor or an epigenetic regulator, it is also possible to achieve the functions of drug-induced transcription repression or drug-induced epigenetic regulation.

Further, the Cas9protein used in the invention is SpCas9, and other SpCas9 varieties with different PAM recognition sequences or different types of Cas9 proteins such as SaCas9 can be replaced, so that the applicability of a drug induction system is promoted, and wider and complex functional regulation is realized.

The invention has the beneficial effects that:

the invention develops a genome editing system capable of carrying out drug induction, and on the basis, through a series of experimental researches, a scheme with the highest activity and the lowest background activity is developed and optimized and is applied to the editing of endogenous genes.

Moreover, the invention also provides the method for simultaneously editing and activating the genome in a single system, so that the functions of controlling the genome by a drug induction system are exerted to the maximum extent by means of more diversified designs. The establishment of such a drug induction system with multiple activities will provide a more powerful tool for accurate genome engineering studies.

Drawings

FIG. 1 is a diagram showing the results of TLR experiments in example 2 of the present invention.

FIG. 2 is a diagram showing the results of the TLR test in example 2 of the present invention.

FIG. 3 is a graph showing the result of FCR experiment in example 2 of the present invention.

FIG. 4 is a graph showing the results of the CD201 knock-out experiment in example 2 of the present invention.

FIG. 5 is a schematic view of the carrier in comparative example 1 of the present invention.

FIG. 6 is a schematic diagram showing intracellular localization fluorescence in comparative example 1 of the present invention.

FIG. 7 is a graph showing the results of the pSSA experiment in comparative example 1 of the present invention.

FIG. 8 is a graph showing the results of the pSSA experiment in comparative example 2 of the present invention.

FIG. 9 is a diagram showing the results of flow cytometry in example 4 of the present invention.

FIG. 10 is a graph showing the result of FCR experiment in comparative example 3 of the present invention.

FIG. 11 is a graph showing the results of the TLR test in comparative example 3 of the present invention.

FIG. 12 is a graph showing the results of the TLR test in comparative example 3 of the present invention.

FIG. 13 is a graph showing the results of the Surveyor's experiment in comparative example 3 of the present invention.

FIG. 14 is a diagram showing the analysis of the flow cytometry results in example 5 of the present invention.

FIG. 15 is a graph showing the results of luciferase assay in example 6 of the present invention.

FIG. 16 is a diagram showing the analysis of the results of flow cell assay in example 7 of the present invention.

FIG. 17 is a graph showing the results of luciferase assay in example 7 of the present invention.

FIG. 18 is a diagram showing the analysis of the results of flow cell assay in example 7 of the present invention.

Detailed Description

Preferred embodiments of the present invention will be described in detail with reference to the following examples. It is to be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the present invention. Various modifications and alterations of this invention will become apparent to those skilled in the art without departing from the spirit and scope of this invention.

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1 drug-inducible CRISPR/Cas9 system for genome editing

This example serves to illustrate the construction of the drug-inducible CRISPR/Cas9 system for genome editing described in the present invention.

The construction method comprises the following steps:

the drug-induced genome editing system constructed by the invention comprises the following two parts:

(1) composed of Cas9 and two ERs in series with the C terminal^T2Composition, Cas9-2ER^T2。

(2) In Cas9-2ER^T2One/two SERIES NES, Cas9-NES-2ER, was inserted into the plasmid^T2/Cas9-2NES-2ER^T2。

The elements of each part of the plasmid are derived as follows:

the Cas9 element was amplified from plasmid pX330-U6-Chimeric _ BB-CBh-hSpCas9 (from Zhang Feng laboratory, Addgene plasma # 4223040). ER^T2Elements were amplified from plasmid pAd-CreER (gift from the t.c.he laboratory, university of chicago). NES sequences were according to the reports of Ding et al (Ding, y., Ai, h.w., Hoi, H).&Campbell, R.E.Forster response energy transfer-based biosensors for multipartameter ratio measurement imaging of Ca2+ dynamics and caspase-3activity in single cells 83,9687-9693 (2011.) was synthesized by Shanghai Biotech and inserted into different Cas9 expression vectors.

Construction of the Reporter plasmid in the TLR system was accomplished by replacing the Sce site in pCVL Traffic Light Reporter 1.1(Sce target) Ef1a Puro plasmid (Addge plasmids #31482) from Andrew Scharenberg laboratory with the targeting sequence for the sgRNA. The GFP donor plasmid used was from Andrew Scharenberg laboratories (Addgene plasmids # 31475).

The reporter plasmid in the FCR system is obtained by mutating a single amino acid of the GFP protein, and is constitutively expressed.

Example 2

This example illustrates the application of the system described in example 1.

1. Experimental Material

Cas9-2ER^T2，Cas9-NES-2ER^T2And Cas9-2NES-2ER^T2Plasmids, sgrnas targeting different sites, donor plasmids for use in TLR systems and single-stranded DNA donors (ssDNA donor) for use in FCR experiments.

2. Experimental methods

HEK293T cells (ATCC) were cultured in Dulbecco's modified Eagle's medium supplemented with 10% FBS, 2mM GlutaMAX (Thermo Fisher), 100U/ml penicillin and 100. mu.g/ml streptomycin and placed at 37 ℃ in 5% CO₂The incubator of (2) for cultivation. The monoclonal TLR and FCR stable cell line is obtained by slow virus packaging and infection. The cell transfection reagent was a DNA transfection reagent from Biotool, and the transfection method was performed as described. The total amount of transfected DNA per well was consistent in each experiment. Cell fluid change is carried out after 5 hours of transfection, 4OHT with the final concentration of 100-500nM is added to the experimental group 24 hours after transfection, absolute ethyl alcohol with the same volume is added to the control group, and detection of genome editing is carried out after continuous culture for 48 hours.

For TLR experiments, TLR reporter cell lines were pre-seeded in 24-well plates, followed by transfection of 250ng Cas9-ERT2 fusion protein expression vector, 150ng sgRNA, and 400ng GFP donor plasmid per well (addge plasmids #31475)¹⁷) (or not transfected with GFP donor plasmid). Cells were digested with 0.25% pancreatin (Thermo Fisher), at least 50000 cells collected per well, and HDR efficiency was analyzed using a CytoFLEX flow cytometer (Beckman Coulter). The efficiency of HDR was measured by the percentage of GFP positive cells. For analysis of the NHEJ event, cells were transferred to 96-well plates, fixed with 4% paraformaldehyde and stained with Hochest 33342(Thermo Fisher), and images were scanned using an Operetta high content imaging system (Perkin-Elmer) and the fluorescence signal of mCherry was analyzed using Harmony3.5 (Perkin-Elmer).

For the CD201 gene knockout experiment, cell culture and transfection were performed in the same manner. 24 hours after transfection, cells were resuspended in medium containing 125ug/ml Zeocin, 100ug/ml G418, and 24 hours after incubation replaced with medium containing 125nM 4OHT only. After several days of cell culture to sufficient numbers, the cells were incubated with antibody using PE-Vio770(Miltenyi Biotec) and analyzed by flow cytometry using Cytoflex (Beckman Coulter).

For FCR experiments, the stable transfectant cell lines were seeded in 24-well plates in advance. Each well was then transfected with 300ng Cas9-ERT2 fusion protein expression vector, 300ng BFP sgRNA, and 10pmol ssDNA donor (5'-GCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACGTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGA-3', in situ). At least 30000 cells per well were collected and HDR efficiencies were analyzed using the CytoFLEX flow cytometer (Beckman Coulter). The efficiency of HDR was measured by the percentage of GFP positive cells.

3. Results of the experiment

Cas9-2ER was first detected simultaneously using a traffic-light reporter (TLR) experiment^T2(C2E) efficiency of induced NHEJ and HDR. The reporter system comprises two fluorescent proteins, GFP and mCherry. Since the drug-induced effect of C2E is achieved by nuclear transport, a stable transgenic cell line with the reporter gene stably integrated in the genome was developed for this purpose. In this reporter system, a targeting sequence targeting the sgRNA of human hcoct-4 was inserted into the coding region of GFP, so neither GFP nor mCherry could read correctly. The correct reading of mCherry is restored when the target sequence forms a double-stranded DNA break (DSB) due to the activity of Cas9protein, and then a frame shift mutation of 3n +2 bases is induced by the repair mode of NHEJ. The repair mode of HDR was tested by co-transforming GFP template plasmid in the system to obtain a complete reading frame for GFP. Thus, the fluorescent signals of mCherry and GFP can represent the efficiency of NHEJ and HDR events, respectively. Through TLR experiments, C2E-mediated NHEJ and HDR events were found to have significant 4 OHT-inducing effects (figure 1). However, it was also found that there was a certain percentage of background activity in the absence of 4OHT treatment (FIG. 1).

The background effect was assumed to be due to the fact that some C2E was also localized in the nucleus when 4OHT was not present. Thus, to reduce background effects, insertion of one or two Nuclear Export Signals (NES) into C2E forms Cas9-NES-2ER^T2(CN2E) and Cas9-2NES-2ER^T2(C2N 2E). Consistent with the C2E design performance, at TLR levelsCN2E and C2N2E also showed significant drug-induced effects in the experiment, and this design did further reduce the background effect while maintaining drug-induced genome editing activity (fig. 2). Considering the low sensitivity of TLR experiments in detecting HDR efficiency, studies were performed using fluorescence conversion experiments (FCR). In this system, after Cas9 cleaves the target DNA to generate DSBs, the repair pattern by HDR leads to a change in one key amino acid site, which in turn leads to a change in fluorescence from BFP to GFP. This experiment was more sensitive than TLR and a decrease in the background effect of CN2E and C2N2E after insertion of an additional NES could be detected (figure 3).

Further, sgRNA targeting the 5' end of the CD201 coding region was designed for a cell surface protein CD201 highly expressed in HEK293T cells, and NHEJ-induced gene knockout efficiency was examined by flow cytometry. The results also show that both CN2E and C2N2E can achieve 4 OHT-induced knock-out of the CD201 gene, and that the insertion of 2NES can further reduce background activity without 4OHT treatment (fig. 4).

The above results demonstrate that the constructed drug-induced genome editing system can realize the editing of specific gene loci under the induction of 4 OHT.

Comparative example 1

Taking into account ER^T2And its effect on Cas9 endonuclease activity when present at different positions of Cas9, a series of ERs were designed^T2Combined with Cas9 and the corresponding plasmid was constructed (fig. 5).

The effect of different designs on the intracellular localization of Cas9 was first examined and the results indicated when ER was present^T2Present at the N-terminus of Cas9, 4-OHT was unable to efficiently induce Cas9 into the nucleus, only when ER^T2At the C-terminus of Cas9, 4-OHT was able to induce its nuclear entry significantly, but at the same time there was also higher background activity (fig. 6).

To detect different Cas9 from ER^T2Whether the endonuclease activity of the Cas9 is influenced during combination, different sgRNAs are respectively designed for human telomere (human telomere) and Oct4 genes, the efficiencies of the different sgRNAs are detected by using a pSSA luciferase report system, and the sgRNA with the highest efficiency is selected from the sgRNAsActive sgRNA, verifying the activity of different drugs inducing Cas9 design. The results were found to be consistent with intracellular localization when ER was present^T2At the C-terminus of Cas9(CE and C2E), Cas9 has higher activity (fig. 7).

Comparative example 2

To further reduce background effects, one or two nuclear output signals (NES) were inserted at different locations of C2E (fig. 8A). By Single Strand Annealing (SSA) luciferase experiments, it was found in Cas9 and 2ER^T2Inserted with an NES (Cas9-NES-2 ER)^T2CN2E), the activity of Cas9 endonuclease was best maintained (fig. 8B). In contrast, when NES is in Cas9-2ER^T2Either end of the protein impairs its drug-induced effects, indicating that the structure of the protein complex is critical for its function.

Example 3 drug-inducible CRISPR/Cas9 system with simultaneous genome editing and transcriptional activation

This example illustrates the construction of a drug-inducible CRISPR/Cas9 system that performs genome editing and transcription activation simultaneously, taking genome editing on a BFP gene and transcription activation on a CD43 gene as an example.

The construction method comprises the following steps:

the drug-inducible CRISPR/Cas9 system for simultaneously carrying out genome editing and transcription activation comprises Cas9-2NES-2ER^T2-GCN4 and scFv-2ER^T2VPH, in which Cas9-2NES-2ER^T2For the plasmid constructed in example 1, GCN4 was a short peptide of 10 copies of the yeast transcriptional activator GCN4, V was VP64, P was P65, and H was HSF 1. The source and construction method of each element of the plasmid are as follows:

VP64 is obtained by amplification with pLenti-EF1a-SOX2 plasmid (Addgene plasmid #35388) from Zhang Feng laboratory as template; p65 and Rta are obtained by taking SP-dCas9-VPR plasmid (Addgene plasmid #63798) of George Church laboratory as a template for amplification; HSF1 was amplified using the lenti MS2-P65-HSF1_ Hygro plasmid (Addgene plasmid #61426) from Zhang Feng laboratory as template. scFv-sfGFP-GB1 and 10xGCN4 sequences reported by Tanenbaum M.E.et. al (Tanenbaum, M.E., Gilbert, L.A., Qi, L.S., Weissman, J.S. & Vale, R.D.A. protein-targeting system for signal amplification in gene expression and fluorescence imaging.cell 159,635-646 (2014)) were synthesized by Kinzhi. For scFv expression vectors used in simultaneous genome editing and transcriptional activation, sfGFP in scFv vectors was removed to avoid interfering with BFP and was edited to be labeled GFP.

Example 4

This example is used to illustrate the application of the system described in example 3.

1. Experimental Material

Cas9-2NES-2ER^T2GCN4(C2N2E-GCN4) and scFv-2ER^T2VPH plasmid, targeting sgRNA at different sites, single stranded DNA donor (ssDNA donor) for use in FCR experiments. anti-CD43 antibody for detecting APC markers of CD43 expression. Stable transgenic cell lines integrated with BFP reporter genes for FCR experiments.

Cas9-NLS-GCN4 plasmid served as a control.

2. Experimental methods

Simultaneous BFP editing and CD43 activation experiments were performed using BFP stable transgenic cell lines. Cells were cultured in 24-well plates and transfected as in example one. The total amount of transfected DNA in each well is ensured to be consistent during transfection, and sgRNA, Cas9 fusion protein vector and activator vector which target CD43 and BFP are carried out according to an equimolar ratio. In addition, 10pmol of ssDNA donor was added to each well. After 48 hours of 4OHT action, cells were harvested and incubated with CD 43-specific antibody CD43-apc (miltenyi biotec) as indicated, followed by cytoflow analysis with cytoflex (beckman coulter). The efficiency of genome editing and transcriptional activation was obtained by the percentage of GFP and CD43 positive cells.

3. Results of the experiment

Sgrnas shortened to lengths below 16nt are reported to direct Cas9 to and bind to the target DNA, but do not cleave (Kiani, s.et al. castsgrna engineering for genome editing, activation and expression. nature methods 12,1051-1054(2015), Dahlman, j.e.et al. organic gene cleavage and activation with a catalytic active cassette. nat Biotechnol 33,1159-1161 (2015)). Based on the characteristic, the invention establishes a system and a method for utilizing the same CRISPR/Cas9Drug-induced genome editing and transcriptional activation are achieved. Selecting a BFP-targeting sgRNA of 20nt and a CD 43-targeting sgRNAs of 14nt, C2N2E-GCN4 and scFv-2ER^T2After a period of time of-VPH cotransformation and 4OHT treatment, it was confirmed by flow cytometry that both the events of BFP being edited into GFP and CD43 transcriptional activation occurred in the same system (FIG. 9). While when this experiment was performed with Cas9-NLS-GCN4, it was consistent with expectations that the genome editing event was not drug-induced regulated (fig. 9).

Comparative example 3

Several drug-Inducible CRISPR/Cas9 systems have been reported (Gonzalez, f.et al. an i CRISPR Platform for Rapid, Multiplexable, and inductively Genome Editing in Human Pluripotent Stem cells, cell Stem cell (2014).

Dow, L.E.et al.Induceble in vivo gene encoding with CRISPR-Cas9.Nat Biotechnology 33, 390-incorporated 394(2015) Zetsche, B, Volz, S.E. & Zhang, F.A split-Cas9architecture for index gene encoding and translation modulation Nat Biotechnology 33, 139-incorporated 142(2015) Davis, K.M., Pattanayak, V, Thompson, D.B. & Zuri, J.A & Liu, D.R.Smalll-cloned 9protein with expressed gene-incorporated into chemistry. Nat Chem 6311, 318) including the insertion of a Cas-peptide at the Cas position 2015 83; split-Cas9 design that splits the Cas9protein into two parts; TRE3G-Cas9 design that regulates Cas9 from the transcriptional level, and the like. This comparative example compares the functions of the HIT-Cas9 and HIT2 systems and these published inducible systems in genome editing, one to one. First, using the FCR experiment, contrary to C2N2E-GCN4 of HIT-Cas9 system and C2N2E-GCN4 of HIT2 system, intein-S219-Cas9, Split-Cas9, and TRE3G-Cas9 systems all had significant background effects, and TRE3G-Cas9 was most significant (fig. 10). The comparative example also compared the design of a mutant with an intein inserted in Cas9 (G512R) that resulted in it being no longer sensitive to endogenous β -estradiol but able to selectively respond to exogenous 4-OHT. There was no significant background effect of Intein-S219-G512R-Cas9, but its drug-induced effect was also significantly reduced compared to HIT 2. The low sensitivity TLR experiment further proves that the efficiency of Intein-S219-G512R-Cas9 is lower than that of the HIT system, and the background effect of the Tet-on system is higher (FIGS. 11 and 12). Detection of two off-target sites of EMX1 by Surveyor experiments revealed that the HIT-Cas9, HIT2 system and other drug-induced Cas9 design off-target effects were very low (fig. 13). In contrast, Cas9 vector with NLS has higher off-target effect, which further suggests the advantage of drug-induced system. In conclusion, compared with existing drug induction schemes, the HIT-Cas9 and HIT2 designs not only better maintain the activity of Cas9, but also ensure that the background effect is lower when the inducer is not present.

Example 5

On the basis of examples 2 and 4, this example serves to illustrate how the dose-dependent drug response of the drug-induced system established in the present invention can be demonstrated, as well as the specificity of drug selection.

The dose-dependent effects of the HIT-Cas9 and HIT2 systems on 4-OHT and β -estradiol were first tested. The genome editing test was performed by FCR experiment (fig. 14), and as a result, the selection specificity of 4-OHT was observed in all HIT systems. Furthermore, dose-dependent effects are also observed which are closely related not only to the drug treatment time but also to the drug concentration. As expected, only mutant intein containing G512R, but not wild-type intein, showed selection specificity for 4-OHT at genome editing (FIG. 14).

Example 6

This example serves to demonstrate how the drug-induced reversible regulation of the transcriptional activation system established in the present invention can be demonstrated.

Reversibility of drug regulation is an important factor for dynamically regulating the expression of a specific gene. Reversible detection experiments are carried out by using a cell line which is stably integrated with an HIT-SunTag system related expression vector, a luciferase report plasmid and a sgRNA expression vector in a genome, and the results show that when 4-OHT is removed after a certain time of adding drugs in a culture system, a luciferase signal is weakened to a background level, and when 4-OHT is added again, the luciferase signal is recovered (figure 15A), which is obviously different from a group which is continuously added with a drug, a group which is continuously removed with a drug and a group which is not treated with 4-OHT. Similar results were also observed with 4-OHT treatment at different concentrations (fig. 15B). These data indicate that the transcriptional activation by the HIT-SunTag system established in the present invention is reversible.

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Example 7

This example serves to illustrate the application of the genome editing and transcriptional regulatory functions of the drug induction system established in the present invention in different types of Cas9 proteins.

SaCas9 is derived from Staphylococcus aureus, with a highly variable PAM sequence (NNGRR). SaCas9-2NES-2ER for genome editing was constructed using SaCas9 in place of SpCas9^T2And (3) a carrier. This design successfully converted fluorescence from BFP to GFP when used with sgrnas targeting BFP. Although the background effect of SaCas9 was higher compared to SpCas9, requiring further optimization, it did show stronger drug inducibility (fig. 16).

To perform simultaneous genome editing and transcriptional activation using the HIT2 system constructed based on SaCas9, it was first verified whether a change in sgRNA length could cause a change in Cas9 editing or DNA binding ability. SaCas9 was co-transfected with sgrnas of different lengths, the genome editing activity was verified by the pSSA experiment (fig. 17A), and the transcription activation activity was verified by the luciferase reporter experiment (fig. 17B). It was found that reducing the length of sgRNA by 1nt almost resulted in loss of its genome editing ability, and the transcriptional activation effect was the best when the length of sgRNA was 15nt to 18 nt. Thus, a SaCas9-2NES-2ER was constructed^T2GCN4 vector and co-transfected with 21nt BFP sgRNA, 15nt or 18nt CD43 sgRNA. Experiments show that the HIT2-SaCas9 and two sgRNAs with shortened length can realize drug-induced genome editing and transcriptional activation (FIG. 18), and the HIT system designed by the invention can be proved to beTo be applied to Cas9 from different species, thereby expanding its application.

Sequence listing

<110> institute of animal research of Chinese academy of sciences

<120> drug-inducible CRISPR/Cas9 system for genome editing and transcriptional regulation

<130> KHP171112373.6

<160> 1

<170> PatentIn version 3.5

<210> 1

<211> 313

<212> PRT

<213> ERT2

<400> 1

Ala Gly Asp Met Arg Ala Ala Asn Leu Trp Pro Ser Pro Leu Met Ile

1 5 10 15

Lys Arg Ser Lys Lys Asn Ser Leu Ala Leu Ser Leu Thr Ala Asp Gln

20 25 30

Met Val Ser Ala Leu Leu Asp Ala Glu Pro Pro Ile Leu Tyr Ser Glu

35 40 45

Tyr Asp Pro Thr Arg Pro Phe Ser Glu Ala Ser Met Met Gly Leu Leu

50 55 60

Thr Asn Leu Ala Asp Arg Glu Leu Val His Met Ile Asn Trp Ala Lys

65 70 75 80

Arg Val Pro Gly Phe Val Asp Leu Thr Leu His Asp Gln Val His Leu

85 90 95

Leu Glu Cys Ala Trp Leu Glu Ile Leu Met Ile Gly Leu Val Trp Arg

100 105 110

Ser Met Glu His Pro Val Lys Leu Leu Phe Ala Pro Asn Leu Leu Leu

115 120 125

Asp Arg Asn Gln Gly Lys Cys Val Glu Gly Met Val Glu Ile Phe Asp

130 135 140

Met Leu Leu Ala Thr Ser Ser Arg Phe Arg Met Met Asn Leu Gln Gly

145 150 155 160

Glu Glu Phe Val Cys Leu Lys Ser Ile Ile Leu Leu Asn Ser Gly Val

165 170 175

Tyr Thr Phe Leu Ser Ser Thr Leu Lys Ser Leu Glu Glu Lys Asp His

180 185 190

Ile His Arg Val Leu Asp Lys Ile Thr Asp Thr Leu Ile His Leu Met

195 200 205

Ala Lys Ala Gly Leu Thr Leu Gln Gln Gln His Gln Arg Leu Ala Gln

210 215 220

Leu Leu Leu Ile Leu Ser His Ile Arg His Met Ser Asn Lys Gly Met

225 230 235 240

Glu His Leu Tyr Ser Met Lys Cys Lys Asn Val Val Pro Leu Tyr Asp

245 250 255

Leu Leu Leu Glu Ala Ala Asp Ala His Arg Leu His Ala Pro Thr Ser

260 265 270

Arg Gly Gly Ala Ser Val Glu Glu Thr Asp Gln Ser His Leu Ala Thr

275 280 285

Ala Gly Ser Thr Ser Ser His Ser Leu Gln Lys Tyr Tyr Ile Thr Gly

290 295 300

Glu Ala Glu Gly Phe Pro Ala Thr Ala

305 310

Claims

1. A drug-induced CRISPR/Cas9 system capable of simultaneously carrying out genome editing and transcription activation is characterized by comprising 16-22nt sgRNA for genome editing targeting a specific gene locus A, 10-16nt sgRNA for transcription activation targeting a specific gene locus B, Cas9- (NES) m- (ER)^T2) n-GCN4 and scFv- (ER)^T2) n-ADs, m is 1-2, n is 2, GCN4 is 10 copies of short epitope peptide from yeast transcription activator GCN4, ScFv is single-chain antibody variable region of anti-GCN 4 peptide, ADs is transcription effector combination VPH, V is VP64, P is P65, H is HSF 1; the fusion protein is from the N end to the C end from left to right, and all elements can be connected through a linker of 3-20 amino acids.

2. The system of claim 1, wherein the 10-16nt sgRNA, 16-22nt sgRNA, Cas9- (NES) m- (ER)^T2) n-GCN4 and scFv- (ER)^T2) The n-ADs may be present on different vectors or on the same vector.

3. Use of the system of claim 1 or 2 for drug-inducible genome editing and/or transcriptional activation.

4. A gene encoding the system of claim 1 or 2.

5. A vector comprising the gene encoding the gene of claim 4.

6. A method for simultaneously performing genome editing and transcriptional activation by drug induction, characterized in that a vector containing the system of claim 1 or 2 is co-transfected into a cell or tissue for translation/expression, and when genome editing and transcriptional activation are required, drug treatment is performed by using 4-OHT and/or TAM and/or derivatives thereof, so as to induce the translated Cas9 fusion protein to enter the nucleus, perform genome editing for a specific gene site targeted by 16-22nt sgRNA, and perform transcriptional activation for a specific gene site targeted by 10-16nt sgRNA.

7. Use of the system of claim 1 or 2 in the development of other drug induction systems with different functions based on CRISPR/Cas9 technology, including systems employing other Cas9 proteins and systems employing other functional regulators.

8. A method for transcriptional activation that can achieve reversible drug induction when genome editing and transcriptional activation are performed simultaneously, characterized in that a vector containing the system of claim 1 or 2 is co-transfected into a cell or tissue for translation/expression, and transcription of a specific gene can be rapidly activated when treated with 4-OHT and/or TAM and/or their derivatives; when the 4-OHT and/or TAM and/or their derivatives are inactivated, the transcriptional activity of the specific gene is reduced to a background level, and when treated again with the 4-OHT and/or TAM and/or their derivatives, the transcriptional activity of the specific gene may be increased again.