CN109207517A - Drug induced CRISPR/Cas9 system for genome editor and transcriptional control - Google Patents
Drug induced CRISPR/Cas9 system for genome editor and transcriptional control Download PDFInfo
- Publication number
- CN109207517A CN109207517A CN201710553178.2A CN201710553178A CN109207517A CN 109207517 A CN109207517 A CN 109207517A CN 201710553178 A CN201710553178 A CN 201710553178A CN 109207517 A CN109207517 A CN 109207517A
- Authority
- CN
- China
- Prior art keywords
- cas9
- drug
- induced
- sgrna
- genome
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases RNAses, DNAses
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2810/00—Vectors comprising a targeting moiety
- C12N2810/10—Vectors comprising a non-peptidic targeting moiety
Abstract
The present invention relates to molecular biology fields, specifically disclose a kind of drug induced CRISPR/Cas9 system for genome editor, including target specific gene site 16-22nt sgRNA and Cas9 fusion protein, the Cas9 fusion protein by Cas9 and with the concatenated 2-5 ER of its C-terminalT2Composition, the Cas9 and concatenated ERT2Between 1 or 2-10 concatenated NES of insertion.The present invention is probed by a series of experiments, is developed and scheme of the optimization with most highly active and minimum background activity, it is applied to the editor of endogenous gene.In addition, with richer diversified design, playing the function of drug-induced system manipulation genome to the greatest extent the present invention also provides genome editor and transcriptional activation is carried out simultaneously in triangular web.The foundation of such a drug-induced system with multiple activities will provide more powerful tool for accurate genome project research and the clinical research of field of gene and application.
Description
Technical field
The present invention relates to molecular biology fields, specifically, being related to a variety of for genome editor and transcriptional control
Drug induced CRISPR/Cas9 system.
Background technique
CRISPR/Cas9 system, the immunologic mechanism of viral DNA or other exogenous DNAs from bacterial degradation invasion.It utilizes
The DNA binding activity and endonuclease activity that RNA is mediated, which can be in such a way that a kind of sequence relies in genome
It is adjusted.Cas9 albumen is combined in the method for sequence-specific and cutting double-stranded DNA, and the combination of this sequence-specific is
It is realized by the guide RNA (gRNA) complementary with target sequence and neighbouring protospacer-adjacent motif (PAM)
's.The compound-mediated DNA double chain that Cas9 and gRNA is formed is broken, and completes targeting by two kinds of DNA repair mechanisms of NHEJ and HDR
The editor of gene.CRISPR/Cas9 system can also extend its function in conjunction with different effector molecules, swash with transcription
The abilities such as living, inhibition, genomic DNA label or apparent adjusting.For this purpose, Cas9 albumen is further transformed, by nuclease function
Domain mutates and generates dead Cas9 (dCas9) form of loss of activity, while the activity still retained in conjunction with DNA is convenient for
Corresponding effector molecule is raised to play a role to target site.
As people are continuously increased CRISPR/Cas9 understanding, this technology has been widely used in biological study
Every field.However, usually needing more accurate control methods for dynamic biology systematic research, drug is established
The CRISPR/Cas9 system of induction, realizing that effect protein function is switched at any time to meet practical application request is that people pursue
One of important goal.One possible scheme is to make the expression of Cas9 albumen by drug induced promoter or tissue specificity
Promoter regulation controls the generation of genome editor or transcription by the transcription of control effect albumen.The shortcomings that this scheme
It is that effect protein needs just have activity by the process of transcription and translation, it is usually relatively slow to drug-induced response time,
And operating method may be comparatively laborious, there are certain obstacles for vivo applications.
Currently, some laboratories, which have been based on CRISPR/Cas9 technology, establishes the inducible system of different drugs, including
In the adjustment and control system of transcriptional level and post-translational control system etc..The regulation of transcriptional level can be divided into two kinds: special promoter
Or Doxycycline induction system.Shen etc. using CRISPR/Cas9 technology established in nematode model one it is derivable
Condition knocks out system, and design is the transcription that Cas9 and sgRNA are controlled by heat shock protein promoter Phsp.When this system
When being introduced into nematode body, the knockout to specific endogenous gene can be started under thermostimulation appropriate.Dow etc. is established
The Cas9 of doxycycline regulation can induce system, make the expression of Cas9 by the regulation of TRE3G promoter, in treated with medicaments
Genome editor is successfully realized in mouse model afterwards in multiple tissues.Gonzalez etc. is also with doxycycline
Regulation and control model establishes quick, multiplicity the drug-induced genome editing system based on CRISPR platform.Utilize this
System the induced gene of implementation phase specificity can knock out in human pluripotent stem cells atomization.Adjustment and control system after translation
The control to genome editor or transcriptional activation is mainly realized by the regulation of pairing effect protein active.Polstein etc. and
Nihongaki etc. establishes photoinduction activation systems using Cas9 technology, carries out dynamic regulation to the transcriptional activation of endogenous gene.
Cas9 albumen introduces relatively inefficient when cell since molecular weight is larger, therefore has researcher that Cas9 is split as two
Point, and control device is added for every half of Cas9 albumen, make the combination of mature functional Cas9 albumen at drug (Rapamycin)
Or it is completed under photocontrol, and then realize regulation active to Cas9 to achieve the purpose that adjust genome editor or transcriptional activation.
It is that one section of intein that can be induced and be cut by small molecule 4-OHT is inserted into Cas9 there are also a kind of design scheme
(intein), which makes Cas9 albumen occurred conformation change and lose activity, just extensive after agent-feeding treatment cuts off intein
It is active.
Although having in terms of drug-induced genome editor and transcriptional activation systematic research at present some successful
Report, but every kind of scheme has the limitation of itself.The usual answer speed of the control methods of transcriptional level is slower, and organizes special
The selection of Specific Promoters is relatively fewer, may be more preferably square for the active adjusting of posttranslational protein in contrast
Formula.However, existing several successful schemes are unilaterally to be studied genome editor or transcriptional activation, and select mostly
Regulating medicine or mode be not particularly suited for all spectra, divide Cas9 design and make drug-induced result irreversible,
Therefore, it is necessary to develop new drug-induced system.
Summary of the invention
In order to solve the problems in the existing technology, the present invention proposes to build on the basis of comprehensive previous karyotype studies
The new drug-induced system for the Cas9 technology that is based on, by by the mutant ER of estrogen receptorT2It is real in conjunction with effect protein
The genome editor of existing 4-OHT induction and the transcriptional activation that can be carried out simultaneously with genome editor.
The present invention carries out various optimizations to different drug-induced System Design, therefrom selects with most highly active and minimum
It is applied to the editor of endogenous gene by the scheme of background activity.The present invention also attempts to carry out gene simultaneously in triangular web
Group editor and transcriptional activation play drug-induced system manipulation genome with richer diversified design to the greatest extent
Function.The foundation of such a drug-induced system with multiple activities will provide more for accurate genome project research
Powerful tool.
Technical scheme is as follows:
In a first aspect, present invention firstly provides the drug induced CRISPR/Cas9 system for genome editor, with
The prior art the difference is that, the system comprises targeting specific gene site 16-22nt sgRNA and Cas9 fusion
Albumen, wherein the Cas9 fusion protein by Cas9 and with the concatenated 2-5 ER of its C-terminalT2Composition, i.e. Cas9- (ERT2) n, n
=2-5.
When the Cas9 fusion protein by Cas9 and with concatenated two ER of its C-terminalT2When composition, i.e. Cas9-2ERT2(letter
Claim C2E).
The ERT2For band there are three amino acid mutation G400V/M543A/L544A estrogen receptor (Feil, R.,
Wagner, J., Metzger, D.&Chambon, P.Regulation of Cre recombinase activity by
mutated estrogen receptor ligand-binding domains.Biochemical and biophysical
Research communications237,752-757,1997).
The present invention is by Cas9 and ERT2Fusion is so that Cas9 is regulated and controled by 4-OHT, by merging one or two ERT2To Cas9
N-terminal or C-terminal, formed four kinds of various forms of drug-induced genome editing systems (i.e. EC, 2EC, CE, C2E).Together
When, the present invention uses the single-stranded guidance RNA (sgRNA) of a plurality of mosaic type for different genes site, from different Cas9-ERT2
Fusion protein combination utilizes the luciferase based on single-stranded annealing (single strand annealing, SSA) repair mechanism
Reporting system compares the cleavage activity of four kinds of various forms of drug-induced genome editing systems.In the luciferase reporting system
In system, the DNA double chain notch of target site can rebuild luciferase-encoding sequences by SSA, and then pass through detection luciferase
Activity reflects the cleavage activity of Cas9.ER is only worked as in detection discoveryT2(CE and C2E) is to Cas9 when being blended in the C-terminal of Cas9
Endonuclease activity influence it is smaller.
Further, the present invention has selected the highly expressed cell surface protein in human embryonic kidney epithelial cells HEK293T
CD201 devises the sgRNA that the targeting code area CD201 5 ' is held, by flow cytomery by different medicines as target gene
The gene knockout efficiency of the induction of NHEJ caused by object induced gene group editing system (CE and C2E).Using merge the Cas9 of NLS as
Positive control, cell mass are deviated to the negative areas CD201, illustrate CD201 by successful knockout.Sanger sequencing result demonstrates
NHEJ event occurs in CD201 negative cells.Test result shows to merge two ERT2Cas9 (C2E) when 4-OHT is not added
Background activity is lower.
However, although two ER of fusionT2Cas9 (C2E) with merge an ERT2Cas9 (CE) compare, 4- is being not added
Background activity is lower when OHT, but still very ideal state is not achieved, and 4-OHT group is not added, and there are still a certain proportion of CD201
Negative cells are applied to still have adverse effect.
To those skilled in the art, can deduce according to this field routine techniques knowledge is beyond all doubt, when by 2
A concatenated ERT2Replace with 3-5 concatenated ERT2There can also be identical/similar technical effect.
In order to reduce background activity of the system when 4-OHT is not added to a greater degree, realize that drug compiles genome
The absolute control for the event of collecting, the present invention are further inserted into 1 or 2-10 concatenated nuclear signal out in the different location of C2E
(nuclear export signal, NES), the bootable albumen merged with it of the signal is mobile from nucleus to cytoplasm, can
Control Cas9 albumen is in the dynamic equilibrium of karyon/matter to a certain extent, to achieve the purpose that eliminate background.By being based on SSA
The luciferase assay of repair mechanism, discovery is when in Cas9 and 2ERT2Between be inserted into a NES (Cas9-NES-2ERT2,
When CN2E), Cas9 albumen can still keep very high endonuclease activity.It is consistent therewith to be, in another fluorescent reporter system
(the TLR system can pass through analysis mCherry fluorescin and GFP in (Traffic Light Repoter, TLR) TLR experiment
The percentage of fluorescin positive cell detects the occurrence frequency of NHEJ and HDR event), CN2E also shows significant drug
Inductive effect and inapparent background activity.In contrast, when NES is in Cas9-2ERT2Either end when can all damage it
Drug-induced effect, this shows that the structure of the protein complexes is most important to the performance of its function.
Further, the present invention is using high sensitivity in the fluorescence handover report system (fluorescence of TLR
Conversion reporter, FCR) it is studied.Within the system, HDR mediate a key amino acid site replacement from
And fluorescence is caused to be changed into GFP by BFP, reflect the luminous efficiency of HDR event by analyzing the percentage of GFP positive cell.
In this experiment, the background activity of CN2E is detected, the background living of (C2N2E) after two NES of insertion is also detected simultaneously by
Property significantly reduce.
To those skilled in the art, can deduce according to this field routine techniques knowledge is beyond all doubt, when by 1
A or 2 concatenated NES, which replace with 3-10 concatenated NES, can also have identical/similar technical effect.Therefore, the use
It can also be in the Cas9 and 2-5 concatenated ER in the drug induced CRISPR/Cas9 system of genome editorT2Interleave
Enter 1 or 2-10 concatenated NES, i.e. Cas9- (NES) m- (ERT2) n, m=1-10.
Preferably, the drug induced CRISPR/Cas9 system for genome editor includes targeting specific base
Because of the sgRNA and Cas9-NES-2ER in siteT2/Cas9-2NES-2ERT2, most preferably target the sgRNA in specific gene site
And Cas9-2NES-2ERT2(this system is referred to as HIT-Cas9).
Further, melt in application, needing to construct to translate the sgRNA and express aforementioned Cas9 in the system
The carrier of hop protein, the Cas9- (ERT2)n/Cas9-(NES)m-(ERT2) n and sgRNA can be respectively present in different carriers
Or it is present in identical carrier.
Wherein, the fusion protein is N-terminal to C-terminal from left to right, can pass through 3~20 amino acid between each element
Linker is connected.
It should be understood that freedom of the fusion protein due to linker, encoding gene is not limited to specific
Nucleotide sequence.
Further, the encoding gene of the fusion protein, and the carrier containing the encoding gene also belong to the present invention
Protection scope.
The carrier can be DNA vector, RNA carrier, protein carrier, slow virus carrier, adenovirus vector or common
Plasmid vector etc..
In experimental study of the invention, use slow virus pRRL.sin-18.ppy as carrier.
On aforementioned Research foundation, the present invention provides application of the system in drug induced genome editor.
The application may be embodied in a variety of aspects, as long as carrying out drug induced genome editor using system of the present invention,
It belongs to the scope of protection of the present invention.
More specifically, the application can be presented as a kind of method for utilizing drug-induced progress genome editor.It will
System (carrier containing the system) transfection translate/express into cell or tissue, is needing to carry out genome
When editor, drug-treated is carried out using 4-OHT and/or TAM and/or their derivative, the Cas9 after induction translation merges egg
It is white to enter nucleus, genome editor is carried out for specific gene site.
The system can be stringent under the action of 4-OHT and/or TAM and/or their derivative and effectively adjust Cas9
The activity of albumen feeds them into realization genome editting function in nucleus, and agent-feeding treatment will not generate background activity.This hair
The drug dose that the derivable genome editing system of this drug is illustrated in clear proof relies on response and selection specificity, should with guarantee
System can widely be applied to the research in biomedical each field.
Second aspect, the present invention provides can carry out the drug induced of genome editor and transcriptional activation simultaneously
CRISPR/Cas9 system, the 16-22nt sgRNA for genome editor including targeting specific gene site A, targets specific
10-16nt sgRNA, Cas9- (NES) m- (ER for transcriptional activation of gene loci BT2) n-GCN4 and scFv- (ERT2)n-
ADs, m=1-10, n=2-5, ADs are transcription factor combination, and the transcription factor is selected from one of V, P, R, H or a variety of.This
Cas9- (NES) m- (ER to play a major role in one systemT2) n-GCN4 is referred to as HIT2.
Cas9 in the system is wild type Cas9, and NES is nuclear signal (nuclear export signal), (NES)
M is m concatenated NES, V VP64, P P65, R Rta, H HSF1, ERT2It is that there are three amino acid mutations for a kind of band
The artificial mutation body (amino acid sequence is as shown in SEQ ID NO.1) of G400V/M543A/L544A, (ERT2) n is that n is concatenated
ERT2, scFv is the single-chain antibody variable region of anti-GCN4 peptide, and GCN4 is 5-30 copy from yeast transcriptional activity factor GCN4
One section of epitope small peptide, preferably 10 copy GCN4 small peptides.Sequence reference document (the Tanenbaum of scFv and GCN4
Deng A protein-tagging system for signal amplification in gene expression and
Fluorescence imaging.Cell 159,635-646 (2014).Said elements belong to albumen/base known in the art
Because of element.
The present invention has the sgRNA (from 12bp-22bp) of different length by design, can be led using pSSA assay determination
It causes wild type Cas9 to lose the active optimization length of cutting double-stranded DNA, finally preferably obtains 10-16nt sgRNA.Therefore, same
In the drug-induced system of Shi Jinhang genome editor and transcriptional activation, design 10-16nt sgRNA, which is executed, is directed to specific gene
Transcriptional activation, while still using 16-22nt sgRNA execute be directed to specific gene genome editor.
In application, the 10-16nt sgRNA and 16-22nt sgRNA may be present in different carriers or identical carrier,
Cas9-(NES)m-(ERT2) n-GCN4 and scFv- (ERT2) n-ADs is respectively present in different carriers.
Wherein, the fusion protein is N-terminal to C-terminal from left to right, can pass through 3~20 amino acid between each element
Linker is connected.
It should be understood that freedom of the fusion protein due to linker, encoding gene is not limited to specific
Nucleotide sequence.
Further, the encoding gene of the fusion protein, and the carrier containing the encoding gene also belong to the present invention
Protection scope.
Based on the system, the present invention provides a kind of using drug-induced while carrying out genome editor and transcriptional activation
Method translate/express by the carrier cotransfection containing the system to cell or tissue, is needing to carry out genome volume
When collecting with transcriptional activation, drug-treated is carried out using 4-OHT and/or TAM and/or their derivative, after induction translation
Cas9 fusion protein enters nucleus, carries out genome editor for the specific gene site of 16-22nt sgRNA targeting, for
The transcriptional activation that the specific gene site of 10-16nt sgRNA targeting carries out.
Further, the present invention also provides it is a kind of carry out genome editor and transcriptional activation at the same time when may be implemented can
The inverse drug-induced transcriptional activation method of type, when carrying out drug-treated with 4-OHT and/or TAM and/or their derivative,
The transcription of specific gene can be activated quickly；When cancelling 4-OHT and/or TAM and/or their derivative, specific gene
Transcriptional activity be reduced to background level, when again use 4-OHT and/or TAM and/or they derivative processing when, specific base
The transcriptional activity of cause can increase again.
The third aspect, in drug regulation system established by the present invention, in addition to needing to guarantee drug to whole system function
Outside the strict control of energy, the drug dose for also having detected constructed system relies on response, can be regulated and controled needed for its function with determination
Optimal dose.It is special to the selection of drug 4-OHT and endogenous estrogen ligand beta estradiol that the present invention also has detected system
Property, it is only played a role under the action of 4-OHT and/or TAM and/or their derivative with guarantee system, without by interior
The interference of endogenous ligand.
The present invention relates to operation be unless otherwise specified this field routine operation.
On the basis of common knowledge of the art, above-mentioned each optimum condition, can be combined with each other, obtain specific embodiment party
Formula.
Present invention may also apply to develop other drug-induced systems based on CRISPR/Cas9 technology with different function.
For example, such as drug-induced Cas9 albumen and transcription inhibitory factor or the commitment factor are combined, it is also possible to realize that drug lures
The functions such as the Transcription inhibition or drug-induced epigenetic regulation led.
Further, the Cas9 albumen used in the present invention is SpCas9, also be can be replaced with different PAM identification
Other SpCas9 mutation of sequence, or different types of Cas9 albumen such as SaCas9 is replaced with, to promote drug-induced system
Applicability, realize more complicated functional regulation extensively.
The beneficial effects of the present invention are:
The present invention, which develops one kind, can carry out drug-induced genome editing system, and on this basis, by a system
Column test is probed into, and is developed and scheme of the optimization with most highly active and minimum background activity, it is applied to endogenous gene
Editor.
Moreover, the present invention also provides genome editor and transcriptional activation is carried out simultaneously in triangular web, with more
The design of rich and variedization plays the function of drug-induced system manipulation genome to the greatest extent.It is such a have it is multiple
The foundation of active drug-induced system will provide more powerful tool for accurate genome project research.
Detailed description of the invention
Fig. 1 is TLR experimental result picture in the embodiment of the present invention 2.
Fig. 2 is TLR experimental result picture in the embodiment of the present invention 2.
Fig. 3 is FCR experimental result picture figure in the embodiment of the present invention 2.
Fig. 4 is that CD201 knocks out experimental result picture in the embodiment of the present invention 2.
Fig. 5 is carrier schematic diagram in comparative example 1 of the present invention.
Fig. 6 is intracellular targeting fluorescence schematic diagram in comparative example 1 of the present invention.
Fig. 7 is pSSA experimental result picture in comparative example 1 of the present invention.
Fig. 8 is pSSA experimental result picture in comparative example 2 of the present invention.
Fig. 9 is FCM analysis result figure in the embodiment of the present invention 4.
Figure 10 is FCR experimental result picture in comparative example 3 of the present invention.
Figure 11 is TLR experimental result picture in comparative example 3 of the present invention.
Figure 12 is TLR experimental result picture in comparative example 3 of the present invention.
Figure 13 is Surveyor experimental result picture in comparative example 3 of the present invention.
Figure 14 is FCM analysis result analysis chart in the embodiment of the present invention 5.
Figure 15 is luciferase testing result figure in the embodiment of the present invention 6.
Figure 16 is FCM analysis result analysis chart in the embodiment of the present invention 7.
Figure 17 is luciferase testing result figure in the embodiment of the present invention 7.
Figure 18 is FCM analysis result analysis chart in the embodiment of the present invention 7.
Specific embodiment
The preferred embodiment of the present invention is described in detail below in conjunction with embodiment.It will be appreciated that following real
Providing merely to play the purpose of explanation for example is applied, is not used to limit the scope of the present invention.The skill of this field
Art personnel without departing from the spirit and purpose of the present invention, can carry out various modifications and replace to the present invention.
Experimental method used in following embodiments is conventional method unless otherwise specified.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
Embodiment 1 is used for the drug induced CRISPR/Cas9 system of genome editor
The present embodiment is used to illustrate the drug induced CRISPR/Cas9 system of the present invention for genome editor
Building.
Construction method:
Drug induced genome editing system includes following two parts constructed by the present invention:
(1) by Cas9 and with concatenated two ER of its C-terminalT2Composition, i.e. Cas9-2ERT2。
(2) in Cas9-2ERT2One/two concatenated NES, i.e. Cas9-NES-2ER are inserted into plasmidT2/Cas9-
2NES-2ERT2。
Plasmid each section element source is as follows:
Cas9 element is expanded from plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 to be obtained (from a peak experiment
Room, Addgene plasmid#42230 40).ERT2Element is from plasmid pAd-CreER (by the laboratory Chicago University T.C.He
Present) amplification obtain.NES sequence according to the report of Ding et al. (Ding, Y., Ai, H.W., Hoi, H.&Campbell,
R.E.Forster resonance energy transfer-based biosensors for multiparameter
ratiometric imaging of Ca2+dynamics and caspase-3activity in single
Cells.Analytical chemistry 83,9687-9693 (2011)) it is synthesized by Shanghai Sangon Biotech Company and is inserted into difference
In Cas9 expression vector.
The building of reporter plasmid is by by the pCVL Traffic in the laboratory Andrew Scharenberg in TLR system
The position Sce in (Sce target) the Ef1a Puro plasmid of Light Reporter 1.1 (Addgene plasmids#31482)
What the targeting sequence that point is substituted for sgRNA was completed.The GFP donor plasmid used comes from the laboratory Andrew Scharenberg
(Addgene plasmids#31475)。
Reporter plasmid in FCR system is by will obtain after the mutation of GFP albumen single amino acids, which is composing type
Expression.
Embodiment 2
The present embodiment is for illustrating systematic difference described in embodiment 1.
1, experimental material
Cas9-2ERT2, Cas9-NES-2ERT2And Cas9-2NES-2ERT2Plasmid targets the sgRNA of different loci, is used for
Donor plasmid in TLR system and for the single stranded DNA donor (ssDNA donor) in FCR experiment.
2, experimental method
HEK293T cell (ATCC) culture be added to 10%FBS, 2mM GlutaMAX (Thermo Fisher),
The Dulbecco's modified Eagle's culture medium of 100U/ml penicillin and 100 μ g/ml streptomycin
In, it is placed in 37 DEG C, 5%CO2Incubator in cultivated.The TLR and FCR of monoclonal surely turn cell line and pass through slow virus packet
Dress, mode of infection obtain.Lipofectamine is the DNA transfection reagent of Biotool company, and transfection method is according to illustrating to carry out.
In each experiment, the DNA total amount of every hole transfection is consistent.Cell is carried out after transfection 5 hours and changes liquid, is tested after transfection 24 hours
The 4OHT of final concentration of 100-500nM is added in group, and the dehydrated alcohol of same volume is added in control group, carries out after continuing culture 48 hours
The detection of genome editor.
TLR is tested, TLR reporter cell lines are seeded in 24 orifice plates in advance, every hole transfects 250ng Cas9- later
ERT2 fusion protein expression vector, 150ng sgRNA and 400ng GFP donor plasmid (Addgene plasmids#3147517)
(or not Transfection of GFP donor plasmid).With 0.25% pancreatin (Thermo Fisher) vitellophag, it is thin that every hole at least collects 50000
Born of the same parents analyze HDR efficiency using CytoFLEX flow cytometer (Beckman Coulter).The efficiency of HDR passes through GFP
The percentage of positive cell is detected.When analyzing NHEJ event, cell is transferred to 96 orifice plates, is fixed with 4% paraformaldehyde
And with after Hochest 33342 (Thermo Fisher) dyeing, Operetta high intension imaging system (Perkin- is utilized
Elmer the fluorescence signal of) scan image, mCherry is analyzed with Harmony3.5 (Perkin-Elmer).
For CD201 gene knockout experiment, cell culture and transfection are carried out with same method.After transfection 24 hours, use
Cell is resuspended in culture medium containing 125ug/ml Zeocin, 100ug/ml G418, and culture is changed to after 24 hours containing only 125nM's
The culture medium of 4OHT.Cell culture a couple of days to quantity it is enough after, cell is carried out with PE-Vio770 (Miltenyi Biotec)
Antibody incubation, then analyzed with flow cytometer CytoFLEX (Beckman Coulter).
FCR is tested, surely will turn cell line in advance and be seeded in 24 orifice plates.Every hole transfects 300ng Cas9- later
The ssDNA donor (5 '-of ERT2 fusion protein expression vector, 300ng BFP sgRNA and 10pmol
GCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGAC
CACCCTGACGTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGA-3 ', in raw work synthesis).It at least receives in every hole
Collect 30000 cells, HDR efficiency is analyzed using CytoFLEX flow cytometer (Beckman Coulter).The effect of HDR
Rate is detected by the percentage of GFP positive cell.
3, experimental result
Come first with traffic-light reporter (TLR) experiment while detecting Cas9-2ERT2(C2E) it induces
The efficiency of NHEJ and HDR.This report system includes two kinds of fluorescins of GFP and mCherry.Because of the drug-induced effect of C2E
To be realized by nuclear translocation, establish thus one plant of stable integration this report gene in genome surely turn cell line into
Row experiment.In this reporting system, the targeting sequence for targeting the sgRNA of people hOct-4 is inserted into the code area of GFP, therefore
GFP and mCherry cannot correct reading code.When target sequence since the activity of Cas9 albumen forms double-strand DNA cleavage (DSB),
And then the correct reading code of mCherry can be restored when the frameshift mutation of 3n+2 base as caused by the repair mode of NHEJ.HDR's
The detection of repair mode makes GFP obtain entire reading frame by the corotation GFP template plasmid in system.Therefore, mCherry and
The fluorescence signal of GFP can respectively represent the efficiency that NHEJ and HDR event occurs.It is tested by TLR, the NHEJ that discovery C2E is mediated
There is significant 4OHT inductive effect (Fig. 1) with HDR event.However find, when 4OHT processing is not added, also there is certain ratio simultaneously
The background activity (Fig. 1) of example.
It is assumed that base affection is as also being had caused by certain C2E is located in nucleus in the absence of 4OHT.
Therefore, to reduce base affection, it is inserted into one or two nuclear export signal (NES) in C2E and forms Cas9-NES-2ERT2
(CN2E) and Cas9-2NES-2ERT2(C2N2E).Consistent with C2E design performance is the CN2E and C2N2E in TLR experiment
Significant drug-induced effect is equally shown, and this design is keeping drug-induced genome editor active really
It further reduced base affection (Fig. 2) simultaneously.In view of TLR experiment is in the low sensitivity of detection HDR efficiency, turned using fluorescence
Experiment (FCR) is changed to be studied.In the system, after Cas9 cuts target DNA generation DSBs, led by the repair mode of HDR
The change in a key amino acid site is caused, and then fluorescence is caused to become GFP from BFP.This experiment high sensitivity, can in TLR
The reduction (Fig. 3) of C2N2E base affection after base affection and the additional NES of insertion to detect CN2E.
Further, for a cell surface protein CD201 highly expressed in HEK293T cell, targeting is devised
The sgRNA that the code area CD201 5 ' is held, the gene knockout efficiency induced by flow cytomery NHEJ.As a result it again shows that,
The knockout of the CD201 gene of 4OHT induction may be implemented in CN2E and C2N2E, and the insertion of 2 NES can further decrease
Background activity (Fig. 4) when no 4OHT processing.
The above results demonstrate constructed drug-induced genome editing system can be real under the induction of 4OHT
Now to the editor in specific gene site.
Comparative example 1
In view of ERT2Different numbers and its when being present in the different location of Cas9 to the shadow of Cas9 endonuclease activity
It rings, devises a series of ERT2Corresponding plasmid (Fig. 5) is constructed with the merging of the group of Cas9.
The influence that different designs position Cas9 in the cell is had detected first, the results showed that works as ERT2It is present in the N of Cas9
When end, 4-OHT effectively cannot induce Cas9 to enter in nucleus, only work as ERT2When positioned at the C-terminal of Cas9,4-OHT can be bright
It enters core for aobvious induction, but there is also higher background activity (Fig. 6) simultaneously.
In order to detect different Cas9 and ERT2Whether the endonuclease activity of Cas9 is affected when combination, for people's telomere
(human telomere) and Oct4 gene have separately designed different sgRNA, are detected using pSSA luciferase assay
The efficiency of different sgRNA therefrom selects the sgRNA with most highly active, the effect of verifying different pharmaceutical induction Cas9 design
Activity.As a result, it has been found that the result with intracellular targeting is consistent, work as ERT2(CE and C2E), the activity of Cas9 when positioned at the C-terminal of Cas9
Higher (Fig. 7).
Comparative example 2
In order to further decrease base affection, one or two nuclear export signal (NES) is inserted into the different location of C2E
(Fig. 8 A).By single-stranded annealing (SSA) luciferase assay, find in Cas9 and 2ERT2Between be inserted into a NES (Cas9-
NES-2ERT2, CN2E) when, best (Fig. 8 B) of the activity holding of Cas9 restriction endonuclease.In contrast, when NES is in Cas9-2ERT2
Either end when can all damage its drug-induced effect, this shows the structures of the protein complexes to the performance of its function extremely
It closes important.
Embodiment 3 can carry out the drug induced CRISPR/Cas9 system of genome editor and transcriptional activation simultaneously
The present embodiment for carrying out transcriptional activation to CD43 gene, is illustrated simultaneously with carrying out genome editor to BFP gene
Carry out the building of the drug induced CRISPR/Cas9 system of genome editor and transcriptional activation.
Construction method:
The present invention is used for while carrying out the drug induced CRISPR/Cas9 system of genome editor and transcriptional activation
Cas9-2NES-2ERT2- GCN4 and scFv-2ERT2- VPH, wherein Cas9-2NES-2ERT2For constructed plasmid in embodiment 1,
GCN4 is the small peptide of the yeast transcriptional activity factor GCN4 of 10 copies, V VP64, P P65, H HSF1.Each element of plasmid
Source and construction method are as follows:
VP64 is template expansion with the pLenti-EF1a-SOX2 plasmid (Addgene plasmid#35388) in the laboratory Zhang Feng
Increasing obtains；P65 and Rta is with the SP-dCas9-VPR plasmid (Addgene plasmid#63798) in the laboratory George Church
It is obtained for template amplification；HSF1 is with the lenti MS2-P65-HSF1_Hygro plasmid (Addgene in the laboratory Zhang Feng
Plasmid#61426 it) is obtained for template amplification.ScFv-sfGFP-GB1 and 10xGCN4 is according to Tanenbaum M.E.et.al.
(Tanenbaum,M.E.,Gilbert,L.A.,Qi,L.S.,Weissman,J.S.&Vale,R.D.A protein-tagging
system for signal amplification in gene expression and fluorescence
Imaging.Cell 159,635-646 (2014)) report sequence Jin Weizhi company synthesize.For carrying out gene at the same time
The scFv expression vector used in group editor and transcriptional activation, by the sfGFP removal in scFv carrier in order to avoid interference BFP is by compiling
It collects and is designated as GFP.
Embodiment 4
The present embodiment is for illustrating systematic difference described in embodiment 3.
1, experimental material
Cas9-2NES-2ERT2- GCN4 (C2N2E-GCN4) and scFv-2ERT2- VPH plasmid, targets different loci
SgRNA, for the single stranded DNA donor (ssDNA donor) in FCR experiment.What the APC for detecting CD43 expression was marked
Anti-CD43 antibody.The steady of BFP reporter gene that incorporate for FCR experiment turns cell line.
Cas9-NLS-GCN4 plasmid is as control.
2, experimental method
Surely turn cell line progress using BFP while BFP is edited and CD43 activation experiment.In 24 orifice plates simultaneously by cell culture
It is transfected by scheme in embodiment one.Guarantee that the DNA total amount of every hole transfection is consistent and targets CD43's and BFP when transfection
SgRNA, Cas9 fusion protein carrier and activity factor carrier are carried out according to equimolar ratio.In addition to this, every hole also needs to be added
10pmol ssDNA donor.After 4OHT is acted on 48 hours, cell is collected and uses CD43 specific antibody CD43-APC
(Miltenyi Biotec) carries out cell streaming with CytoFLEX (Beckman Coulter) later according to illustrating to be incubated for
Analysis.The efficiency of genome editor and transcriptional activation is obtained by the percentage of GFP and CD43 positive cell.
3, experimental result
It is reported that length foreshorten to 16nt sgRNA below can guide Cas9 reach target DNA at and it is in combination, but
It will not occur to cut (Kiani, S.et al.Cas9gRNA engineering for genome editing, activation
and repression.Nature methods 12,1051-1054(2015).Dahlman,J.E.et al.Orthogonal
gene knockout and activation with a catalytically active Cas9nuclease.Nat
Biotechnol 33,1159-1161(2015).).Based on this characteristic, the present invention, which establishes, utilizes same CRISPR/Cas9
System realizes drug-induced genome editor and transcriptional activation simultaneously.Select sgRNA and the targeting of the 20nt of a targeting BFP
The sgRNAs and C2N2E-GCN4 and scFv-2ER of the 14nt of CD43T2- VPH corotation passes through stream after adding 4OHT to handle a period of time
Formula cell detection, which is demonstrated, BFP had not only had occurred in same system to be edited the event for being converted to GFP, but also CD43 transcription has occurred
The event (Fig. 9) of activation.And when carrying out the experiment with Cas9-NLS-GCN4, consistent with expection to be, genome editor's event
Not by drug-induced regulation (Fig. 9).
Comparative example 3
At present it has been reported that excessively some drug induced CRISPR/Cas9 system (Gonzalez, F.et al.An
iCRISPR Platform for Rapid,Multiplexable,and Inducible Genome Editing in
Human Pluripotent Stem Cells.Cell stem cell(2014).
Dow,L.E.et al.Inducible in vivo genome editing with CRISPR-Cas9.Nat
Biotechnol 33,390-394(2015).Zetsche,B.,Volz,S.E.&Zhang,F.A split-
Cas9architecture for inducible genome editing and transcription
modulation.Nat Biotechnol 33,139-142(2015).Davis,K.M.,Pattanayak,V.,Thompson,
D.B.,Zuris,J.A.&Liu,D.R.Small molecule-triggered Cas9protein with improved
Genome-editing specificity.Nat Chem Biol 11,316-318 (2015)), including at 291 of Cas9
The intein-Cas9 design of intein is inserted into serine position；Cas9 albumen is divided into two-part split-Cas9 design；From
Transcriptional level is to Cas9 TRE3G-Cas9 design regulated and controled etc..This comparative example compares HIT-Cas9 and HIT2 system one by one
Function of the inducible type systems delivered with these in terms of genome editor.Firstly, the comparison carried out using FCR experiment,
By contrast with the C2N2E-GCN4 of the C2N2E and HIT2 system of HIT-Cas9 system, intein-S219-Cas9, Split-
Cas9 and TRE3G-Cas9 system all has apparent base affection, and TRE3G-Cas9 is the most obvious (Figure 10).Comparison
Example also compares the design that the mutant (G512R) of intein is inserted into Cas9, which causes it to endogenic β-
Estradiol is no longer sensitive, and can selectively make a response to external source 4-OHT.Intein-S219-G512R-Cas9 does not have
Apparent base affection, but compared with HIT2, its drug-induced effect is significantly reduced.It is real by the lower TLR of sensitivity
Test further demonstrate Intein-S219-G512R-Cas9 efficiency ratio HIT system it is low, and the base affection of Tet-on system
Higher (Figure 11,12).Detection discovery, HIT-Cas9, HIT2 are carried out to two sites of missing the target of EMX1 by Surveyor experiment
System and the Cas9 design undershooting-effect of other medicines induction are very low (Figure 13).In contrast, the Cas9 carrier tool with NLS
There is higher undershooting-effect, this more shows the advantage of drug-induced system.In short, with existing drug-induced project plan comparison,
HIT-Cas9 and HIT2 design had not only preferably maintained Cas9 activity, but also guaranteed there is lower background effect in the absence of inducer
It answers.
Embodiment 5
On the basis of embodiment 2 and 4, the present embodiment illustrates how to prove drug-induced body established by the present invention
The dose-dependent drug responses for being and the selection specificity to drug.
HIT-Cas9 and HIT2 system is tested first to the dose-dependent effect of 4-OHT and β-estradiol.Pass through
Test (Figure 14) in terms of FCR experiment progress genome editor, as a result observes that the selection of 4-OHT is special in all HIT systems
It is anisotropic.In addition, also observed not only with drug exposure times, the also closely related dose-dependent effect with drug concentration.Just
It as expected, only include the saltant type intein of G512R, rather than wild type intein, the table in genome editor
The selection revealed to 4-OHT is specific (Figure 14).
Embodiment 6
The present embodiment illustrates how to prove the reversible regulation of drug-induced transcriptional activation system established by the present invention.
The invertibity of drug regulation is an important factor for the expression of dynamic regulation specific gene.Utilize genome
Middle stable integration has one plant of HIT-SunTag system correlative expression vector, luciferase reporting plasmid and sgRNA expression vector
Cell line carries out invertibity test experience, and as when dosing removes 4-OHT after a certain period of time in cultivating system, luciferase is believed for discovery
When number can die down to background level, and rejoin 4-OHT, luciferase signal restores (Figure 15 A), this with lasting dosing group,
Continue withdrawal group and the group without 4-OHT processing compares obvious differences.Class is also observed with the 4-OHT of various concentration processing
Like result (Figure 15 B).These are statistics indicate that transcriptional activation caused by HIT-SunTag system established by the present invention is reversible.
Although above the present invention is described in detail with a general description of the specific embodiments,
On the basis of the present invention, it can be made some modifications or improvements, this will be apparent to those skilled in the art.Cause
This, these modifications or improvements, fall within the scope of the claimed invention without departing from theon the basis of the spirit of the present invention.
Embodiment 7
The present embodiment is for illustrating gene of the drug-induced system established by the present invention in different type Cas9 albumen
The application of group editor and transcriptional control function.
SaCas9 derives from Staphylococcus aureus, and PAM sequence has highly variable (NNGRR).It utilizes
SaCas9 replaces SpCas9, constructs the SaCas9-2NES-2ER for genome editorT2Carrier.When with targeting BFP's
When sgRNA is used in conjunction with, fluorescence is successfully changed into GFP by BFP by this design scheme.Although compared with SpCas9,
The base affection of SaCas9 is higher, needs to be optimized, but it shows stronger drug-induced property (Figure 16) really.
In order to carry out genome editor and transcriptional activation simultaneously using the HIT2 system constructed based on SaCas9, test first
Whether the change for having demonstrate,proved sgRNA length can cause Cas9 to edit or combine the change of DNA ability.By SaCas9 and different length
SgRNA cotransfection tested by the activity (Figure 17 A) of pSSA experimental verification genome editor by luciferase reporting
It verifies transcriptional activation activity (Figure 17 B).It was found that the length of sgRNA, which is reduced 1nt, almost leads to the funeral of its genome edit capability
It loses, and transcriptional activation effect is best when sgRNA length is 15nt to 18nt.Therefore, SaCas9-2NES-2ER is constructedT2-
GCN4 carrier and by itself and BFP sgRNA, the 15nt of 21nt or the CD43sgRNA cotransfection of 18nt.Experiment discovery, HIT2-
The SaCas9 and sgRNA of two kinds of shortening length, which is used in conjunction with, can realize drug-induced genome editor and transcriptional activation
(Figure 18), it was demonstrated that designed HIT system of the invention can be applied to the Cas9 in different plant species source, and then expands it and answer
With.
Sequence table
<110>Institute of Zoology, Academia Sinica
<120>the drug induced CRISPR/Cas9 system of genome editor and transcriptional control are used for
<130> KHP171112373.6
<160> 1
<170> PatentIn version 3.5
<210> 1
<211> 313
<212> PRT
<213> ERT2
<400> 1
Ala Gly Asp Met Arg Ala Ala Asn Leu Trp Pro Ser Pro Leu Met Ile
1 5 10 15
Lys Arg Ser Lys Lys Asn Ser Leu Ala Leu Ser Leu Thr Ala Asp Gln
20 25 30
Met Val Ser Ala Leu Leu Asp Ala Glu Pro Pro Ile Leu Tyr Ser Glu
35 40 45
Tyr Asp Pro Thr Arg Pro Phe Ser Glu Ala Ser Met Met Gly Leu Leu
50 55 60
Thr Asn Leu Ala Asp Arg Glu Leu Val His Met Ile Asn Trp Ala Lys
65 70 75 80
Arg Val Pro Gly Phe Val Asp Leu Thr Leu His Asp Gln Val His Leu
85 90 95
Leu Glu Cys Ala Trp Leu Glu Ile Leu Met Ile Gly Leu Val Trp Arg
100 105 110
Ser Met Glu His Pro Val Lys Leu Leu Phe Ala Pro Asn Leu Leu Leu
115 120 125
Asp Arg Asn Gln Gly Lys Cys Val Glu Gly Met Val Glu Ile Phe Asp
130 135 140
Met Leu Leu Ala Thr Ser Ser Arg Phe Arg Met Met Asn Leu Gln Gly
145 150 155 160
Glu Glu Phe Val Cys Leu Lys Ser Ile Ile Leu Leu Asn Ser Gly Val
165 170 175
Tyr Thr Phe Leu Ser Ser Thr Leu Lys Ser Leu Glu Glu Lys Asp His
180 185 190
Ile His Arg Val Leu Asp Lys Ile Thr Asp Thr Leu Ile His Leu Met
195 200 205
Ala Lys Ala Gly Leu Thr Leu Gln Gln Gln His Gln Arg Leu Ala Gln
210 215 220
Leu Leu Leu Ile Leu Ser His Ile Arg His Met Ser Asn Lys Gly Met
225 230 235 240
Glu His Leu Tyr Ser Met Lys Cys Lys Asn Val Val Pro Leu Tyr Asp
245 250 255
Leu Leu Leu Glu Ala Ala Asp Ala His Arg Leu His Ala Pro Thr Ser
260 265 270
Arg Gly Gly Ala Ser Val Glu Glu Thr Asp Gln Ser His Leu Ala Thr
275 280 285
Ala Gly Ser Thr Ser Ser His Ser Leu Gln Lys Tyr Tyr Ile Thr Gly
290 295 300
Glu Ala Glu Gly Phe Pro Ala Thr Ala
305 310
Claims (16)
1. being used for the drug induced CRISPR/Cas9 system of genome editor, which is characterized in that including targeting specific gene position
SgRNA the and Cas9 fusion protein of the 16-22nt of point, the Cas9 fusion protein are a by Cas9 and with the concatenated 2-5 of its C-terminal
ERT2Composition, i.e. Cas9- (ERT2) n, n=2-5.The fusion protein is N-terminal to C-terminal from left to right, can be led between each element
The linker for crossing 3~20 amino acid is connected.
2. system according to claim 1, which is characterized in that the Cas9 and 2-5 concatenated ERT2Between be inserted into 1
Or 2-10 concatenated NES, i.e. Cas9- (NES) m- (ERT2) n, m=1-10.The fusion protein is N-terminal to C from left to right
It holds, can be connected by the linker of 3~20 amino acid between each element.
3. system according to claim 1 or 2, which is characterized in that the Cas9- (ERT2)n/Cas9-(NES)m-(ERT2)
N and sgRNA is respectively present in different carriers or is present in identical carrier.
4. application of the described in any item systems of claims 1 to 3 in drug induced genome editor.
5. the encoding gene of any one of claims 1 to 3 fusion protein.
6. the carrier containing encoding gene described in claim 5.
7. a kind of utilize the drug-induced method for carrying out genome editor, which is characterized in that will be any containing claims 1 to 3
The carrier of the item system is transfected to cell or tissue, transcribe/translation/and is expressed, when needing to carry out genome editor, benefit
Drug-treated is carried out with 4-OHT and/or TAM and/or their derivative, the Cas9 fusion protein after induction translation enters cell
Core is integrated to the target site of genome under the guidance of special sgRNA, carries out genome editor for specific gene site.
8. claims 1 to 3 described in any item systems other have different function based on CRISPR/Cas9 technology developing
Application in drug-induced system, including the system using other Cas9 albumen and the system using other function controlling factors.
9. one kind can carry out the drug induced CRISPR/Cas9 system of genome editor and transcriptional activation simultaneously, feature exists
In the 16-22nt sgRNA for genome editor including targeting specific gene site A targets the use of specific gene site B
In 10-16nt sgRNA, Cas9- (NES) m- (ER of transcriptional activationT2) n-GCN4 and scFv- (ERT2) n-ADs, m=1-10, n
=2-5, GCN4 are one section of epitope small peptide from yeast transcriptional activity factor GCN4 of 5-30 copy, and ScFv is anti-
The single-chain antibody variable region of GCN4 peptide, ADs are transcription effector combination.The fusion protein is N-terminal to C-terminal from left to right,
It can be connected by the linker of 3~20 amino acid between each element.
10. system according to claim 9, which is characterized in that the 10-16nt sgRNA, 16-22nt sgRNA,
Cas9-(NES)m-(ERT2) n-GCN4 and scFv- (ERT2) n-ADs may be present in different carriers or identical carrier.
11. the described in any item systems of claim 9~10 answering in drug induced genome editor and/or transcriptional activation
With.
12. the encoding gene of any one of claim 9~10 fusion protein.
13. the carrier containing encoding gene described in claim 12.
14. a kind of utilize method that is drug-induced while carrying out genome editor and transcriptional activation, which is characterized in that will contain and have the right
Benefit requires the carrier cotransfection of 9 or 10 systems to cell or tissue, translate/express, is needing to carry out genome volume
When collecting with transcriptional activation, drug-treated is carried out using 4-OHT and/or TAM and/or their derivative, after induction translation
Cas9 fusion protein enters nucleus, carries out genome editor for the specific gene site of 16-22nt sgRNA targeting, for
The specific gene site of 10-16nt sgRNA targeting carries out transcriptional activation.
15. the described in any item systems of claim 9~10 are developing other CRISPR/Cas9 technologies that are based on different function
Drug-induced system in application, be including the system using other Cas9 albumen and using the other function controlling factors
System.
16. a kind of carry out that the drug-induced transcriptional activation side of reversible may be implemented when genome editor and transcriptional activation at the same time
Method, which is characterized in that when carrying out drug-treated with 4-OHT and/or TAM and/or their derivative, the transcription of specific gene
It can quickly be activated；When cancelling 4-OHT and/or TAM and/or their derivative, the transcriptional activity of specific gene is reduced
To background level, when using 4-OHT and/or TAM and/or their derivative to handle again, the transcriptional activity of specific gene can
It increases again.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710553178.2A CN109207517B (en) | 2017-07-07 | 2017-07-07 | Drug-inducible CRISPR/Cas9 system for genome editing and transcriptional regulation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710553178.2A CN109207517B (en) | 2017-07-07 | 2017-07-07 | Drug-inducible CRISPR/Cas9 system for genome editing and transcriptional regulation |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109207517A true CN109207517A (en) | 2019-01-15 |
| CN109207517B CN109207517B (en) | 2020-12-01 |
Family
ID=64991217
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710553178.2A Active CN109207517B (en) | 2017-07-07 | 2017-07-07 | Drug-inducible CRISPR/Cas9 system for genome editing and transcriptional regulation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109207517B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114763559A (en) * | 2021-01-15 | 2022-07-19 | 中国农业大学 | Targeting gene capturing system independent of homologous recombination and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103772506A (en) * | 2012-10-22 | 2014-05-07 | 北京唯尚立德生物科技有限公司 | Transcription activator like effector-functional group-estrogen receptor function protein and application thereof |
| CN105188767A (en) * | 2012-07-25 | 2015-12-23 | 布罗德研究所有限公司 | Inducible DNA binding proteins and genome perturbation tools and applications thereof |
| WO2016108926A1 (en) * | 2014-12-30 | 2016-07-07 | The Broad Institute Inc. | Crispr mediated in vivo modeling and genetic screening of tumor growth and metastasis |
| CN109207516A (en) * | 2017-07-07 | 2019-01-15 | 中国科学院动物研究所 | A kind of drug-induced gene transcriptional activation method |
-
2017
- 2017-07-07 CN CN201710553178.2A patent/CN109207517B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105188767A (en) * | 2012-07-25 | 2015-12-23 | 布罗德研究所有限公司 | Inducible DNA binding proteins and genome perturbation tools and applications thereof |
| CN103772506A (en) * | 2012-10-22 | 2014-05-07 | 北京唯尚立德生物科技有限公司 | Transcription activator like effector-functional group-estrogen receptor function protein and application thereof |
| WO2016108926A1 (en) * | 2014-12-30 | 2016-07-07 | The Broad Institute Inc. | Crispr mediated in vivo modeling and genetic screening of tumor growth and metastasis |
| CN109207516A (en) * | 2017-07-07 | 2019-01-15 | 中国科学院动物研究所 | A kind of drug-induced gene transcriptional activation method |
Non-Patent Citations (1)
| Title |
|---|
| KAIWEN IVY LIU等: "A chemical-inducible CRISPR–Cas9 system for rapid control of genome editing", 《NATURE CHEMICAL BIOLOGY》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114763559A (en) * | 2021-01-15 | 2022-07-19 | 中国农业大学 | Targeting gene capturing system independent of homologous recombination and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109207517B (en) | 2020-12-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106544351B (en) | CRISPR-Cas9 knock out in vitro drug resistant gene mcr-1 method and its dedicated cell-penetrating peptides | |
| Willems et al. | ORANGE: A CRISPR/Cas9-based genome editing toolbox for epitope tagging of endogenous proteins in neurons | |
| CN110312793A (en) | Safety for enhancing from the restricted circuit Cas9 (SLiCES) plasmid and its slow virus system | |
| US20220112472A1 (en) | Enhanced hAT Family Transposon-Mediated Gene Transfer and Associated Compositions, Systems, and Methods | |
| CN108431225A (en) | The induction type of cellular genome is modified | |
| EA038500B1 (en) | THERMOSTABLE Cas9 NUCLEASES | |
| JP2008528056A (en) | Site-specific serine recombinases and methods for their use | |
| CN108823202A (en) | Base editing system, method, kit and its application of the mutation of people's HBB gene are repaired for specificity | |
| Borzacchiello et al. | Expression of platelet-derived growth factor-β receptor and bovine papillomavirus E5 and E7 oncoproteins in equine sarcoid | |
| JP2006523448A5 (en) | ||
| CN109207518A (en) | Drug induced CRISPR/Cas9 system for gene transcriptional activation | |
| Huang et al. | Analysis of nucleotide sequence-dependent DNA binding of poly (ADP-ribose) polymerase in a purified system | |
| CN109207517A (en) | Drug induced CRISPR/Cas9 system for genome editor and transcriptional control | |
| Gong et al. | Stable transfection into rat bone marrow mesenchymal stem cells by lentivirus‑mediated NT‑3 | |
| US20190024090A1 (en) | Construct for epigenetic modification and its use in the silencing of genes | |
| WO2000024912A1 (en) | Use of a self-cleaving rna motif to modulate gene expression | |
| Akiyoshi et al. | Reconstituting the kinetochore–microtubule interface: what, why, and how | |
| EA020311B1 (en) | Artificial chromosome vector | |
| CN102533722B (en) | Method for improving transient expression of recombinant proteins in mammalian cells through temperature jump | |
| Spencer et al. | Definitive localization of intracellular proteins: Novel approach using CRISPR-Cas9 genome editing, with glucose 6-phosphate dehydrogenase as a model | |
| Hamaker | Development of site-specific integration strategies and characterization of protein expression instability to improve CHO cell line engineering | |
| US7892823B2 (en) | Methods and systems for high homologous recombination (“HR”) targeting efficiency | |
| Liu et al. | Positive selection vector using the KillerRed gene | |
| US20190024072A1 (en) | Construct for epigenetic modification and its use in the silencing of genes | |
| JP5457915B2 (en) | Enhancer and / or promoter screening method, and vector, vector library and assay kit used therein |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |