WO2013153361A1 - Expression génique à partir d'épisomes mitotiquement stables - Google Patents

Expression génique à partir d'épisomes mitotiquement stables Download PDF

Info

Publication number
WO2013153361A1
WO2013153361A1 PCT/GB2013/050795 GB2013050795W WO2013153361A1 WO 2013153361 A1 WO2013153361 A1 WO 2013153361A1 GB 2013050795 W GB2013050795 W GB 2013050795W WO 2013153361 A1 WO2013153361 A1 WO 2013153361A1
Authority
WO
WIPO (PCT)
Prior art keywords
host cell
vector
cell
cells
idlv
Prior art date
Application number
PCT/GB2013/050795
Other languages
English (en)
Inventor
George Dickson
Rafael YANEZ-MUNOS
Hanna KYMALAINEN
Original Assignee
Royal Holloway And Bedford New College
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Royal Holloway And Bedford New College filed Critical Royal Holloway And Bedford New College
Priority to EP13713483.9A priority Critical patent/EP2836598A1/fr
Publication of WO2013153361A1 publication Critical patent/WO2013153361A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67—General methods for enhancing the expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/22011—Polyomaviridae, e.g. polyoma, SV40, JC
    • C12N2710/22022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/16043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/108—Plasmid DNA episomal vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2820/00—Vectors comprising a special origin of replication system
    • C12N2820/60—Vectors comprising a special origin of replication system from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/46—Vector systems having a special element relevant for transcription elements influencing chromatin structure, e.g. scaffold/matrix attachment region, methylation free island

Definitions

  • the present invention relates to gene expression, and in particular to stable transgene expression in host cells using episomal vectors.
  • the invention extends to the use of such vectors for expressing transgenes in a range of different medical and heterologous protein production applications.
  • Gene addition therapy attempts to correct a disease phenotype by introducing a functional copy of the non-functional gene into the patient, thereby restoring the synthesis of the functional gene product.
  • One of the main challenges faced by gene therapy is establishing stable transgene expression without integration into the host genome, because integration can often result in insertional mutagenesis and the activation of oncogenes.
  • a method of expressing a transgene in a host cell comprising exposing a host cell, which comprises a genetic construct comprising a transgene, to conditions which substantially block mitosis in the host cell, such that the construct forms a mitotically stable episome resulting in expression of the transgene.
  • a host cell comprising a genetic construct comprising a transgene, wherein the host cell has been exposed to conditions which substantially block mitosis in the host cell such that the construct forms a mitotically stable episome upon, and wherein the host cell is capable of expressing the transgene.
  • the host cell of the second aspect maybe prepared by the method according to the first aspect.
  • the inventors have overcome the problems of genomic insertional mutagenesis by using a construct in the method of the first aspect in order to establish mitotically stable, non-integrating stable episomes (including autonomous nuclear DNA elements) containing the transgene. This is achieved by blocking mitosis to induce cell cycle arrest in the host cell, which results in expression of the transgene.
  • mitotic block may allow time for epigenetic chromatinisation events to occur which allows the delivered episomal DNA from the construct comprising the transgene to establish permanency (i.e. mitotic stability), as well as features of replication and segregation.
  • the mitotic block allows the establishment of mitotically stable replicating and segregating episomes, and so is an extremely important and non-obvious observation.
  • the episome may be capable of replicating and segregating into daughter cells.
  • the inventors have surprisingly demonstrated that, using the method of the first aspect, stable transgene expression can be established and maintained over many cell divisions, i.e. months of continuous culture amounting to over loo cell doublings.
  • the inventors have shown that it is possible to isolate stable cell clones and sub-clones expressing very high
  • episomes are the eukaryotic equivalent of bacterial plasmids.
  • episomes are closed circular autonomous DNA elements that are replicated in the nucleus.
  • Viruses are the most common examples of this, such as herpesviruses, adenoviruses and polyomaviruses.
  • Other examples include aberrant chromosomal fragments, such as double minute chromosomes, that can arise during artificial gene amplifications or in pathologic processes (e.g., cancer cell transformation).
  • Episomes in eukaryotes behave similarly to plasmids in prokaryotes in that the DNA is stably maintained and replicated within the host cell.
  • Cytoplasmic viral episomes (as in poxvirus infections) can also occur. Some episomes, such as herpesviruses, replicate in a rolling circle mechanism, similar to bacterial phage viruses. Others replicate through a bi-directional replication mechanism (Theta type plasmids). In either case, episomes remain physically separate from host cell chromosomes.
  • the method of the invention may comprise blocking host cell mitosis in order to induce cell cycle arrest.
  • the rationale for inducing cell cycle arrest on the host cell is based on the assumption that stable nuclear DNA elements are anchored onto the nuclear matrix or scaffolding. Therefore, for an episome (i.e. the construct comprising the transgene) to become mitotically stable, an interaction maybe necessary between the newly introduced construct gene sequence and the nuclear matrix of the host cell, and such an interaction should be allowed sufficient time to take place prior to the dissipation of the nuclear membrane during mitosis, followed by potential diffusion of the vector genome. It was reasoned by the inventors that an induced cell cycle arrest may provide the opportunity for the construct to attach to the nuclear matrix.
  • mitosis may be blocked between the Gi phase and S phase of the host cell cycle.
  • a period of cell cycle arrest or quiescence may be induced either during or after transduction of the host cell with the transgene-containing construct.
  • the mitotic block may be induced within the first 48 hours, 24 hours, 12 hours, 6 hours, 3 hours, 1 hour or 30 minutes upon transduction of the host cell with the construct.
  • the mitotic block is induced immediately upon transduction.
  • Cell cycle arrest may be allowed to proceed for a determined period, after which the host cell may then be returned to standard culture conditions, whereupon the usual cell cycle and mitosis of the host cell resumes. Accordingly, the mitotic block may be reversible.
  • the inventors are of the view that, to date, no studies have ever reported the use of reversible cell cycle arrest as a means for encouraging the establishment of mitotically stable episomes. It will be appreciated that the determined period for inducing the mitotic block will be dependent on the type of host cell being cultured, but it should be sufficiently long for epigenetic chromatinisation events to occur which would allow the construct comprising the transgene to establish permanency (i.e.
  • the period required to induce the mitotic block (i.e. cell cycle arrest) in the host cell may be between ⁇ hour and 10 days, or between 6 hours and 9 days, or between 12 hours and 8 days, or between 18 hours and 7 days.
  • the period may be between 1 day and 6 days, or between 2 days and 5 days, or between 2 days and 4 days.
  • the period required to induce the mitotic block arrest may be at least 1, 2, 3, 4, or 5 days, or more.
  • the mitotic block may be achieved through the means of addition or restriction or depletion of substances usually required in the medium in which the host cell is disposed.
  • the medium may be physiological bodily fluid, or a growth culture medium.
  • chemotherapeutic drugs to induce Gi/G 0 arrest may include ribonucleotide biosynthesis inhibitors, as well as ionising and UV irradiation, which may be use in the method of the invention.
  • cell cycle arrest may also be achieved using a range of physical, metabolic, cell culture or pharmacological stimuli, which may be selected from a group of stimuli consisting of metabolic restriction (such as serum starvation); hormone or cytokine treatment or withdrawal; pharmacological drug exposure or withdrawal; inhibition or activation of cell signalling pathways; and culture temperature or atmosphere stimuli.
  • metabolic restriction such as serum starvation
  • hormone or cytokine treatment or withdrawal pharmacological drug exposure or withdrawal
  • inhibition or activation of cell signalling pathways and culture temperature or atmosphere stimuli.
  • a preferred method for inducing the mitotic block in the host cell may be methionine depletion of the host cell's growth media.
  • Methionine depletion may be preferred over chemical methods, which may damage the DNA and therefore increase the rate of random integrations and cell death.
  • Methionine restriction in combination with serum depletion is a preferred means for inducing cell cycle arrest.
  • concentration of methionine in the growth medium may be less than about 0.5 ⁇ , or less than ⁇ .4 ⁇ or less than ⁇ . ⁇ .
  • Bovine serum contains methionine at an estimated concentration of 15 ⁇ , resulting in a final methionine concentration of about 0.3 ⁇ , which is referred to herein as being "methionine restricted”.
  • the concentration of serum in the growth medium may be less than about 5%, 4%, 3% or 2% by volume.
  • the serum concentration used in the Examples was 2% (v/v) and referred to herein as being "serum depleted".
  • the growth medium used for inducing the mitotic block may comprise Dulbecco's Modified Eagle's Medium (DMEM) with no methionine and 4.5 g/1 glucose
  • the medium may comprise o.02g/l L- proline.
  • the genetic construct may be in the form of an expression cassette, which is suitable for expression of the transgene in the host cell.
  • the method may comprise introducing the genetic construct into the host cell. This may be achieved without the construct being incorporated in a vector.
  • the genetic construct which maybe a nucleic acid molecule, maybe incorporated within a liposome or a virus particle.
  • a purified nucleic acid molecule e.g. histone-free DNA, or naked DNA
  • the genetic construct may be introduced directly in to cells of a host subject (e.g. a eukaryotic or prokaryotic cell) by transfection, infection, electroporation, microinjection, cell fusion, protoplast fusion or ballistic
  • genetic constructs of the invention may be introduced directly into a host cell using a particle gun.
  • the genetic construct may be harboured within a vector, for expression in a suitable host cell.
  • the vector which may be recombinant, may be a plasmid, cosmid or phage.
  • Such vectors are useful for transforming host cells with the genetic construct, and for replicating the expression cassette comprising the transgene therein.
  • the skilled technician will appreciate that genetic constructs of the invention may be combined with many types of backbone vector for expression purposes.
  • the vector comprising the transgene maybe a virus.
  • the vector may be a member of the Retroviridae family, or of the Orthoretrovirinae Subfamily.
  • the vector may be a member of the Lentivirus genus.
  • lentiviral vectors As a gene delivery vector, lentiviral vectors have key several advantages over other systems. Firstly, they have a large packaging capacity of at least 8 Kb of DNA, which is an important feature when packaging sizeable expression cassettes of tissue- specific promoters and transgenes. Secondly, they differ from simpler retroviruses not only in the genome organisation, but also in that they are able to transduce non- dividing cells, which is a very useful quality when considering application as a gene therapy vector to non-proliferating tissues such as muscle, neurons and
  • lentivectors have reduced immunogenicity compared to adenoviral vectors, making it possible to consider systemic delivery routes.
  • Lentiviral vectors are commonly produced by transient transfection of 293T cells and and harvesting of the virus-containing supernatant. Useful titres, typically ⁇ 6 - ⁇ ? TU/ml, are routinely achieved. Substituting the HIV-i envelope protein with the G glycoprotein of vesicular stomatitis virus (VSV-G) confers the viral particles with a highly stable capsid structure, allowing the vector preparations to be further concentrated by ultracentrifugation. VSV-G pseudotyped vectors also exhibit a dramatically increased tissue tropism compared to wild-type lentivirus vectors, which is why it is commonly utilised for both in vitro and in vivo applications.
  • VSV-G vesicular stomatitis virus
  • HrV-i-derived vectors display a propensity for integrating within transcriptionally active genes, possibly as a result of interactions between the pre-integration complex (PIC) and chromatin-binding factors.
  • PIC pre-integration complex
  • chromatin-binding factors chromatin-binding factors
  • the vector is a non-integrating or integration- deficient vector.
  • the vector is an integration-defective lentiviral vector (IDLV), which, as described in the examples, has proven to be especially effective.
  • IDLVs integration-defective lentiviral vectors
  • the most efficient way of achieving this may be to mutate one of the amino acids in the catalytic site of Integrase (IN), the enzyme which catalyses the integration of the viral cassette into the host genome.
  • I IN mutants of which the D64V is one embodiment, are only defective in integration and the integrase retains its other functions, resulting in normal levels of viral DNA
  • the construct comprises a mutation in the catalytic site of Integrase (IN) enzyme, preferably a D64V mutation, which is substantially set out as SEQ ID No: 2.
  • the construct may comprise a nucleic acid sequence substantially as set out in either SEQ ID No.i or SEQ ID No.2, or a functional fragment or variant thereof.
  • non-integrating lentivectors are also protected from epigenetic silencing which may otherwise occur upon integration into an inactive part of the genome.
  • Expression levels both in vitro and in vivo have been significantly augmented by including the self-inactivating (SIN) deletion, which removes the negative regulatory effect arising from the full-length Long Terminal Repeat (LTR).
  • SI self-inactivating
  • the construct may comprise a SIN deletion (Zufferey, R et al., 1997, Nat Biotechnol 15(9): 871-875.).
  • the nucleic acid sequence of the SIN mutation is substantially set out as SEQ ID No: 3.
  • the construct may comprise one or more long terminal repeat (LTR).
  • LTR long terminal repeat
  • the nucleic acid sequence of the LTR is substantially set out as SEQ ID No: 4. actggaagggctaattcactcccaacgaagacaagatatccttgatctgtggatctac cacacacaaggctacttccctgattggcagaactacacaccagggccagggatcagat atccactgacctttggatggtgctacaagctagtaccagttgagcaagagaaggtaga agaagccaatgaaggagagaacacccgcttgttacaccctgtgagcctgcatgggatg gatgacccggagagagaagtattagagtggaggttttgacagccctagcatttcatc acatggcccgagagctgcatcggagtacttca
  • the construct may comprise a nucleic acid sequence substantially as set out in either SEQ ID N0.3 or SEQ ID N0.4, or a functional fragment or variant thereof.
  • WPRE woodchuck hepatitis virus post- transcriptional element
  • the construct may comprise woodchuck hepatitis virus post- transcriptional element (WPRE), preferably disposed downstream of the transgene.
  • WPRE woodchuck hepatitis virus post- transcriptional element
  • the nucleic acid sequence of the WPRE is substantially set out as SEQ ID No:5.
  • the construct may comprise a nucleic acid sequence substantially as set out in SEQ ID N0.5, or a functional fragment or variant thereof.
  • the vector may or may not comprise a so-called Scaffold/Matrix Attachment Regions (S/MAR) element.
  • S/MAR Scaffold/Matrix Attachment Regions
  • the nucleic acid sequence of a S/MAR element may be substantially set out as SEQ ID No: 6.
  • S/MARs are architectural components of genomic DNA that are involved in the organisation of chromatic into domains and also in the regulation of several DNA functions, such as replication and transcription.
  • the S/MAR may be a miniMAR, as described in the Examples.
  • nucleic acid sequence of a miniMAR may be substantially set out as SEQ ID No: 7.
  • the construct may comprise a nucleic acid sequence substantially as set out in either SEQ ID No.6 or SEQ ID No.7, or a functional fragment or variant thereof.
  • the vector may include a variety of other functional elements including a suitable promoter to initiate transgene expression.
  • the vector is preferably capable of autonomously replicating in the nucleus of the host cell.
  • elements which induce or regulate DNA replication may be required in the recombinant vector.
  • Suitable promoters may include the SV40 promoter.
  • a terminator may also be provided.
  • the vector may also comprise DNA coding for a gene that may be used as a selectable marker in the cloning process, i.e. to enable selection of cells that have been transfected or transformed, and to enable the selection of cells harbouring vectors incorporating heterologous DNA.
  • a selectable marker for example, ampicillin resistance or green fluorescent protein (GFP) are envisaged.
  • the selectable marker gene may be in a different vector to be used simultaneously with the vector containing the transgene.
  • the vector may also comprise DNA involved with regulating expression of the transgene, or for targeting the expressed polypeptide to a certain part of the host cell.
  • the method of the invention results in a surprisingly low amount of integration of the transgene into the host's genome.
  • the amount of integration may be less than 1%, or less than 0.1%, or less than 0.01%.
  • the inventors were pleased to observe that, as described in the examples, deep sequencing analysis of IDLV integration sites has shown that most integration events occur in non-coding regions and most likely via cell-mediated repair mechanisms rather than residual Integrase activity.
  • the construct (referred to herein as pRRLsc SV40 eGFP) may comprise a lentivector backbone, the nucleic acid sequence of which is substantially set out as SEQ ID No: 8. tcgagatgtgtgtcagttagggtgtggaaagtccccaggctccccagcaggcagaagta tgcaaagcatgcatctcaattagtcagcaaccaggtgtggaaagtccccaggctcccca gcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccatagtcccgccct aactccgcccatcccctaactcccgcccagttccgcccattctccgcccatggct gactaattttttttatttatgcagaggccgaggc
  • the construct may comprise a nucleic acid sequence substantially as set out in SEQ ID No.8, or a functional fragment or variant thereof.
  • the construct (referred to herein as pRRLsc CMV eGFP) may comprise a lentivector backbone, the nucleic acid sequence of which is substantially set out as SEQ ID No: 9. gtacctttaagaccaatgacttacaaggcagctgtagatcttagccacttttttaaaag aaaggggggactggaagggctaattcactcccaacgaagacaagatctgctttttgc ttggttagaccagatctgagcctgggagctctctggctaacta gggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgtgtg ccctggtaggtaacta gggaacccactgcttaagcctcaataaa
  • the construct may comprise a nucleic acid sequence substantially as set out in SEQ ID No.9, or a functional fragment or variant thereof.
  • the transgene may be any gene encoding a protein, which may have therapeutic or industrial utility.
  • the transgene may encode dystrophin, a blood coagulation factor, insulin or a cytokine receptor sub-unit.
  • the host cell may be a prokaryotic or eukaryotic cell.
  • the host cell may be an animal cell.
  • the host cell may be a cell from a vertebrate, mammal or domestic animal, and is preferably a human cell.
  • the host cell is a progenitor or stem cell, which may be either pluripotent or totipotent.
  • the host cell may be a haematopoietic stem cell (HSC).
  • the host cell may be either an embryonic, foetal or adult stem cell.
  • the host cell may be in a cell culture, or may be in situ in a host organism, for example a subject to be treated.
  • CHO cells are preferred host cells.
  • the Chinese hamster ovary cell line was originally derived from an in-bred female laboratory animal in 1957 (Tjio et ah, 1958). The cells descend from a spontaneously
  • CHO cells are the cell line of choice for the production of many therapeutic biopharmaceuticals, as they are capable of performing human-compatible post-translational modifications as well as yielding several grams of protein per litre.
  • Another feature increasing the attractiveness of CHO cells for human protein production is their resistance to infection by many human viruses, including HSV and HIV-i, due to lack of viral entry receptors.
  • Regulation of cell cycle in CHO cells may be achieved by allowing them to reach a stationary growth phase, which can be used to induce an arrest in the d phase when prolonged for up to 8o hours (Tobey et al., 1970).
  • the cells resume an exponential growth phase following dilution.
  • the cells may be induced to re-enter cycling by the introduction of isoleucine and glutamine to the medium, which were then deemed as essential for growth of the cells.
  • the preferred host cell for the method of the invention may be CHO-Ki, which is a sub-clone of the parental CHO cell line created by single cell cloning in 1957 (Puck et al., 1958).
  • the karyotype of this cell line is very different to the wild-type Chinese hamster, and only 8 of the 22 chromosomes in the cells are equivalent to wt chromosomes (Wurm et ah, 2011).
  • the modal chromosome number of this cell line is 20, although again this varies between sub-clones (Kao et al, 1970).
  • the method of the first aspect and the host cell of the second aspect may be used as a means for expressing and producing proteins on a commercial scale.
  • a culture of host cells may be grown in a reactor, which may be run in either batch or continuous culture to produce the protein.
  • the protein may then be subsequently isolated.
  • the specific culture conditions and growth medium will depend on the type of host cell being grown and on the type of transgene being expressed.
  • the period of time required to induce the mitotic block in the host cell and the means by which mitosis is blocked (e.g. methionine depletion) will depend on the type of host cell.
  • the intervention to induce cell cycle arrest may vary in nature (e.g. cytokine withdrawal) and timing (e.g. cells may already quiescent).
  • the host cell may be used in therapy or diagnosis.
  • the host cell according to the second aspect for use in therapy or diagnosis.
  • Lentiviral vectors are currently the vector of choice for many primary
  • lentivectors are also the vector of choice for targeting the central nervous system, and for the treatment of diseases such as spinal muscular atrophy and Parkinson's disease.
  • a fourth aspect there is provided use of the host cell according to the second aspect, for treating an immunodeficiency disorder, a blood clotting disorder, a central nervous system (CNS) disorder, spinal muscular atrophy, or Parkinson's disease.
  • an immunodeficiency disorder a blood clotting disorder, a central nervous system (CNS) disorder, spinal muscular atrophy, or Parkinson's disease.
  • CNS central nervous system
  • a method of treating, ameliorating or preventing an immunodeficiency disorder, a blood clotting disorder, a central nervous system (CNS) disorder, spinal muscular atrophy, or Parkinson's disease, in a subject comprising administering, to a subject in need of such treatment, a therapeutically effective amount of the host cell according to the second aspect.
  • CNS central nervous system
  • a clotting disorder may be treated by ex vivo treatment of haematopoietic stem cells (HSCs).
  • HSCs haematopoietic stem cells
  • SCID-Xi X-linked severe combined immunodeficiency
  • HSC gene therapy using an integrating lentivirus vectors encoding the gamma-chain of the IL2 receptor.
  • significant instances of haematological malignancies have arisen due to vector integration and insertional mutagenesis. Therefore, a therapeutic application using the methods of the invention involving the replicating episome (i.e.
  • non-integrating vector technology would be highly advantageous by using IDLVs expressing the gamma-chain of the IL2 receptor, coupled with cell cycle arrest to stably transduce the HSCs from SCID-Xi patients.
  • the transduced stem cells may then be infused back into the patient to reconstitute the bone marrow and immune systems, but with a much reduced risk of integration and subsequent leukaemia induction.
  • the host cell may be a stem cell, for example a haematopoietic stem cell.
  • the construct may comprise a transgene, which encodes the gamma-chain of the IL2 receptor.
  • a "subject" may be a vertebrate, mammal, or domestic animal.
  • the host cell according to the invention may be used to treat any mammal, for example livestock (e.g. a horse), pets, or may be used in other veterinary applications. Most preferably, however, the subject is a human being.
  • a "therapeutically effective amount" of the host cell is any amount which, when administered to a subject, is the amount of medicament or drug that is needed to treat the disease condition, or produce the desired effect.
  • nucleic acid or peptide or variant, derivative or analogue thereof which comprises substantially the amino acid or nucleic acid sequences of any of the sequences referred to herein, including functional variants or functional fragments thereof.
  • substantially the amino acid/nucleotide/peptide sequence can be a sequence that has at least 40% sequence identity with the amino acid/ nucleotide/peptide sequences of any one of the sequences referred to herein, for example 40% identity with the nucleotide sequence identified as SEQ ID No:8 (i.e.
  • pRRLsc SV40 eGFP DNA or 40% identity with the nucleotide identified as SEQ ID No: 9 (i.e. pRRLsc CMV eGFP DNA), and so on.
  • Amino acid/polynucleotide/polypeptide sequences with a sequence identity which is greater than 50%, more preferably greater than 65%, 70%, 75%, and still more preferably greater than 80% sequence identity to any of the sequences referred to are also envisaged.
  • the amino acid/polynucleotide/polypeptide sequence has at least 85% identity with any of the sequences referred to, more preferably at least 90%, 92%, 95%, 97%, 98%, and most preferably at least 99% identity with any of the sequences referred to herein.
  • an alignment of the two sequences must first be prepared, followed by calculation of the sequence identity value.
  • the percentage identity for two sequences may take different values depending on:- (i) the method used to align the sequences, for example, ClustalW, BLAST, FASTA, Smith-Waterman (implemented in different programs), or structural alignment from 3D comparison; and (ii) the parameters used by the alignment method, for example, local vs global alignment, the pair-score matrix used (e.g. BLOSUM62, PAM250, Gonnet etc.), and gap-penalty, e.g. functional form and constants.
  • percentage identity between the two sequences. For example, one may divide the number of identities by: (i) the length of shortest sequence; (ii) the length of alignment; (iii) the mean length of sequence; (iv) the number of non-gap positions; or (iv) the number of equivalenced positions excluding overhangs. Furthermore, it will be appreciated that percentage identity is also strongly length dependent. Therefore, the shorter a pair of sequences is, the higher the sequence identity one may expect to occur by chance.
  • acid/polynucleotide/polypeptide sequences may then be calculated from such an alignment as (N/T)*ioo, where N is the number of positions at which the sequences share an identical residue, and T is the total number of positions compared including gaps but excluding overhangs.
  • Alternative methods for identifying similar sequences will be known to those skilled in the art.
  • a substantially similar nucleotide sequence will be encoded by a sequence which hybridizes to the sequences shown in SEQ ID No's: 1-9, or their complements under stringent conditions.
  • stringent conditions we mean the nucleotide hybridises to filter-bound DNA or RNA in 3x sodium chloride/ sodium citrate (SSC) at approximately 45°C followed by at least one wash in o.2x SSC/ 0.1% SDS at approximately 20-65°C.
  • a substantially similar polypeptide may differ by at least 1, but less than 5, 10, 20, 50 or 100 amino acids from the sequences referred to herein.
  • nucleic acid sequence described herein could be varied or changed without substantially affecting the sequence of the protein encoded thereby, to provide a functional variant thereof.
  • Suitable nucleotide variants are those having a sequence altered by the substitution of different codons that encode the same amino acid within the sequence, thus producing a silent change.
  • Other suitable variants are those having homologous nucleotide sequences but comprising all, or portions of, sequence, which are altered by the substitution of different codons that encode an amino acid with a side chain of similar biophysical properties to the amino acid it substitutes, to produce a conservative change.
  • small non-polar, hydrophobic amino acids include glycine, alanine, leucine, isoleucine, valine, proline, and methionine.
  • Large non- polar, hydrophobic amino acids include phenylalanine, tryptophan and tyrosine.
  • the polar neutral amino acids include serine, threonine, cysteine, asparagine and glutamine.
  • the positively charged (basic) amino acids include lysine, arginine and histidine.
  • the negatively charged (acidic) amino acids include aspartic acid and glutamic acid. It will therefore be appreciated which amino acids may be replaced with an amino acid having similar biophysical properties, and the skilled technician will known the nucleotide sequences encoding these amino acids.
  • FIG. 1 shows embodiments of transfer plasmids used for making each of the three lentiviral vectors used in the method of the invention.
  • the packaging plasmid during vector production contained the D64V mutation in the Integrase gene, resulting in integration-deficient lentiviral vectors (IDLVs).
  • IDLVs integration-deficient lentiviral vectors
  • FIG. 2 shows stress-induced DNA duplex (SIDD) analysis of l-LTR and 2-LTR circular episomes derived from a standard IDLV vector does not reveal significant differences.
  • the strand separation potential profiles are shown for l-LTR (A) and 2- LTR (B) circles for IDLV SV40 eGFP. Both forms can be expected to be formed in vitro after transduction.
  • the length of the LTR region (shown in red) does not influence the strand separation potential for the remaining sections of the episome.
  • G(x) average free energy of all states x in which the base pair separates against bp position for each episome.
  • X axis length of construct in bp starting at the beginning of the (first) LTR;
  • Figure 3 shows SIDD analysis reveals the destabilising and condensing effects of S/MAR elements on l-LTR IDLV episomes.
  • the promoters and Ori regions produce the highest destabilisation potential.
  • the SIDD potential of these regions is reduced in favour of the miniMAR, particularly in the nearby SV40 promoter/ Ori (red arrow).
  • Addition of the full-length S/MAR element (C) results in a typical periodically destabilised region (green line), whilst the SV40 promoter (red arrow) remains condensed to the same level as in construct B.
  • G(x) average free energy of all states x in which the base pair separates against bp position for each episome.
  • X axis length of construct in bp;
  • Figure 4 shows the results of plating CHO cells, transduced with IDLV vectors or mock control after 1 day, and then treated with methionine-free medium from Day 2 to Day 7, over a 5 day period.
  • D7 cultures were returned to normal growth medium and allowed to proliferate as normal with routine passaging as required.
  • cell cycle phase analyses were performed by propidium iodide staining and flow cytometry at D7, at the end of the methionine depletion period.
  • the coloured sections indicate the average percentages of cells in each cell cycle phase (i.e. Gi, S and G2) as determined by PI staining followed by FlowJo analysis of the data.
  • the cell cycle phases determined to differ significantly between treatments are denoted with *, as indicated by Student's t-test comparing each phase at D7.
  • Cells were induced to undergo transient cell cycle arrest by methionine and serum depletion of the culture media at D2 (A and C) or allowed to proliferate freely (B and D). From D7, all cells were allowed to proliferate normally with routine passaging for a period up to D72.
  • IDLV-SG IDLV SV40 GFP
  • IDLV-SGm IDLV SV40 GFP mMAR
  • IDLV-CG IDLV CMV GFP
  • the cells were subjected to 5 days of methionine and serum depletion, allowed to proliferate for 100 days, and then subjected to dilution cloning in 96-well plates. After 14 days, 12 GFP+ clones were expanded to establish cell lines, and evaluated by flow cytometry.
  • Figure 7 shows the results of CHO cell lines derived by dilution cloning of mixed parent populations transduced with IDLV-SG vector and subjected to transient cell cycle arrest (clones 4, 7 and 10). The cells were maintained in continuous
  • Figure 8 Genomic DNA was prepared from the stably GFP+ CHO clones derived from transduction and transient cell cycle arrest with IDLV-SG (tracks 1, 2 &3), IDLV-SGm (tracks 4, 5 &6) and IDLV-CG (tracks 7, 8 & 9), and from a polyclonal population transduced with integrating LV-SG (track 10).
  • the DNA was subject to LAM-PCR as described in Fig 5.11, and the final products were analysed by agarose- EtBr gel electrophoresis. Track 1 shows a 100 bp marker ladder.
  • Dominant bands at 280 bp correspond to LTR to vector backbone junctions present in all vector forms, 180 bp bands (blue boxes) correspond to LTR- LTR junctions only present in 2-LTR circles.
  • the integrating clonal control (track 10) shows a smear of bands of varying sizes, as expected;
  • Figure 9 shows the majority of reads generated by high-throughput sequencing contain only vector sequences. Sequences from samples resulting in > 400 independent sequence reads were analysed and all SV40 promoter -containing clones were found to contain mostly vector DNA. IDLV3 clones 2 & 12 and the positive ICLV control also contained non-vector DNA. Vi: IDLV SV40 GFP, V2: IDLV SV40 GFP mMAR, V3: IDLV CMV GFP;
  • Figure 10 shows Quantitative Real-Time PCR results indicate vector genomes persist in copy numbers of 1-15 per cell.
  • A 4 independent qRT-PCR reactions were run to quantify the amount of episomes present in transduced CHO cells. Primer binding sites are shown with black arrows. From the absolute quantities of these signals, the comparable amounts of i-LTR, 2-LTR and backbone signals per cell were calculated and are shown in (B). The numbers of backbone signals (grey bars) can be used as an estimate for the number of vector genomes per cell.
  • the 3 controls (IDLV and ICLV harvested 24 post-transduction and ICLV clonal population in 3 lanes on right) resulted in very high backbone (BB) and i-LTR signal.
  • BB backbone
  • Vector 3 The 3 clones transduced with IDLV CMV eGFP (Vector 3) produced high levels of 2-LTR signal.
  • Vector 1 IDLV SV40 eGFP
  • vector 2 IDLV SV40 eGFP mMAR
  • vector 3 IDLV CMV GFP.
  • Figure 11 shows Southern blotting of DNA from IDLV-transduced CHO cells indicates several clones containing episomal vectors. High molecular weight DNA was harvested from cells transduced with vectors, and digested with either EcoRI or Xhol (mMAR-containing vector only).
  • Figure 12 shows fluorescent in situ hybridisation analysis of transduced cells supports the hypothesis that a majority of vector genomes remain episomal.
  • B CHO cell line transduced with IDLV SV40 eGFP, Clone 4, and
  • C CHO cell line transduced with IDLV SV40 eGFP mMAR, Clone 11. Examples
  • 293T cells were seeded at 3 x 10 6 cells per plate on 15 cm 2 plates, and were transfected 2 days later having reached ⁇ 90% confluency. The media was replaced with 20 ml fresh media (DMEM + glucose + 10% FBS + 2% pen/ strep) 2 h before transfection.
  • the DNA mix was prepared in a molar ratio of 1:1:1:2 using 12.5 g pMDLg/pRRE or pMDLg/ pRREintD64V, 6.25 g pRSV-REV, 7 g pMD2.VSV-G and 32 g of either pRRLsc SV40 eGFP, pRRLsc SV40 eGFP mMAR or pRRLsin PPT CMV eGPF WPRE transfer plasmid (all plasmids from the Yanez group).
  • FIG. 1 Diagrammatic representation of the transfer plasmids is shown in Figure 1. This was made up to a total volume of 112.5 ⁇ with TE buffer and then 1012.5 ⁇ water was added to make 0.1 x TE. 125 ⁇ 2.5 M CaCl 2 was added, the solution vortexed and incubated for 5 min at room temperature. Then, 1250 ⁇ 2 x HBS was added dropwise while vortexing the DNA/ CaCl 2 mix at full speed. This mixture was then added to cells and the cells returned to incubators set at 37°C, with 5% C0 2 . 16 h after transfection the media was removed and replaced with 18 ml fresh media per plate. The supernatant containing lentivector particles was harvested on days 2 and 3 post- transfection.
  • HeLa cells were chosen for the IDLV titration by flow cytometry for GFP expression, as the expression kinetics from IDLV episomes is slower than that from ICLVs and a fast-growing cell line may result in excessive dilution of the gene product (Wanisch, K, Yanez-Munoz, RJ (2009), Mol Ther 17(8): 1316-1332). HeLa cells are further slowed down by the polybrene used to aid transduction, therefore they were used for all GFP titrations of IDLVs in this work. The cells were seeded at 10 5 cells per well in 2 ml medium on 6-well plates. The next day, 10-fold vector dilutions were made in full DMEM, ranging from 10-3 to 10 6 .
  • 6-well plates were seeded with 10 5 HeLa cells per well in 2 ml medium.
  • the cells were transduced the next day with 1 ml of 5x1 ⁇ 4 and 5x1 ⁇ 5 dilutions of vector preps (Multiplicity of infection (MOIs) 0.5 and 0.05 for a io 8 /ml vector) and 1 ml of DMEM with 16 g/ml polybrene (Sigma) and a mock control.
  • MOIs Multiple of infection
  • DMEM fetal cal fetal
  • DMEM 16 g/ml polybrene
  • a mock control 24 h after transduction, cells were harvested and DNA was prepared with DNeasy tissue kit (Qiagen). Quantitative Real-time PCR reactions were set up using ABI universal master mix (2X) and corresponding primer/probe concentrations. Standards (in triplicate) were made in mock cell extract. Samples were measured in duplicate. In the negative control (duplicate) Qiagen DNA elution buffer AE was used instead of cell extract.
  • Reverse primer 5'-CAGCGGAACCGCTCATTGCCAATGG-3' SEQ ID No: 11
  • Probe 5'-(VIC)-ATGCCCTCCCCCATGCCATCCTGCGT-(TAMRA)-3' SEQ ID No: 12
  • Reaction volume was 25 ⁇ , sample volume 5 ⁇ , primer concentration 900 nM, probe concentration 200 nM.
  • Lentiviral backbone qPCR (Bushman's late reverse transcript reaction (Miller et al, 1997)): Forward primer 5 ' -TGTGTGCCCGTCTGTTGTGT-3' (SEQ ID No: 13), reverse primer 5' GAGTCCTGCGTCGAGAGAGC-3' (SEQ ID No: 14).
  • Reaction volume 25 ⁇ , sample volume 6.25 ⁇ , primer concentration 300 nM, Standards: IO-IO? copies of pHR'SIN-cPPT-SEW/reaction.
  • the cells were stored in liquid N 2 after ⁇ 70 days. For the control cells not undergoing quiescence, transduction was done as above. 24 h post-transduction, one well per vector was analysed for GFP expression and cell cycle phase by flow cytometry. Cell cycle and GFP expression analyses were repeated 4 days later, and following this the cells were cultured normally by splitting 3 times a week and measuring GFP expression by flow cytometry at least once a week. Cultures were discontinued after ⁇ days and cells stored in liquid N 2 .
  • IDLV SV40 eGFP 1 cell population for IDLV SV40 eGFP, IDLV SV40 eGFP mMAR and IDLV CMV eGFP each was retrieved from liquid N 2 and cultured for ⁇ 14 days prior to cloning.
  • Cells were seeded on 96-well plates at a density of 0.7 cells/well in 100 ⁇ media containing 50 ⁇ fresh DMEM + Pro + PenStrep +10% FCS, and 50 ⁇ CHO cell conditioned media.
  • Conditioned media was taken from 24-hour old untransduced CHO cell cultures and filtered through ⁇ .2 ⁇ syringe filters.
  • CHO-Ki cells were prepared for cell cycle analysis by staining with PI, as follows: approximately lxio 6 cells were trypsinised and spun down at 800 rpm for 4 min. The supernatant was discarded and the cells resuspended in the remaining drops of medium by gently flicking the tube. 1 ml of Solution I was added into each tube while shaking and cells incubated at room temperature in the dark for 30 min. 1 ml of
  • the quantification of episomes in transduced CHO cells was carried out by Real- Time PCR using the Roche LightCycler 480 system. 100 ng of high molecular weight genomic DNA in 2 ⁇ was used as a template in each reaction. 10 ⁇ of reaction mix contained 300 nM of each primer and 5 ⁇ Absolute Blue qPCR SYBR Green 2X Buffer (Thermo Scientific). Primers were as described in Table 1 below.
  • Linear amplification-mediated PCR is a highly sensitive method that can be used to identify unknown sequences flanking known sequences (Schmidt et ah, 2007).
  • the protocol consists of a linear PCR with a biotinylated primer, and the resulting product is purified using streptavidin-coated magnetic beads.
  • a second strand is synthesised using random hexanucleotide primers and Klenow fragment of DNA polymerase, and the double-stranded product is digested with a suitable restriction enzyme that cuts within ⁇ 200 bp from the 1 st primer into the vector sequence and at unknown sites into the genomic DNA.
  • a unidirectional double- stranded linker is ligated to the sticky end created by the restriction enzyme.
  • the DNA is denatured using NaOH and subsequently subjected to two exponential nested PCR reactions to achieve maximum amounts of specific product.
  • the first set of primers bind to the linker cassette and 5'biotinylated vector, the second set bind to linker cassette and vector sequence (LTR).
  • the products can be visualised on an agarose gel and compared to expected fragment lengths, and sequenced either by extracting the bands from the gel or by conventional shotgun cloning and sequencing (Gabriel et al, 2009; Schmidt et al, 2007).
  • LAM-PCR was performed on all clonal cell line hmw DNA, with integrating clone 6 as a positive control and DNA from CHO cells transduced with IDLV SV40 eGFP and harvested 24 h post-transduction as a negative control.
  • the protocol was performed as previously published (Schmidt et ah, 2007).
  • the LAM-PCR reactions were carried out by the author in Christof Von Kalle's laboratory at the National Centre for Tumour Diseases at the German Cancer Research Institute in Heidelberg, Germany.
  • the subsequent Deep sequencing was carried out in the same laboratory using the Roche 454 sequencing system.
  • the bioinformatic analysis of the results was performed by Dr Uwe Appelt. Linear PCR
  • Each reaction contained 2 ⁇ of hmw DNA ([c] 250 ng/ ⁇ ), 2.5 ⁇ ⁇ Taq Buffer (Qiagen), 1 ⁇ dNTPs (10 ⁇ each ,Fermentas), 0.25 ⁇ Taq (Qiagen), 0.5 ⁇ Primer LRT 543 bio (0.5 pmol/ ⁇ ), and water to a total volume of 25 ⁇ .
  • the PCR reaction was performed as follows: 95°C for 2 min, 95°C for 45 s, 58°C for 45s, 72PC for 1 min, steps 2-4 repeated 50 times, 0.25 ⁇ Taq added, Steps 2-4 repeated 50 times,72°C for 5 min.
  • the product was digested with TSP509I, which cuts ⁇ 2io bp into the vector sequence from the 1 st primer in a LTR-backbone or LTR-genome junction, and -105 bp into the second LTR sequence in a LTR-LTR junction.
  • Each reaction contained 2 ⁇ of product from the linear PCR reaction, together with 2.5 ⁇ ⁇ Taq Buffer (Qiagen), 0.5 ⁇ dNTPs (10 ⁇ each), 0.25 ⁇ each primer (SK4 LTR bio and LC-i), 0.25 Taq (Qiagen) and water to 25 ⁇ .
  • the reaction conditions were the same as above, but repeated only for 35 cycles.
  • 1 ⁇ product from previous reaction was used as a template for primers HIV LTR 566 and LC II.
  • the products of the reaction were visualised on a Spreadex gel (Elchrom Scientific). They were also subjected to sequencing using the Roche 454 system, creating an average of ⁇ 1200 independent sequence reads per sample.
  • Southern blotting is a method for detecting specific DNA sequences present within a DNA sample.
  • the DNA samples are usually digested using restriction enzymes, and the fragments are separated by size by agarose gel electrophoresis.
  • the DNA fragments are transferred onto a membrane using capillary transfer, and the membrane is then exposed to a hybridisation probe which is labelled to enable detection.
  • the probe is designed to be complimentary to the DNA sequence of interest (Southern, 1975). Digestion of mammalian genomic DNA
  • a mixture was made up of 1 g DNA ladder, 2 ⁇ ⁇ NTB, 4 ⁇ CTG, 1 ⁇ (io ⁇ (3 ⁇ 4 [ ⁇ - 32P] dATP, 1 ⁇ Klenow, water was added to 20 ⁇ , and the mix incubated at RT for 90 min. 40 ⁇ of TE was then added to stop reaction.
  • a Microspin S-300HR column was packed by spinning at 3003g for 1 min. Sample was loaded on column and centrifuged at 3000 g for 2 min. Approximately 15 Geiger counts of ladder were loaded per lane. Remaining hot ladder was stored at -20°C.
  • a 0.7% agarose gel was cast in lx TAE with ethidium bromide. The gel was loaded with 10 ⁇ g of digested genomic DNA per lane and hot DNA ladder. The gel was run in TAE with ethidium bromide overnight in at 35V, constant voltage.
  • the membrane was retrieved and agitated in 0.4 M NaOH for 1 min followed by 0.2 M Tris-CIH pH 7.5, 1 x SSC for 1 min. It was washed with 2xSSC and DNA cross-linked to membrane using Stratagene UV crosslinker. PCR for eGFP Probe
  • PCR was performed to create a 717 bp fragment of the eGFP gene. Plasmid pRRLsc SV40 eGFP was used as template. Forward primer: 3'ATG GTG AGC AAG GGC GAG (SEQ ID No: 28), reverse primer: 3'CTT GTA CAG CTC GTC CAT (SEQ ID No: 29). The reaction was set up with an annealing temperature of 56 °C and a total of 35 cycles. Probe labelling by random priming
  • 100 ng of DNA fragment to be labelled was made up to 4 ⁇ with TE, 1 ⁇ of 60 ng/ ⁇ dN6 was added, the mixture boiled for 5 min, and cooled on ice for 2 min.
  • Membrane was pre-hybridised with 15 ml Church mix at 68 °C for at least 1 h.
  • Labelled probe was boiled for 5 min, transferred to ice for 2 min, and added to hybridisation tube. The reaction was left to hybridise overnight. The membrane was washed with 2xSSC, 0.5% SDS at 65°C 3 times quickly and 3 x 10 min washes. Finally it was washed with 2xSSC and exposed to Phosphoimager screen.
  • FISH probes were prepared for each vector by labelling the corresponding transfer plasmid, each containing around at least 3 kb complementary DNA, with
  • Probe mixes were prepared for FISH by adding Cot-i DNA to each labelled probe (50X the weight of probe) and then 2x the total volume 100% ethanol.
  • the probes were pelleted and dried using Speedy Vac apparatus and Savant Centrifuge / concentrator. The dry pellets were resuspended in Abbott LSI/WCP Hybridisation buffer at a concentration of 6.7 ng/ ⁇ and stored in the dark at -20°C.
  • the slides were incubated for 2 min at RT in 4x SSC/0.05% Tween pH 7.0, and then rinsed 3 times with PBS for 2 min each time. After the final PBS wash, the slides were air dried and 15 ⁇ of the nuclear stain DAPI (Cytocell,i6o ng/ml) was applied together with a new cover slip, which was then sealed with nail varnish. Imaging and analysis of FISH signals
  • the ratio of signals inside nuclei versus outside nuclei was calculated for each field, to account for variation within different regions of the slide.
  • the number of signals per nucleus was calculated as the number of "in” signals per field minus the number of nuclei without signals.
  • Statistical analyses were performed on A) the ratio of signals inside v outside nuclei, using oneway ANOVA and comparing "true" samples to the negative control, and B) the number of signals per nucleus on each slide using one-way ANOVA. Results
  • Circularisation can occur by homologous recombination between the two LTRs, or the linear DNA can be circularised by non-homologous end-joining. In this way, circles containing either one or two copies of the LTR are formed.
  • l-LTR circles have been found to be several-fold more common than 2-LTR circles in vivo, although non-integrating vectors may produce comparatively more 2- LTR forms (Bayer et ah, 2008).
  • S/MAR elements have been shown to need read-through transcription to function effectively, there were two theoretically possible locations within the vector cassette; immediately after the eGFP gene, or after the Gag gene but relying on residual promoter activity from the LTR. Two different S/MAR elements were analysed for strand separation potential; the full-length ⁇ -interferon S/MAR and its shortened mutant daughter element, miniMAR.
  • Example 2 Optimisation of induced cell cycle arrest for lentiviral transduction Following the IDLV transduction, half of the cells were induced by methionine and serum depletion to enter a reversible period of cell cycle arrest.
  • the cell cycle phase analysis was performed using propidium iodide staining of the nuclei followed by flow cytometric analysis and computer analysis of the resulting data.
  • CHO cell cultures transduced with various IDLVs were induced to undergo transient cell cycle arrest by methionine and serum depletion of the culture media.
  • Cells were plated, transduced after 1 day, and then treated with methionine-free medium from D2 to D7 over a 5 day period.
  • D7 cultures were returned to normal growth medium and allowed to proliferate as normal with routine passaging as required.
  • cell cycle phase analyses were performed by propidium iodide staining and flow cytometry at the D2 and D7 time points, effectively before and after the methionine depletion period.
  • MOI multiplicity of infection
  • the virus/media mixture included polybrene at a final concentration of 8 g/ml, to aid transduction by neutralising the charge repulsion between the virions and the cell surface (Davis et ah, 2004).
  • the cells were incubated at 37°C, and GFP expression in the transduced cells was measured 24 h and 72 h post-transduction by flow cytometry. MOI of 1 was found to be sufficient to give > 90% eGFP positive CHO cells.
  • Example 4 A period of induced cell cycle arrest results in high stable transduction of CHO cells bv IDLVs
  • the highest retention levels were achieved by the IDLV SV40 eGFP vector, with an average of 25% of cells remaining GFP-positive after 72 days in culture.
  • the same vector but including the mMAR element resulted in slightly lower levels of eGFP expression, at an average of 15 % positive cells after 72 days.
  • the differences in transgene expression levels for the IDLV SV40 eGFP and IDLV SV40 eGFP mMAR vectors, between the cells held quiescent and in continuous culture, were highly statistically significant (P ⁇ 0.001, One-way AN OVA and Tukey's Test for pairwise comparison, including the last 3 data points, n 3.)
  • the transgene-expressing percentage began to rise after ⁇ 35 days in culture, increasing from an average of 1% to 4% over the course of a month.
  • the three cell populations simultaneously transduced with IDLV SV40 eGFP and initially held quiescent had diverged in the percentage of GFP-expressing cells by more than 3-fold and contained 45 %, 20 % and 12 % GFP positive respectively.
  • Example - High transduction of CHO cells by IDLVs following a period of cell cycle arrest is a clonally stable phenomenon
  • dilution cloning was performed for cells transduced with each of the 3 vectors. 14 days after seeding, 35 out of 82 colonies (43%) for IDLV SV40 eGFP and 17 out of 124 colonies (14%) for IDLV SV40 eGFP mMAR were expressing eGFP. Since the total cell population transduced with IDLV CMV eGFP was initially only 11% positive, two rounds of dilution cloning was required to obtain a sufficient number of positive clones. Twelve eGFP-positive colonies for each vector were expanded to obtain clonal populations, and analysed for eGFP expression and Mean Fluorescence Intensity (MFI) by flow cytometry.
  • MFI Mean Fluorescence Intensity
  • Clonal cell lines derived from the population transduced with IDLV CMV eGFP showed a tendency towards a decline in eGFP expression. Initially, the clonal populations were 63%, 93% and 99% GFP positive, and by day 50 post-cloning the expression had increased up to 76% in the first clone, and declined to 83% in both other clones. This is in line with the observations from the polyclonal population, where one population also showed an increase and the other two showed a decrease in eGFP expression.
  • Example 6 Evaluation of episomal status of IDLV genomes in CHO cell clones stably transduced following a period of induced cell cycle arrest
  • FISH Fluorescent In Situ hybridisation
  • Southern blotting was used to assess vector digest patterns in the highly expressing clonal populations, but it is not sensitive enough to be used for the polyclonal populations.
  • linear amplification-mediated PCR was used to amplify regions adjacent to the LTRs, which were then subjected to sequencing to distinguish the vector's genome from the host's genome.
  • Example 7 Agarose gel analysis and high throughput sequencing of LAM-PCR products amplified from DNA from IDLV-transduced CHO cell clones
  • Linear amplification -mediated PCR is a method whereby unknown DNA sequences adjacent to a known sequence can be amplified for sequencing. It is generally used for analysing lentivector integration sites, and in the case of IDLVs it can be used to detect the proportional frequency of integrants and episomal forms. This method was used to analyse the 3 distinct clonal populations for each of the 3 vectors shown in Figure 7. Each sample was subjected to an initial linear PCR reaction starting from the LTR, followed by second strand synthesis.
  • the strands are then digested with a restriction enzyme that cuts approximately at 210 bp if the strand was synthesised from an LTR towards the vector genome, or -105 bp if it was synthesised from an LTR joined to another LTR, and at a variety of lengths when the LTR is joined to the host genome.
  • Two of the IDLV SV40 eGFP mMAR clones (8 and 11) also gave bands corresponding to the LTR- vector genome junction, although clone 11 also has a second band indicating a possible integrant.
  • the single band in the lane for IDLV SV40 eGFP mMAR clone 5 does not correspond to either the l-LTR or the 2-LTR band sizes.
  • the PCR products from LAM-PCR were subjected to high throughput sequencing, resulting in an average of 1200 reads per sample.
  • IDLV SV40 eGFP clone 10 and IDLV SV40 eGFP mMAR clone 8 did result in some BLAST hits, however these were excluded after further analysis established them as too partial and fragmented to be likely true matches. Of all the IDLV samples, only IDLV CMV eGFP clone 2 contains a likely integrant, at a site corresponding to the murine
  • chromosome 4 The integrating control sample resulted in high read counts for 2 integration sites, one corresponding to the murine chromosome 1 and the other to chromosome 2.
  • the 1 read for the same site discovered in IDLV CMV eGFP clone 12 is likely to be contamination from the adjoining lane.
  • the sequences corresponding to loci in the murine chromosomes l, 2 and 4 were verified by BLAST analysis to be present also in the CHO cells. As the genome is not annotated, no information could be retrieved regarding the location of these sites (Xu et al, 2011).
  • Genomic DNA from the stably GFP+ CHO clones and cells transduced with an integrating LV was subject to LAM-PCR.
  • the products were analysed by high- throughput deep sequencing followed by BLAST analysis of all generated sequences against the vector genome and the mouse genomic sequence as the closest available sequenced relative of the Chinese hamster.
  • the table shows numbers of successful sequencing reads per sample (Total Reads), and numbers of reads containing only vector sequences (Blue) and other sequences verified by BLAST analysis against the murine genome (Red).
  • the green column indicates the corresponding location of the BLAST result in the mouse genome.
  • Example 8 Copy number and conformation analysis of vector genomes IDLV- transduced CHO cells by Quantitative Real-Time PCR
  • qRT-PCR quantitative real-time PCR
  • the quantities of these 3 sequences were normalised to the amount of cellular DNA present in each sample by quantifying the amount of CHO ⁇ - actin.
  • High molecular weight DNA from both polyclonal and clonal cell populations was subjected to all 4 qRT-PCR reactions, and the copy number of each of the vector sequences was then calculated per cell using ⁇ -actin data to estimate number of cell equivalents per sample (Figure 10 B).
  • Each vector genome is expected to produce one backbone (BB) signal, one or two LTR signals, and one or none LTR-to-LTR signals, depending on the conformation and integration status.
  • the amount of BB signal can be used to estimate vector copy number and the ratios of the 3 independent vector signals can be used to infer conformation and integration status.
  • Figure 10 B shows the amounts of the 3 independent vector signals as calculated per cell equivalent. Most samples resulted in low amounts of vector signal,
  • the 3 polyclonal samples indicated average vector copy numbers of 0.6/cell for IDLV CMV eGFP, 1.1/cell for IDLV SV40 eGFP mMAR and 1.6/cell for IDLV SV40 eGFP, which reflects the differing percentages of eGFP-expressing cells in these populations at the time of investigation ( Figure 4 C).
  • the clonal populations transduced with IDLV SV40 eGFP averaged 2.8 (Clone 4), 0.6 (Clone 7) and 1.1 (Clone 10) backbone copies per cell.
  • the average backbone copy numbers were 0.1 (Clone 5), 4.8 (Clone 8) and 6.0 (Clone 11) per cell.
  • the average BB copy numbers for clonal populations derived from IDLV CMV eGFP -transduced cells were 4.4 (Clone 2), 1.8 (Clone 10) and 1.4 (Clone 12) signals per cell.
  • the qPCR data was used to provide information on vector genome conformation. This was based on the following principles: i) If the vector has integrated via the integrase-mediated pathway, two copies of the LTR signal should be present for each of the backbone signals, with no LTR-to-LTR signal present (first row of Table 3).
  • the ratio of LTR to backbone signals should be 1:1 with no LTR-to-LTR signal present (second row of Table 3).
  • the vector is present mostly as 2-LTR episomes, each vector genome should produce one LTR- LTR signal, two LTR signals, and one backbone signal (third row of Table 3). The ratios of l-LTR and 2-LTR signals per copy of backbone signal were calculated for each vector (Table 3). Only one sample produced a ratio suggesting a possible Integrase-mediated integration event; IDLV SV40 eGFP clone 4 gave a ratio of 2:1 of LTR:BB (2.07:1 averaged over all data points). The remaining clones produced ratios indicative of either l-LTR or 2-LTR episomes.
  • Southern blotting is a method that can be used to detect the presence and abundance of a known DNA sequence within a sample, as well as inspecting the integration status of the sequence by probing DNA digested with a restriction enzyme.
  • a restriction enzyme that cuts once within the vector genome and separated on an agarose gel.
  • the DNA was then transferred onto a membrane and probed with a radioactive probe. If episomal, the resulting bands should correspond to the expected size of the episome; if integrated, each integration event should produce a band not likely to correspond to the expected episome size.
  • the results show multiple integration sites in the clonal control transduced with integration-competent SV40 eGFP control vector ( Figure 11, lane 1).
  • the controls in lanes 2 and 3 contain DNA was harvested 24 hours after transduction with IDLV SV40 eGFP and ICLV SV40 eGFP, and both show bands corresponding to i-LTR and 2-LTR circles.
  • Lanes 4-6 contain DNA from clonal populations transduced with IDLV SV40 eGFP; clone 4 shows bands corresponding to both episomal forms and clone 7 shows a faint 2-LTR sized band.
  • clone 11 shows a band corresponding to the i-LTR episome (lane 9).
  • the DNA in the other two clones has not digested sufficiently to enter the gel.
  • Clone 2 of IDLV CMV eGFP (lane 10) shows a band corresponding to i-LTR and 2- LTR episomes in addition to several other bands. All IDLV CMV eGFP clones have the same band at ⁇ 2200 bp, which is too small to contain the entire episome and may therefore indicate either rearrangement or integration.
  • Example 10 Conformation and copy number analysis of vector genomes using Fluorescent In Situ Hybridisation
  • FISH Fluorescence In situ hybridization
  • the metaphase images provide supportive evidence for the presence of episomes in the cells transduced with non-integrating vectors, as only 1 doublet signal was found on all metaphase images on the IDLV slides. In contrast, 8 clear doublets were observed in metaphases of the 3 different ICLV clones investigated ( Figure 12 A).
  • the samples included in the statistical analysis were clonal IDLV SV40 eGFP, IDLV SV40 eGFP mMAR and ICLV SV40 eGFP cell lines, as well as a negative control. Signals and nuclei were counted in 20 fields throughout the slide, and the ratio of signals inside nuclei versus outside nuclei was calculated for each field.
  • miniMAR-element in the vector cassette did not influence the level of retention of the vectors in any of the cell types, either with cell cycle arrest or in continuous culture. This suggests that even if association of vector DNA with the nuclear scaffolding took place, it happened independently of the S/MAR element and was not assisted by its presence.
  • FISH FISH
  • the non-vector amplicons obtained for IDLV SV40 eGFP clone 10 and IDLV SV40 eGFP mMAR clone 8 did not retrieve any BLAST results from the mouse or the rat genome, making it likely they were the result of contamination from neighbouring sequencing lanes containing HlV-i samples in human cells.
  • the possibility that at least some of them resulted from integrations in the CHO genome in a rare section that does not correlate well with the mouse and rat genomes cannot be completely excluded, however, it is highly unlikely considering the almost perfect alignment of the other integration sites with one or both the rat and mouse genomes.
  • the one BLAST-positive read for sample IDLV CMV eGFP clone 12 is likely contamination from the neighbouring lane, which contained the positive control, as it is unlikely for integration to have occurred at exactly the same site in two independent samples.
  • the possibility of this cannot be entirely discounted, as the site in question could be a hotspot for rearrangement and therefore exhibit a tendency towards non-integrase -mediated integration.
  • amplicon length bias One factor that may prevent integration sites from being detected by LAM-PCR is amplicon length bias. If the restriction site is further than ⁇ 400 bp away from the LTR in the host genome, the resulting fragment will be too long for downstream processing and deep sequencing. It is therefore possible that some integration sites were missed because of this.
  • Another factor introducing inherent bias in the LAM- PCR experiment is the positioning of the primers in the LTR. Although this is the best method to detect LTR-mediated integrations, in our case it is possible that some of the integration events were not /iV-mediated and therefore the vector-genome junction is present elsewhere in the genome. These would not have been picked up by the protocol used.
  • Quantitative RT-PCR provides data on intracellular vector conformation
  • the LTR to BB ratio is high, ranging from 2: 1 to 5:1, but as the 2-LTR signal is also high this can be expected to arise from 2-LTR circles.
  • the l-LTR to BB ratio may be affected if the reverse transcription during transduction has been incomplete, as the BB signal is measured from the part which is the last one to be transcribed. It is also possible that the LTR to BB ratios are affected by the method of DNA purification, which may damage the circular episomes and the breakage may result in the BB signal being reduced. Also, as with any very sensitive PCR-based methods, different primers may have slightly differing binding efficiencies, so obtained ratios may deviate somewhat from expected. Ratios may also be affected if the method of DNA purification causes the DNA to become fragmented, although it should not be the case here since the protocol used was specifically designed to keep the DNA molecules as intact as possible.
  • Fluorescent In situ hybridisation provides supporting data on the copy number and intracellular location of the episomes
  • FISH was in this case limited to supportive evidence due to the small size of the target sequence.
  • Statistical analysis of the signals supports the theory that the signals observed arise from real vectors present in the cells, and may be used to infer approximate copy numbers per cell.
  • copy numbers were estimated for IDLV SV40 GFP clone 4 and IDLV SV40 GFP mMAR clone 11, and both had the same average of 1.6 transgenes per cell.
  • FISH signals were only observed in slides containing SV40 promoter -driven vectors, which were all analysed using the same probe.
  • the slides made with cell lines transduced with IDLV CMV eGFP did not produce quantifiable signals.
  • the probe used for these cells differed from the probe used for the SV40 -containing cell lines, and hence it may be assumed that the reason for the weak signal was a sub- optimal probe.
  • Putative reasons for the FISH probe for the IDLV CMV GFP vector not working include problems with target binding; the CMV sequence may hybridise very weakly and is removed during stringent washes. Another possibility is that the probe may bind to genomic sequences resulting in high weak-level background, drowning out the true signals. While the technique could be optimised and the quality of signals and images potentially improved, due to time constraints this was not possible within the scope of this project.
  • Table 4 Summary of the experimental evidence to evaluate the episomal status of IDLV genomes in CHO cell lines derived by dilution cloning from transduced cell populations subjected to a transient cell cycle arrest
  • the table shows the results from 5 independent experimental techniques to evaluate the episomal status of IDLV genomes in clonal CHO cell lines derived by dilution cloning from transduced cell populations subjected to early transient cell cycle arrest. Green tick indicates that the experiment provides evidence to support the existence of replicating episome structures. The red cross indicates that the experiment does not provide evidence to support the existence of replicating episome structures. The "?” indicates unavailability of information where the experiment was either not performed or judged not to provide reliable data.
  • the linear amplification-mediated PCR reaction was designed to reveal any existing vector-genome junctions. The products of the reaction were first visualised on an agarose gel, as products arising from exclusively episomal vector are expected to correspond to defined sizes.
  • the quantitative real-time PCR experiment produced data on the amount of LTR signals, LTR to LTR junctions, and vector backbone present in the cells.
  • the ratio of the amount of signal is expected to be different in cells with episomes and integrants, if the integration has been LTR-mediated.
  • the signals were calculated as the amount of each type of product present per cell equivalent, and expressed as ratios of i-LTR and 2-LTR (LTR to LTR junction) signals for each backbone (BB) signal.
  • IDLV-SG clones 7 and 10 and IDLV-SGm clone 11 produced LTR to BB signal ratios close to 1:1 (0.7 to 1, 1.1 to 1 and 0.96 to 1 respectively), which is expected to arise from i-LTR circles.
  • IDLV-CG clones produced high amounts of LTR signal as well as high amounts of 2-LTR signal, indicating the presence of 2-LTR circles.
  • the ratios of 1- LTR: 2-LTR: BB in the clones were 2.4 to 0.2 to 1 for clone 2, 5.0 to 1.1 to 1 for clone 10, and 5.1 to 1.8 to 1 for clone 12 (see Table 114 and Figure 11).
  • the Southern blotting experiment indicated bands corresponding to the expected i-LTR and 2- LTR episomes for cells transduced with IDLV-SG, clones 4 and 7, and cells transduced with IDLV-SGm, clone 11. Of these, clones 7 and 11 contain a single band, indicating that the cell line is indeed clonal and contains the transgene in a single conformation.
  • the potential for generating stable episomes using IDLVs has been investigated by transducing IDLV vectors in vitro into CHO-Ki cells and inducing a period of reversible cell cycle arrest for 4-5 days following transduction, to assist in the establishment of the episomes in the nuclear environment.
  • the cell cycle arrest was achieved by methionine restriction and serum depletion, and accompanied by a control group of transduced cell which were not induced to undergo cell cycle arrest.
  • the integration status of the vector genomes in the stably transduced cells has also been investigated. Cells containing episomes were analysed using four independent methods: LAM-PCR, quantitative Real-Time PCR, Southern blotting and Fluorescent In Situ Hybridisation, to ascertain the intranuclear location of the vectors and to identify potential integration events.
  • LTRs long terminal repeats
  • CHO cells were originally derived from a tissue sample from an inbred laboratory animal. They are noted for their chromosome instability. It is possible that the stress caused by methionine depletion induces further DNA instability, chromosome breaks and integration or any exogenous DNA present in the nucleus. However, very little evidence for integration events was found during extensive investigations, favouring instead the hypothesis that the quiescent period encouraged the episomes to become permanently associated either with chromosomes or the nuclear matrix. References

Landscapes

  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Virology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

Cette invention concerne un procédé d'expression d'un transgène dans une cellule hôte, le procédé comprenant l'exposition de la cellule hôte, qui contient un produit de recombinaison génétique comprenant un transgène, à des conditions qui bloquent sensiblement la mitose dans la cellule hôte, de façon que le produit de recombinaison forme un épisome mitotiquement stable permettant l'expression du transgène. Cette invention s'étend à l'utilisation de ces produits de recombinaison pour exprimer des transgènes dans tout un éventail d'applications de production de protéines à visée médicale et hétérologues différentes.
PCT/GB2013/050795 2012-04-12 2013-03-27 Expression génique à partir d'épisomes mitotiquement stables WO2013153361A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP13713483.9A EP2836598A1 (fr) 2012-04-12 2013-03-27 Expression génique à partir d'épisomes mitotiquement stables

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GBGB1206455.6A GB201206455D0 (en) 2012-04-12 2012-04-12 Gene expression
GB1206455.6 2012-04-12

Publications (1)

Publication Number Publication Date
WO2013153361A1 true WO2013153361A1 (fr) 2013-10-17

Family

ID=46208961

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2013/050795 WO2013153361A1 (fr) 2012-04-12 2013-03-27 Expression génique à partir d'épisomes mitotiquement stables

Country Status (3)

Country Link
EP (1) EP2836598A1 (fr)
GB (1) GB201206455D0 (fr)
WO (1) WO2013153361A1 (fr)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103740756A (zh) * 2013-12-25 2014-04-23 中国农业大学 一种可调控删除的非病毒游离载体及其构建方法
EP2878674A1 (fr) * 2013-11-28 2015-06-03 Fundación Centro Nacional de Investigaciones Cardiovasculares Carlos III (CNIC) Épisomes stables sur la base des vecteurs lentiviraux non intégratifs
WO2018206168A1 (fr) * 2017-05-11 2018-11-15 Zentrum Für Forschungsförderung In Der Pädiatrie Gmbh Concept pour le traitement de troubles monogénétiques
WO2019219649A1 (fr) * 2018-05-14 2019-11-21 Vivet Therapeutics Vecteurs de thérapie génique comprenant des séquences s/mar
WO2020252136A1 (fr) 2019-06-11 2020-12-17 Shire Human Genetic Therapies, Inc. Administration de vecteur viral adéno-associé d'anticorps pour le traitement de la kallicréine plasmatique dérégulée à médiation par une maladie
WO2021081280A1 (fr) 2019-10-23 2021-04-29 Shire Human Genetic Therapies, Inc. Thérapie génique à vecteurs de virus adéno-associé pour œdème de quincke héréditaire
WO2022130014A1 (fr) 2020-12-16 2022-06-23 Takeda Pharmaceutical Company Limited Administration d'anticorps à l'aide de vecteurs viraux adéno-associés pour le traitement d'une maladie médiée par une kallicréine plasmatique dérégulée

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010055413A1 (fr) * 2008-11-12 2010-05-20 Fondazione Centro San Raffaele Del Monte Tabor Vecteur génique pour induire une tolérance immunitaire spécifique d’un transgène

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010055413A1 (fr) * 2008-11-12 2010-05-20 Fondazione Centro San Raffaele Del Monte Tabor Vecteur génique pour induire une tolérance immunitaire spécifique d’un transgène

Non-Patent Citations (37)

* Cited by examiner, † Cited by third party
Title
ANGELO LOMBARDO ET AL: "Gene editing in human stem cells using zinc finger nucleases and integrase-defective lentiviral vector delivery", NATURE BIOTECHNOLOGY, NATURE PUBLISHING GROUP, NEW YORK, NY, US, vol. 25, no. 11, 1 November 2007 (2007-11-01), pages 1298 - 1306, XP002633002, ISSN: 1087-0156, [retrieved on 20071028], DOI: 10.1038/NBT1353 *
BANASIK M B ET AL: "Integrase-defective lentiviral vectors: progress and applications", GENE THERAPY, NATURE PUBLISHING GROUP, GB, vol. 17, no. 2, 1 January 2010 (2010-01-01), pages 150 - 157, XP002633004, ISSN: 0969-7128, [retrieved on 20091022], DOI: 10.1038/GT.2009.135 *
BAYER, M; KANTOR, B; COCKRELL, A; MA, H; ZEITHAML, B; LI, X; MCCOWN, T; KAFRI, T: "A large U3 deletion causes increased in vivo expression from a nonintegrating lentiviral vector", MOL THER, vol. 16, no. 12, 2008, pages 1968 - 1976, XP055130132, DOI: doi:10.1038/mt.2008.199
DAVIS, HE; ROSINSKI, M; MORGAN, JR; YARMUSH, ML: "Charged polymers modulate retrovirus transduction via membrane charge neutralization and virus aggregation", BIOPHYS J, vol. 86, no. 2, 2004, pages 1234 - 1242
DEAVEN, LL; PETERSEN, DF: "The chromosomes of CHO, an aneuploid Chinese hamster cell line: G-band, C-band, and autoradiographic analyses", CHROMOSOMA, vol. 41, no. 2, 1973, pages 129 - 144
ENGELMAN ET AL., J VIROL, vol. 69, no. 5, 1995, pages 2729 - 2736
ENGELMAN, A; ENGLUND, G; ORENSTEIN, JM; MARTIN, MA; CRAIGIE, R: "Multiple effects of mutations in human immunodeficiency virus type 1 integrase on viral replication", J VIROL, vol. 69, no. 5, 1995, pages 2729 - 2736, XP001205947
GABRIEL, R; ECKENBERG, R; PARUZYNSKI, A; BARTHOLOMAE, CC; NOWROUZI, A; ARENS, A; HOWE, SJ; RECCHIA, A; CATTOGLIO, C; WANG, W: "Comprehensive genomic access to vector integration in clinical gene therapy", NAT MED, vol. 15, no. 12, 2009, pages 1431 - 1436, XP002633026, DOI: doi:10.1038/nm.2057
GAUR, M; LEAVITT, AD: "Mutations in the human immunodeficiency virus type 1 integrase D,D(35)E motif do not eliminate provirus formation", J VIROL, vol. 72, no. 6, 1998, pages 4678 - 4685
HAGINO-YAMAGISHI, K; DONEHOWER, LA; VARMUS, HE: "Retroviral DNA integrated during infection by an integration-deficient mutant of murine leukemia virus is oligomeric", J VIROL, vol. 61, no. 6, 1987, pages 1964 - 1971
HANNA KYMALAINEN: "Abstract: Development of Viral & Non-viral Episomal Vectors For Gene Therapy Applications", 1 June 2012 (2012-06-01), XP055065143, Retrieved from the Internet <URL:http://pure.rhul.ac.uk/portal/en/publications/development-of-viral--nonviral-episomal-vectors-for-gene-therapy-applications%281704c610-a468-4e08-91da-169f81ba32a1%29.html> [retrieved on 20130604] *
KAO, FT; PUCK, TT: "Genetics of somatic mammalian cells: linkage studies with human-Chinese hamster cell hybrids", NATURE, vol. 228, no. 5269, 1970, pages 329 - 332
KLAUS WANISCH ET AL: "Integration-deficient Lentiviral Vectors: A Slow Coming of Age", MOLECULAR THERAPY, vol. 17, no. 8, 1 August 2009 (2009-08-01), pages 1316 - 1332, XP055021370, ISSN: 1525-0016, DOI: 10.1038/mt.2009.122 *
MILLER ET AL., BUSHMAN'S LATE REVERSE TRANSCRIPT REACTION, 1997
MILLER, MD; FARNET, CM; BUSHMAN, FD: "Human immunodeficiency virus type 1 preintegration complexes: studies of organization and composition", J VIROL, vol. 71, no. 7, 1997, pages 5382 - 5390, XP002918879
OMASA, T; CAO, Y; PARK, JY; TAKAGI, Y; KIMURA, S; YANO, H; HONDA, K; ASAKAWA, S; SHIMIZU, N; OHTAKE, H: "Bacterial artificial chromosome library for genome- wide analysis of Chinese hamster ovary cells", BIOTECHNOL BIOENG, vol. 104, no. 5, 2009, pages 986 - 994
PHILIPPE STEPHANIE ET AL: "Lentiviral vectors with a defective integrase allow efficient and sustained transgene expression in vitro and in vivo", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, NATIONAL ACADEMY OF SCIENCES, US, vol. 103, no. 47, 21 November 2006 (2006-11-21), pages 17684 - 17689, XP002433815, ISSN: 0027-8424, DOI: 10.1073/PNAS.0606197103 *
PUCK, TT; CIECIURA, SJ; ROBINSON, A: "Genetics of somatic mammalian cells. III. Long-term cultivation of euploid cells from human and animal subjects", JEXP MED, vol. 108, no. 6, 1958, pages 945 - 956, XP055102527, DOI: doi:10.1084/jem.108.6.945
RANGASAMY, D: "An S/MAR-based Li retrotransposition cassette mediates sustained levels of insertional mutagenesis without suffering from epigenetic silencing of DNA methylation", EPIGENETICS, vol. 5, no. 7, 2010, pages 601 - 611
RUPPRECHT, S; LIPPS, HJ: "Cell cycle dependent histone dynamics of an episomal non-viral vector", GENE, vol. 439, no. 1-2, 2009, pages 95 - 101, XP026093657, DOI: doi:10.1016/j.gene.2009.03.010
SAENZ D T ET AL: "UNINTEGRATED LENTIVIRUS DNA PERSISTENCE AND ACCESSIBILITY TO EXPRESSION IN NONDIVIDING CELLS: ANALYSIS WITH CLASS I INTEGRASE MUTANTS", JOURNAL OF VIROLOGY, THE AMERICAN SOCIETY FOR MICROBIOLOGY, US, vol. 78, no. 6, 1 March 2004 (2004-03-01), pages 2906 - 2920, XP001205919, ISSN: 0022-538X, DOI: 10.1128/JVI.78.6.2906-2920.2004 *
SCHMIDT, M; SCHWARZWAELDER, K; BARTHOLOMAE, C; ZAOUI, K; BALL, C; PILZ, I; BRAUN, S; GLIMM, H; VON KALLE, C: "High-resolution insertion-site analysis by linear amplification-mediated PCR (LAM-PCR", NAT METHODS, vol. 4, no. 12, 2007, pages 1051 - 1057, XP002633006, DOI: doi:10.1038/NMETH1103
SOUTHERN, EM: "Detection of specific sequences among DNA fragments separated by gel electrophoresis", JMO1 BIOL, vol. 98, no. 3, 1975, pages 503 - 517, XP000564884, DOI: doi:10.1016/S0022-2836(75)80083-0
THOMPSON ET AL., NUCLEIC ACIDS RESEARCH, vol. 22, 1994, pages 4673 - 4680
THOMPSON ET AL., NUCLEIC ACIDS RESEARCH, vol. 24, 1997, pages 4876 - 4882
TJIO, JH; PUCK, TT: "Genetics of somatic mammalian cells. II. Chromosomal constitution of cells in tissue culture", J EXP MED, vol. 8, no. 2, 1958, pages 259 - 268
TOBEY, RA; LEY, KD: "Regulation of initiation of DNA synthesis in Chinese hamster cells. I. Production of stable, reversible Gi-arrested populations in suspension culture", J CELL BIOL, vol. 46, no. 1, 1970, pages 151 - 157
VARGAS J ET AL: "NOVEL INTEGRASE-DEFECTIVE LENTIVIRAL EPISOMAL VECTORS FOR GENE TRANSFER", HUMAN GENE THERAPY, MARY ANN LIEBERT, NEW YORK ,NY, US, vol. 15, no. 4, 1 April 2004 (2004-04-01), pages 361 - 372, XP001205920, ISSN: 1043-0342, DOI: 10.1089/104303404322959515 *
WANISCH, K; YANEZ-MUNOZ, RJ, MOL THER, vol. 17, no. 8, 2009, pages 1316 - 1332
WANISCH, K; YANEZ-MUNOZ, RJ: "Integration-deficient lentiviral vectors: a slow coming of age", MOL THER, vol. 17, no. 8, 2009, pages 1316 - 1332, XP055021370, DOI: doi:10.1038/mt.2009.122
WURM, FM; HACKER, D: "First CHO genome", NAT BIOTECHNOL, vol. 29, no. 8, 2011, pages 718 - 720
XU, X; NAGARAJAN, H; LEWIS, NE; PAN, S; CAI, Z; LIU, X; CHEN, W; XIE, M; WANG, W; HAMMOND, S: "The genomic sequence of the Chinese hamster ovary (CHO)-Ki cell line", NAT BIOTECHNOL, vol. 29, no. 8, 2011, pages 735 - 741, XP055223996, DOI: doi:10.1038/nbt.1932
YÁÑEZ-MUÑOZ RAFAEL J ET AL: "Effective gene therapy with nonintegrating lentiviral vectors", NATURE MEDICINE, NATURE PUBLISHING GROUP, NEW YORK, NY, US, vol. 12, no. 3, 1 March 2006 (2006-03-01), pages 348 - 353, XP002433816, ISSN: 1078-8956, DOI: 10.1038/NM1365 *
YANEZ-MUNOZ, RJ; BALAGGAN, KS; MACNEIL, A; HOWE, SJ; SCHMIDT, M; SMITH, AJ; BUCH, P; MACLAREN, RE; ANDERSON, PN; BARKER, SE: "Effective gene therapy with nonintegrating lentiviral vectors", NAT MED, vol. 12, no. 3, 2006, pages 348 - 353, XP002433816, DOI: doi:10.1038/nm1365
ZUFFEREY, R ET AL., J VIROL, vol. 73, no. 4, pages 2886 - 2892
ZUFFEREY, R ET AL., NAT BIOTECHNOL, vol. 15, no. 9, 1997, pages 871 - 875
ZUFFEREY, R; DONELLO, JE; TRONO, D; HOPE, TJ: "Woodchuck hepatitis virus posttranscriptional regulatory element enhances expression of transgenes delivered by retroviral vectors", J VIROL, vol. 73G, no. 4, 1999, pages 2886 - 2892, XP055184231

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2878674A1 (fr) * 2013-11-28 2015-06-03 Fundación Centro Nacional de Investigaciones Cardiovasculares Carlos III (CNIC) Épisomes stables sur la base des vecteurs lentiviraux non intégratifs
WO2015078999A1 (fr) * 2013-11-28 2015-06-04 Fundación Centro Nacional De Investigaciones Cardiovasculares Carlos Iii (Cnic) Épisomes stables basés sur des vecteurs lentiviraux non intégratifs
CN106170552A (zh) * 2013-11-28 2016-11-30 卡洛斯三世心血管研究国家中心基金会（Cnic） 基于非整合型慢病毒载体的稳定附加体
US10294492B2 (en) 2013-11-28 2019-05-21 Fundación Centro Nacional De Investigaciones Cariovasculares Carlos Iii (Cnic) Stable episomes based on non-integrative lentiviral vectors
CN106170552B (zh) * 2013-11-28 2020-03-17 卡洛斯三世心血管研究国家中心基金会（Cnic） 基于非整合型慢病毒载体的稳定附加体
CN103740756A (zh) * 2013-12-25 2014-04-23 中国农业大学 一种可调控删除的非病毒游离载体及其构建方法
WO2018206168A1 (fr) * 2017-05-11 2018-11-15 Zentrum Für Forschungsförderung In Der Pädiatrie Gmbh Concept pour le traitement de troubles monogénétiques
US11634472B2 (en) 2017-05-11 2023-04-25 Zentrum Für Forschungsförderung In Der Pädiatrie Gmbh Treatment of monogenetic disorders
WO2019219649A1 (fr) * 2018-05-14 2019-11-21 Vivet Therapeutics Vecteurs de thérapie génique comprenant des séquences s/mar
WO2020252136A1 (fr) 2019-06-11 2020-12-17 Shire Human Genetic Therapies, Inc. Administration de vecteur viral adéno-associé d'anticorps pour le traitement de la kallicréine plasmatique dérégulée à médiation par une maladie
WO2021081280A1 (fr) 2019-10-23 2021-04-29 Shire Human Genetic Therapies, Inc. Thérapie génique à vecteurs de virus adéno-associé pour œdème de quincke héréditaire
WO2022130014A1 (fr) 2020-12-16 2022-06-23 Takeda Pharmaceutical Company Limited Administration d'anticorps à l'aide de vecteurs viraux adéno-associés pour le traitement d'une maladie médiée par une kallicréine plasmatique dérégulée

Also Published As

Publication number Publication date
EP2836598A1 (fr) 2015-02-18
GB201206455D0 (en) 2012-05-30

Similar Documents

Publication Publication Date Title
Vargas et al. Retroviral vectors and transposons for stable gene therapy: advances, current challenges and perspectives
Sinn et al. Gene therapy progress and prospects: development of improved lentiviral and retroviral vectors–design, biosafety, and production
US10017785B2 (en) Polypurine tract modified retroviral vectors
WO2013153361A1 (fr) Expression génique à partir d&#39;épisomes mitotiquement stables
US20190119699A1 (en) Lentiviral triplex dna, and vectors and recombinant cells containing lentiviral triplex dna
JP6525986B2 (ja) レトロウイルスベクター
CA2867981A1 (fr) Procede d&#39;expression de petites molecules d&#39;arn antivirales a l&#39;interieur d&#39;une cellule
US9018011B2 (en) Gamma satellite insulator sequences and their use in preventing gene silencing
US20210238632A1 (en) Vector production in serum free media
KR20220139911A (ko) 렌티바이러스 벡터의 생산
Schott et al. Retrovirus-based vectors for transient and permanent cell modification
Cockrell et al. HIV-1 vectors: fulfillment of expectations, further advancements, and still a way to go
Deyle et al. Nonintegrating foamy virus vectors
Ryu et al. A chromatin insulator blocks interactions between globin regulatory elements and cellular promoters in erythroid cells
WO2001040488A1 (fr) Expression transgenique accrue dans des vecteurs retroviraux possedant une region d&#39;attachement sar
WO2017066570A1 (fr) Procédés et compositions de vecteurs lentiviraux à déficience d&#39;intégration
Hahm et al. Construction of retroviral vectors with enhanced efficiency of transgene expression
IL116216A (en) Eukaryotic cell lineages for recombinant viral retroviral RNA storage, using trans-expression vectors used to complete the trans
Doi A novel lentiviral vector model to investigate the mechanism of insertional mutagenesis by aberrant splicing
KR20230147060A (ko) 조작된 nk 세포 및 암 치료 방법
EP4132590A1 (fr) Vecteurs modifiés pour la production de rétrovirus
AU774551B2 (en) Vectors for delivering viral and oncogenic inhibitors
Šenigl Improvement of retroviral vectors for efficient gene transfer
Kymalainen Development of Viral & Non-viral Episomal Vectors For Gene Therapy Applications
Branston Development of HSV-1 vectors for applications in the peripheral nervous system

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13713483

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2013713483

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE