WO2013152109A1 - Antagoniste de trpv4 et procédés d'utilisation de celui-ci - Google Patents

Antagoniste de trpv4 et procédés d'utilisation de celui-ci Download PDF

Info

Publication number
WO2013152109A1
WO2013152109A1 PCT/US2013/035129 US2013035129W WO2013152109A1 WO 2013152109 A1 WO2013152109 A1 WO 2013152109A1 US 2013035129 W US2013035129 W US 2013035129W WO 2013152109 A1 WO2013152109 A1 WO 2013152109A1
Authority
WO
WIPO (PCT)
Prior art keywords
trpv4
cell
antagonist
trpv4 antagonist
compound
Prior art date
Application number
PCT/US2013/035129
Other languages
English (en)
Inventor
Bruce M. Spiegelman
Li Ye
Original Assignee
Dana-Farber Cancer Institute, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Dana-Farber Cancer Institute, Inc. filed Critical Dana-Farber Cancer Institute, Inc.
Publication of WO2013152109A1 publication Critical patent/WO2013152109A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/445—Non condensed piperidines, e.g. piperocaine
    • A61K31/4523—Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems
    • A61K31/454—Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a five-membered ring with nitrogen as a ring hetero atom, e.g. pimozide, domperidone
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/13—Amines
    • A61K31/135—Amines having aromatic rings, e.g. ketamine, nortriptyline
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/13—Amines
    • A61K31/155—Amidines (), e.g. guanidine (H2N—C(=NH)—NH2), isourea (N=C(OH)—NH2), isothiourea (—N=C(SH)—NH2)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/336—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having three-membered rings, e.g. oxirane, fumagillin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/357—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having two or more oxygen atoms in the same ring, e.g. crown ethers, guanadrel
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/365—Lactones
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/4427—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems
    • A61K31/4439—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems containing a five-membered ring with nitrogen as a ring hetero atom, e.g. omeprazole
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/4965—Non-condensed pyrazines
    • A61K31/497—Non-condensed pyrazines containing further heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/55—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/22—Hormones
    • A61K38/26—Glucagons
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/22—Hormones
    • A61K38/27—Growth hormone [GH], i.e. somatotropin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • G01N33/5023—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects on expression patterns
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5082—Supracellular entities, e.g. tissue, organisms
    • G01N33/5088—Supracellular entities, e.g. tissue, organisms of vertebrates
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6872—Intracellular protein regulatory factors and their receptors, e.g. including ion channels
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/04—Endocrine or metabolic disorders
    • G01N2800/042—Disorders of carbohydrate metabolism, e.g. diabetes, glucose metabolism
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/04—Endocrine or metabolic disorders
    • G01N2800/044—Hyperlipemia or hypolipemia, e.g. dyslipidaemia, obesity

Definitions

  • Thermogenesis is the process of heat production in organisms. As a component of the metabolic rate, stimulation of thermogenesis can increase energy expenditure and fat oxidation. Chronic energy imbalance, for example, excessive energy intake, moderate energy expenditure, or both, can cause various metabolic disorders such as obesity and diabetes. The epidemic of obesity and diabetes has increased the interest in searching for effective treatments. Brown adipose tissue (BAT) is specialized for the efficient dissipation of chemical energy in the form of heat. It does this by having an
  • thermogenic program in BAT is controlled, for example, by transcriptional regulators in the genome.
  • TRPV4 antagonists can be used to treat or prevent a disorder.
  • disorders include, e.g., metabolic disorders, e.g., obesity or diabetes, a comorbidity of obesity or diabetes, an obesity or diabetes related disorder, or a disorder in which one or more symptoms can be alleviated by exercise or diet.
  • metabolic disorders e.g., obesity or diabetes, a comorbidity of obesity or diabetes, an obesity or diabetes related disorder, or a disorder in which one or more symptoms can be alleviated by exercise or diet.
  • TRPV4 as a regulator of adipose oxidative metabolism, inflammation and energy homeostasis.
  • TRPV4 inhibition can cause the white adipocytes, a major form of energy storage, to develop brown fat- like characteristics, such as the ability to dissipate energy through the oxidation of glucose and other fuels. Therefore, pharmacologic inhibition of TRPV4 expression or activity, directly or indirectly, in adipocytes, can lead to an increase in energy expenditure and a reduction in adipose tissue inflammation, both of which provide therapeutic benefits for metabolic disorders such as obesity and diabetes. Further, this disclosure provides fat cells that contain a reporter gene.
  • Such fat cells can be used to evaluate treatments, e.g., to identify compounds (e.g., therapeutic agents) that regulate TRPV4 pathway, for treating or preventing a disorder, e.g., a metabolic disorder, e.g., obesity or diabetes.
  • a disorder e.g., a metabolic disorder, e.g., obesity or diabetes.
  • the disclosure features a method of treating or preventing a metabolic disorder, or a symptom thereof, the method comprising administering a TRPV4 antagonist, e.g., a TRPV4 antagonist described herein, to a subject, in a therapeutically effective amount, to treat or prevent the metabolic disorder, or the symptom thereof.
  • a TRPV4 antagonist e.g., a TRPV4 antagonist described herein
  • the metabolic disorder is obesity.
  • the metabolic disorder is diabetes, e.g., type II diabetes.
  • the symptom of the metabolic disorder comprises high blood sugar, insulin resistance, glucose intolerance, abnormal lipid levels (e.g., decreased high-density lipoprotein (HDL) level, increased levels of triglycerides and low-density lipoprotein (LDL)), or high blood pressure.
  • abnormal lipid levels e.g., decreased high-density lipoprotein (HDL) level, increased levels of triglycerides and low-density lipoprotein (LDL)
  • the TRPV4 antagonist is selected, at least in part, on the basis that it is a TRPV4 antagonist. In some embodiments, the TRPV4 antagonist does not inhibit one, two, or all of TRPV1, TRPV2, and TRPV3. In some embodiments, the TRPV4 antagonist inhibits one, two, or all of TRPV1, TRPV2, and TRPV3. In some embodiments, the TRPV4 antagonist is selected from the group consisting of rimonabant, AMG-251, AMG9810, GSK205, and BCTC. In some embodiments, TRPV4 antagonist is other than rimonabant. In some embodiments, the TRPV4 antagonist is other than AMG-251.
  • the TRPV4 antagonist is other than AGM9810. In some embodiments, the TRPV4 antagonist is other than GSK205. In some embodiments, the TRPV4 antagonist is other than BCTC. In some embodiments, the TRPV4 antagonist inhibits inflammation, e.g., local or systemic inflammation, e.g., adipose tissue inflammation, e.g., chronic adipose tissue inflammation. In some embodiments, the TRPV4 antagonist does not affect central nervous system.
  • the therapeutically effective amount of the TRPV4 antagonist decreases body weight by, at least about 2%, 4%, 6%, 8%, 10%, 15%, 20%, or 25%, in the subject post-treatment from the body weight of the subject prior to the treatment. In some embodiments, the therapeutically effective amount of the TRPV4 antagonist decreases body weight after, e.g., at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or 25 weeks, in the subject post-treatment from the body weight of the subject prior to the treatment. In some embodiments, the TRPV4 antagonist is administered orally. In some embodiments, the TRPV4 antagonist is administered intravenously. In some
  • the TRPV4 antagonist is administered subcutaneously. In some embodiments, the TRPV4 antagonist is administered at least once, twice, or three times a day. In some embodiments, the TRPV4 antagonist is administered at least once a week, twice a week, or three times a week.
  • the subject is a human. In some embodiments, the subject is an animal, e.g., a household animal (e.g., a pet) or a zoo animal.
  • an animal e.g., a household animal (e.g., a pet) or a zoo animal.
  • the method further comprises providing, to the subject, a second therapy.
  • the second therapy a diabetes therapy.
  • the second therapy comprises administering to the subject one or more of the following agents: sulfonylureas, meglitinides, biguanides, metformin, troglitazone, pioglitazone, rosiglitazone, acarbose, pramlintide, exenatide, glyburide/metformin (Glucovance®), rosiglitazone/metformin (Avandamet®), and glipizide/metformin (Metaglip®).
  • the second therapy is an anti-obesity therapy.
  • the second therapy comprises administering to the subject one or more of the following agents: orlistat (Xenical®), sibutramine (Reductil® or Meridia®), rimonabant (Acomplia®), metformin (Glucophage®), exenatide (Byetta®), pramlintide (Symlin®), ZGN-433, Lorcaserin, human growth hormone, and dinitrophenol (DNP).
  • the secondary therapy is an anti-inflammatory therapy.
  • the second therapy is surgery, e.g., bariatric surgery. In some
  • the second therapy comprises administering to the subject one or more of: a TRPV1 antagonist, a TRPV2 antagonist, and a TRPV3 antagonist.
  • the TRPV4 antagonist is administered in combination with a reduced calorie diet or increased physical activity.
  • the disclosure features a method of treating or preventing an inflammation associated with a metabolic disorder, the method comprising administering a TRPV4 antagonist, e.g., a TRPV4 antagonist described herein, to a subject, in a therapeutically effective amount, to treat or prevent the inflammation associated with the metabolic disorder.
  • a TRPV4 antagonist e.g., a TRPV4 antagonist described herein
  • the inflammation associated with the metabolic disorder comprises adipose tissue inflammation, e.g., chronic adipose tissue inflammation.
  • the metabolic disorder is obesity.
  • the metabolic disorder is diabetes, e.g., type II diabetes.
  • the subject has one or more symptoms of: high blood sugar, insulin resistance, glucose intolerance, abnormal lipid levels (e.g., decreased high- density lipoprotein (HDL) level, increased levels of triglycerides and low-density lipoprotein (LDL)), and high blood pressure.
  • abnormal lipid levels e.g., decreased high- density lipoprotein (HDL) level, increased levels of triglycerides and low-density lipoprotein (LDL)
  • high blood pressure e.g., decreased high- density lipoprotein (HDL) level, increased levels of triglycerides and low-density lipoprotein (LDL)
  • the TRPV4 antagonist is selected, at least in part, on the basis that it is a TRPV4 antagonist. In some embodiments, the TRPV4 antagonist does not inhibit one, two, or all of TRPV1, TRPV2, and TRPV3. In some embodiments, the TRPV4 antagonist inhibits one, two, or all of TRPV1, TRPV2, and TRPV3. In some embodiments, the TRPV4 antagonist is selected from the group consisting of rimonabant, AMG-251, AMG9810, GSK205, and BCTC. In some embodiments, the TRPV4 antagonist is other than rimonabant. In some embodiments, the TRPV4 antagonist is other than AMG-251.
  • the TRPV4 antagonist is other than AGM9810. In some embodiments, the TRPV4 antagonist is other than GSK205. In some embodiments, the TRPV4 antagonist is other than BCTC. In some embodiments, the TRPV4 antagonist does not affect central nervous system.
  • the disclosure features a cell (e.g., a fat cell, e.g., a brown fat lineage cell, or a progenitor thereof) comprising a reporter gene, wherein the reporter gene is under the control of, e.g., inserted at, e.g., the transcription of which is initiated from, a genetic locus comprising a gene described herein, e.g., a gene in the TRPV4 pathway, e.g., TRPV4 or PGCla.
  • a cell e.g., a fat cell, e.g., a brown fat lineage cell, or a progenitor thereof
  • the reporter gene is under the control of, e.g., inserted at, e.g., the transcription of which is initiated from, a genetic locus comprising a gene described herein, e.g., a gene in the TRPV4 pathway, e.g., TRPV4 or PGCla.
  • the cell is a fat cell, e.g., a brown fat lineage cell, or a progenitor thereof.
  • the cell is a preadipocyte, e.g., an
  • the cell is a human cell.
  • the cell is an animal cell, e.g., a mammalian cell, e.g., a mouse cell.
  • the cell is a cultured cell.
  • the cell is a primary cell, a non-primary cell, an immortalized cell, or a clonal cell.
  • the cell is derived from a subject having a disorder described herein, e.g., a metabolic disorder, e.g., obesity or diabetes.
  • the reporter gene encodes a protein useful for monitoring gene expression, e.g., a protein which luminesces or fluoresces, which is colored, or produces a colored substrate or an enzymatic activity, e.g., phosphatase activity.
  • a protein useful for monitoring gene expression e.g., a protein which luminesces or fluoresces, which is colored, or produces a colored substrate or an enzymatic activity, e.g., phosphatase activity.
  • the reporter gene encodes a protein selected from the group consisting of luciferase (e.g., firefly luciferase and Renilla luciferase), green fluorescent protein (GFP), red fluorescent protein (RFP), yellow fluorescent protein (YFP), chloramphenicol acetyltransferase (CAT), alkaline phosphatase (AP) (e.g., secreted embryonic alkaline phosphatase (SEAP)), ⁇ -galactosidase ( ⁇ -gal), ⁇ -lactamase (Bla), horseradish peroxidase (HRP), and a variant thereof.
  • luciferase e.g., firefly luciferase and Renilla luciferase
  • GFP green fluorescent protein
  • RFP red fluorescent protein
  • YFP yellow fluorescent protein
  • CAT chloramphenicol acetyltransferase
  • AP alkaline phosphatase
  • the genetic locus comprises a gene described in Table 1.
  • the disclosure features a method of evaluating a treatment, e.g., a compound, e.g., identifying a therapeutic agent, the method comprising:
  • a cell described herein e.g., a fat cell, e.g. a brown fat lineage cell, or a progenitor thereof, comprising a reporter gene (e.g., a reporter gene described herein), wherein the reporter gene is under the control of, e.g., inserted at, e.g., the transcription of which is initiated from, a genetic locus comprising a gene described herein (e.g., in Table 1), e.g., a gene in the TRPV4 pathway, e.g., a gene down-regulated by TRPV4, e.g., PGCl .
  • a reporter gene e.g., a reporter gene described herein
  • a compound e.g., a therapeutic agent
  • the method further comprises selecting a compound, e.g., a therapeutic agent, that increases the activity of the reporter gene expression product, by at least about 2, 5, 10, 20, 40, 60, 80, 100, 200, 400, 600, 800, or 1000 fold, compared to a control, e.g., the activity of the reporter gene expression product when the cell does not contact the compound, e.g., the therapeutic agent.
  • the method is performed in vitro. In some embodiments, the method is performed in vivo, e.g., using an animal model, e.g., an animal model described herein.
  • the method further comprises determining the binding of the compound, e.g., the therapeutic agent, to TRPV4.
  • the method further comprises selecting a compound, e.g., a therapeutic agent, that inhibits the activity of TRPV4, by at least about 2, 5, 10, 20, 40, 60, 80, 100, 200, 400, 600, 800, or 1000 fold, compared to a control, e.g., the activity of TRPV4 when the cell does not contact the compound, e.g., the therapeutic agent.
  • a compound e.g., a therapeutic agent
  • the method further comprises determining the binding of the compound, e.g., the therapeutic agent, to one or more of TRPVl, TRPV2, and TRPV3.
  • the method further comprises selecting a compound, e.g., a therapeutic agent, that does not inhibit the activity of one or more of TRPVl, TRPV2 and TRPV3.
  • a compound e.g., a therapeutic agent
  • the method further comprises retesting the identified treatment.
  • the method is performed in vitro, further comprising retesting in vivo, e.g., using an animal model, e.g., an animal model described herein.
  • the disclosure features a method of evaluating a treatment, e.g., a compound, e.g., identifying a therapeutic agent, the method comprising:
  • a cell described herein e.g., a fat cell, e.g. a brown fat lineage cell, or a progenitor thereof, comprising a reporter gene (e.g., a reporter gene described herein), wherein the reporter gene is under the control of, e.g., inserted at, e.g., the transcription of which is initiated from, a genetic locus comprising a gene described herein (e.g., in Table 1), e.g., a gene in the TRPV4 pathway, e.g., TRPV4 gene or a gene up-regulated by TRPV4.
  • a reporter gene e.g., a reporter gene described herein
  • a compound e.g., a therapeutic agent
  • the method further comprises selecting a compound, e.g., a therapeutic agent, that decreases the activity of the reporter gene expression product, by at least about 2, 5, 10, 20, 40, 60, 80, 100, 200, 400, 600, 800, or 1000 fold, compared to a control, e.g., the activity of the reporter gene expression product when the cell does not contact the compound, e.g., the therapeutic agent.
  • a compound e.g., a therapeutic agent
  • the method is performed in vitro. In some embodiments, the method is performed in vivo, e.g., using an animal model, e.g., an animal model described herein.
  • the method further comprises retesting the identified treatment.
  • the method is performed in vitro, further comprising retesting in vivo, e.g., using an animal model, e.g., an animal model described herein.
  • FIG. 1 depicts a summary of the high-throughput chemical screen.
  • the results were presented as dCT (the CT number difference between PGCl and TBP) from each well.
  • dCT the CT number difference between PGCl and TBP
  • Each point on X-axis represents one 384- well plate treated with corresponding library plate.
  • the lower the dCT was, indicates the more PGCla mRNA was expressed in the cells from that well.
  • FIG. 2A depicts qPCR analysis of Pgcla mRNA in fully differentiated 3T3-F442A adipocytes after 24-hour treatment with indicated CB1 antagonists. SLV319 and
  • FIG. 2B depicts qPCR analysis of Pgcla mRNA in fully differentiated 3T3-F442A adipocytes after 24-hour treatment with indicated TRPV1 antagonists.
  • AMG9810 and BCTC were used at three doses: 0.2, 2 and 20uM.
  • FIG. 2C depicts qPCR analysis of Pgcla, CytC and Ucpl mRNA in adipocytes treated with 20uM AMG9810 or DMSO, at basal level or after Forskolin (lOuM) stimulation.
  • FIG. 2D depicts normalized mRNA expression of Trpvl, Trpv2, Trpv3 and Trpv4 in 3T3-F442A adipocytes.
  • FIG. 2E depicts Trpvl, Trpv2 and Trpv4 mRNA levels (bars from left to right in the same order) in adipocytes infected with scrambled (SCR), shTRPVl, shTRPV2 or shTRPV4 lentivirus.
  • SCR scrambled
  • FIG. 2F depicts aP2 mRNA levels in adipocytes infected with scrambled (SCR), shTRPV 1 , shTRPV2 or shTRPV4 lentivirus .
  • FIG. 2G depicts Pgcla mRNA levels in adipocytes infected with scrambled (SCR), shTRPVl, shTRPV2 or shTRPV4 lentivirus.
  • FIG. 3A depicts QPCR analysis of TRPV4 mRNA in interscapular brown fat (BAT), inguinal (ING), axillary (AXL), epididymal (EPI) and retroperitoneal (RP) fat.
  • FIG. 3B depicts Oil-Red-0 staining (red) for lipid accumulation and mRNA levels of general adipocyte markers (aP2, Adiponectin, and PPARy) in 3T3-F442A adipocytes treated with shTRPV4 or shGFP.
  • general adipocyte markers aP2, Adiponectin, and PPARy
  • FIG. 3C depicts measurement of intracellular calcium levels presented as ratio of 340nm/380nm emission from Furo-2 in 3T3-F442A adipocytes treated with shTRPV4 or shGFP.
  • FIG. 4A depicts TRPV4 protein expression in 3T3-F442A adipocytes infected with retrovirus expressing shTRPV4 or shGFP.
  • FIG. 4B depicts Pgcla and Ucpl mRNA expression in 3T3-F442A adipocytes infected with retrovirus expressing shTRPV4 or shGFP, with or without ⁇ norepinephrine (NE) stimulation.
  • NE norepinephrine
  • FIG. 4C depicts mRNA expression of indicated mitochondrial components in 3T3- F442A adipocytes infected with retrovirus expressing shTRPV4 or shGFP.
  • FIG. 4D depicts protein expression of indicated mitochondrial components in 3T3- F442A adipocytes infected with retrovirus expressing shTRPV4 or shGFP.
  • FIG. 4E depicts basal, uncoupled and maximum oxygen consumption rates in 3T3- F442A adipocytes infected with retrovirus expressing shTRPV4 or shGFP.
  • FIG. 4F depicts mRNA expression of aP2, Pgcla, Ucpl and Cox8b in 3T3-F442A adipocytes, after 48 hours treatment of GSK1016790A at indicated doses.
  • FIG. 5A depicts qPCR analysis of mRNA encoding chemokines/cytokines in 3T3-F442A adipocytes with shTRPV4 (right) or shGFP (left).
  • FIG. 5B depicts qPCR analysis of mRNA encoding indicated genes involved in inflammatory pathways in 3T3-F442A adipocytes with shTRPV4 (right) or shGFP (left).
  • FIG. 5C depicts mRNA expression of Mcpl, Mipla, Rantes, Mcp3, 116, Cxcll, Timpl and Tlr2 in 3T3-F442A adipocytes with shTRPV4 or shGFP, with or without 48 hours agonist treatment.
  • FIG. 5D depicts protein concentrations of MCP1, ⁇ , CXCL1 and RANTES in culture medium from cell in FIG. 5C determined by ELISA.
  • FIG. 6A depicts Western blot analysis of the expression of phosphorylated
  • Cells were treated with lOOnM GSK1016790A and cell lysates were collected at the indicated time points.
  • a 20-min treatment of lOuM CL316243 was used as a positive control for p38 phosphorylation.
  • 6B depicts Western blot analysis of the expression of pERKl/2, ERK1/2, pJNK, and JNK in 3T3-F442A adipocytes exposed to lOOnM GSK1016790A for 15 minutes, with 45-minute pre-treatment of vehicle (GSK101+V), U0126 (GSK101+U) or
  • FIG. 6C depicts mRNA expression of Pgcla, Mipla and Cxcll in the adipocytes described in FIG. 6B.
  • the levels of mRNA expression were measured 48 hours after the treatment.
  • FIG. 7A depicts qPCR analysis of mRNA expression of thermogenic and brown fat- selective genes in subcutaneous adipose tissues from TRPV4-/- (right) and WT (left) mice, with exposure to chow.
  • FIG. 7B depicts qPCR analysis of mRNA expression of thermogenic and brown fat- selective genes in subcutaneous adipose tissues from TRPV4-/- (right) and WT (left) mice, with exposure to 8-week high fat diet.
  • FIG. 7C depicts qPCR analysis of mRNA expression of thermogenic and brown fat- selective genes in subcutaneous adipose tissues from TRPV4-/- (right) and WT (left) mice, with exposure to 16-week high fat diet.
  • FIG. 7D depicts Western blot analysis of UCPl protein in subcutaneous fat from WT and TRPV4-/- mice, on chow and 8-week high fat diet (HFD).
  • FIG. 7E depicts representative images from immunohistochemistry for UCP1 (brown stain) protein in subcutaneous fat from WT and TRPV4-/- mice after 8 weeks of HFD.
  • UCP1 -expressing adipocytes are indicated by arrows.
  • FIG. 7F depicts mRNA expression of chemokine/chemoattractant genes in epididymal fat from WT (left) and TRPV4-/- (right) mice analyzed under all three diet conditions.
  • FIG. 7G depicts mRNA expression of chemokine/chemoattractant genes in subcutaneous fat from WT (left) and TRPV4-/- (right) mice analyzed under all three diet conditions.
  • FIG. 8A depicts body weights of male WT (upper) and TRPV4-/- (lower) mice on chow and HFD over 16 weeks.
  • FIG. 8B depicts MRI analysis of body composition (fat, lean and water mass (from left to right in the same order)) after 12 weeks HFD (left bar: WT; right bar: KO).
  • FIG. 8C depicts 24-hour food intake measured in individually housed WT and TRPV4-/- mice after 8 weeks HFD.
  • FIG. 8D depicts energy expenditure (as oxygen consumption rate) in individually housed WT and TRPV4-/- mice after 8 weeks HFD.
  • FIG. 8E depicts physical activity measured in individually housed WT and TRPV4-/- mice after 8 weeks HFD.
  • FIG. 8F depicts mRNA expression of three macrophage markers (F) in epididymal fat from WT (upper) and TRPV4-/- (lower) mice on chow, 8-week HFD and 16-week HFD.
  • FIG. 8G depicts H&E staining of epididymal adipose tissues from WT and TRPV4-/- mice after 16-week HFD. Arrows indicates "crown like structures" (CLS) consisting of macrophages.
  • FIG. 8H depicts mRNA expression of Tnfa in epididymal fat from WT (left)
  • TRPV4-/- mice on chow, 8-week HFD and 16-week HFD.
  • FIG. 81 depicts a Western blot analysis of PPARy serine-273 phosphorylation and total PPARy in epididymal fat after 8-32 week and 16-week HFD.
  • FIG. 8J depicts glucose tolerance tests that show the blood glucose levels measured in 7 weeks high fat-fed WT (upper) or TRPV4-/- (lower) mice, after overnight fasting (time 0) and at the indicated time points after intraperitoneal injection of glucose (1.5g/kg body weight for 7W-HFD).
  • FIG. 8K depicts glucose tolerance tests that show blood glucose levels measured in 12 weeks high fat-fed WT (upper) or TRPV4-/- (lower) mice, after overnight fasting (time 0) and at the indicated times after intraperitoneal injection of glucose (lg/kg body for 12w- HFD).
  • FIG. 9 depicts the body weight of female TRPV4-/- (lower) mice and female WT (upper) controls on a high fat diet.
  • FIG. 10A depicts the qPCR analysis of mRNA of BAT selective thermogenic genes in Epididymal fat, from TRPV4-/- (right) and WT (left) control mice on a chow diet.
  • FIG. 10B depicts the qPCR analysis of mRNA of BAT selective thermogenic genes in Epididymal fat, from TRPV4-/- (right) and WT (left) control mice after 8 weeks of high fat diet.
  • FIG. IOC depicts the qPCR analysis of mRNA of BAT selective thermogenic genes in Epididymal fat, from TRPV4-/- (right) and WT (left) control mice after 16 weeks of high fat diet.
  • FIG. 11A depicts mitochondrial and brown fat selective gene expression in in vitro differentiated TRPV4-/- (right) and WT (left) primary adipocytes at the basal level.
  • FIG. 11B depicts Pgcla and Ucpl mRNA in in vitro differentiated TRPV4-/- (right) and WT (left) primary adipocytes at basal, and after stimulation with ⁇ or ⁇ norepinephrine (NE) for 4 hours.
  • FIG. llC depicts chemokines and Tnfa mRNA expression in in vitro differentiated TRPV4-/- (right) and WT (left) primary adipocytes.
  • Adipose cells play a number of key roles in systemic energy balance and metabolic regulation.
  • white adipose cells are the primary depot for energy storage in mammals
  • brown adipose cells are an important component in whole body energy homeostasis through the dissipation of stored chemical energy in the form of heat (thermogenesis).
  • thermogenesis adipose cells become enlarged and adipose tissue becomes inflamed.
  • Obesity is associated with chronic inflammation in adipose tissue.
  • Cytokines such as TNFa and IL- ⁇ are secreted from immune cells in the inflamed adipose tissue, which may contribute to systemic insulin resistance.
  • This disclosure features, inter alia, methods of treating or preventing a disorder, e.g., a metabolic disorder, e.g., obesity and diabetes, or a symptom thereof, in a subject, by selectively promoting an anti-disorder activity ⁇ e.g., anti-metabolic disorder activity) with a treatment, e.g., a compound, e.g., a therapeutic agent, that inhibits TRPV4.
  • a treatment e.g., a compound, e.g., a therapeutic agent, that inhibits TRPV4.
  • methods of screening for compounds that inhibit TRPV4 which can promote gene expression associated with an anti-disorder activity ⁇ e.g., anti-metabolic disorder activity), or eliminate unwanted gene expression associated with a disorder described herein.
  • the compounds ⁇ e.g., therapeutic agents) describe herein can bind to TRPV4 or inhibit the expression of TRPV4, and which selectively promote an anti-disorder activity ⁇ e.g., anti-metabolic disorder), e.g., over classical TRPV4 activation and/or PGCla repression, e.g., in a diseased tissue or subject.
  • an anti-disorder activity e.g., anti-metabolic disorder
  • PGCla repression e.g., in a diseased tissue or subject.
  • Cells, compositions, kits, constructs, animals, and other reagents useful or related to the compounds or methods described herein are also provided.
  • BAT Brown Adipose Tissue
  • Adipose tissue is a major endocrine organ that exerts a profound influence on whole-body energy homoeostasis.
  • WAT stores energy and is the largest energy reserve in mammals.
  • BAT is specialized for the efficient dissipation of chemical energy in the form of heat. It does this by having an exceptionally high mitochondrial content and respiration that is uncoupled from ATP synthesis. This uncoupling is mainly due to the presence of UCP1, a protein that catalyzes proton leak across the inner mitochondrial membrane. Brown fat is very prominent in rodents and human infants; and the presence of substantial brown fat deposits in adult humans has also been appreciated.
  • brown fat cells There are two distinct kinds of brown fat cells.
  • the classical type of brown fat is exemplified by the interscapular depot of rodents; these UCP1 expressing cells are derived from a muscle-like lineage that expressed Myf5/Pax7 during earlier development
  • thermogenic gene program Key transcriptional regulators of UCP1 and the broader thermogenic gene program in both types of brown adipocytes include, for example, FOXC2, C/ ⁇ , LXR, PGCla, and PRDM16. While PRDM16 plays a critical role in the cell fate determination, PGCl , C/ ⁇ and FOXC2 do not control the identity of brown fat cells per se, but regulate expression of the thermogenic gene program, including UCP1. As described herein, regulation of certain biological pathways, e.g., TRPV4 pathway, can result in increased expression of Pgcla, Ucpl and other mitochondrial genes, which can cause the white adipocytes to develop brown fatlike characteristics ("browning").
  • TRPV4 pathway can result in increased expression of Pgcla, Ucpl and other mitochondrial genes, which can cause the white adipocytes to develop brown fatlike characteristics ("browning").
  • Transient receptor potential cation channel, subfamily V, member 4 is a member of the OSM9-like transient receptor potential channel (OTRPC) subfamily in the transient receptor potential (TRP) superfamily of ion channels.
  • TRPV4 is also known as, e.g., VROAC, OTRPC4, TRP 12, CMT2C, VR-OAC, VRL-2, OSM9-like transient receptor potential channel 4, Osm-9-like TRP channel 4, osmosensitive transient receptor potential channel 4, transient receptor potential protein 12, vanilloid receptor-like channel 2, vanilloid receptor-related osmotically activated channel, VRL2, TrpV4, HMSN2C, vanilloid receptor-like protein 2, SPSMA2, vanilloid receptor-related osmotically- activated channel, or SSQTL1.
  • the nucleotide and amino acid sequences of human and mouse TRPV4, as well as the genomic locations of human and mouse TRPV4 genes, are known in the art. For example, the
  • TRPV4 isoform a are described in NCBI Reference Sequence: NM_021625.4 and NCBI Reference Sequence: NP_067638.3, respectively; and the human TRPV4 gene is located at chromosome 12q24.1.
  • TRPV4 is a Ca 2+ -permeable, nonselective cation channel that is thought to be involved in the regulation of systemic osmotic pressure. Further, the presence of a large intracellular domain on TRPV4 suggests that it may also operate as a signal transducing protein. As described herein, TRPV4 is a common cell-autonomous mediator for both thermogenic and pro-inflammatory programs in adipocytes. TRPV4 can be activated by cell swelling and cellular stretch. Since fat cells become very large in obesity, this cellular distention may activate TRPV4 and lead to the expression of the pro- inflammatory gene program described herein. As described herein, the inflammatory effect of TRPV4 on adipocytes is mediated, at least in part, by ERK1/2.
  • TRPV4 antagonists are described, e.g., in US 2011/0130400, WO 2011/119704, WO 2011/119701, WO 2011/119694, WO 2011/119693, WO 2011/091407, WO
  • PGCl Peroxisome Proliferator-activated Receptor Gamma Coactivator 1 -alpha
  • PGCla Peroxisome Proliferator-activated Receptor Gamma Coactivator 1 -alpha
  • PGCla was originally identified as a coactivator of PPARy in the control of the UCP1 promoter in brown fat cells (Puigserver et ah, 1998, Cell 92: 829-839). It binds to and coactivates most nuclear receptors as well as many transcription factors outside the nuclear receptor family.
  • PGCla plays a key role in mitochondrial biogenesis and oxidative metabolism in many tissues, linking mitochondrial biogenesis to the extracellular and extraorganismal environment.
  • PGCla gene expression is induced in brown adipose tissue by cold exposure and by agents that activate the ⁇ -adrenergic system.
  • PGCla is also known as, e.g., PGC1A, PGC-lv, PPARGC1, ligand effect modulator-6, LEM6, PPAR gamma coactivator variant form, PPARGC-1 -alpha, PPAR- gamma coactivator 1 -alpha, or peroxisome proliferative activated receptor, gamma, coactivator 1, alpha.
  • PGCla agonists are described in Arany et ah, 2008, Proc. Natl. Acad. Sci. USA
  • Suitable cells for example, fat cells or progenitors thereof, can be used for the in vitro evaluation of a treatment, e.g., a compound, e.g., a therapeutic agent, and/or for the analysis of the in vitro effect of a TRPV4 antagonist.
  • a treatment e.g., a compound, e.g., a therapeutic agent
  • TRPV4 antagonist e.g., a TRPV4 antagonist
  • Such cells can be human cells or animal cells, e.g., derived from a human or animal subject having a disorder described herein. Both primary cells and non-primary cells can be used for the analysis of the in vitro effect of a TRPV4 antagonist.
  • Exemplary primary cells include, but not limited to, primary white adipocytes (e.g., primary subcutaneous white adipocytes), primary brown adipocytes (e.g., primary subcutaneous brown adipocytes), primary beige/brite adipocytes (e.g., primary subcutaneous beige/brite adipocytes), primary white fat lineage cells, and primary brown fat lineage cells.
  • primary white adipocytes e.g., primary subcutaneous white adipocytes
  • primary brown adipocytes e.g., primary subcutaneous brown adipocytes
  • primary beige/brite adipocytes e.g., primary subcutaneous beige/brite adipocytes
  • primary white fat lineage cells e.g., primary white fat lineage cells
  • primary brown fat lineage cells e.g., primary brown fat lineage cells.
  • Exemplary non- primary cells include, but not limited to, adipocyte or preadipocyte cell lines (e.g., white adipose or preadipocyte cell lines (e.g., SGBS, hMADS, 3T3L1/3T3 F442A, Obl7, PFC6, TA, 1246, ST13), brown adipocyte or preadipocyte cell lines (e.g., BFC-1, HB2, RBM-Ad, C3H10T1/2, HIB, T37i), and beige/brite adipocyte or preadipocyte cell lines), cell lines of white fat lineage, and cell lines of brown fat lineage.
  • the cells described herein can contain a reporter gene.
  • the reporter gene can be placed under the control of, e.g., inserted at, e.g., the transcription of which is initiated from, a genetic locus comprising a gene described herein, e.g., a gene in the TRPV4 pathway, e.g., TRPV4 or PGCla. Gene expression.
  • in vitro cell cultures can be grown in the presence of a compound, e.g., a TRPV4 antagonist, or a suitable control, for a predetermined length of time, e.g., at least about 1 hour, 2 hours, 5 hours, 10 hours, 15 hours, 20 hours, 1 day, 2 days, 3 days, 4 days, or 5 days, and gene expression analyzed.
  • a predetermined length of time e.g., at least about 1 hour, 2 hours, 5 hours, 10 hours, 15 hours, 20 hours, 1 day, 2 days, 3 days, 4 days, or 5 days, and gene expression analyzed.
  • the level of gene expression can be assayed by determining the level of mRNA expression of the gene of interest (e.g., a gene described herein) using quantitative real time reverse transcription polymerase chain reaction (q-RT-PCR), using standard q-RT-PCR techniques known to those skilled in the art.
  • q-RT-PCR quantitative real time reverse transcription polymerase chain reaction
  • specific genes sets may be analyzed. For example, the level of expression of genes associated with adipose oxidative metabolism, inflammation and energy homeostasis, e.g., one or more genes describe in Table 1, can be assayed.
  • Cellular transcriptional changes caused by a compound, e.g., a TRPV4 antagonist, in vitro can also be assayed using gene expression arrays using techniques known to those skilled in the art; and immunohistochemistry techniques, also known to those skilled in the art.
  • Mitochondrial Biogenesis The effect of a treatment, e.g., a compound, e.g., a therapeutic agent, e.g., a TRPV4 antagonist, on in vitro cellular mitochondrial biogenesis can be measured using several techniques known to those skilled in the art. In vitro cellular mitochondrial biogenesis can be measured by examining the level of
  • mitochondrial DNA mitochondrial DNA (mtDNA) using southern blot analysis as described in the literature and known to those skilled in the art.
  • Mitochondrial biogenesis can also be analyzed by examining the level of expression of genes involved in mitochondrial biogenesis, e.g., mTFA or NRF-1, using q-RT-PCR.
  • In vitro cellular mitochondrial biogenesis can also be analyzed by transmission electron microscopy (TEM) using standard protocols known to those skilled in the art. TEM can also be used to analyze mitochondria size and density of cristae, and TEM coupled with quantitative morphometric analysis can be used to measure mitochondrial density (mitochondrial number/cytoplasmic area), using standard TEM techniques. Oxygen consumption.
  • TEM transmission electron microscopy
  • a treatment e.g., a compound, e.g., a therapeutic agent, e.g., a TRPV4 antagonist
  • an oxygen electrode e.g., Clark-type electrode
  • Oxygen consumption can also be used as measure of cellular respiration.
  • uncoupled respiration can be determined by adding an ATP synthase inhibitor, e.g., oligomycin (2 ⁇ g/mL) to the cultured cells, using standard protocols known to those skilled in the art.
  • levels of uncoupled respiration in response to cAMP may be beneficial to evaluate levels of uncoupled respiration in response to cAMP, as a characteristic of brown adipocytes is a high rate of uncoupled respiration in response to cAMP.
  • Levels of uncoupled respiration in response to cyclic AMP can be evaluated via treatment of the cultured cells with 0.5mM dibutyryl-cAMP for 12 hours prior to measuring oxygen consumption, using standard protocol known to those skilled in the art.
  • the cultured cells can be analyzed for expression of genes related to thermogenesis, e.g., UPC1 and PCGla.
  • Glucose uptake The effect of a treatment, e.g., a compound, e.g., a therapeutic agent, e.g., a TRPV4 antagonist, on glucose uptake in vitro can be analyzed by positron emission tomography (PET) with fluorodeoxyglucose ( 18 FDG), using standard PET scan techniques previously published and known to those skilled in the art. Active brown adipose tissue functions as a repository for glucose disposal and thus features increased levels of glucose uptake. PET measures glucose uptake, and can thus be used to detect functioning brown adipose tissue in vitro.
  • PET positron emission tomography
  • 18 FDG fluorodeoxyglucose
  • a suitable in vivo animal model (e.g., mouse model) can be used to evaluate the effect of a treatment, e.g., a compound, e.g., a therapeutic agent, e.g., a TRPV4 antagonist, on the treatment of a disorder described herein, e.g., a metabolic disorder, e.g., obesity (e.g., diet induced obesity) or diabetes (e.g., insulin resistant diabetes).
  • a suitable mouse model of obesity and diabetes can be obtained or rendered by feeding
  • mice are administered with a compound, e.g., a TRPV4 antagonist, e.g., by injection (e.g., intravenous injection), or oral administration, and the presence and activity of the compound, e.g. , the TRPV4 antagonist, can be analyzed at predetermined time points post administration, e.g., 5 days, 7 days, 10 days, 14 days, 21 days, etc; post
  • the level of the compound e.g. , the TRPV4 antagonist
  • the level of the compound can be analyzed in the mouse plasma derived from tail blood sampling and/or in the mouse fat pads post mouse sacrifice, collection, and processing of the fat pad tissue.
  • Methods of measuring the level of a compound, e.g., a TRPV4 antagonist are known in the art, e.g., HPLC, MS, ELISA, and qRT-PCR. Experimental results can be compared to a control group of mice administered a suitable control compound.
  • Gene expression The effect of a treatment, e.g., a compound, e.g., a therapeutic agent, e.g., a TRPV4 antagonist, on the level of gene expression of a gene of interest (e.g., a gene described herein) can be analyzed by measuring the mRNA level of transcripts of interest using q-RT-PCR.
  • Genes of interest can include, for example, genes associated with adipose oxidative metabolism, inflammation and energy homeostasis, e.g., one or more genes describe in Table 1.
  • Transcriptional changes caused by a compound, e.g., a TRPV4 antagonist can also be assayed using gene expression arrays using techniques known to those skilled in the art; and immunohistochemistry techniques, also known to those skilled in the art.
  • Body fat and weight To evaluate the effect of a treatment, e.g., a compound, e.g., a therapeutic agent, e.g., a TRPV4 antagonist, on animal weight and body fat parameters, animal body weight can be measured using a suitable scale; and analysis of body fat content can be measured using a dual energy X-ray absorptiometry (DEXA) scanner, both utilizing standard protocols known to those skilled in the art.
  • DEXA dual energy X-ray absorptiometry
  • Whole body NMR, MRI, and X-ray computer topogromy e.g., CT and micro-CT
  • CT and micro-CT X-ray computer topogromy
  • Metabolic parameters Metabolic disorders, such as obesity and diabetes (e.g., diet induced insulin resistant diabetes) can be associated with impaired insulin and glucose tolerance as well as elevated levels of fasting plasma insulin and glucose concentrations.
  • a treatment e.g., a compound, e.g., a therapeutic agent, e.g., a TRPV4 antagonist
  • standard metabolic tests known to those skilled in the art can be performed using standard techniques.
  • In vivo insulin tolerance can be tested using a standard insulin tolerance test known to those skilled in the art. Briefly, mice fasted for several hours are injected intraperitoneally with insulin at approximately 0.8U/kg.
  • Fasting plasma insulin concentrations can be measured using a standard insulin enzyme linked immunosorbant assay (ELISA) using plasma derived from tail blood sampling at specific time points pre and post insulin administration.
  • ELISA insulin enzyme linked immunosorbant assay
  • In vivo glucose tolerance can be tested using a standard glucose tolerance test known to those skilled in the art. Briefly, mice fasted for several hours are injected intraperitoneally with glucose at approximately 2 g/kg.
  • Fasting plasma glucose concentrations can be measured using a standard glucometer using plasma derived from tail blood sampling at specific time points pre and post glucose
  • Insulin resistance is indicated by elevated fasting plasma insulin and fasting plasma glucose concentrations, as well as impaired glucose and insulin tolerance.
  • Glucose uptake The effect of a treatment, e.g., a compound, e.g., a therapeutic agent, e.g., a TRPV4 antagonist, on glucose uptake in vivo can be analyzed by positron emission tomography (PET) with fluorodeoxyglucose ( 18 FDG), using standard PET scan techniques previously published and known to those skilled in the art. Active brown adipose tissue functions as a repository for glucose disposal and thus features increased levels of glucose uptake. PET measures glucose uptake, and can thus be used to detect functioning brown adipose tissue in vivo. PET scans can be conducted on the mice or tissue derived from the mice using standard PET scan techniques previously published and known to those skilled in the art.
  • Oxygen consumption The effect of a treatment, e.g., a compound, e.g., a therapeutic agent, e.g., a TRPV4 antagonist, on oxygen consumption can be measured using Comprehensive Lab Animal Monitoring System (CLAM) cages.
  • CLAM Comprehensive Lab Animal Monitoring System
  • the principal setup of the CLAM based respirometric system has been previously published and is known to those skilled in the art. Briefly, volumes of oxygen consumed and volumes of carbon dioxide produced by each mouse can be measured at specific time intervals using electrochemical oxygen and carbon dioxide analyzers. Oxygen and carbon dioxide readings can further be converted to metabolic rate. Energy intake and energy expenditure.
  • the effect of a treatment e.g., a compound, e.g., a therapeutic agent, e.g., a TRPV4 antagonist
  • energy intake in vivo can be measured by the level of food consumption.
  • the effect of a compound, e.g., a TRPV4 antagonist, on energy expenditure in vivo can be measured using several techniques known to those skilled in the art. Energy expenditure can be a measure of oxygen consumption, measured as described above; physical activity, which can be simultaneously, measured using the CLAM cages using standard protocols known to those skilled in the art; and/or thermogenesis, measured as described below.
  • thermogenesis Thermogenic capacity and thermogenesis.
  • a treatment e.g., a compound, e.g., a therapeutic agent, e.g., a TRPV4 antagonist
  • TRPV4 antagonist a therapeutic agent
  • thermogenic capacity can be examined by several techniques, known to those skilled in the art.
  • Shivering thermogenesis can be evaluated by conducting a standard cold challenge assay, using standard protocols known to those skilled in the art. Briefly, mice can be exposed to a below thermoneutral temperature, e.g., 4°C, and their subsequent shivering response and core body temperature monitored at several predetermined time points pre and post the start of cold exposure. The mice can be analyzed for the display of signs of insensitivity to the cold, e.g., the ability to keep their body temperature around baseline; or sensitivity to the cold, e.g., a sustained drop in body temperature or hypothermia or lethal hypothermia.
  • the effect of a compound, e.g., a TRPV4 antagonist, on mouse thermogenesis can also be measured by collecting brown fat tissue after several predetermined time points pre and post cold exposure and analyzing the gene expression of genes associated with mouse thermogenesis and brown fat cell thermogenesis, e.g., UCP1, PGCl .
  • mice acclimated to a below thermoneutral temperature e.g., 4°C
  • mice acclimated to a below thermoneutral temperature e.g., 4°C
  • mice acclimated to a below thermoneutral temperature e.g., 4°C
  • mice acclimated to a below thermoneutral temperature e.g., 4°C
  • norepinephrine e.g., 4°C
  • temperature and oxygen consumption is measured as described above at several predetermined time points pre and post norepinephrine administration.
  • the effect of a compound, e.g., a TRPV4 antagonist, on mouse non-shivering thermogenesis can also be measured by collecting brown fat tissue after several predetermined time points post epinephrine administration and analyzing the gene expression of genes associated with mouse thermogenesis and brown fat cell thermogenesis, e.g., UCP1, PGCla. Reporter Genes
  • the cells described herein can contain a reporter gene, e.g., for evaluating a treatment described herein.
  • a reporter gene encodes any protein that is useful for monitoring gene expression.
  • the reporter can itself be detected; or a product produced or catalyzed by the reporter can be detected; or the reporter can be a change in a property of the cell, e.g., growth, morphology, viability, and the like.
  • the reporter gene can encode a protein which luminesces or fluoresces, which is colored or produces a colored substrate or an enzymatic activity, e.g., phosphatase activity.
  • reporter proteins include, e.g., luciferase proteins, fluorescent proteins, chemiluminescent proteins, proteins that can be detected by immunostaining, proteins that can be identified by their enzymatic activity, and radioactively-labeled proteins.
  • the reporter gene is heterologous to the control region under which it is placed.
  • Exemplary luciferase proteins include, e.g., firefly luciferase and Renilla luciferase.
  • luminescent reactions light is produced by the oxidation of a luciferin.
  • Photon emission can be detected by light sensitive apparatus such as a luminometer or modified optical microscopes.
  • Exemplary fluorescent proteins include, e.g., enhanced blue fluorescent protein (EBFP), enhanced blue fluorescent protein-2 (EBFP2), mKATE, iRFP (infrared fluorescent protein), enhanced yellow fluorescent protein (EYFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP), Katushka, Ds-Red express, TurboRFP, TagRFP, green fluorescent protein (GFP), blue fluorescent protein (BFP), cyan fluorescent protein(CFP), enhanced green fluorescent protein (EGFP), AcGFP,
  • EBFP enhanced blue fluorescent protein
  • EBFP2 enhanced blue fluorescent protein-2
  • mKATE iRFP (infrared fluorescent protein)
  • EYFP enhanced yellow fluorescent protein
  • YFP yellow fluorescent protein
  • RFP red fluorescent protein
  • Katushka Ds-Red express
  • TurboRFP TagRFP
  • green fluorescent protein GFP
  • BFP blue fluorescent protein
  • CFP enhanced green fluorescent protein
  • AcGFP AcGFP
  • TurboGFP Emerald, Azami Green, ZsGreen, Sapphire, T-Sapphire, enhanced cyan fluorescent protein (ECFP), mCFP, Cerulean, CyPet, AmCyanl, Midori-Ishi Cyan, mTFPl (Teal), Topaz, Venus, mCitrine, YPet, PhiYFP, ZsYellowl, mBanana, Kusabira Orange, mOrange, dTomato, dTomato-Tandem, DsRed, DsRed2, DsRed-Express (Tl), DsRed-Monomer, mTangerine, mStrawberry, AsRed2, mRFPl, JRed, mCherry, HcRedl, mRaspberry, HcRedl, HcRed-Tandem, mPlum, and AQ143. Fluorescent proteins can be assayed, e.g., by FACS
  • reporter proteins include beta-galactosidase (encoded by the lacZ gene), any polypeptide comprising a detectable protein tag, such as a FLAG tag or HISx6 tag, a c-myc tag or a HaloTag® (Promega Corporation).
  • Reporter gene expression can be assayed by immunohistochemistry, e.g., by detecting expressed proteins with antibodies labeled with different detectable probes (e.g., Alexa fluor®, Oregon Green® or Pacific Blue®; horseradish peroxidase (HRP) and alkaline phosphatase (AP)).
  • detectable probes e.g., Alexa fluor®, Oregon Green® or Pacific Blue®; horseradish peroxidase (HRP) and alkaline phosphatase (AP)
  • beta-galactosidase is assayed using X-Gal substrate.
  • the cells described herein e.g., genetic engineered fat cells described herein, can be produced by methods of gene targeting.
  • Methods for gene targeting and producing genetic engineered cells are known in the art, e.g., as described in Morrow B. and
  • the disclosure also features a pharmaceutical composition
  • a pharmaceutical composition comprising a compound, e.g., a therapeutic agent, e.g., a TRPV4 antagonist, e.g., a TRPV4 antagonist described herein, and a pharmaceutically acceptable excipient.
  • a pharmaceutical composition may take the form of a pharmaceutical formulation described below.
  • the pharmaceutical formulations according to the disclosure include those suitable for the route of administration, e.g., oral and parenteral (including subcutaneous, intradermal, intramuscular, intravenous, and intraarticular) administration, although the most suitable route may depend upon, for example, the condition and disorder of the recipient.
  • the formulations may be conveniently presented in unit dosage form and may be prepared by any of the methods well known in the art.
  • compositions for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the composition isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents.
  • the formulations may be presented in unit-dose or multi-dose containers, for example sealed ampoules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example saline or water-for-injection, e.g., immediately prior to use.
  • compositions for parenteral administration include injectable solutions or suspensions which can contain, for example, suitable non-toxic, parenterally acceptable diluents or solvents, such as mannitol, 1,3-butanediol, water, Ringer's solution, an isotonic sodium chloride solution, or other suitable dispersing or wetting and suspending agents, including synthetic mono- or diglycerides, and fatty acids, including oleic acid, or Cremaphor.
  • suitable non-toxic, parenterally acceptable diluents or solvents such as mannitol, 1,3-butanediol, water, Ringer's solution, an isotonic sodium chloride solution, or other suitable dispersing or wetting and suspending agents, including synthetic mono- or diglycerides, and fatty acids, including oleic acid, or Cremaphor.
  • An aqueous carrier may be, for example, an isotonic buffer solution at a pH of from about 3.0 to about 8.0, e.g., at a pH of from about 3.5 to about 7.4, for example from 3.5 to 6.0, for example from 3.5 to about 5.0.
  • Useful buffers include sodium citrate-citric acid and sodium phosphate-phosphoric acid, and sodium acetate/acetic acid buffers.
  • Excipients that can be included are, for instance, other proteins, such as human serum albumin or plasma preparations.
  • the pharmaceutical composition may also contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
  • Typical unit dosage compositions are those containing an effective dose, or an appropriate fraction thereof, of the active ingredient.
  • composition may include other agents conventional in the art having regard to the type of formulation in question.
  • the compounds e.g., TRPV4 antagonists described herein, are also suitably administered as sustained-release systems.
  • sustained-release systems include suitable polymeric materials, for example semi-permeable polymer matrices in the form of shaped articles, e.g., films, or microcapsules; suitable
  • hydrophobic materials for example as an emulsion in an acceptable oil; or ion exchange resins; and soluble derivatives thereof, for example, a sparingly soluble salt.
  • compositions for administration can be suitably formulated to give controlled release of a compound, e.g., a TRPV4 antagonist, e.g., a TRPV4 antagonist described herein.
  • a compound e.g., a TRPV4 antagonist, e.g., a TRPV4 antagonist described herein.
  • the pharmaceutical compositions may be in the form of particles comprising one or more of biodegradable polymers, polysaccharide jellifying and/or bioadhesive polymers, amphiphilic polymers, agents capable of modifying the interface properties of the particles of the compound featured in the invention. These compositions exhibit certain biocompatibility features which allow a controlled release of the active substance. See U.S. Patent No. 5,700,486.
  • a therapeutically effective amount of a compound, e.g., a TRPV4 antagonist described herein can be administered as a single pulse dose, as a bolus dose, or as pulse doses administered over time.
  • a bolus administration of a compound featured in the invention is provided, followed by a time period wherein the compound, e.g., the TRPV4 antagonist, is administered to the subject, followed by a second bolus administration.
  • pulse doses of a compound, e.g., a TRPV4 antagonist are administered during the course of a day, during the course of a week, or during the course of a month.
  • the compound, e.g., the TRPV4 antagonist is administered twice weekly, weekly, once every two weeks, once every three weeks or preferable once every month, month and a half or two months.
  • the therapeutically effective amount of a compound e.g., a TRPV4 antagonist, will be dependent on the molecule utilized, the subject being treated, the severity and type of the affliction, and the manner and route of administration.
  • the disclosure features the use of a TRPV4 antagonist described herein for the treatment or prevention of a disorder.
  • treating refers to partially or completely alleviating, ameliorating, improving, relieving, delaying onset of, inhibiting progression of, reducing severity of, and/or reducing incidence of one or more symptoms, features, or clinical manifestations of a particular disorder or condition.
  • Treatment may be administered to a subject who does not exhibit signs of a disorder or condition (e.g., prior to an identifiable disorder or condition), or to a subject who exhibits only early signs of a disorder or condition for the purpose of decreasing the risk of developing pathology associated with the disorder or condition.
  • treatment comprises delivery of a TRPV4 antagonist to a subject in need thereof.
  • preventing refers to partially or completely delaying onset of a particular disorder or condition; partially or completely delaying onset of one or more symptoms, features, or clinical manifestations of a particular disorder or condition (e.g., prior to an identifiable disorder or condition);
  • the phrase "therapeutically effective amount” means an amount of an agent to be delivered (e.g., a TRPV4 antagonist) that is sufficient, when administered to a subject suffering from or susceptible to a disorder or condition, to treat, improve symptoms of, diagnose, prevent, and/or delay the onset of the disorder or condition.
  • an agent to be delivered e.g., a TRPV4 antagonist
  • Exemplary disorders or conditions that can be treated or prevented by the compounds and methods described herein include, e.g., metabolic disorders, e.g., obesity or diabetes, a comorbidity of obesity or diabetes, an obesity or diabetes related disorder, or a disorder in which one or more symptoms can be alleviated by exercise or diet.
  • the subject to whom the compound is administered may be overweight, for example, obese.
  • the subject can have a body mass index (BMI) at least about 25, e.g., from about 25 to about 30, from about 30 to about 35, from about 35 to 40, or greater than about 40.
  • BMI body mass index
  • the subject may be diabetic, for example having insulin resistance or glucose intolerance, or both.
  • the subject may have diabetes mellitus, for example, the subject may have Type II diabetes.
  • the subject may be overweight, for example, obese and have diabetes mellitus, for example, Type II diabetes.
  • the subject may have, or may be at risk of having, a disorder in which obesity or being overweight is a risk factor.
  • disorders include, but are not limited to, cardiovascular disease, for example hypertension, atherosclerosis, congestive heart failure, and dyslipidemia; stroke; gallbladder disease; osteoarthritis; sleep apnea; reproductive disorders for example, polycystic ovarian syndrome; cancers, for example breast, prostate, colon, endometrial, kidney, and esophagus cancer; varicose veins; acanthosis nigricans; eczema; exercise intolerance; insulin resistance;
  • hypertension hypercholesterolemia; cholithiasis; osteoarthritis; orthopedic injury; insulin resistance, for example, type 2 diabetes and syndrome X; metabolic syndrome; and thromboembolic disease (see Kopelman (2000), Nature 404:635-43; Rissanen et ah, British Med. J. 301, 835, 1990).
  • obesity Other disorders associated with obesity include depression, anxiety, panic attacks, migraine headaches, PMS, chronic pain states, fibromyalgia, insomnia, impulsivity, obsessive-compulsive disorder, irritable bowel syndrome (IBS), and myoclonus.
  • IBS irritable bowel syndrome
  • obesity is a recognized risk factor for increased incidence of complications of general anesthesia. ⁇ See e.g., Kopelman, Nature 404:635-43, 2000). In general, obesity reduces life span and carries a serious risk of co-morbidities such as those listed above.
  • Other diseases or disorders associated with obesity are birth defects, maternal obesity being associated with increased incidence of neural tube defects, carpal tunnel syndrome (CTS); chronic venous insufficiency (CVI); daytime sleepiness; deep vein thrombosis (DVT); end stage renal disease (ESRD); gout; heat disorders; impaired immune response; impaired respiratory function; infertility; liver disease; lower back pain; obstetric and gynecologic complications; pancreatititis; as well as abdominal hernias; acanthosis nigricans; endocrine abnormalities; chronic hypoxia and hypercapnia; dermatological effects; elephantitis; gastroesophageal reflux; heel spurs; lower extremity edema; mammegaly which causes considerable problems such as bra strap pain, skin damage, cervical pain, chronic odors and infections in the skin folds under the breasts, etc.; large anterior abdominal wall masses, for example abdominal panniculitis with frequent panniculitis, impeding walking, causing frequent infections, odors
  • Conditions or disorders associated with increased caloric intake include, but are not limited to, insulin resistance, glucose intolerance, obesity, diabetes, including type 2 diabetes, eating disorders, insulin-resistance syndromes, metabolic syndrome X, and Alzheimer's disease.
  • Disorders in which one or more symptoms can be alleviated by exercise include, but not limited to, cardiovascular disease, neurodegenerative diseases, e.g., multiple sclerosis, Parkinson's disease and Alzheimer's disease; certain cancers, e.g., prostate, breast, colon; certain intestinal disorders, e.g., ulcers, irritable bowel syndrome, indigestion, diverticulosis, gastrointestinal bleeding; certain emotional disorders, e.g., depression, menopause related emotional symptoms, e.g., anxiety, stress, depression.
  • cardiovascular disease e.g., neurodegenerative diseases, e.g., multiple sclerosis, Parkinson's disease and Alzheimer's disease
  • certain cancers e.g., prostate, breast, colon
  • certain intestinal disorders e.g., ulcers, irritable bowel syndrome, indigestion, diverticulosis, gastrointestinal bleeding
  • certain emotional disorders e.g., depression, menopause related emotional symptoms, e.g., anxiety, stress, depression.
  • the disclosure also features compounds, e.g., TRPV4 antagonists, for use as a medicament for the prevention or treatment of diseases and disorders described herein, e.g., a metabolic disorder, e.g., obesity, or obesity related disorders, or disorders in which exercise can alleviate one or more symptoms, or age-related disorders.
  • a metabolic disorder e.g., obesity, or obesity related disorders, or disorders in which exercise can alleviate one or more symptoms, or age-related disorders.
  • the compounds, e.g., TRPV4 antagonists described herein, can also be administered in combination with another agent, for example, a treatment for lipolysis, an antihypertension treatment, a treatment for dyslipidemia, and/or a treatment for type 2 diabetes.
  • Administered "in combination", as used herein, means that two (or more) different treatments are delivered to the subject during the course of the subject's affliction with the disorder, e.g., the two or more treatments are delivered after the subject has been diagnosed with the disorder or diagnosed as being at risk for the disorder and before the disorder has been cured or eliminated, or before the symptom or symptoms associated with risk for the disorder have been alleviated or eliminated or treatment has ceased for other reasons.
  • the delivery of one treatment is still occurring when the delivery of the second begins, so that there is overlap in terms of administration. This is sometimes referred to herein as “simultaneous" or “concurrent delivery”.
  • the delivery of one treatment ends before the delivery of the other treatment begins.
  • the treatment is more effective because of combined administration.
  • the second treatment is more effective, e.g., an equivalent effect is seen with less of the second treatment, or the second treatment reduces symptoms to a greater extent, than would be seen if the second treatment were administered in the absence of the first treatment, or the analogous situation is seen with the first treatment.
  • delivery is such that the reduction in a symptom, or other parameter related to the disorder is greater than what would be observed with one treatment delivered in the absence of the other.
  • the effect of the two treatments can be partially additive, wholly additive, or greater than additive.
  • the delivery can be such that an effect of the first treatment delivered is still detectable when the second is delivered.
  • Exemplary treatment for lipolysis includes, but not limited to, a beta 3 agonist (e.g., Amibegron (SR-58611A), Solabegron (GW-427,353), Nebivolol, L-796,568, CL- 316,243, LY-368,842, Ro40-2148 and Octopamine).
  • a beta 3 agonist e.g., Amibegron (SR-58611A), Solabegron (GW-427,353), Nebivolol, L-796,568, CL- 316,243, LY-368,842, Ro40-2148 and Octopamine.
  • Exemplary anti-hypertension treatment include, but not limited to, diuretic, e.g., hydrochlorothiazide, Acetazolamide, Chlorthalidone, Hydrochlorothiazide, Indapamide, Metolazone, Amiloride hydrochloride, Bumetanide, Ethacrynic acid Furosemide, Spironolactone, Torsemide, Triamterene; beta-blockere.g., Acebutolol, Atenolol, Betaxolol, Bisoprolol, Carteolol, Carvedilol, Labetalol, Metoprolol Nadolol, Penbutolol, Propranolol, Timolol; angiotensin II receptor blockers, e.g., Candesartan, Irbesartan, Losartan, Telmisartan, Valsartan; angiotensin-converting enzyme inhibitors e.g
  • Quinapril, Ramipril, Trandolapril alpha blockers, centrally acting drugs, vasodialators, rennin inhibitors, calcium channel blockers, e.g., Amlodipine, Diltiazem, Felodipine, Isradipine, Nicardipine, Nifedipine, Nisoldipine, Verapamil hydrochloride; combination therapies, e.g., Amiloride and hydrochlorothiazide, Amlodipine and benazepril, Atenolol and chlorthalidone, Benazepril and hydrochlorothiazide, Bisoprolol and
  • hydrochlorothiazide Felodipine and enalapril, Hydralazine and hydrochlorothiazide, Lisinopril and hydrochlorothiazide, Losartan and hydrochlorothiazide, Methyldopa and hydrochlorothiazide, Metoprolol and hydrochlorothiazide, Nadolol and bendroflumethiazide, Propranolol and hydrochlorothiazide, Spironolactone and hydrochlorothiazide, Triamterene and hydrochlorothiazide, Verapamil and trandolapril.
  • Exemplary treatment for dyslipidemia includes, but not limited to, statins, e.g., Atorvastatin (Lipitor®), Fluvastatin (Lescol®), Lovastatin (Mevacor®), Pravastatin (Pravachol®), Simvastatin (Zocor®), Rosuvastatin (Crestor®); Bile acid sequestrants, e.g., Questran® and Questran Light®, Colestid®, WelChol®; Niacin, e.g., Nicolar®, Niaspan®; Fibrates, e.g., Atromid®, Tricor®, Lopid®, Lofibra® (fenofibrate);
  • statins e.g., Atorvastatin (Lipitor®), Fluvastatin (Lescol®), Lovastatin (Mevacor®), Pravastatin (Pravachol®), Simvastatin (Zocor®), Rosuvastatin (Cre
  • Ezetimibe Omega-3 fatty acids, e.g., Lovaza®; Combination statin and niacin, e.g., Advicor® (niacin-lovastatin); Combination cholesterol absorption inhibitor and statin, e.g., Vytorin® (ezetimibe- simvastatin).
  • Combination statin and niacin e.g., Advicor® (niacin-lovastatin)
  • Combination cholesterol absorption inhibitor and statin e.g., Vytorin® (ezetimibe- simvastatin).
  • Exemplary treatment for type 2 diabetes include, but not limited to, Meglitinides, e.g., Repaglinide (Prandin®), Nateglinide (Starlix®); Sulfonylureas, e.g., Glipizide (Glucotrol®), Glimepiride (Amaryl®), Glyburide (DiaBeta®, Glynase®); Dipeptidy peptidase-4 (DPP-4) inhibitors, e.g., Saxagliptin (Onglyza®), Sitagliptin (Januvia®), Linagliptin (Tradjenta®); Biguanides, e.g., Metformin (Fortamet®, Glucophage®, etc); Thiazolidinediones, e.g., Rosiglitazone (Avandia®), Pioglitazone (Actos®); Alpha- glucosidase inhibitors, e.g., Acar
  • kits can be provided in a kit, e.g., as a component of a kit.
  • the kit includes (a) a compound, e.g., a TRPV4 antagonist, e.g., a composition (e.g., a pharmaceutical composition) that includes a compound, e.g., a TRPV4 antagonist, and, optionally (b) informational material.
  • the informational material can be descriptive, instructional, marketing or other material that relates to a method described herein and/or the use of a compound, e.g., a TRPV4 antagonist, e.g., for a method described herein.
  • the kit can include (a) a container that contains a cell described herein; optionally (b) reagents and buffers for use with the cell, e.g., for evaluating a treatment; and optionally (c) informational material.
  • the informational material of the kit is not limited in its form. In one
  • the informational material can include information about production of the compound, molecular weight of the compound, concentration, date of expiration, batch or production site information, and so forth.
  • the informational material relates to using the compound, e.g., the TRPV4 antagonist, to treat, prevent, or diagnosis of disorders and diseases, e.g., disorders and diseases described herein.
  • the information material relates to the use of the cells described herein for evaluating a treatment, e.g., a compound, e.g., a therapeutic agent, e.g., a TRPV4 antagonist.
  • the informational material can include instructions to administer a compound, e.g., a TRPV4 antagonist, in a suitable manner to perform the methods described herein, e.g., in a suitable dose, dosage form, or mode of administration (e.g., a dose, dosage form, or mode of administration described herein).
  • the informational material can include instructions to administer a compound, e.g., a TRPV4 antagonist, to a suitable subject, e.g., a human, e.g., a human having, or at risk for, a disorder or disease described herein.
  • the material can include instructions to administer a compound, e.g., a TRPV4 antagonist, to a patient with a disorder or condition described herein, e.g., a metabolic disorder, e.g., diabetes or obesity.
  • a disorder or condition described herein e.g., a metabolic disorder, e.g., diabetes or obesity.
  • the informational material of the kits is not limited in its form. In many cases, the informational material, e.g., instructions, is provided in print but may also be in other formats, such as computer readable material.
  • the compounds, e.g., the TRPV4 antagonists described herein, can be provided in any form, e.g., liquid, dried or lyophilized form. It is preferred that a compound, e.g., a TRPV4 antagonist, be substantially pure and/or sterile.
  • a compound, e.g., a TRPV4 antagonist is provided in a liquid solution, the liquid solution preferably is an aqueous solution, with a sterile aqueous solution being preferred.
  • a compound, e.g., a TRPV4 antagonist is provided as a dried form, reconstitution generally is by the addition of a suitable solvent.
  • the solvent e.g., sterile water or buffer
  • the kit can include one or more containers for the composition containing a compound, e.g., a TRPV4 antagonist described herein.
  • the kit contains separate containers, dividers or compartments for the composition and informational material.
  • the composition can be contained in a bottle, vial, or syringe, and the informational material can be contained in association with the container.
  • the separate elements of the kit are contained within a single, undivided container.
  • the composition is contained in a bottle, vial or syringe that has attached thereto the informational material in the form of a label.
  • the kit includes a plurality (e.g., a pack) of individual containers, each containing one or more unit dosage forms (e.g., a dosage form described herein) of a compound, e.g., a TRPV4 antagonist.
  • the kit includes a plurality of syringes, ampules, foil packets, or blister packs, each containing a single unit dose of a compound, e.g., a TRPV4 antagonist.
  • the containers of the kits can be air tight, waterproof (e.g., impermeable to changes in moisture or evaporation), and/or light-tight.
  • the kit optionally includes a device suitable for administration of the
  • composition e.g., a syringe or any such delivery device.
  • the disclosure also features a method of providing a kit, e.g., by combining components described herein.
  • the following examples present, at least in part, a quantitative high throughput screen to identify compounds (e.g., small molecules) that can inhibit TRPV4 activity and/or induce PGCla expression in adipocytes.
  • Small molecules antagonizing the TRPVs (Transient Receptor Potential Vanilloid), a family of ion channels, induced PGCl expression in adipocytes.
  • TRPVs Transient Receptor Potential Vanilloid
  • inhibition of TRPV4 increased expression of PGCl , UCP1 and cellular respiration; conversely, chemical activation of TRPV4 repressed this pathway.
  • Blocking TRPV4 in cultured adipocytes also reduced the expression of multiple pro-inflammatory genes that are involved in the development of insulin resistance.
  • mice with a null mutation for TRPV4 showed higher energy expenditure with no change in movement or food intake, and were protected from diet-induced obesity, adipose inflammation, and insulin resistance. This study indicates that TRPV4 and related biological pathways can be used as therapeutic targets for metabolic disorders, including, but not limited to, obesity and diabetes.
  • Example 1 A chemical screen identifies TRPVs as negative regulators of Pgcla expression
  • a quantitative PCR-based chemical screen was performed to identify small molecules that can induce Pgcla mRNA expression in white adipocytes.
  • Fully differentiated 3T3- F442A adipocytes were treated with a chemical library of 3,000 drugs and drug-like compounds for 20 hours; mRNA from treated cells was then harvested and analyzed by qPCR to quantify the expression of Pgcla (FIG. 1).
  • FIGS 2A-2G shows identification of TRPVs as negative regulators of PGCl expression (data are presented as mean + sem; student' s t-test was used for single comparisons; * P ⁇ 0.05, ** P ⁇ 0.01, *** P ⁇ 0.001, compared to control group).
  • AM-251 a cannabinoid receptor 1 (CBl) antagonist was identified as one of the primary hits; it induced Pgcla mRNA 10 fold at 20uM (FIG. 2A).
  • CBl cannabinoid receptor 1
  • AM-251 is a structural analogue of another well-known CBl antagonist rimonabant (Lan et al, 1999), an anti-obesity drug that was in clinical use in Europe.
  • AM-251 is annotated as a CB l antagonist
  • two other CBl antagonists SLV319 (Lange et al, 2004, J. Med. Chem. 42: 769-776) and CAY10508 (Muccioli et al, 2006, J. Med. Chem. 49: 872-882)
  • failed to induce Pgcla at any dose tested FOG. 2A.
  • rimonabant have been reported when these compounds were used at lOuM or above, including TRPV1 (De Petrocellis et al, 2001, J. Neurochem. 77: 1660-1663; Zygmunt et al, 1999, Nature 400: 452-457).
  • TRPV1 De Petrocellis et al, 2001, J. Neurochem. 77: 1660-1663; Zygmunt et al, 1999, Nature 400: 452-457.
  • two TRPV1 antagonists increased Pgcla mRNA expression in 3T3-F442A adipocytes in a dose-dependent manner (FIG. 2B).
  • key transcriptional targets of PGCla such as Cytochrome C (CytC) and Ucpl, were also increased at the mRNA level both basally and after c AMP- stimulation (FIG. 2C).
  • AMG9810 is known to antagonize TRPV1 but can also antagonize closely related TRPVs, such as TRPV2, TRPV3 and TRPV4, at the micromolar doses used here (Gavva et al, 2005, J. Pharmacol. Exp. Ther. 313: 474-484).
  • the mRNA expression of Trpvl, Trpv2, Trpv3 and Trpv4 was compared in 3T3-F442A adipocytes. As shown in FIG. 2D, mRNAs encoding Trpvl, Trpv2 and Trpv4 were expressed in 3T3-F442A adipocytes, with Trpv4 being expressed at the highest level.
  • TRPV4 is a negative regulator of oxidative metabolism and respiration in adipocytes
  • TRPV4 is a calcium permeable, non- selective ion channel that was first identified as an osmolality sensor (Liedtke et al., 2000, Cell 103: 525-535; Strotmann et al., 2000, Nat. Cell. Biol. 2: 695-702). Since then, many physical and chemical stimuli have been shown to activate TRPV4 (Nilius et al., 2004, Am. J. Physiol. Cell Physiol. 286: C195- 205), including warmth (Guler et al., 2002, J. Neurosci. 22: 6408-6414; Watanabe et al., 2002, J. Biol. Chem.
  • FIGS. 4A-4F show that TRPV4 negatively regulates oxidative metabolism and respiration in adipocytes (data are presented as mean + sem; student' s t-test was used for single comparisons; * P ⁇ 0.05, ** P ⁇ 0.01, *** P ⁇ 0.001, compared to control group).
  • TRPV4 protein was detected by western blot (FIG. 4A).
  • intracellular calcium measurement was used as a functional assay to test for TRPV4 activity.
  • GSK1016790A a potent and selective TRPV4 agonist (Thorneloe et al, 2008, J. Pharmacol. Exp. Ther. 326: 432-442; Willette et al., 2008, J. Pharmacol. Exp. Ther. 326: 443-452), induced a robust and rapid increase in intracellular calcium concentration in adipocytes at ⁇ . This increase was dependent on TRPV4, as it was largely abolished by the shRNA against TRPV4 (FIG. 3C).
  • Pgcla mRNA expression was 3 times higher in adipocytes expressing shRNA against TRPV4 with this retroviral system, compared to controls (FIG. 4B).
  • ⁇ -adrenergic signaling is important for the induction of PGCl and its target genes in thermogenesis; when cells were exposed to norepinephrine, mRNA expression of Pgcla and its thermogenic target Ucpl was robustly increased (4-7 fold) in the TRPV4 knock-down cells compared to controls (FIG. 4B).
  • PGCla is known to drive the expression of many genes involved in mitochondrial oxidative phosphorylation, including cytochrome c (CytC), and the cytochrome C oxidative (COX) subunits (CoxIII, Cox4il, Cox5b, Cox7a and Cox8b). Higher mRNA expression of these genes (1.5-2fold) was observed in TRPV4-knockdown adipocytes compared to controls (FIG. 4C). In addition, the TRPV4-knockdown adipocytes showed significantly higher expression of proteins present in all five OXPHOS complexes (FIG. 4D).
  • TRPV4 inhibition caused the white adipocytes to develop brown fat-like characteristics, which we termed "browning" here.
  • oxygen consumption was measured in adipocytes with an oxygen sensitive Clark electrode.
  • TRPV4 knockdown has significant effects on the basal, uncoupled and maximal cellular respiration rate.
  • Adipocytes with reduced TRPV4 showed a 40% increase in basal respiration, a 30% increase in uncoupled and a 30% increase in FCCP- stimulated maximal respiration, relative to controls.
  • TRPV4 agonist GSK1016790A was added to mature 3T3-F442A adipocytes for 48 hours. While there was no difference in adipocyte differentiation, as assessed by aP2 gene expression, GSK1016790A repressed the expression of mRNAs encoding Pgcla, Ucpl and Cox8b in a dose-dependent manner (FIG. 4F). Taken together, these data strongly suggest that TRPV4 functions as a negative regulator of PGCl and oxidative metabolism in white adipocytes.
  • TRPV4 positively controls a pro-inflammatory gene program in adipocytes
  • microarray analysis of global gene expression was performed with mRNA from 3T3-F442A adipocytes expressing shRNAs against TRPV4 or GFP.
  • Table 1 shows top 35 most up-regulated and down-regulated genes affected by
  • TRPV4-knockdown in 3T3-F442A adipocytes identified from microarray analysis.
  • any gene whose expression was below 40 (Arbitrary Unit) in the experimental group was filtered; for down-regulated gene list, any gene whose expression was below 50 (A.U.) in the control group was filtered.
  • Values in the table represented means from two samples in each group.
  • cytochrome P450 family 7, subfamily b, polypeptide 1 -6.18
  • chemokines/cytokines or genes related to pro-inflammatory pathways were chemokines/cytokines or genes related to pro-inflammatory pathways (Table 1).
  • the chemokine Ccl7 (Mcp3) mRNA was decreased by more than 85% in the TRPV4 knockdown adipocytes; expression of mRNA encoding Saa3, a proinflammatory amyloid protein secreted from adipose tissue, was reduced by 98%.
  • the expression of 22 genes that are either highly regulated by TRPV4 (from the array) or are known from published literature to be important in adipose inflammation was further analyzed by qPCR.
  • TRPV4 controls pro-inflammatory gene expression in adipocytes (data are presented as mean + sem; student's t-test was used for single comparisons; * P ⁇ 0.05, ** P ⁇ 0.01, *** P ⁇ 0.001, n.s. not significant, compared to control group).
  • experimental reduction of TRPV4 expression had a profound inhibitory effect on a whole array of chemokines, such as Cell ⁇ Mcpl), Ccl3 (Mipla), Ccl5 (Rantes), Ccl7 (Mcp3), Cxcll (KC), Ccl8, Cxcl5 and Cxcll 0 and cytokines such as 116, Saa3 and Thrombospondin (FIG.
  • TRPV4 The signaling pathways by which TRPV4 carries out these functions in adipocytes were investigated. It has been reported previously that the protein kinases ERK1/2 can be activated by TRPV4 signaling (Li et ah, 2009, Environ. Health Perspect. 117: 400-409; Li et al., 2011, Environ. Health Perspect. 119: 784-793; Thodeti et al, 2009, Circ. Res. 104: 1123-1130). TRPV4 agonism and the activation of three MAP kinases that have been implicated in adipose biology: ERKl/2, JNKl/2 and P38MAPK were examined. FIGS.
  • 6A-6C show that ERKl/2 mediates the signal transduction from TRPV4 to gene expression (data are presented as mean + sem; student's t-test was used for single comparisons; * P ⁇ 0.05, ** P ⁇ 0.01, *** P ⁇ 0.001, compared to control group).
  • Addition of the TRPV4 agonist to 3T3-F442A adipocytes caused a rapid phosphorylation of both ERKl/2 and JNKl/2 at sites known to reflect activation of these kinases.
  • no activating phosphorylation on P38 MAPK was detected with TRPV4 agonism; while the p3-agonist CL316243 led to the expected P38MAPK activation (Cao et al, 2001, /. Biol.
  • Inhibitors of MEK1/2 (U0126) and JNK (SP600125) were then used to determine if the activation of these two MAP kinases was required for the key TRPV4-mediated gene regulation events.
  • pretreatment of cells with U0126 and SP600125 blocked the TRPV4 agonist-induced phosphorylation of ERKl/2 and JNKl/2, respectively.
  • U0126 effectively reversed the repression on Pgcla caused by the agonist (FIG. 6C).
  • SP600125 had only a small effect.
  • TRPV4-deficient mice have altered expression of thermogenic and proinflammatory genes in adipose tissue
  • mice with a genetic deletion of Trpv4 was studied. These mice are grossly similar to wild-type animals in morphology, behavior and breeding (Liedtke and Friedman, 2003, Proc. Natl.
  • FIG. 8A In light of the effect of TRPV4 on oxidative metabolism and expression of the pro-inflammatory genes in white adipocytes, gene expression in white adipose tissues from TRPV4-/- and WT control mice was examined. Subcutaneous adipose tissue has been shown to have a greater thermogenic capacity than other white adipose tissues (Barbatelli et ah, 2010, Am. J. Physiol. Endocrinol. Metab. 298: E1244-1253) and can significantly contribute to whole body energy homeostasis (Seale et al, 2011, J. Clin. Invest. 121: 96-105).
  • mice also have elevated mRNA levels for many genes known to be enriched in BAT, such as Cidea, Cox4il, and Cox8b (FIG. 7A).
  • Cidea Cidea
  • Cox4il Cox8b
  • FIG. 7A mRNA levels for many genes known to be enriched in BAT, such as Cidea, Cox4il, and Cox8b
  • visceral (epididymal) fat has a low thermogenic capacity and expresses very little Ucpl and Cidea (data not shown). Nonetheless, mRNA levels for fi3Adr, Pgclfi, CytC, Cox4il and Cox5a, were
  • FIGS. lOA-lOC shows that TRPV4 epididymal adipose tissue have higher thermogenic gene expression.
  • pro-inflammatory genes especially chemokines, identified from the analysis of TRPV4 knockdown 3T3-F442A adipocytes. These included Mcpl, Mipla, Mcp3, Rantes and Vcam. These genes were expressed at very low levels in the adipose tissues of lean animals and no significant differences were observed in either subcutaneous or epididymal adipose tissues between the mutants and controls on a chow diet (FIGS. 7F and 7G).
  • thermogenic genes such as ⁇ 3 ⁇ , Pgcla and Cidea were also observed in the TRPV4-/- subcutaneous fat.
  • Example 6 Increased energy expenditure protects TRPV4 deficient mice from diet induced obesity
  • TRPV4 mutant mice began to gain significantly less weight after 9 weeks on the HFD, compared to their age- and sex- matched WT littermates (FIG. 8A). Body composition analysis showed that TRPV4-/- mice had gained less fat, resulting in a higher lean/fat mass ratio compared to WT controls (FIG. 8B).
  • TRPV4-/- adipose tissue showed a 40% or 60% reduction in the expression of the macrophage marker mRNA after 8 or 16 weeks of HFD, respectively (FIG. 8F). This suggests that there were significantly fewer macrophages infiltrating in TRPV4-/- adipose tissue. Indeed, histologic analysis showed there were far fewer "crown-like-structures", previously shown to represent macrophages in fat tissues (Cinti et al, 2005, J. Lipid Res. 46: 2347-2355), in the TRPV4-/- epididymal fat compared to WT controls (FIG. 8G).
  • Tnfa a key cytokine for obesity-induced insulin resistance
  • HFD significantly increased Tnfa mRNA in WT adipose tissue, while the induction was reduced by more than 30 -40 in adipose tissue from TRPV4- /- mice (8 weeks HFD or 16 weeks HFD, respectively) (FIG. 8H).
  • IP glucose tolerance tests were first performed 7 weeks after HFD, when no difference in body weight had occurred between the two genotypes. As shown in Figure 6J, TRPV4-/- mice showed a small yet significant improvement in glucose tolerance. As these mice continued on the diet (12 weeks), the relative improvement in glucose tolerance of mutants compared to controls became more apparent (FIG. 8K).
  • Example 8 Genetic TRPV4 deficiency affects adipocyte thermo genesis and proinflammatory gene programs in a cell-autonomous manner
  • TRPV4 -/- mice Since the TRPV4 -/- mice have a whole-body TRPV4 deficiency, the phenotype observed in vivo was examined to determine whether or not it was associated with cell- autonomous alterations in adipocyte cultures derived from these mice. To examine this, stromal-vascular cells from the adipose tissue of young, lean TRPV4 -/- and WT mice were isolated and stimulated to differentiate into adipocytes in vitro. After 8 days, greater than 90% of the cells were fully differentiated.
  • chemokine/cytokines such as Mcpl, Mipla, Mcp3, Tnfa and Vcam were reduced by more than 80% in TRPV4-/- primary adipocytes (FIG. 11C). Taken together, these data indicate that TRPV4 controls two key gene expression programs related to fat metabolism in a cell autonomous manner.
  • Antibody sources are as follows: anti-UCPl and anti-OXPHOS (Abeam), anti-TRPV4 (Alomone), anti-pERKl/2, ERKl/2, pJNK, JNK, pP38, P38 (Cell Signaling).
  • Forskolin, norepinephrine, GSK1016790A, AMG9810, AM251, insulin, dexamethasone, isobutylmethylxanthine and puromycin were from Sigma.
  • BCTC was from Tocris.
  • SLV319, CAY10508 and Rosiglitazone were from Cayman Chemical.
  • U0126 and SP600125 were from Cell Signaling.
  • shRNA constructs were in pLKO vectors (for lenti virus) or pMKO vectors (for retrovirus). Sequences for all shRNA and QPCR primers are listed in Table 2. Table 2. Sequences of PCR primers and shRNAs are listed in Table 2. Table 2. Sequences of
  • shTRPV2 CCGGCCCAAGATTCTTCTTCAACTTC AATTCAAAAACCCAAGATTCTTCTTC
  • mice All animal experiments were performed according to procedures approved by the Institutional Animal Care and Use Committee of Dana-Farber Cancer Institute. Mice were either maintained on a standard rodent chow or a 60% high-fat diet (Research Diets) with 12-hour light and dark cycles. Trpv4-/- mice were provided by Dr. Liedtke (Liedtke and Friedman, 2003, Proc. Natl. Acad. Sci. USA 100: 13698-13703) and back-crossed to C57BL/6J (Jackson Lab) for 10 generations before all studies. Each study group contains 9-13 animals of each genotype.
  • 3T3-F442A pre-adipocytes were infected for 4 hour (lenti) or overnight (retro), followed by puromycin selection (2ug/ml).
  • 3T3-F442A adipocyte differentiation was induced in cultures by treating confluent cells with 850 nM insulin for 8-10 days. To stimulate thermogenesis, cells were incubated with forskolin (lOuM) or norepinephrine ( ⁇ or ⁇ ) for 4 hours.
  • TRPV1 TRPV2 and TRPV4 expression
  • the standard curve method was used to quantify the absolute copy numbers.
  • the standard curves were generated with pMSCV plasmids containing TRPVl, TRPV2 and TRPV4 cDNA.
  • Western blot analysis cells or tissues were lysed in RIPA buffer (0.5% NP-40, 0.1%sodium
  • deoxycholate 150 mM NaCl, 50 mM Tris-Cl, pH 7.5). Lysates were resolved by SDS- PAGE, transferred to PVDF membrane (Millipore), and probed with the indicated antibodies.
  • ELISA ELISA. Overnight culture medium from fully differentiated adipocytes was used to measure chemokine concentrations. Milliplex® MAP Mouse Cytokine/Chemokine Panel (Millipore) was used according to manufacturer's instruction for multiplex detection for MCP1, ⁇ , RANTES, MCP3 and TNFa.
  • 3T3-F442A adipocytes were trypsinized and split into 384 well plates (3000 cell/well).
  • adipocytes were treated with a chemical library (Broad Institute) in 384- well plates for 20 hours at ⁇ 20uM.
  • mRNA was harvested using the TurboCapture kit (Qiagen), reverse transcribed to cDNA, and quantified by qPCR with Sybr-Green (ABI). All values were normalized to vehicle (DMSO) treated wells.
  • 3T3-F442A adipocytes were trypsinized and transferred to coverslip coated with Cell-Tak solution (BD Biosciences). Cells were loaded with 10 uM Fura-2AM (Invitrogen) for 20 min at 37 °C and then washed twice in standard Tyrodes Solution (in mM): 135 NaCl, 4 KC1, 10 glucose, 10 HEPES, 1.2 CaCl 2 , 1 MgCl 2 , pH 7.40 at room temperature.
  • Fluorescence images were obtained (at 510 nm) using an Olympus ⁇ 81 inverted microscope with a 20X objective (Olympus) and a CCD camera (Hamamatsu, Model# C4742-80- 12AG) upon sequential excitation with 340 nm followed by 380 nm light.
  • a selective TRPV4 agonist, GSKlOl (lOOnM) was perfused onto the cells.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Molecular Biology (AREA)
  • Urology & Nephrology (AREA)
  • Cell Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • Endocrinology (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Diabetes (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Obesity (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne des procédés de traitement ou de prévention de troubles au moyen de composés qui régulent la voie de TRPV4. Elle concerne également des procédés et des cellules qui peuvent être utilisés pour évaluer des composés, comme des antagonistes de TRPV4, pour le traitement ou la prévention de troubles. Dans certains modes de réalisation, l'antagoniste de TRPV4 est sélectionné, au moins en partie, parce qu'il est un antagoniste de TRPV4. Dans certains modes de réalisation, l'antagoniste de TRPV4 n'inhibe aucun des TRPV1, TRPV2 et TRPV3. Dans certains modes de réalisation, l'antagoniste de TRPV4 inhibe un, deux ou l'ensemble des TRPV1, TRPV2 et TRPV3. Dans certains modes de réalisation, l'antagoniste de TRPV4 est sélectionné dans le groupe comprenant le Rimonabant, l'AMG-251, l'AMG9810, le GSK205, et le BCTC.
PCT/US2013/035129 2012-04-04 2013-04-03 Antagoniste de trpv4 et procédés d'utilisation de celui-ci WO2013152109A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201261620205P 2012-04-04 2012-04-04
US61/620,205 2012-04-04

Publications (1)

Publication Number Publication Date
WO2013152109A1 true WO2013152109A1 (fr) 2013-10-10

Family

ID=49301017

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2013/035129 WO2013152109A1 (fr) 2012-04-04 2013-04-03 Antagoniste de trpv4 et procédés d'utilisation de celui-ci

Country Status (1)

Country Link
WO (1) WO2013152109A1 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108836971B (zh) * 2018-08-16 2020-10-30 青岛大学 Ws6对小梁网细胞肌动蛋白形成的影响
CN115317488A (zh) * 2022-07-22 2022-11-11 南华大学附属第一医院 Gsk1016790a在制备治疗或缓解糖尿病肠病的药物中的应用
US11970460B1 (en) 2023-10-24 2024-04-30 King Faisal University 4-(4,5-bis(4-bromophenyl)-2-phenyl-1H-imidazol-1-yl)benzoic acid as an antimicrobial compound

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030170744A1 (en) * 2002-03-05 2003-09-11 Beske Oren E. Multiplexed analysis of cellular responses using endogenous reporter genes
US20060100205A1 (en) * 2004-04-21 2006-05-11 Eckard Weber Compositions for affecting weight loss
WO2007055743A2 (fr) * 2005-11-01 2007-05-18 Amylin Pharmaceuticals, Inc. Procédés pour traiter l'obésité et des troubles associés
WO2010080985A1 (fr) * 2009-01-08 2010-07-15 Dana-Farber Cancer Institute, Inc. Compositions et procédés pour induire la différenciation du tissu adipeux brun
WO2010094734A2 (fr) * 2009-02-19 2010-08-26 Biofocus Dpi B.V. Procédés d'identification de composés utiles pour le diagnostic et le traitement de maladies liées à une inflammation
US20100273777A1 (en) * 2005-05-09 2010-10-28 Hydra Biosciences, Inc. Compounds for Modulating TRPV3 Function
WO2011128782A2 (fr) * 2010-04-13 2011-10-20 Jorge Luis Rosado Compositions et procédés pour traiter le diabète de type ii et des troubles associés

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030170744A1 (en) * 2002-03-05 2003-09-11 Beske Oren E. Multiplexed analysis of cellular responses using endogenous reporter genes
US20060100205A1 (en) * 2004-04-21 2006-05-11 Eckard Weber Compositions for affecting weight loss
US20100273777A1 (en) * 2005-05-09 2010-10-28 Hydra Biosciences, Inc. Compounds for Modulating TRPV3 Function
WO2007055743A2 (fr) * 2005-11-01 2007-05-18 Amylin Pharmaceuticals, Inc. Procédés pour traiter l'obésité et des troubles associés
WO2010080985A1 (fr) * 2009-01-08 2010-07-15 Dana-Farber Cancer Institute, Inc. Compositions et procédés pour induire la différenciation du tissu adipeux brun
WO2010094734A2 (fr) * 2009-02-19 2010-08-26 Biofocus Dpi B.V. Procédés d'identification de composés utiles pour le diagnostic et le traitement de maladies liées à une inflammation
WO2011128782A2 (fr) * 2010-04-13 2011-10-20 Jorge Luis Rosado Compositions et procédés pour traiter le diabète de type ii et des troubles associés

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
GADDE ET AL.: "Cannabinoid-1 Receptor Antagonist, Rimonabant, for Management of Obesity and Related Risks", CIRCULATION, vol. 114, 29 August 2006 (2006-08-29), pages 974 - 984, XP003026208, DOI: doi:10.1161/CIRCULATIONAHA.105.596130 *
JIBLO ET AL.: "The CB1 receptor antagonist rimonabant reverses the diet-induced obesity phenotype through the regulation of lipolysis and energy balance", THE FASEB JOURNAL, vol. 19, 11 July 2005 (2005-07-11), pages 1 - 27 *
PHAN ET AL.: "Functional Characterization of TRPV4 As an Osmotically Sensitive Ion Channel in Articular Chondrocytes", ARTHRITIS & RHEUMATISM, vol. 60, no. ISS. 1, 29 September 2009 (2009-09-29), pages 3028 - 3037 *
WELLEN ET AL.: "Obesity-induced inflammatory changes in adipose tissue", THE JOURNAL OF CLINICAL INVESTIGATION, vol. 112, no. 12, 1 December 2003 (2003-12-01), pages 1785 - 1788 *
YE.: "Identification of TRPV4 as a Regulator of Adipose Oxidative Metabolism, Inflammation and Energy Homeostasis by a Chemical Biology Approach", DISSERTATION., 12 April 2012 (2012-04-12), HARVARD UNIVERITY DASH REPOSITORY. *
YE.: "TRPV4 Is a Regulator of Adipose Oxidative Metabolism, Inflammation, and Energy Homeostasis", CELL, vol. 151, 12 September 2012 (2012-09-12), pages 96 - 110, XP028516912, DOI: doi:10.1016/j.cell.2012.08.034 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108836971B (zh) * 2018-08-16 2020-10-30 青岛大学 Ws6对小梁网细胞肌动蛋白形成的影响
CN115317488A (zh) * 2022-07-22 2022-11-11 南华大学附属第一医院 Gsk1016790a在制备治疗或缓解糖尿病肠病的药物中的应用
CN115317488B (zh) * 2022-07-22 2024-04-23 南华大学附属第一医院 Gsk1016790a在制备治疗或缓解糖尿病肠病的药物中的应用
US11970460B1 (en) 2023-10-24 2024-04-30 King Faisal University 4-(4,5-bis(4-bromophenyl)-2-phenyl-1H-imidazol-1-yl)benzoic acid as an antimicrobial compound

Similar Documents

Publication Publication Date Title
Chung et al. Endocrine-exocrine signaling drives obesity-associated pancreatic ductal adenocarcinoma
Wu et al. Glucose-sensitive myokine/cardiokine MG53 regulates systemic insulin response and metabolic homeostasis
Ludwig-Portugall et al. An NLRP3-specific inflammasome inhibitor attenuates crystal-induced kidney fibrosis in mice
Santulli et al. Calcium release channel RyR2 regulates insulin release and glucose homeostasis
Shi et al. De novo pyrimidine synthesis is a targetable vulnerability in IDH mutant glioma
Eraly et al. Decreased renal organic anion secretion and plasma accumulation of endogenous organic anions in OAT1 knock-out mice
Overstreet et al. Redox control of p53 in the transcriptional regulation of TGF-β1 target genes through SMAD cooperativity
AU2014253932A1 (en) Companion diagnostic for CDK4 inhibitors
Treves et al. Ca2+ handling abnormalities in early-onset muscle diseases: Novel concepts and perspectives
US20160008332A1 (en) Combinatorial compositions and methods for treatment of melanoma
JP2017186342A (ja) 膵臓β細胞障害における可溶性ＭＡＮＦ
Jiang et al. Over-expression of a cardiac-specific human dopamine D5 receptor mutation in mice causes a dilated cardiomyopathy through ROS over-generation by NADPH oxidase activation and Nrf2 degradation
Ding et al. Insulin resistance disrupts the interaction between AKT and the NMDA receptor and the inactivation of the CaMKIV/CREB pathway in minimal hepatic encephalopathy
WO2013152109A1 (fr) Antagoniste de trpv4 et procédés d'utilisation de celui-ci
Aoyama et al. Monitoring autophagic flux in vivo revealed its physiological response and significance of heterogeneity in pancreatic beta cells
Hui et al. Nonenzymatic function of DPP4 promotes diabetes-associated cognitive dysfunction through IGF-2R/PKA/SP1/ERp29/IP3R2 pathway-mediated impairment of Treg function and M1 microglia polarization
US20150018383A1 (en) Biomarkers of renal disorders
US20070208074A1 (en) Methods and compositions for treating and preventing tumors
Jin et al. WNK1 promotes water homeostasis by acting as a central osmolality sensor for arginine vasopressin release
García-Martínez et al. Insulin drives glucose-dependent insulinotropic peptide expression via glucose-dependent regulation of FoxO1 and LEF1/β-catenin
JP5840124B2 (ja) 統合失調症の検出方法
US20160287602A1 (en) Methods for promoting motor neuron survival
EP2626066A1 (fr) Polythérapie comprenant des inhibiteurs VEGFR-2 sélectifs et inhibiteurs MEK
US20150174202A1 (en) Methods and Compositions for Modulating Beta Cell Proliferation
Chen et al. Nur77 is involved in the regulation of obesity‐related lower muscle mass by promoting Pten degradation

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13771967

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13771967

Country of ref document: EP

Kind code of ref document: A1