WO2013144355A1 - Multivalent recombinant avian herpes viruses and vaccines for immunizing avian species - Google Patents
Multivalent recombinant avian herpes viruses and vaccines for immunizing avian species Download PDFInfo
- Publication number
- WO2013144355A1 WO2013144355A1 PCT/EP2013/056839 EP2013056839W WO2013144355A1 WO 2013144355 A1 WO2013144355 A1 WO 2013144355A1 EP 2013056839 W EP2013056839 W EP 2013056839W WO 2013144355 A1 WO2013144355 A1 WO 2013144355A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- recombinant
- promoter
- nucleotide sequence
- protein
- avian
- Prior art date
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
- A61K39/245—Herpetoviridae, e.g. herpes simplex virus
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
- A61K39/155—Paramyxoviridae, e.g. parainfluenza virus
- A61K39/17—Newcastle disease virus
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/20—Antivirals for DNA viruses
- A61P31/22—Antivirals for DNA viruses for herpes viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
- A61K2039/5256—Virus expressing foreign proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
- A61K2039/552—Veterinary vaccine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/70—Multivalent vaccine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/16011—Herpesviridae
- C12N2710/16311—Mardivirus, e.g. Gallid herpesvirus 2, Marek-like viruses, turkey HV
- C12N2710/16321—Viruses as such, e.g. new isolates, mutants or their genomic sequences
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/16011—Herpesviridae
- C12N2710/16311—Mardivirus, e.g. Gallid herpesvirus 2, Marek-like viruses, turkey HV
- C12N2710/16334—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/16011—Herpesviridae
- C12N2710/16311—Mardivirus, e.g. Gallid herpesvirus 2, Marek-like viruses, turkey HV
- C12N2710/16341—Use of virus, viral particle or viral elements as a vector
- C12N2710/16343—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2720/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsRNA viruses
- C12N2720/00011—Details
- C12N2720/10011—Birnaviridae
- C12N2720/10034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/18011—Paramyxoviridae
- C12N2760/18111—Avulavirus, e.g. Newcastle disease virus
- C12N2760/18134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
Definitions
- the present invention relates generally to the field of vaccine preparations.
- the present invention specifically relates to multivalent recombinant herpes viruses in which at least two foreign genes have been inserted, and their uses for inducing simultaneously a protective immunity against a plurality of avian diseases.
- Poultry meat and eggs are important food sources, whose consumption increases continually due to the growth of the human population and their great quality-price ratio.
- the recent epidemic of avian influenza focused the public opinion on poultry health as well as food safety and security.
- Poultry vaccine technology became a worldwide concern.
- Viral vectors expressing pathogen proteins are commonly used as poultry vaccines against targeted pathogens. Vaccines including such viral vectors induce expression of foreign pathogen proteins within infected cells, and thereby induce corresponding T cell immunity.
- herpes viruses including herpes virus of turkey (HVT) and Marek's disease virus (MDV), can permanently survive in the body of an infected animal in the state of latent or persistent infection. Consequently, recombinant herpes viruses, in which a foreign gene derived from a pathogen has been integrated, have been developed to be used as viral-vectored vaccines increasing the duration of immunity to an immunized animal.
- HVT herpes virus of turkey
- MDV Marek's disease virus
- Vaccine preparations have been developed to achieve effective avian vaccinations, using recombinant herpes viruses which incorporate a gene encoding a foreign antigen. Such vaccine preparations allow to vaccinate against both MDV (the vector) and another avian disease, through the inserted foreign DNA sequence.
- vaccine preparations provide efficient results to vaccinate avian species against many fatal diseases, competition and immunosuppression between pathogens can occurr when birds are injected with two or more recombinant herpes viruses, each harboring a different foreign antigen gene.
- multivalent recombinant herpes viruses i.e. harboring at least two different antigen genes
- rHVTs recombinant HVTs
- rHVTs recombinant HVTs
- rHVTs recombinant HVTs
- the present invention relates to a recombinant avian herpes virus, which comprises at least two recombinant nucleotide sequences, each recombinant nucleotide sequence encoding and expressing in cells of avian species an antigenic peptide, wherein said at least two recombinant nucleotide sequences are inserted into distinct non-coding regions of the viral genome chosen among the region located between UL44 and UL45, the region located between UL45 and UL46, the region located between US 10 and SORF3, and the region located between SORF3 and US2.
- one recombinant nucleotide sequence is inserted in the region located between UL45 and UL46, and one recombinant nucleotide sequence is inserted in the region located between UL44 and UL45, between US 10 and SORF3, or between SORF3 and US2.
- such recombinant avian herpes virus constructs provide particularly stable and efficient expression of the two corresponding antigenic peptides in infected avian cells.
- the two, or more, recombinant nucleotide sequences are co- expressed in Chicken Embryo Fibroblast (CEF) cells, even after 10 or more passages, and preferentially even after 15 passages.
- CEF Chicken Embryo Fibroblast
- the recombinant nucleotide sequences are advantageously under the control of particular promoters.
- the promoters are preferentially chosen among the chicken beta-actin (Bac) promoter, the Pec promoter, the Murine Cytomegalovirus (Mcmv) immediate-early (ie)l promoter, Human Cytomegalovirus (Hcmv) promoter, the Simian virus (SV)40 promoter, and the Raus Sarcoma virus (RSV) promoter, or any fragments thereof which retain a promoter activity.
- each recombinant nucleotide sequence is under the control of a distinct promoter.
- the foreign genes are advantageously chosen among an antigenic peptide of avian paramyxovirus type 1, and preferentially the F protein of Newcastle disease virus (NDV), an antigenic peptide of Gumboro disease virus, preferentially the VP2 protein of the Infectious bursal disease virus (IBDV), an antigenic peptide of the infectious laryngotracheitis virus (ILTV), preferentially the gB protein, an antigenic peptide of Mycoplasma galisepticum, preferentially the 40K protein, and an antigenic peptide of the avian influenza virus, preferentially a surface protein hemagglutinin (HA).
- NDV Newcastle disease virus
- IBDV Infectious bursal disease virus
- ILTV infectious laryngotracheitis virus
- gB protein an antigenic peptide of Mycoplasma galisepticum
- 40K protein an antigenic peptide of the avian influenza virus
- HA hemagglutinin
- the recombinant avian herpes virus comprises a first recombinant nucleotide sequence encoding a first antigenic peptide inserted into the non- coding region located between UL44 and UL45, and a second recombinant nucleotide sequence encoding a second antigenic peptide inserted into the non-coding region located between UL45 and UL46, between US10 and SORF3, or between SORF3 and US2.
- the recombinant avian herpes virus comprises a first recombinant nucleotide sequence encoding a first antigenic peptide inserted into the non- coding region located between UL45 and UL46, and a second recombinant nucleotide sequence encoding a second antigenic peptide inserted into the non-coding region located between US10 and SORF3, or between SORF3 and US2.
- the recombinant avian herpes virus comprises a first recombinant nucleotide sequence encoding a first antigenic peptide inserted into the non- coding region located between US 10 and SORF3, and a second recombinant nucleotide sequence encoding a second antigenic peptide inserted into the non-coding region located between SORF3 and US2.
- a further object of the invention relates to a multivalent vaccine for immunizing avian species, such as poultry, which comprises an effective immunizing amount of recombinant avian herpes virus of the invention.
- This vaccine can be used for immunizing avian species, such as poultry.
- a further object of the invention concerns an antiserum directed against avian herpes virus obtained by immunizing avian species with an effective amount of recombinant avian herpes virus of the invention and recovering the antiserum after bleeding the bird.
- the invention further relates to method of immunizing an avian comprising administering to said avian an effective immunizing amount of the vaccine according to the invention.
- the invention further provides a vaccination kit for immunizing avian species which comprises an effective amount of the vaccine of the invention, and a means for administering said components to said species.
- the invention may be used in any avian, for vaccination against any avian pathogen.
- Figure 1 illustrates the schematic diagram of the HVT genome.
- the location of the Unique Long (UL) 44, UL45 and UL46 and the location of the Unique Short (US) 10, SORF3 and US2 are marked.
- the recombinant nucleotide sequences can be inserted at PCR generated Sfil sites between UL44 and UL45, and/or between UL45 and UL46, and/or between US10 and SORF3, and/or between SORF3 and US2.
- Figure 2A and 2B illustrates schematic diagrams of the HVT genome integrating different clusters of nucleotide sequences and promoters, according to particular embodiments of the invention.
- FIG. 3 shows immunofluorescence staining of CEFs infected with double recombinant HVTs according to embodiments of the invention (FW129 and FW141) co-expressing NDV-F and IBDV-VP2 (rHVT/ND/IBD infected cells).
- Protein VP2 expression was detected by anti-VP2 Mab (R63) and Alexa Flour 546.
- Protein F expression was detected by anti-F #35 rabbit serum and Alexa Flour 488. The results show that both cells infected with FW129 or FW141 express both the inserted NDV-F protein and the inserted IBDV- VP2 protein.
- FIGs 4A and 4B are western blotting analysis showing the expression of VP2 protein and/or F protein in CEF cells infected with rHVTs of the invention.
- a protein band of 60 kilodaltons (kDa) was observed only in the lane with rHVT/ND/IBD infected cells, which was the expected size of the F protein (t ⁇ f).
- t ⁇ f the expected size of the F protein
- Figures 5A to 5D shows results of a southern blotting analysis for genome structure check of purified FW129 (rHVT/45-46 pecF/44-45 Rsv VP2), indicating that double recombinant HVT/ND/IBD of the invention had the expected genomic structure. More precisely, the results of southern blotting showed that
- Figures 6 A and 6B show results of a western blotting analysis for stability check of recombinant HVT FW129 in successive passages, indicating that after 15 passages F protein and VP2 protein were expressed stably in CEF infected with the rHVT FW129 of the invention.
- Figures 7A to 7D show results of a southern blotting analysis for stability check of recombinant HVTs after 15 passages.
- Figure 7 A The results of southern blotting show that a 2077-bp fragment was hybridized to VP2 probe in the DNA from FW129. 2334-bp fragment was hybridized to VP2 probe in the DNA from FW130. In contrast, no band was detected in p45/46Pec F.
- Figure 7C The results of southern blotting show that a 2744-bp fragment was hybridized to F probe in the DNA from each double recombinant HVT FW129 and FW130. No band was detected in the p45/46 Sfil.
- Figures 8A and 8B show comparative results of anti-NDV titers (Figure 8A) and anti- IBDV titers (Figure 8B) obtained from chicken inoculated with double recombinant HVTs (FW122, FW137, FW129, FW130, FW135), compared to titers obtained from chicken inoculated with single recombinant HVTs (FW029 and FW023 respectively).
- the present invention generally relates to multivalent recombinant herpes viruses and their use for immunizing avian species against at least two diseases in the same time.
- foreign DNA sequences are inserted in particular insertion sites within the rHV genome, providing stable and efficient constructs suitable for use in vaccine compositions or methods.
- the term "reconstructed” or “recombinant” in relation to a sequence designates a sequence, nucleic acid or unit which does not exist naturally and/or which has been engineered using recombinant DNA technology (also called gene cloning or molecular cloning).
- recombinant in relation to a herpes virus refers to aherpes virus whose genome has been modified by insertion of at least one heterologous nucleic acid, Le., a nucleic acid (e.g., DNA) which is not found naturally in the genome of the herpes virus, or which is found naturally in said genome but in a different form or at a different position.
- a nucleic acid e.g., DNA
- nucleic acid refers to a nucleic acid molecule having a determined sequence, which may be deoxyribonucleotides and/or ribonucleotides.
- the nucleotide sequence may be first prepared by e.g., recombinant, enzymatic and/or chemical techniques, and subsequently replicated in a host cell or an in vitro system.
- a nucleotide sequence preferentially comprises an open reading frame encoding a peptide.
- the nucleotide sequence may contain additional sequences such as a transcription terminator, a signal peptide, an IRES, an intron, etc.
- an open reading frame in a recombinant nucleic acid does not contain an intron.
- untranslated region refers to a region of nucleotides that has no OPvF and do not define an amino acid sequence of protein to be expressed by translation, or a region of nucleotides in which the ORF is not involved in any of transcription, translation, or protein expression.
- avian species is intended to encompass all kinds of avians such as birds of the class of Aves, i.e., vertebrate animals which are feathered, winged, bipedal, endothermic and egg-laying.
- avians or avian species refer more particularly to birds with economical and/or agronomical interests, such as poultry, (such as chickens and turkeys), waterfowl poultry (such as ducks and geese) and ornamental birds (such as swans and psittacines).
- vaccine designates an agent which may be used to cause, stimulate or amplify an immune response in an organism.
- Viruses for use in the present invention are those that belong generally to the genus of avian herpes viruses. .
- avian herpes viruses for use in the present invention include, but are not limited to, a herpes virus of turkeys (HVT), a serotype 2 Marek's disease virus, preferably the SB1 strain of the serotype 2 Marek's disease virus, or a serotype 1 Marek's disease virus, preferably the CVI988/Rispens strain of the serotype 1 Marek's disease virus.
- HVT herpes virus of turkeys
- a serotype 2 Marek's disease virus preferably the SB1 strain of the serotype 2 Marek's disease virus
- a serotype 1 Marek's disease virus preferably the CVI988/Rispens strain of the serotype 1 Marek's disease virus.
- Preferred herpes viruses of the invention are derived from serotypes or strains that are non-pathogenic to targeted avian species.
- An object of the invention relates to recombinant avian herpes viruses suitable for immunizing avian species against at least two diseases, with improved stability through passages.
- Particular insertion sites have been identified by the inventors which, in combinations, provide improved stability for foreign antigen genes.
- An object of the invention therefore relates to a recombinant avian herpes virus, which comprises at least two recombinant nucleotide sequences, each recombinant nucleotide sequence encoding a distinct antigenic peptide, wherein said at least two recombinant nucleotide sequences are inserted into distinct non-coding regions of the viral genome chosen among the region located between UL44 and UL45, the region located between UL45 and UL46, the region located between US 10 and SORF3, and the region located between SORF3 and US2.
- the region located between UL44 and UL45 corresponds to nucleotides 94243-94683 of the HVT genome
- the region located between UL45 and UL46 corresponds to nucleotides 95323-95443 of the HVT genome
- the region located between US 10 and SORF3 corresponds to nucleotides 138688-138825 of the HVT genome
- the region located between SORF3 and US2 corresponds to nucleotides 139867-140064 of the HVT genome.
- the nucleic acid of interest for insertion into the genome of the herpes virus may be homologous or heterologous with respect to the herpes virus.
- the nucleic acid typically encodes an antigen from a pathogen and may be derived or obtained from any pathogenic organism capable of causing an infection in avian species.
- the cloned nucleic acids are derived from pathogens which cause diseases that have an economic impact on the poultry industry. Examples of pathogens that cause infection in avian include viruses, bacteria, fungi, protozoa, etc.
- the homologous or heterologous nucleotide sequence for insertion into the viral genome may thus be any sequence coding for an antigenic peptide of a bird pathogenic agent.
- the nucleic acid sequence according to the present invention can be derived from any source, e.g., viral, prokaryotic, eukaryotic or synthetic.
- the nucleotide sequences encode an immunogenic peptide of a pathogen, and preferably represent surface proteins, secreted proteins or structural proteins of said pathogen, or fragments thereof.
- the nucleotide sequence may encode for example an antigenic peptide derived from avian influenza virus, avian paramyxovirus type 1, also called Newcastle disease virus (NDV), avian metapneumovirus, Marek's disease virus, Gumboro disease virus, also called infectious bursal disease virus (IBDV), Infectious laryngotracheitis virus (ILVT), Infectious bronchitis virus (IBV), Escherichia coli, Salmonella species, Pasteurella multocida, Riemerella anatipestifer, Ornithobacterium rhinotracheale, Mycoplasma gallisepticum, Mycoplasma synoviae, Mycoplasmas microorganisms infecting avian species or coccidian.
- NDV Newcastle disease virus
- ILVT Infectious laryngotracheitis virus
- IBV Infectious bronchitis virus
- Escherichia coli Salmonella species, Pasteurella multocida, Riemerella an
- the nucleotide sequences inserted into the viral genome are chosen among the F protein of NDV, the VP2 protein of IBDV, the gB protein of ILTV, the 40K protein of Mycoplasma galisepticum, and the surface protein hemagglutinin (HA) of the avian influenza virus.
- antigenic peptides may present great interest, depending on several factors, such as avian species, rearing-country, rearing-conditions etc.
- the multivalent recombinant avian herpes virus of the invention incorporates into its genome the nucleotide sequence coding for the F protein of NDV and the nucleotide sequence coding for the VP2 protein of IBDV.
- three or more nucleotide sequences may be inserted into the viral genome.
- the recombinant herpes virus of the invention can express two or more antigens from a same pathogen.
- the homologous or heterologous nucleotide sequences coding for the antigens of interest may be operably linked to a promoter and further inserted into the viral genome.
- the promoter used may be either a synthetic or natural, endogenous or heterologous promoter.
- the promoter is not limited as long as it can effectively function in cells of birds infected with rHVT. Hence the choice of a promoter extends to any eukaryotic, prokaryotic or viral promoter capable of directing gene transcription in avian cells infected by the rHVT.
- the promoters are chosen among the chicken beta-actin (Bac) promoter, the Pec promoter, the Murine Cytomegalovirus (Mcmv) iel promoter, the Human Cytomegalovirus (Hcmv) promoter, the Simian virus (SV)40 promoter, and the Raus Sarcoma virus (RSV) promoter, or any fragments thereof which retain a promoter activity.
- Bac chicken beta-actin
- Pec promoter the Murine Cytomegalovirus
- Mcmv Murine Cytomegalovirus
- Hcmv Human Cytomegalovirus
- SV Simian virus
- RSV Raus Sarcoma virus
- the nucleic acid sequence of a chicken Bac promoter is shown in SEQ ID NO: 1, the sequence of a Pec promoter is shown in SEQ ID NO: 2, the sequence of a Mcmv iel promoter is shown in SEQ ID NO: 3, the sequence of a Hcmv promoter is shown in SEQ ID NO: 4, the sequence of a SV40 promoter is shown in SEQ ID NO: 5, and the sequence of a RSV promoter is shown in SEQ ID NO: 6. It should be noted that variants of such sequences encoding functional promoters are known and/or can be designed/tested by the skilled artisan, for use in the instant invention.
- At least one of the nucleic acids comprises a Pec or Bac promoter to drive expression of the antigenic peptide.
- the herpes virus is propagated in a suitable host cell and then the genomic DNA is obtained.
- the host and the conditions for propagating the virus are selected as appropriate.
- host cells cells derived from chicken are preferred, and CEF (chick embryo fibroblast), chicken kidney cells, and the like, can be used. They may be cultured in a culture medium such as Eagle's MEM, Leibowitz-L-15/McCoy 5 A (1 : 1 mixture) culture medium at about 37°C for 3 to 4 days.
- DNA is extracted from the virus-infected cells cultured as above according to a conventional method. After protein is denatured in the lysis buffer and removed, DNA is extracted with phenol and ethanol.
- the recombinant viruses may be prepared by homologous recombination between the viral genome and a construct (e.g., a plasmid) comprising the nucleic acid to be inserted, flanked by nucleotides from the insertion site to allow recombination.
- a construct e.g., a plasmid
- Plasmid with insertion site sequence Plasmid with insertion site sequence
- One possibility to insert a foreign gene in one of the untranslated regions of the viral genome according to the invention may be to first clone a sequence containing the targeted untranslated region into a plasmid, or other suitable vector.
- sequence is chosen among the sequence of the region located between UL44 and UL45, the sequence of the region located between UL45 and UL46, the sequence of the region located between US 10 and SORF3, and the sequence of the region located between SORF3 and US2.
- Examples of plasmids comprise pBR322, pBR325, pBR327, pBR328, pUC18, pUC19, pUC7, pUC8, and pUC9
- examples of phages comprise lambda phage and M13 phage
- example of cosmids comprises pHC79.
- the untranslated region sequence is integrated into the plasmid according to a conventional cloning method.
- the insertion region sequences are preferably of sufficient length so that, upon insertion of the nucleic acid, the sequences which flank the nucleic acid are of appropriate length so as to allow in vivo homologous recombination with the viral genome.
- the flanking sequences shall have at least approximately 50 nucleotides in length.
- mutation may be carried out at a specific site of the untranslated region to make a new cleavage site for restriction enzymes.
- a method of carrying out mutation may be a conventional method, and a method commonly used by a person skilled in the art such as in vitro mutagenesis and PCR can be used.
- a mutation such as the deletion, replacement, or addition of 1 to 2 nucleotides in the PCR primer is carried out, and the primer is then used to create a mutation.
- Plasmid further containing targeted foreign nucleotide sequence(s)
- nucleotide and promoter sequences for insertion into the virus, are further inserted into the insertion region of the viral genome in the plasmid.
- nucleotide and promoter sequences are introduced into a fragment of genomic herpes virus DNA containing insertion region sequences, subcloned in the plasmid.
- a plasmid can be prepared, which contains two or more foreign nucleic acid sequences, t ⁇ g., derived from the same or different pathogens, said sequences being flanked by insertion region sequences as described herein.
- Viral genome comprising a foreign nucleotide sequence in an insertion site
- Plasmids in which at least one nucleotide sequence has been inserted into the untranslated region obtained as above may be introduced into an HVT-infected cell or HVT genome- trans fected cells using electroporation, calcium phosphate, a lipofectin-based method or the like.
- the amount of the plasmid to be introduced is in the range of 0.1 to 1000 ⁇ g, the efficiency of generation of recombinant viruses by recombination between the homologous regions of HVT-DNA and the plasmid becomes high in cells. Production of the multivalent recombinant herpes virus
- the multivalent of the invention may be obtained by co-transfecting in the same cell culture a plasmid containing, as described above, an insertion site sequence in which is integrated a foreign nucleotide sequence, and a recombinant herpes virus containing, as described above, the same insertion site free of foreign nucleotide sequence and a second insertion site in which is integrated a distinct foreign nucleotide sequence.
- This co- transfection results in the recombination of the plasmid DNA into the viral genome.
- the multivalent of the invention may be obtained by co-transfecting in the same cell culture two plasmids each containing a distinct insertion site sequence in which is integrated a distinct foreign nucleotide sequence, and an herpes virus containing, as described above, the same insertion sites free of foreign nucleotide sequence.
- the co- transfection results in the recombination of the both plasmid DNAs into the viral genome.
- the resulting multivalent recombinant virus may be selected genotypically or phenotypically using known techniques of selection, t ⁇ g., by hybridization, detecting enzyme activity encoded by a gene co-integrated along with the recombinant nucleic acid sequences or detecting the antigenic peptide expressed by the recombinant herpes virus immunologically.
- the selected recombinant herpes virus can be cultured on a large scale in cell culture after which, recombinant herpes virus containing peptides can be collected.
- the Applicant has surprisingly found that particular combinations present a high level of stability, allowing their use for preparing improved multivalent vaccines. Based on this noticing, it is a purpose of the invention to propose specific multivalent recombinant avian herpes viruses with a high level of stability.
- Preferred multivalent recombinant avian herpes viruses of the invention comprise two recombinant nucleotide sequences, each recombinant nucleotide sequence encoding a distinct antigenic peptide and being inserted into a distinct non-coding region of the viral genome chosen among the region located between UL44 and UL45, the region located between UL45 and UL46, the region located between US 10 and SORF3, and the region located between SORF3 and US2.
- Preferred antigenic peptides of the invention are chosen among the F protein of NDV, the VP2 protein of IBDV, the gB protein of ILTV, the 40K protein of Mycoplasma galisepticum, and the surface protein HA of the avian influenza virus.
- the promoters used with nucleotide sequences inserted in the insertion site between UL44 and UL45 are chosen among the Pec promoter, the Mcmv iel promoter, the Hcmv promoter, the SV40 promoter, and the RSV promoter, or any fragments thereof which retain a promoter activity.
- the Bac promoter inserted between UL44 and UL45 does not allow stable expression of a foreign gene.
- the Bac promoter, inserted in the region between UL45 and UL46 does allow stable expression.
- the recombinant avian herpes virus comprises, inserted between UL45 and UL46 a recombinant nucleotide sequence encoding the F protein of NDV, or a fragment thereof, preferentially under the control of the Pec promoter, and, inserted between UL44 and UL45 a recombinant nucleotide sequence encoding the VP2 protein of IBDV or a fragment thereof, preferentially under the control of SV40 promoter (FW130).
- the recombinant avian herpes virus comprises in the insertion site between UL45 and UL46 a recombinant nucleotide sequence encoding the F protein of NDV, or a fragment thereof, preferentially under the control of the Pec promoter, and in the insertion site between UL44 and UL45 a recombinant nucleotide sequence encoding the VP2 protein of IBDV or a fragment thereof, preferentially under the control of the RSV promoter (FW129).
- the recombinant avian herpes virus comprises in the insertion site between UL45 and UL46 a recombinant nucleotide sequence encoding the F protein of NDV, or a fragment thereof, preferentially under the control of the Pec promoter, and in the insertion site between UL44 and UL45 a recombinant nucleotide sequence encoding the VP2 protein of IBDV or a fragment thereof, preferentially under the control of the Mcmv iel promoter (FW141).
- the recombinant avian herpes virus comprises in the insertion site between UL45 and UL46 a recombinant nucleotide sequence encoding the F protein of NDV, or a fragment thereof, preferentially under the control of the Pec promoter, and in the insertion site between SORF3 and US2 a recombinant nucleotide sequence encoding the VP2 protein of IBDV or a fragment thereof, preferentially under the control of the Mcmv iel promoter (FW144).
- the recombinant avian herpes virus comprises in the insertion site between UL45 and UL46 a recombinant nucleotide sequence encoding the F protein of NDV, or a fragment thereof, preferentially under the control of the Pec promoter, and in the insertion site between SORF3 and US2 a recombinant nucleotide sequence encoding the VP2 protein of IBDV or a fragment thereof, preferentially under the control of the Bac promoter (FW146).
- the recombinant avian herpes virus comprises in the insertion site between UL44 and UL45 a recombinant nucleotide sequence encoding the F protein of NDV, or a fragment thereof, preferentially under the control of the Pec promoter, and in the insertion site between UL45 and UL46 a recombinant nucleotide sequence encoding the VP2 protein of IBDV or a fragment thereof, preferentially under the control of the Mcmv iel promoter (FW143).
- the recombinant avian herpes virus comprises in the insertion site between UL44 and UL45 a recombinant nucleotide sequence encoding the F protein of NDV, or a fragment thereof, preferentially under the control of the Mcmv iel promoter, and in the insertion site between UL45 and UL46 a recombinant nucleotide sequence encoding the VP2 protein of IBDV or a fragment thereof, preferentially under the control of the Bac promoter (FW142).
- the recombinant avian herpes virus comprises in the insertion site between SORF3 and US2 a recombinant nucleotide sequence encoding the F protein of NDV, or a fragment thereof, preferentially under the control of the Pec promoter, and in the insertion site between UL45 and UL46 a recombinant nucleotide sequence encoding the VP2 protein of IBDV or a fragment thereof, preferentially under the control of the Bac promoter (FW147).
- the recombinant avian herpes virus comprises in the insertion site between UL45 and UL46 a recombinant nucleotide sequence encoding the VP2 protein of IBDV, or a fragment thereof, preferentially under the control of the Bac promoter, and in the insertion site between SORF3 and US2 a recombinant nucleotide sequence encoding the F protein of NDV or a fragment thereof, preferentially under the control of the Mcmv iel promoter (FW145).
- the recombinant avian herpes virus comprises in the insertion site between UL45 and UL46 a recombinant nucleotide sequence encoding the VP2 protein of IBDV, or a fragment thereof, preferentially under the control of the Bac promoter, and in the insertion site between SORF3 and US2 a recombinant nucleotide sequence encoding the F protein of NDV or a fragment thereof, preferentially under the control of the SV40 promoter (FW149).
- the recombinant avian herpes virus comprises in the insertion site between UL45 and UL46 a recombinant nucleotide sequence encoding the F protein of NDV, or a fragment thereof, preferentially under the control of the SV40 promoter, and in the insertion site between SORF3 and US2 a recombinant nucleotide sequence encoding the VP2 protein of IBDV or a fragment thereof, preferentially under the control of the Bac promoter (FW148).
- the recombinant avian herpes virus comprises in the insertion site between UL45 and UL46 a recombinant nucleotide sequence encoding the F protein of NDV, or a fragment thereof, preferentially under the control of the Pec promoter, and in the insertion site between US 10 and SORF3 a recombinant nucleotide sequence encoding the VP2 protein of IBDV or a fragment thereof, preferentially under the control of the Mcmv iel promoter (FW153).
- the recombinant avian herpes virus comprises in the insertion site between UL45 and UL46 a recombinant nucleotide sequence encoding the F protein of NDV, or a fragment thereof, preferentially under the control of the Pec promoter, and in the insertion site between US 10 and SORF3 a recombinant nucleotide sequence encoding the VP2 protein of IBDV or a fragment thereof, preferentially under the control of the Bac promoter (FW154).
- the recombinant avian herpes virus comprises in the insertion site between UL45 and UL46 a recombinant nucleotide sequence encoding the VP2 protein of IBDV or a fragment thereof, preferentially under the control of the Bac promoter, and in the insertion site between US 10 and SORF3 a recombinant nucleotide sequence encoding the F protein of NDV, or a fragment thereof, preferentially under the control of the Mcmv iel promoter (FW155).
- the recombinant avian herpes virus comprises in the insertion site between UL45 and UL46 a recombinant nucleotide sequence encoding the VP2 protein of IBDV or a fragment thereof, preferentially under the control of the Bac promoter, and in the insertion site between US 10 and SORF3 a recombinant nucleotide sequence encoding the F protein of NDV, or a fragment thereof, preferentially under the control of the Pec promoter (FW156).
- the recombinant avian herpes virus comprises in the insertion site between US 10 and SORF3 a recombinant nucleotide sequence encoding the F protein of NDV, or a fragment thereof, preferentially under the control of the Pec promoter, and in the insertion site between SORF3 and US2 a recombinant nucleotide sequence encoding the VP2 protein of IBDV or a fragment thereof, preferentially under the control of the Mcmv iel promoter (FW157).
- the recombinant avian herpes virus comprises in the insertion site between US 10 and SORF3 a recombinant nucleotide sequence encoding the F protein of NDV, or a fragment thereof, preferentially under the control of the Mcmv iel promoter, and in the insertion site between SORF3 and US2 a recombinant nucleotide sequence encoding the VP2 protein of IBDV or a fragment thereof, preferentially under the control of the Bac promoter (FW158).
- the recombinant avian herpes virus comprises in the insertion site between US 10 and SORF3 a recombinant nucleotide sequence encoding the VP2 protein of IBDV, or a fragment thereof, preferentially under the control of the Bac promoter, and in the insertion site between SORF3 and US2 a recombinant nucleotide sequence encoding the F protein of NDV or a fragment thereof, preferentially under the control of the Mcmv iel promoter (FW159).
- the recombinant avian herpes virus comprises in the insertion site between US 10 and SORF3 a recombinant nucleotide sequence encoding the VP2 protein of IBDV, or a fragment thereof, preferentially under the control of the Mcmv iel promoter, and in the insertion site between SORF3 and US2 a recombinant nucleotide sequence encoding the F protein of NDV or a fragment thereof, preferentially under the control of the Pec promoter (FW160).
- the recombinant avian herpes virus comprises in the insertion site between UL45 and UL46 a recombinant nucleotide sequence encoding the VP2 protein of IBDV or a fragment thereof, preferentially under the control of the Mcmv iel promoter, and in the insertion site between US 10 and SORF3 a recombinant nucleotide sequence encoding the F protein of NDV, or a fragment thereof, preferentially under the control of the Pec promoter (FW161).
- Cell cultures in the insertion site between UL45 and UL46 a recombinant nucleotide sequence encoding the VP2 protein of IBDV or a fragment thereof, preferentially under the control of the Mcmv iel promoter, and in the insertion site between US 10 and SORF3 a recombinant nucleotide sequence encoding the F protein of NDV, or a fragment thereof, preferentially under the control of the Pec promoter
- the resulting recombinant viruses of the present invention may be propagated in cell cultures in which said recombinant virus can propagate and grow. After required growth of the viruses is achieved the cells may be detached from the wells using a scraper or with trypsin and the infected cells may be separated from the supernatant by centrifugation.
- CEF CEF, embryonated egg, chicken kidney cell, and the like may be used as the host cells for the propagation of recombinant herpes viruses.
- Multivalent recombinant viruses of the present invention may be cultured in a culture medium such as Eagle's MEM, Leibowitz-L-15/McCoy 5 A (1 : 1 mixture) culture medium at about 37° C for 3 to 4 days.
- the infected cells thus obtained are suspended in a culture medium containing 10% dimethyl sulfoxide (DMSO) and stored frozen under liquid nitrogen.
- DMSO dimethyl sulfoxide
- the recombinant multivalent herpes viruses of the invention present a high level of stability through passages, which corresponds to a coexpression of the recombinant nucleotide sequences in cells of avian species even after 10 or more passages.
- a "passage" or “cell passaging” means a culture of cells in suitable conditions for allowing their growth and keeping them alive until they are 90% to 100% confluent.
- the passaging step consists on transferring a small number of cells of the previous confluent culture into a new culture medium. An aliquot of the previous confluent culture, containing a few cells, may be diluted in a large volume of fresh medium.
- cells may be first detached, for example by using a mixture of trypsin and EDTA, or any suitable enzyme, before to use a few number of detached cells for seeding a new culture medium.
- CEF cells transfected with recombinant avian herpes viruses of the invention still coexpress the corresponding antigenic peptides after at least 10 passages.
- CEF cells resulting from 10 or more passages of CEF cells trans fected with recombinant avian herpes viruses of the invention, and more particularly resulting from 15 passages still contain the foreign nucleotide sequences of the recombinant avian herpes virus used for the initial cell transfection and express the at least two corresponding antigenic peptides.
- cells of a said passage still express the antigenic peptides if the level of production is greater than 80% of the level of production of the first passage, and preferentially greater than 85%.
- the invention also relates to a multivalent vaccine for immunizing avian species, such as poultry, which comprises an effective immunizing amount of a multivalent recombinant avian herpes virus of the invention.
- vaccines of the invention are able to cause or stimulate or amplify immunity against at least two pathogens chosen among avian paramyxovirus type 1, Gumboro disease virus, the infectious laryngotracheitis virus, Mycoplasma galisepticum, and the avian influenza virus.
- Vaccines of the invention comprise an immunologically effective amount of a multivalent recombinant herpes virus as described above, in a pharmaceutically acceptable vehicle.
- a multivalent recombinant herpes virus according to the invention may be preferably used as a live vaccine although other alternatives like inactivated vaccines or attenuated vaccines are well within the skill of a person skilled in the art.
- the vaccine according to the present invention may further comprise a suitable solvent, such as for example an aqueous buffer or a phosphate buffer.
- the vaccine also comprises additives.
- Additives of the present invention may be obtained from any of a number of sources including various proteins and peptides derived from animals (e.g., hormones, cytokines, co-stimulatory factors), and novel nucleic acids derived from viruses and other sources (e.g., double stranded R A, CpG), and the like which are administered with the vaccine in an amount sufficient to enhance the immune response.
- sources including various proteins and peptides derived from animals (e.g., hormones, cytokines, co-stimulatory factors), and novel nucleic acids derived from viruses and other sources (e.g., double stranded R A, CpG), and the like which are administered with the vaccine in an amount sufficient to enhance the immune response.
- any number of combinations of the aforementioned substances may provide an immunopotentiation effect, and therefore, can form an immunopotentiator of the present invention.
- the vaccines of the present invention may further be formulated with one or more further additives to maintain isotonicity, physiological pH and stability, for example, a buffer such as physiological saline (0.85%), phosphate-buffered saline (PBS), citrate buffers, Tris(hydroxymethyl aminomethane (TRIS), Tris-buffered saline and the like, or an antibiotic, for example, neomycin or streptomycin, etc.
- a buffer such as physiological saline (0.85%), phosphate-buffered saline (PBS), citrate buffers, Tris(hydroxymethyl aminomethane (TRIS), Tris-buffered saline and the like, or an antibiotic, for example, neomycin or streptomycin, etc.
- the route of administration can be any route including oral, ocular (e.g., by eyedrop), oculo-nasal administration using aerosol, intranasal, Cloacal in feed, in water, or by spray, in ovo, topically, or by injection (e.g., intravenous, subcutaneous, intramuscular, intraorbital, intraocular, intradermal, and/or intraperitoneal) vaccination.
- injection e.g., intravenous, subcutaneous, intramuscular, intraorbital, intraocular, intradermal, and/or intraperitoneal
- the skilled person will easily adapt the formulation of the vaccine composition for each type of route of administration.
- Each vaccine dose may contain a suitable dose sufficient to elicit a protective immune response in avian species. Optimization of such dose is well known in the art.
- the amount of antigen per dose may be determined by known methods using antigen/anti-body reactions, for example by the ELISA method.
- the vaccines of the invention can be administered as single doses or in repeated doses, depending on the vaccination protocol.
- the vaccines of the present invention are further advantageous in that they confer to bird species up to 80% protection against the targeted avian pathogens after 3 weeks of vaccination.
- the present invention further relates to the use of the vaccine as described above for immunizing avian species, such as poultry, and to method of immunizing avian species by administering an immunologically effective amount of the vaccine according to the invention.
- the vaccine may be advantageously administered intradermally, subcutaneously, intramuscularly, orally, in ovo, by mucosal administration or via oculonasal administration.
- the present invention further relates to vaccination kits for immunizing avian species which comprises an effective amount of the multivalent vaccine as described above and a means for administering said components to said species.
- kit comprises an injection device filled with the multivalent vaccine according to the invention and instructions for intradermic, subcutaneous, intramuscular, or in ovo injection.
- the kit comprises a spray/aerosol or eye drop device filled with the multivalent vaccine according to the invention and instructions for oculo-nasal administration, oral or mucosal administration.
- herpes virus monovalent or mulytivalent according to the invention
- HVT/first insertion site- first foreign gene/second insertion site-second foreign gene recombinant herpes virus
- the plasmid construction was essentially performed by the standard molecular biology techniques (Molecular Cloning: A Laboratory Manual. 3rd Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 2001). DNA restriction fragments were electrophoresed on agarose gels and purified with Plasmid plus Midi Kit (QIAGEN, Cat # 12945)
- HVT DNA was prepared from CEF cells infected with the HVT FC126 strain according to the method of Lee et al. (J. Gen. Virol, 51 : 245-253, 1980). Using the obtained HVT DNA as a template, PCR was performed with two pairs of primers.
- the first pair was SEQ NO: 7 (5 '-CCCCGAATTCATGGAAGAAATTTCC-3 ') and SEQ
- the second pair was SEQ NO: 9 (5'- GCGCGGCCTTATTGGCCTTAAATACCGCGTTTGGAG-3') and SEQ NO: 10 (5'-
- the resulting fragment was then digested with EcoRI and Hindlll and ligated to pUC18, which had been digested with EcoRI and Hindlll.
- the obtained plasmid was designated p44/45Sfi.
- HVT DNA was prepared from CEF cells infected with the HVT FC126 strain according to the method of Lee et al. (J. Gen. Virol, 51 : 245-253, 1980). Using the obtained HVT DNA as a template, PCR was performed with two pairs of primers. Each primer was designed on the information of Genbank X68653.1. A DNA fragment having a Sfil site between two ORFs, US2 (HVT088) and SORF3 (HVT087), was prepared by PCR and cloned into pUC18.
- the first pair was SEQ NO.11 (5 '-GGGAATTCGAAGAGCCCCCGCGGACGCATG-3 ') and SEQ NO. 125'-CCGCTAGCGGCCGCAAGTTCCTTCACCATGACCAG-3')
- the second pair was SEQ NO.13 (5'-)
- the first resulting fragment was digested with EcoRI and Nhel.
- the second resulting fragment was digested with Nhel and Hindlll. These cleaved fragments were integrated into pUC18 cleaved with EcoRI and Hindlll, resulting the plasmid pHVT 87-88.
- HVT DNA was prepared from CEF cells infected with the HVT FC126 strain according to the method of Lee et al. (J. Gen. Virol, 51 : 245-253, 1980). Using the obtained HVT DNA as a template, PCR was performed with two pairs of primers. Each primer was designed on the information of Genbank X68653.1. A DNA fragment having a Sfil site between two ORFs, US 10 (HVT086) and SORF3 (HVT087), was prepared by PCR and cloned into pUC18.
- the first pair was SEQ NO.15 (5'-)
- the second pair was SEQ NO.17 (5 '-GCGGCCGCTAGCGGCCTTATTGGCC GTTTATTCTATGTAAGAC-3') and SEQ NO.18 (5'- CCCAAGCTTAAGTTCCTTCACCATG-3')
- the first resulting fragment was digested with EcoRI and Nhel.
- the second resulting fragment was digested with Nhel and Hindlll. These cleaved fragments were integrated into pUC18 cleaved with EcoRI and Hindlll, resulting the plasmid pHVT 86-87. Construction of the homology vector
- Mcmv iel promoter (SEQ NO.19) was synthesized on the information of ⁇ 188 191- 4731bp in Gene Bank L06816.1 reported by Koszinowski, U. H.. Synthesized Mcmv iel promoter was designed that Bgll-Pstl sites were added in front of it and Xbal-Notl sites were added at the end.
- Sfil-cleaved p44-45d46Sfi was dephosphorylated by using Alkaline Phosphatase Shewanella sp. S1B1 Recombinant (PAP) (Funakoshi #DE110). The fragment was ligated with Bgll-cleaved p45/46BacVP2, resulting in the plasmid, p44/45d46 BacVP2.
- Mcmv iel promoter (Bgll/Xbal) was ligated with p44/45d46 BacVP2 cleaved with EcoRV and Xbal, and p44/45d46 Bac VP2 cleaved with EcoRV and Bgll, resulting in p44/45d46 Mcmv iel VP2.
- the synthetized short polyA signal (SPA: SEQ NO.20 CTGCAGGCGGCCGCTCTAGAGTCGACAATAAAAGATCTTTATTTTCATTAGATC TGTGTGTTGGTTTTTTGTGTGGCCAATAAGGCC) was integrated into p44/45d46 Mcmv iel VP2 cleaved with Sail and Sfil, resulting in the homology plasmid, p44/45d46 Mcmv iel VP2 SPA
- the second pattern was that the CEF cells were transfected with the prepared FW029 DNA and p44/45 Mcmv iel VP2 (ex. FW141).
- the third pattern was that the CEF cells were transfected with the prepared FW023 DNA and p44/45 Mcmv iel F (ex. FW142).
- the fourth pattern was that the CEF were transfected with the prepared FW029 DNA and pHVT87-88Bac VP (ex. FW144).
- the fifth pattern was that the CEF were transfected with the prepared FW023 and pHVT87- 88Pec F (ex. FW145). These resulting recombinant viruses were plaque purified by staining plaques with the anti-NDV-F antibody and anti-IBDV-VP2 antibody. .
- 10 7 primary CEF cells were suspended in 100 ⁇ of MEF-l(Lonza LNJVD-1004) and co-transfected with 1 ⁇ g of the homology vector, for example, p44/45 Mcmv iel F and pHVT Bac VP2, and 2 ⁇ g of HVT DNA, for instance, FC126 , FW029 and FW023 by electroporation. Electroporation was performed on Nucleofector II. Transfected cells were diluted in 20ml of Leibovitz's L-15 (GIBCO BRL, Cat. #41300-39), McCoy's 5A Medium (GIBCO BRL, Cat. #21500-061) (1 : 1) and 4% calf serum (named solution LM (+) medium), spread lOOul per well of 96 well plate.
- the homology vector for example, p44/45 Mcmv iel F and pHVT Bac VP2
- HVT DNA for instance, FC126 , FW029 and
- the double rHVT candidate was stained by the anti-NDV-F antibody 3-1G/5 (Morrison, T. G., Proc. Natl. Acad. Sci. U.S.A. 84: 1020-1024, 1987) or anti F rabbit serum. Finally, Expression of proteins of the every plaques of the candidate rHVT was confirmed by dual IFA staining. CEFs infected by each rHVT were fixed with cold Acetone-Methanol (2: 1), washed with PBS, reacted with antibody mixture (1 : 1000 diluted anti F rabbit serum #35 and anti-VP2 mouse Mab R63) at 37C in 60 minutes.
- the cells After washing 3 times with PBS, the cells reacted with fluorescent antibody mixture (1 : 1000 diluted Alexa Fluor488 anti rabbit and Alexa Fluor546 anti mouse provided by Invitrogen) at 37C in 60 minutes. After washing 3 times with PBS, they are observed by fluorescence microscope at magnification by 400 times.
- Protein VP2 expression was detected by anti-VP2 Mab (R63) and Alexa Flour 546. Protein F expression was detected by anti-F #35 rabbit serum and Alexa Flour 488. When all plaques were expressed both F and VP2, we concluded purification was completed. Figure 3 showed some examples of dual IFA.
- the purified recombinant HVT was designated rHVT/ND/IBD.
- the table 1 below shows the expression of the VP2 and protein F obtained from the different rHVT/ND/IBD.
- Strain FW023 HVT/45-46 Bac VP2
- FW029 HVT/45-46 PecF
- HVT/45-46 PecF monovalent recombinant herpes virus used as control for protein F expression.
- the culture was centrifuged at 300 g for 3minutes, and the precipitated cells were resuspended in lOOul.
- Laemmli buffer (lOOul) was added to the cell suspension.
- the resultant mixture was then boiled for 5 min and 5 ul of them was subjected to 10% SDS- polyacrylamide gel electrophoresis.
- the electrophoresed proteins were transferred from SDS-GEL to a PVDF membrane (Immobilon-P, Millipore), which was blocked in 1% w/v non-fat milk powder in PBS at room temperature for one hour.
- the treated membrane was then reacted with the anti-F rabbit antiserum #35 in 500-fold dilution at room temperature for one hour, washed three times with PBS, and incubated for one hour with the biotinylated anti-rabbit goat antiserum.
- the treated membrane was then reacted with the anti-VP2 Mab R63 in 500-fold dilution at room temperature for one hour, washed three times with PBS, and incubated for one hour with the biotinylated anti-mouse goat antiserum.
- Figure 3B showed VP2 protein was observed at 38-kilodaltons (kd) in the lanes of each rHVT/ND/IBD ( ⁇ ) ⁇ On the contrary, there was no band in the lane of rHVT/PecF (FW029) (Fig. l B).
- the 38-kd is the mature VP2 protein (A. A. Azad et al, 1987, Virol. 161 : 145-152, K. J., Fahey et al, 1985 J. Gen. Virol. 66: 1479-1488).
- Double recombinant HVTs according to the invention expressed both NDV-F and IBDV VP2.
- the purified rHVT/ND/IBD was propagated on CEF cells of one 25 -cm 2 flask to obtain the confluent plaques.
- Cells were recovered from dishes by scraping, transferred to Falcon tubes and subjected to centrifugation at 300 xg for 5 min.
- Harvested cells were washed with PBS, re-suspended in 0.6 ml of PBS and 0.4 ml of lysis buffer (1.25% TritonX-100, 250 mM 2-ME, and 50 mM EDTA in PBS), and lysed by vortexing for 3 min.
- the lysates were then centrifuged at 600 xg for 5 min at room temperature and the supernatants were transferred to a 15 ml Falcon tubes.
- the viruses were collected by centrifugation at 20,400 xg for 20 min.
- the resultant pellets were then suspended in 0.33 ml of a nuclease solution (12.5 mM Tris-Cl (pH7.5), 1 ⁇ g/ml DNase I and 1 ⁇ g/ml RNase A), incubated at 37 ° C for
- SDS-protease solution 50 mM EDTA, 5% SDS, 0.5mg/ml protease K, and 28.5 mM 2- mercaptoethanol.
- SDS-protease solution 50 mM EDTA, 5% SDS, 0.5mg/ml protease K, and 28.5 mM 2- mercaptoethanol.
- the obtained mixture was treated twice with phenol-chloroform, and NaCl was added to the aqueous phase to the final concentration of 0.2 M.
- the viral DNA was precipitated by adding 2.5 volumes of ice-cold ethanol, washed with 70% ethanol and subjected to centrifugation at 20,400 xg for 20 min at 4 C. After air-drying, the pellets were dissolved in TE buffer (10 mM Tris-Cl (pH8.0), 1 mM EDTA).
- the viral DNA in TE buffer was digested with Xhol, Sphl and Smal, and subjected to 0.8%) agarose gel electrophoresis.
- the electrophoresed DNA fragments on the single gel were transferred simultaneously to two nylon membranes (Molecular Cloning: A Laboratory Manual, third edition, 6.35, Sambrook, J., and Russell, D.W. Cold Spring Harbor Laboratory).
- the immobilized DNA was hybridized with DIG-labeled probe, "VP2 probe", or "IS44/45 probe” which was prepared with PCR DIG Probe Synthesis Kit (ROCHE DIAGNOSTICS, Cat. #1636090).
- VP2 probe was prepared with VP2 STC-F (SEQ ID N0.21) and VP2 STC-R (SEQ ID N0.22) as primers and p45/46bacVP2-STC as a template.
- F probe was prepared with F-F (SEQ ID N0.23) and F-R (SEQ ID N0.24) as primers and p45/46PecF as a template.
- IS45/46 probe was prepared with 45/46-F (SEQ ID N0.25) and 45/46-R (SEQ ID N0.26) as primers and pNZ45/46Sfi as a template.
- IS44/45 probe was prepared with 44/45-F (SEQ ID N0.27) and 44/45-R (SEQ ID N0.28) as primers and pNZ44/45d46Sfi as a template.
- VP2 STC-R (SEQ ID N0.22) 5 '-ACGACGGATCCTGTTGCCACTCT-3 '
- NDV-F-F (SEQ ID N0.23) 5 '-CTAGCAGTGGCAGTTGGGAAGAT-3 '
- NDV-F-R (SEQ ID N0.24) 5 '-GTTAAGGCAGGGGAAGTGATTTGT-3 '
- Double recombinant HVTs were passaged serially (up to 15 times) on chicken embryo fibroblasts (CEF). Then Cell lysates were applied to Western blot analysis. In a first panel (figure 6A), the blot was reacted with an anti-F rabbit serum (#35). In a second panel (figure 6B) the blot was reacted with an anti-VP2 Mab (R63). Mock: non-infected CEF M: Precision Plus Protein Standards Bio Rad #161-0374
- TP-24 transfer plasmid p44-45d46SV40VP2
- Figure 7C shows that a 2744-bp fragment was hybridized to F probe in the DNA from each double recombinant HVTs. No band was detected in the p45/46 Sfil.
- Figure 7B shows that 2077-bp and 1228-bp fragments were hybridized to IS44/45 probe in the DNA from FW129, and 2334-bp and 1022-bp fragments were hybridized to IS44/45 probe in the DNA from FW130. 1350-bp fragment was hybridized to IS44/45 probe in p45/46 PecF, which contained no gene at the IS44/45 site.
- Figure 7D shows that 2744-bp and 770-bp fragments were hybridized to IS45/46 probe in the DNA from each double recombinant HVT.
- Figure 8 A shows change of anti-NDV titer.
- Figure 8B shows change of anti-IBDV titer. Double recombinant HVT using two sites stably induced both anti-NDV and anti-IBDV titers.
- Experiment 7 Efficacy of rHVT/ND/IBD in SPF chickens against NDV
- rHVT/ND/IBD FW130, FW135, FW137, FW129
- 3,000 ⁇ /200 ⁇ 1/ ⁇ of rHVT/ND were inoculated subcutaneously into the back of ten one-day-old SPF chickens (LineM, Japan Biological Laboratories) using 20Gauge syringe. From three weeks post vaccination onward, the serum was collected from the vaccinated birds and anti-NDV antibody titer was measured by a commercial ELISA kit (IDEXX, ELISA kit to diagnose Newcastle Disease).
- IDEXX commercial ELISA kit
- Chickens of the positive control group were vaccinated at 14 day of age with a commercial NDV live vaccine according to the vender's recommendation. Chickens of the negative control group were not administered with any vaccine.
- the protection was evaluated by two criteria which are as follows. (1) The weight ratio of the bursa to the body (B/B index) was not statistically different from that of non- vaccinated, non-challenged chickens. (2) No malformation of the Bursa of Fabricius such as edematization, hemorrhage, yellowish exudate, discoloration, atrophy, or gelatinous exudate was detected. The results were summarized in Table 3.
- Gl NINC (not vaccinated not challenged)
- G2 NICC (not vaccinated challenged)
- G3 FW141
- G4 FW144
- MDA+ birds (layers), 16 to 17 birds/group in each group.
- the protection was evaluated by the two following criteria : (1) The weight ratio of the bursa to the body (B/B index) ; (2) No malformation of the Bursa of Fabricius such as edematization, hemorrhage, yellowish exudate, discoloration, atrophy, or gelatinous exudate was detected.
- the results are summarized in the following Table.
- MDA+ birds (layers), 17 birds/group in each group.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Virology (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Genetics & Genomics (AREA)
- Microbiology (AREA)
- Engineering & Computer Science (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Epidemiology (AREA)
- Mycology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Pulmonology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Oncology (AREA)
- Communicable Diseases (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
Abstract
Description
Claims
Priority Applications (26)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
UAA201411726A UA118335C2 (en) | 2012-03-30 | 2013-03-29 | Multivalent recombinant avian herpes viruses and vaccines for immunizing avian species |
PE2019002000A PE20191704A1 (en) | 2012-03-30 | 2013-03-29 | MULTIVALENT RECOMBINANT AVIAN HERPES VIRUSES AND VACCINES TO IMMUNIZE AVIAN SPECIES |
US14/388,268 US10251951B2 (en) | 2012-03-30 | 2013-03-29 | Multivalent recombinant avian herpes viruses and vaccines for immunizing avian species |
JP2015502378A JP6505593B2 (en) | 2012-03-30 | 2013-03-29 | Multivalent recombinant avian herpesvirus and vaccine for immunizing birds |
PL13713195T PL2831246T3 (en) | 2012-03-30 | 2013-03-29 | Multivalent recombinant avian herpes viruses and vaccines for immunizing avian species |
MX2014011754A MX357365B (en) | 2012-03-30 | 2013-03-29 | Multivalent recombinant avian herpes viruses and vaccines for immunizing avian species. |
KR1020147030643A KR102070217B1 (en) | 2012-03-30 | 2013-03-29 | Multivalent recombinant avian herpes viruses and vaccines for immunizing avian species |
PL17168632T PL3219802T3 (en) | 2012-03-30 | 2013-03-29 | Multivalent recombinant avian herpes viruses and vaccines for immunizing avian species |
ES13713195.9T ES2636464T3 (en) | 2012-03-30 | 2013-03-29 | Multivalent recombinant avian herpesviruses and vaccines to immunize avian species |
CA2868132A CA2868132C (en) | 2012-03-30 | 2013-03-29 | Multivalent recombinant avian herpes viruses and vaccines for immunizing avian species |
BR112014024094A BR112014024094A2 (en) | 2012-03-30 | 2013-03-29 | recombinant avian herpes virus, multivalent vaccine, method for vaccination of one bird simultaneously against at least two pathogens, antiserum directed against avian herpes virus, and vaccination kit for the immunization of bird species |
EP20171262.7A EP3708670A1 (en) | 2012-03-30 | 2013-03-29 | Multivalent recombinant avian herpes viruses and vaccines for immunizing avian species |
CN201380028558.4A CN104364381B (en) | 2012-03-30 | 2013-03-29 | Multivalent recombinant avian herpesviruses and vaccines for immunizing birds |
EP13713195.9A EP2831246B1 (en) | 2012-03-30 | 2013-03-29 | Multivalent recombinant avian herpes viruses and vaccines for immunizing avian species |
EP17168632.2A EP3219802B1 (en) | 2012-03-30 | 2013-03-29 | Multivalent recombinant avian herpes viruses and vaccines for immunizing avian species |
RU2014143830A RU2658439C2 (en) | 2012-03-30 | 2013-03-29 | Multivalent recombinant avian herpes viruses and vaccines for immunising avian species |
TNP2014000392A TN2014000392A1 (en) | 2012-03-30 | 2014-09-19 | Multivalent recombinant avian herpes viruses and vaccines for immunizing avian species |
ZA2014/06979A ZA201406979B (en) | 2012-03-30 | 2014-09-25 | Multivalent recombinant avian herpes viruses and vaccines for immunizing avian species |
PH12014502162A PH12014502162B1 (en) | 2012-03-30 | 2014-09-26 | Multivalent recombinant avian herpes viruses and vaccines for immunizing avian species |
MA37446A MA37446B1 (en) | 2012-03-30 | 2014-10-22 | Multivalent recombinant avian herpes virus and vaccines to immunize avian species |
US15/972,277 US10245315B2 (en) | 2012-03-30 | 2018-05-07 | Multivalent recombinant avian herpes viruses and vaccines for immunizing avian species |
US15/972,283 US10500270B2 (en) | 2012-03-30 | 2018-05-07 | Multivalent recombinant avian herpes viruses and vaccines for immunizing avian species |
PH12019501067A PH12019501067A1 (en) | 2012-03-30 | 2019-05-14 | Multivalent recombinant avian herpes viruses and vaccines for immunizing avian species |
US16/707,106 US11123425B2 (en) | 2012-03-30 | 2019-12-09 | Multivalent recombinant avian herpes viruses and vaccines for immunizing avian species |
US17/475,385 US11730807B2 (en) | 2012-03-30 | 2021-09-15 | Multivalent recombinant avian herpes viruses and vaccines for immunizing avian species |
US18/452,624 US20240082390A1 (en) | 2012-03-30 | 2023-08-21 | Multivalent recombinant avian herpes viruses and vaccines for immunizing avian species |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP20120305390 EP2644702A1 (en) | 2012-03-30 | 2012-03-30 | Multivalent recombinant avian herpes virus and vaccine for immunizing avian species |
EP12305390.2 | 2012-03-30 |
Related Child Applications (3)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US14/388,268 A-371-Of-International US10251951B2 (en) | 2012-03-30 | 2013-03-29 | Multivalent recombinant avian herpes viruses and vaccines for immunizing avian species |
US15/972,277 Continuation US10245315B2 (en) | 2012-03-30 | 2018-05-07 | Multivalent recombinant avian herpes viruses and vaccines for immunizing avian species |
US15/972,283 Continuation US10500270B2 (en) | 2012-03-30 | 2018-05-07 | Multivalent recombinant avian herpes viruses and vaccines for immunizing avian species |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2013144355A1 true WO2013144355A1 (en) | 2013-10-03 |
Family
ID=48040245
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/EP2013/056839 WO2013144355A1 (en) | 2012-03-30 | 2013-03-29 | Multivalent recombinant avian herpes viruses and vaccines for immunizing avian species |
Country Status (22)
Country | Link |
---|---|
US (6) | US10251951B2 (en) |
EP (4) | EP2644702A1 (en) |
JP (2) | JP6505593B2 (en) |
KR (1) | KR102070217B1 (en) |
CN (2) | CN104364381B (en) |
BR (1) | BR112014024094A2 (en) |
CA (1) | CA2868132C (en) |
CO (1) | CO7160021A2 (en) |
ES (2) | ES2636464T3 (en) |
HU (2) | HUE035395T2 (en) |
MA (1) | MA37446B1 (en) |
MX (1) | MX357365B (en) |
MY (1) | MY173016A (en) |
PE (2) | PE20150334A1 (en) |
PH (2) | PH12014502162B1 (en) |
PL (2) | PL3219802T3 (en) |
PT (2) | PT3219802T (en) |
RU (2) | RU2766003C2 (en) |
TN (1) | TN2014000392A1 (en) |
UA (1) | UA118335C2 (en) |
WO (1) | WO2013144355A1 (en) |
ZA (1) | ZA201406979B (en) |
Cited By (13)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104120110A (en) * | 2014-07-11 | 2014-10-29 | 中国农业科学院哈尔滨兽医研究所 | Duck plague virus recombinant vaccine strain expressing enhanced green fluorescent protein gene, constructing method thereof and applications of the recombinant vaccine strain |
CN107002097A (en) * | 2014-12-24 | 2017-08-01 | 英特维特国际股份有限公司 | Improved HVT as carrier ND IBD vaccines |
WO2018112051A1 (en) | 2016-12-14 | 2018-06-21 | Merial, Inc. | Recombinant hvt vectors expressing multiple antigens of avian pathogens, and vaccines comprising them |
CN109402071A (en) * | 2018-11-08 | 2019-03-01 | 中国农业大学 | A kind of recombinant herpesvirus of turkeys for expressing H9N2 subtype avian influenza virus H9 albumen |
WO2020127964A1 (en) | 2018-12-21 | 2020-06-25 | Ceva Sante Animale | Recombinant avian herpes viruses containing multiple foreign genes |
WO2020136220A1 (en) | 2018-12-27 | 2020-07-02 | Ceva Sante Animale | Recombinant viruses and the uses thereof |
WO2021123104A1 (en) | 2019-12-20 | 2021-06-24 | Intervet International B.V. | Multivalent hvt vector vaccine |
WO2021257706A1 (en) | 2020-06-17 | 2021-12-23 | Boehringer Ingelheim Animal Health USA Inc. | Recombinant hvt vectors expressing influenza hemagglutinin and immunogenic compositions, and production and uses thereof |
WO2022079160A2 (en) | 2020-10-15 | 2022-04-21 | Ceva Sante Animale | Recombinant hvt and uses thereof |
WO2022136623A1 (en) | 2020-12-24 | 2022-06-30 | Intervet International B.V. | Multivalent hvt vector vaccine |
US11464849B2 (en) | 2019-09-11 | 2022-10-11 | Zoetis Services Llc | Recombinant herpesvirus of turkey vectors expressing antigens of avian pathogens and uses thereof |
WO2023213946A1 (en) | 2022-05-05 | 2023-11-09 | Intervet International B.V. | New multivalent hvt vector vaccine |
RU2812979C2 (en) * | 2018-12-21 | 2024-02-06 | Сева Санте Анималь | Recombinant avian herpes viruses containing several alien genes |
Families Citing this family (10)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP2644702A1 (en) | 2012-03-30 | 2013-10-02 | Ceva Sante Animale | Multivalent recombinant avian herpes virus and vaccine for immunizing avian species |
EP2845904A1 (en) * | 2013-09-06 | 2015-03-11 | Ceva Sante Animale | Recombinant Marek's disease viruses and uses thereof |
CN104212802B (en) * | 2014-09-25 | 2017-09-12 | 中国人民解放军第二军医大学东方肝胆外科医院 | A kind of tumour cell wide spectrum high activity promoter and application thereof |
HUE061405T2 (en) | 2016-06-17 | 2023-06-28 | Intervet Int Bv | Recombinant non-pathogenic marek's disease virus constructs encoding infectious laryngotracheitis virus and infectious bursal disease virus antigens |
CN106350475A (en) * | 2016-08-26 | 2017-01-25 | 江苏省农业科学院 | Novel bacterial artificial chromosome of turkey herpes virus, construction method and application |
CN106929483B (en) * | 2017-01-19 | 2020-09-25 | 北京邦卓生物科技有限公司 | Construction and application of recombinant turkey herpesvirus expressing newcastle disease virus F gene |
EP3694987A1 (en) * | 2017-10-12 | 2020-08-19 | Intervet International B.V. | Recombinant non-pathogenic marek's disease virus constructs encoding multiple heterologous antigens |
CN107815469A (en) * | 2017-10-16 | 2018-03-20 | 北京市农林科学院 | A kind of recombinant herpesvirus of turkeys and preparation method thereof |
CN108060141B (en) * | 2017-12-14 | 2021-05-28 | 天津瑞普生物技术股份有限公司 | VP2 gene and NP gene recombinant adenovirus and application thereof |
CN110684744A (en) * | 2019-10-22 | 2020-01-14 | 青岛易邦生物工程有限公司 | Recombinant turkey herpes virus strain for expressing chicken infectious bursal disease virus VP2 gene |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2003064595A2 (en) * | 2002-01-31 | 2003-08-07 | Zeon Corporation | Recombinant herpesvirus of turkeys and use thereof |
WO2010119112A1 (en) * | 2009-04-15 | 2010-10-21 | Ceva Sante Animale | Recombinant avian herpes virus vectors and vaccine for immunizing waterfowl species |
Family Cites Families (22)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5965138A (en) | 1985-09-06 | 1999-10-12 | Syntro Corporation | Recombinant chimeric virus and uses thereof |
WO1987004463A1 (en) | 1986-01-27 | 1987-07-30 | Syntro Corporation | Attenuated herpesviruses, herpesviruses which include foreign dna encoding an amino acid sequence and vaccine containing same |
ES2070997T3 (en) | 1989-12-04 | 1995-06-16 | Akzo Nobel Nv | RECOMBINANT HERPES VIRUSES OF TURKEYS AND LIVING VECTOR VACCINES DERIVED FROM THEM. |
JPH06292583A (en) | 1992-03-17 | 1994-10-21 | Nippon Zeon Co Ltd | Antigenic protein derived from marek disease virus, recombinant of gene thereof and vaccine using the same |
US6913751B2 (en) * | 1992-06-12 | 2005-07-05 | Schering-Plough Veterinary Corporation | Recombinant avian herpesvirus useful in vaccine production |
RU2120126C1 (en) * | 1994-08-08 | 1998-10-10 | Всероссийский научно-исследовательский ветеринарный институт птицеводства | Method for detecting lymphocytes sensibilized relative to mark disease vaccine |
FR2728795B1 (en) | 1994-12-30 | 1997-03-21 | Rhone Merieux | AVIAN RECOMBINANT LIVING VACCINE USING AVIAN HERPES VIRUS AS A VECTOR |
FR2728794B1 (en) * | 1994-12-30 | 1997-03-21 | Rhone Merieux | AVIAN RECOMBINANT VACCINE BASED ON AVIAN HERPES VIRUS, PARTICULARLY AGAINST GUMBORO DISEASE |
JPH103635A (en) * | 1996-06-12 | 1998-01-06 | Hitachi Ltd | Magnetic head slider and magnetic disk device using it |
JPH1028586A (en) * | 1996-07-18 | 1998-02-03 | Nippon Zeon Co Ltd | Non-essential region of avipoxvirus, recombinant avipoxvirus and vaccine using this region |
EP1026246B1 (en) * | 1997-10-03 | 2006-11-29 | Zeon Corporation | Avian infectious herpesvirus recombinants and recombinant vaccines prepared with the use of the same |
US6764684B2 (en) | 2001-09-28 | 2004-07-20 | Zeon Corporation | Avian herpesvirus-based recombinant infectious bursal disease vaccine |
US7029681B2 (en) * | 2002-03-08 | 2006-04-18 | Schweitzer Chemical Corporation | Multiple and multivalent DNA vaccines in ovo |
ES2369142T3 (en) | 2004-03-29 | 2011-11-25 | CEVA Santé Animale SA | VIRUS HERPES RECOMBINANT AND USES OF THE SAME. |
JP2008228658A (en) | 2007-03-20 | 2008-10-02 | Nippon Zeon Co Ltd | New promoter, recombinant herpesvirus of turkey having the same and vaccine for domestic fowl utilizing the same |
US20080241188A1 (en) * | 2007-03-30 | 2008-10-02 | Zeon Corporation | Turkey herpesvirus vectored recombinant containing avian influenza genes |
JP2009195136A (en) | 2008-02-20 | 2009-09-03 | Nippon Zeon Co Ltd | New recombinant herpesvirus of turkey, and vaccine for domestic fowl utilizing the same |
EP2331128B1 (en) * | 2008-09-05 | 2013-11-06 | CEVA Santé Animale SA | Composition comprising chitosan for ocular administration of vaccine(s) to avians |
US8932604B2 (en) | 2011-10-21 | 2015-01-13 | Intervet Inc. | Recombinant non-pathogenic marek's disease virus constructs encoding infectious laryngotracheitis virus and newcastle disease virus antigens |
PL2785373T3 (en) | 2011-11-30 | 2020-06-01 | Boehringer Ingelheim Animal Health USA Inc. | Recombinant hvt vectors expressing antigens of avian pathogens and uses thereof |
EP2644702A1 (en) | 2012-03-30 | 2013-10-02 | Ceva Sante Animale | Multivalent recombinant avian herpes virus and vaccine for immunizing avian species |
EP2845904A1 (en) | 2013-09-06 | 2015-03-11 | Ceva Sante Animale | Recombinant Marek's disease viruses and uses thereof |
-
2012
- 2012-03-30 EP EP20120305390 patent/EP2644702A1/en not_active Withdrawn
-
2013
- 2013-03-29 EP EP13713195.9A patent/EP2831246B1/en active Active
- 2013-03-29 MX MX2014011754A patent/MX357365B/en active IP Right Grant
- 2013-03-29 PL PL17168632T patent/PL3219802T3/en unknown
- 2013-03-29 CN CN201380028558.4A patent/CN104364381B/en active Active
- 2013-03-29 EP EP17168632.2A patent/EP3219802B1/en active Active
- 2013-03-29 US US14/388,268 patent/US10251951B2/en active Active
- 2013-03-29 HU HUE13713195A patent/HUE035395T2/en unknown
- 2013-03-29 EP EP20171262.7A patent/EP3708670A1/en active Pending
- 2013-03-29 JP JP2015502378A patent/JP6505593B2/en active Active
- 2013-03-29 WO PCT/EP2013/056839 patent/WO2013144355A1/en active Application Filing
- 2013-03-29 CN CN202010638645.3A patent/CN111733143A/en active Pending
- 2013-03-29 PT PT171686322T patent/PT3219802T/en unknown
- 2013-03-29 RU RU2018116857A patent/RU2766003C2/en active
- 2013-03-29 PE PE2014001487A patent/PE20150334A1/en not_active Application Discontinuation
- 2013-03-29 RU RU2014143830A patent/RU2658439C2/en active
- 2013-03-29 ES ES13713195.9T patent/ES2636464T3/en active Active
- 2013-03-29 PT PT137131959T patent/PT2831246T/en unknown
- 2013-03-29 KR KR1020147030643A patent/KR102070217B1/en active IP Right Grant
- 2013-03-29 PE PE2019002000A patent/PE20191704A1/en unknown
- 2013-03-29 HU HUE17168632A patent/HUE050602T2/en unknown
- 2013-03-29 PL PL13713195T patent/PL2831246T3/en unknown
- 2013-03-29 UA UAA201411726A patent/UA118335C2/en unknown
- 2013-03-29 BR BR112014024094A patent/BR112014024094A2/en not_active Application Discontinuation
- 2013-03-29 ES ES17168632T patent/ES2807952T3/en active Active
- 2013-03-29 MY MYPI2014002789A patent/MY173016A/en unknown
- 2013-03-29 CA CA2868132A patent/CA2868132C/en active Active
-
2014
- 2014-09-19 TN TNP2014000392A patent/TN2014000392A1/en unknown
- 2014-09-25 ZA ZA2014/06979A patent/ZA201406979B/en unknown
- 2014-09-26 PH PH12014502162A patent/PH12014502162B1/en unknown
- 2014-09-29 CO CO14215115A patent/CO7160021A2/en unknown
- 2014-10-22 MA MA37446A patent/MA37446B1/en unknown
-
2018
- 2018-05-07 US US15/972,283 patent/US10500270B2/en active Active
- 2018-05-07 US US15/972,277 patent/US10245315B2/en active Active
-
2019
- 2019-01-16 JP JP2019005280A patent/JP6845266B2/en active Active
- 2019-05-14 PH PH12019501067A patent/PH12019501067A1/en unknown
- 2019-12-09 US US16/707,106 patent/US11123425B2/en active Active
-
2021
- 2021-09-15 US US17/475,385 patent/US11730807B2/en active Active
-
2023
- 2023-08-21 US US18/452,624 patent/US20240082390A1/en active Pending
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2003064595A2 (en) * | 2002-01-31 | 2003-08-07 | Zeon Corporation | Recombinant herpesvirus of turkeys and use thereof |
WO2010119112A1 (en) * | 2009-04-15 | 2010-10-21 | Ceva Sante Animale | Recombinant avian herpes virus vectors and vaccine for immunizing waterfowl species |
Non-Patent Citations (2)
Title |
---|
REDDY S K ET AL: "Protective efficacy of a recombinant herpesvirus of turkeys as an in ovo vaccine against Newcastle and Marek's diseases in specific-pathogen-free chickens", VACCINE, ELSEVIER LTD, GB, vol. 14, no. 6, 1 April 1996 (1996-04-01), pages 469 - 477, XP004057273, ISSN: 0264-410X, DOI: 10.1016/0264-410X(95)00242-S * |
TSUKAMOTO K ET AL: "Complete, long-lasting protection against lethal infectious bursal disease virus challenge by a single vaccination with an avian herpesvirus vector expressing VP2 antigens", JOURNAL OF VIROLOGY, vol. 76, no. 11, 1 June 2002 (2002-06-01), pages 5637 - 5645, XP002967899, ISSN: 0022-538X, DOI: 10.1128/JVI.76.11.5637-5645.2002 * |
Cited By (24)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104120110A (en) * | 2014-07-11 | 2014-10-29 | 中国农业科学院哈尔滨兽医研究所 | Duck plague virus recombinant vaccine strain expressing enhanced green fluorescent protein gene, constructing method thereof and applications of the recombinant vaccine strain |
US10308956B2 (en) | 2014-12-24 | 2019-06-04 | Intervet Inc. | HVT-vectored ND-IBD vaccine |
EP3185899B1 (en) | 2014-12-24 | 2017-10-18 | Intervet International B.V. | Improved hvt-vectored nd-ibd vaccine |
JP6246985B1 (en) * | 2014-12-24 | 2017-12-13 | インターベット インターナショナル ベー. フェー. | Improved HVT vector ND-IBD vaccine |
CN107002097B (en) * | 2014-12-24 | 2021-06-15 | 英特维特国际股份有限公司 | Improved HVT-vectored ND-IBD vaccines |
CN107002097A (en) * | 2014-12-24 | 2017-08-01 | 英特维特国际股份有限公司 | Improved HVT as carrier ND IBD vaccines |
WO2018112051A1 (en) | 2016-12-14 | 2018-06-21 | Merial, Inc. | Recombinant hvt vectors expressing multiple antigens of avian pathogens, and vaccines comprising them |
EP3854415A1 (en) | 2016-12-14 | 2021-07-28 | Boehringer Ingelheim Animal Health USA Inc. | Recombinant hvt vectors expressing multiple antigens of avian pathogens, and vaccines comprising them |
EP4085928A1 (en) | 2016-12-14 | 2022-11-09 | Boehringer Ingelheim Animal Health USA Inc. | Recombinant hvt vectors expressing multiple antigens of avian pathogens, and vaccines comprising them |
EP4112072A1 (en) | 2016-12-14 | 2023-01-04 | Boehringer Ingelheim Animal Health USA Inc. | Recombinant hvt vectors expressing multiple antigens of avian pathogens, and vaccines comprising them |
EP3744342A1 (en) | 2016-12-14 | 2020-12-02 | Boehringer Ingelheim Animal Health USA Inc. | Recombinant hvt vectors expressing multiple antigens of avian pathogens, and vaccines comprising them |
CN109402071A (en) * | 2018-11-08 | 2019-03-01 | 中国农业大学 | A kind of recombinant herpesvirus of turkeys for expressing H9N2 subtype avian influenza virus H9 albumen |
CN109402071B (en) * | 2018-11-08 | 2021-04-27 | 中国农业大学 | Recombinant turkey herpesvirus expressing H9N2 subtype avian influenza virus H9 protein |
RU2812979C2 (en) * | 2018-12-21 | 2024-02-06 | Сева Санте Анималь | Recombinant avian herpes viruses containing several alien genes |
US20220040287A1 (en) * | 2018-12-21 | 2022-02-10 | Ceva Sante Animale | Recombinant avian herpes viruses containing multiple foreign genes |
WO2020127964A1 (en) | 2018-12-21 | 2020-06-25 | Ceva Sante Animale | Recombinant avian herpes viruses containing multiple foreign genes |
WO2020136220A1 (en) | 2018-12-27 | 2020-07-02 | Ceva Sante Animale | Recombinant viruses and the uses thereof |
US11464849B2 (en) | 2019-09-11 | 2022-10-11 | Zoetis Services Llc | Recombinant herpesvirus of turkey vectors expressing antigens of avian pathogens and uses thereof |
US11883481B2 (en) | 2019-09-11 | 2024-01-30 | Zoetis Services Llc | Recombinant herpesvirus of turkey vectors expressing antigens of avian pathogens and uses thereof |
WO2021123104A1 (en) | 2019-12-20 | 2021-06-24 | Intervet International B.V. | Multivalent hvt vector vaccine |
WO2021257706A1 (en) | 2020-06-17 | 2021-12-23 | Boehringer Ingelheim Animal Health USA Inc. | Recombinant hvt vectors expressing influenza hemagglutinin and immunogenic compositions, and production and uses thereof |
WO2022079160A2 (en) | 2020-10-15 | 2022-04-21 | Ceva Sante Animale | Recombinant hvt and uses thereof |
WO2022136623A1 (en) | 2020-12-24 | 2022-06-30 | Intervet International B.V. | Multivalent hvt vector vaccine |
WO2023213946A1 (en) | 2022-05-05 | 2023-11-09 | Intervet International B.V. | New multivalent hvt vector vaccine |
Also Published As
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US11730807B2 (en) | Multivalent recombinant avian herpes viruses and vaccines for immunizing avian species | |
EP3391903B1 (en) | Recombinant gallid herpesvirus 3 vaccines encoding heterologous avian pathogen antigens | |
US10188720B2 (en) | Recombinant Marek's disease viruses and uses thereof | |
EP2419132A1 (en) | Recombinant avian herpes virus vectors and vaccine for immunizing waterfowl species | |
US20220040287A1 (en) | Recombinant avian herpes viruses containing multiple foreign genes | |
US20230372474A1 (en) | Recombinant hvt and uses thereof | |
RU2812979C2 (en) | Recombinant avian herpes viruses containing several alien genes |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13713195 Country of ref document: EP Kind code of ref document: A1 |
|
ENP | Entry into the national phase |
Ref document number: 2868132 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: 14388268 Country of ref document: US Ref document number: 001487-2014 Country of ref document: PE |
|
WWE | Wipo information: entry into national phase |
Ref document number: 14215115 Country of ref document: CO Ref document number: MX/A/2014/011754 Country of ref document: MX |
|
ENP | Entry into the national phase |
Ref document number: 2015502378 Country of ref document: JP Kind code of ref document: A |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
WWE | Wipo information: entry into national phase |
Ref document number: IDP00201406051 Country of ref document: ID |
|
REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112014024094 Country of ref document: BR |
|
REEP | Request for entry into the european phase |
Ref document number: 2013713195 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2013713195 Country of ref document: EP |
|
ENP | Entry into the national phase |
Ref document number: 20147030643 Country of ref document: KR Kind code of ref document: A Ref document number: 2014143830 Country of ref document: RU Kind code of ref document: A |
|
ENP | Entry into the national phase |
Ref document number: 112014024094 Country of ref document: BR Kind code of ref document: A2 Effective date: 20140929 |