WO2013139479A1 - Nouveaux marqueurs de diagnostic d'une leucémie myélomonocytaire chronique (cmml) spécifique - Google Patents
Nouveaux marqueurs de diagnostic d'une leucémie myélomonocytaire chronique (cmml) spécifique Download PDFInfo
- Publication number
- WO2013139479A1 WO2013139479A1 PCT/EP2013/000852 EP2013000852W WO2013139479A1 WO 2013139479 A1 WO2013139479 A1 WO 2013139479A1 EP 2013000852 W EP2013000852 W EP 2013000852W WO 2013139479 A1 WO2013139479 A1 WO 2013139479A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- dokl
- expression
- cells
- level
- gene
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
- G01N33/57426—Specifically defined cancers leukemia
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
- G01N33/57492—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites involving compounds localized on the membrane of tumor or cancer cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Definitions
- the present invention relates to new identified genetic markers to diagnose specific chronic myelomonocytic leukemia (CMML), more a CMML with an increased content in immature granulocytes having an immunosupressor activity, which immunosupressor activity induces a disappearance of autologous lymphocytes activated with anti-CD3 and anti-CD28 antibodies through cell-cell contact and by inhibiting macrophagic differentiation through alpha-defensin secretion.
- CMML chronic myelomonocytic leukemia
- Hematopoiesis is maintained by a hierarchical system where hematopoietic stem cells (HSCs) give rise to multipotent progenitors, which in turn differentiate into all types of mature blood cells.
- HSCs hematopoietic stem cells
- Clonal stem-cell disorders in this system lead to Acute Myeloid Leukemia (AML), Myeloproliferative Neoplasms (MPNs), Myelodysplastic Syndromes (MDS) and Myelodysplastic/Myeloproliferative disorders.
- AML Acute Myeloid Leukemia
- MPNs Myeloproliferative Neoplasms
- MDS Myelodysplastic Syndromes
- Myelodysplastic/Myeloproliferative disorders Myelodysplastic/Myeloproliferative disorders.
- myelodysplastic/myeloproliferative neoplasms include four myeloid diseases grouped in 1999 by the WHO: chronic myelomonocytic leukemia (CMML), juvenile myelomonocytic leukemia (JMML), atypical chronic myeloid leukemia (aCML) and unclassified myelodysplastic/myeloproliferative syndromes (U- MDS/MPS).
- CMML chronic myelomonocytic leukemia
- JMML juvenile myelomonocytic leukemia
- aCML atypical chronic myeloid leukemia
- U- MDS/MPS unclassified myelodysplastic/myeloproliferative syndromes
- CMML its four defining features include an absolute monocytosis of >1X10 9 /L, the absence of Philadelphia chromosome or BCR-ABL fusion gene or a fusion gene that include PDGFRb gene (e.g. TEL-PDGFRb fusion gene), a percentage of blast cells in the bone marrow lower than 20%, and a variable degree of dyplasia in all three lineages.
- Myeloblasts and promonocytes comprise less than 5% of nucleated cells in peripheral blood. Roughly half of patients present with an elevated white cell count that is commonly associated with hepatomegaly and splenomegaly, the so-called myeloproliferative form of the disease. Patients lacking these features are generally considered to have the myelodysplastic form of the disease.
- the invention is based on the discovery by the present inventors that the DOK1 and DOK2 genes are under-expressed in some CMML patients associated with an unusual monocytic fraction, which fraction comprises in immature granulocytes (CD 14- CD24+ CD 15+).
- dokl and/or dokl can be used as markers for diagnosing this specific
- MDSC Myeloid-derived suppressor cells
- MDSC differentiation can be obtained by using all- trans retinoic acid (ATRA, LEI et al, PloS One., vol.8(l): e53479), vitamin D or ultra-low doses of paclitaxel (MICHELS et al, J. Immunotoxicol, vol.9(3), p:292-300, 2012).
- ATRA all- trans retinoic acid
- MICHELS et al J. Immunotoxicol, vol.9(3), p:292-300, 2012.
- ROS inhibitors such as CDDO-Me (2- cyano-3,12-dioxooleana-l,9-dien-28-oic acid; NAGARAJ et al, Clin. Cancer Res., vol.l6(6), p: 1812-23, 2010), crizotinib (a TKI having ROS inhibitor capacities), histamine (See. International Patent application WO 02/033050) or deferoxamine (See. International Patent application WO 2007/067567).
- the present invention relates to an in vitro method for determining the prognosis of a subject suffering from CMML, which comprises the step of determining the presence of CD14-/CD24+/CD15+ cells in the PBMC fraction of said subject and wherein the presence of said cells in the PBMC fraction is indicative of a poor prognosis. More specifically, said CD14-/CD24+/CD15+ cells are also CD 16-, HLA-DR low and CD1 lb+. Said CD14-/CD24+/CD15+ cells correspond to MDSCs.
- a PBMC fraction with more than 1%, preferably more than 10%, and more preferably more than 20%, of CD14-/CD24+/CD15+ cells is indicative of a CMML with a poor prognosis.
- the present invention further relates to an in vitro method for diagnosing a CMML associated with an increased level of immunosuppressive CD 14- /CD24+/CD15+ cells in a subject, which comprises the steps of:
- CMML granulocytes inhibit autologous CD3 + lymphocytes activation in a contact dependent manner and inhibit macrophage differentiation of monocytes through alpha-defensin secretion.
- said CMML associated with an increased level of immunosuppressive CD14-/CD24+/CD15+ cells corresponds to a subject having a PBMC fraction with more than 1%, preferably more than 10%, and more preferably more than 20%, of CD14-/CD24+/CD15+ cells.
- CMML is associated with a poor prognosis.
- the biological sample is a blood or bone marrow sample.
- said method comprises the step (i) of determining the level of expression of the dokl and/or dok2 gene(s) in monocytes and/or immature granulocytes subset(s) of said biological sample.
- the normal level of expression of the dokl and/or dok2 gene(s) is the level of expression of said genes in a control sample corresponding to a biological sample of non-tumoral cells.
- the present invention further relates to a composition for treating a subject suffering from such a CMML associated with an increased level of immunosuppressive CD14-/CD24+/CD15+ cells comprising a compound that: i) promotes the differentiation of said cells; ii) promotes the decrease of said cells; and/or iii) inhibits the immunosupressor activity of said cells.
- the present invention also relates to a method for treating a subject suffering from such a CMML associated with an increased level of immunosuppressive CD 14- /CD24+/CD15+ cells comprising the steps of administrating to said subject an effective amount of a compound that: i) promotes the differentiation of said cells; ii) promotes the decrease of said cells; and/or iii) inhibits the immunosupressor activity of said cells; eventually associated with a pharmaceutically acceptable carrier.
- the present invention further relates to an in vitro method for monitoring a DNA methyltransferase inhibitor treatment in a patient suffering from CMML and being diagnosed for an under-expression of the dokl and/or dokl gene(s) before treatment, said method comprising the steps of:
- the invention further relates to a kit for diagnosing chronic myelomonocytic leukemia (CMML) associated with an increased level of immunosuppressive CD 14- /CD24+/CD15+ cells in a subject comprising at least one nucleic acid probe or oligonucleotide or at least one antibody, which can be used in a method as disclosed previously, for determining the level of expression of the dokl and/or dok2 gene(s).
- CMML chronic myelomonocytic leukemia
- the Figure 1 shows that mice deficient for DOK1/DOK2 have more CD24+/Grl+ cells in their blood with aging.
- the Figure 2 shows that Dokl ⁇ Dol ⁇ 7" mice exhibit a myeloproliferative disease with granular hyperplasia when they are aging.
- the Figure 3 shows that granulocytic cells (Ly6G+) isolated from Dokl " " Dok2 " " mice have immunosuppressive properties.
- the Figure 4 shows that the expression study of DOK1 and DOK2 is decreased in some CMML patients.
- the Figure 5 shows that the expression of DOK1 and/or DOK2 genes is decreased in monocytes (CD 14+) and immature granulocytes (CD 14-) in some patients with CMML.
- the Figure 6 shows that CMML patients accumulate immature granulocytes with a suppressor effect on T cells.
- the Figure 7 shows that that the immunosuppressive activity of immature granulocytes is ROS mediated.
- the Figure 8 shows overall survival (OS) and progression-free survival (PFS) for the CMML patients as a function of the percentage of CD14-/CD24+ cells in the PBMC fraction.
- the Figure 9 shows that the expression of the DOK2 is restored after several cycle of treatment of decitabine in some patients.
- the Figure 10 shows the methylation pattern of the DOK2 promoter in one CMML patient with low DOK2 mRNA level at inclusion (4a) and after 3 (4b) and 6 (4c) cycles of decitabine.
- a first object of the present invention relates to an in vitro method for determining the prognosis of a subject suffering from CMML, which comprises the step of determining the presence of CD14-/CD24+/CD15+ cells in the PBMC fraction of said subject and wherein the presence of said cells in the PBMC fraction is indicative ⁇ of a poor prognosis.
- CD14-/CD24+/CD15+ cells enables to identify a specific CMML patients' subgroup.
- CD14-/CD24+/CD15+ cells are also CD 16-, HLA-DR ,0W and CDl lb+.
- the inventors demonstrate for the first time that such CMML patients' subgroup comprises Myeloid-derived suppressor cells (MDSC).
- MDSC Myeloid-derived suppressor cells
- a PBMC fraction with more than 1%, preferably more than 10%, and more preferably more than 20%, of CD14-/CD24+/CD15+ cells is indicative of a CMML with a poor prognosis.
- the present invention relates to an in vitro method for diagnosing a CMML associated with an increased level of immunosuppressive CD 14- /CD24+/CD15+ cells in a subject, which comprises the steps of:
- dokl gene also known as p62DOK, MGC 1 17395 or MGC 138860, refers to a gene encoding a DOKl protein ("docking 1 protein” or "downstream of tyrosine kinase 1") which is a part of a signal transduction pathway downstream of receptor tyrosine kinase.
- the DOKl gene or protein can be from any source, but typically is a mammalian (e.g., human and non- human primate) DOKl, particularly a human DOKl .
- a mammalian (e.g., human and non- human primate) DOKl particularly a human DOKl .
- An exemplary human native DOKl amino acid sequence is provided in GenPept database under accession number NP 001372 (SEQ id n°l) and an exemplary human native DOK2 nucleotide sequence is provided in GenBank database under accession number NM_001381 (SEQ id n°2).
- DOK2 gene or protein can be from any source, but typically is a mammalian (e.g., human and non- human primate) DOK2, particularly a human DOK2.
- GenPept database under accession number NP 003965 (SEQ id n°3) and an exemplary human native DOK2 nucleotide sequence is provided in GenBank database under accession number NM 003974 (SEQ id n°4).
- the term "subject” refers to a mammal, preferably a human. According to the invention, said subject may be healthy, but the method of the invention is particularly useful for testing a subject thought to develop or to be predisposed to developing chronic myelomonocytic leukemia (CMML) associated with an increased level of immunosuppressive CD14/CD24+/CD15+ cells. In that case, the method of the invention enables to confirm that said subject develops or is predisposed for developing CMML.
- CMML chronic myelomonocytic leukemia
- biological sample refers to solid tissues such as, for example, a bone marrow biopsy, a splenoctomy or any tissue biopsy in case of cell infiltration; and to fluids and excretions such as for example, blood, serum or plasma.
- said biological sample is a blood, bone marrow sample or any tissue biopsy in case of cell infiltration, preferably a blood or bone marrow sample.
- the method of the invention comprises the step (i) of determining the level of expression of the dokl and/or dokl gene in the monocytes and/or immature granulocytes subset(s) of said biological sample, preferably in the monocytes subset of said biological sample.
- the term "monocytes” refers to a type of leukocytes (representing about 3 to 8% of total leukocytes) produced by the bonne marrow from haematopoietic stem cell precursors called monoblasts.
- Classical monocytes are characterized by a high expression level of the CD 14 cell surface receptor (CD 14+ cells).
- Granulocytes refers to a type of leukocytes characterized by the presence of granules in their cytoplasm. Granulocytes are also characterized by a high expression level of the CD24 cell surface receptor (CD24+ cells).
- Said monocytes and immature granulocytes may be selected by well known methods in the art (such as flow cytometry) using the specific surface markers expressed on the cells (CD 14 and CD24 respectively).
- the "under-expression" of the dokl and/or dok2 gene occurs when the transcription and/or the translation of said gene is lower than the standard error of the assay employed to assess expression, and is preferably at least 50% inferior to the normal level of expression of said gene, preferably at least 75% inferior to the normal level of expression of said gene, and most preferably at least 85% inferior to the normal level of expression of said gene.
- the "normal level of expression" of the dokl and/or D dok2 gene is the level of expression of said gene in a control sample corresponding to a biological sample of non-tumoral cells, preferably in the monocytes and/or granulocytes subset(s) of said biological sample of non-tumoral cells, most preferably in the monocytes subset of said biological sample of non-tumoral cells.
- Said biological sample of non-tumoral cells can be simply obtained, as an example, from a healthy subject such as by purification of peripheral blood monocytes sorted from a healthy donor blood sample.
- Said normal level of expression is assessed in a control sample and preferably is the average expression level of said gene in several control samples.
- the level of expression of the dokl and/or dok2 gene is assessed by determining the level of expression of its mRNA transcript or mRNA precursors, such as nascent RNA, of said gene.
- Such analysis can be assessed by preparing mRNA/cDNA from cells in a biological sample from a subject, and hybridizing the mRNA/cDNA with a reference polynucleotide.
- the prepared mRNA/cDNA can be used in hybridization or amplification assays that include, but are not limited to, Southern or Northern analyses, polymerase chain reaction analyses, such as quantitative PCR (TAQMAN), and probes arrays such as GENECHIPTM DNA Arrays (AFFYMETRIX).
- the analysis of the expression level of mRNA transcribed from the dokl and/or dok2 gene(s) involves the process of nucleic acid amplification, e. g., by RT-PCR (the experimental embodiment set forth in U. S. Patent No. 4,683, 202), ligase chain reaction (BARANY, Proc. Natl. Acad. Sci. USA, vol.88, p: 189-193, 1991), self sustained sequence replication (GUATELLI et al., Proc. Natl. Acad. Sci. USA, vol.87, p: 1874-1878, 1990), transcriptional amplification system (KWOH et al., 1989, Proc. Natl. Acad. Sci.
- RT-PCR the experimental embodiment set forth in U. S. Patent No. 4,683, 202
- BARANY Proc. Natl. Acad. Sci. USA, vol.88, p: 189-193, 1991
- self sustained sequence replication (GUATELLI et al.,
- amplification primers are defined as being a pair of nucleic acid molecules that can anneal to 5' or 3 'regions of a gene (plus and minus strands, respectively, or vice-versa) and contain a short region in between.
- amplification primers are from about 10 to 30 nucleotides in length and flank a region from about 50 to 200 nucleotides in length. Under appropriate conditions and with appropriate reagents, such primers permit the amplification of a nucleic acid molecule comprising the nucleotide sequence flanked by the primers.
- the expression of the dokl and/or dok2 gene is assessed by determining the level of expression of the DOK1 and/or DOK2 protein.
- Such analysis can be assessed using an antibody (e.g., a radio-labelled, chromophore-labelled, fluorophore-labelled, or enzyme-labelled antibody), an antibody derivative (e.g., an antibody conjugate with a substrate or with the protein or ligand of a protein of a protein/ligand pair (e.g., biotin-streptavidin)), or an antibody fragment (e.g., a single-chain antibody, an isolated antibody hypervariable domain, etc.) which binds specifically to the protein translated from DOK1 and/or DOK2.
- an antibody e.g., a radio-labelled, chromophore-labelled, fluorophore-labelled, or enzyme-labelled antibody
- an antibody derivative e.g., an antibody conjugate with a substrate or with the protein or ligand of a protein of a protein/ligand pair (e.g., biotin-streptavidin)
- an antibody fragment e.g., a single-
- EIA enzyme immunoassay
- RIA radioimmunoassay
- ELISA enzyme linked immunoabsorbant assay
- Polyclonal antibodies can be prepared by immunizing a suitable animal, such as mouse, rabbit or goat, with the DOK1 and/or DOK2 protein or a fragment thereof (e.g., at least 10 or 15 amino acids).
- a suitable animal such as mouse, rabbit or goat
- the antibody titer in the immunized animal can be monitored over time by standard techniques, such as with an ELISA using immobilized polypeptide.
- antibody producing cells can be obtained from the animal and used to prepare monoclonal antibodies (mAb) by standard techniques, such as the hybridoma technique originally described by KOHLER and MILSTEIN (Nature, vol.256, p:495- 497, 1975), the human B cell hybridoma technique (KOZBOR et al., Immunol., vol.4, p: 72, 1983), the EBV- hybridoma technique (COLE et al., In Monoclonal Antibodies and Cancer Therapy, Alan R. Liss,Inc, p: 77-96, 1985) or trioma techniques.
- mAb monoclonal antibodies
- Hybridoma cells producing the desired monoclonal antibody are detected by screening the hybridoma culture supernatants for antibodies that bind the polypeptide of interest, e.g., using a standard ELISA.
- Monoclonal antibodies directed against DOK1 protein are well known from the skilled person such as the antibodies commercialized by ABCAM, ABGENT, ACRIS ANTIBODIES, ABNOVA CORPORATION, etc.
- Monoclonal antibodies directed against DOK2 protein are well known from the skilled person such as the antibodies commercialized by ABCAM, ABGENT, ACRIS ANTIBODIES, ABNOVA CORPORATION, CELL SIGNALLING TECHNOLOGY, GENETEX, etc.
- a third object of the invention relates to a composition for treating a subject suffering from such a CMML associated with an increased level of immunosuppressive CD14-/CD24+/CD15+ cells comprising a compound that: i) promotes the differentiation of said cells; ii) promotes the decrease of said cells; and/or iii) inhibits the immunosupressor activity of said cells; eventually associated with a pharmaceutically acceptable carrier.
- CMML patients comprise a fraction of MDSC, which fraction is implicated in the disease progression.
- immunosuppressive fraction associated with the fact that solid tumors expressing similar fractions have been successfully treated enables to predict that said specific CMML patients can be treated with similar protocols.
- Such compounds can be simply identified by the skilled person. As an example of such compounds, one can cites the ones disclosed in NAJJAR & FINKE, (abo vementioned, 2013).
- ATRA all-trans retinoic acid
- vitamin D vitamin D
- paclitaxel a compound that promotes the differentiation of MDSC
- curcumin As an example of a compound that promotes the decrease of MDSC, one can cites curcumin, Gemcitabine, 5-Fluorouracil or sunitinib
- ROS inhibitors such as CDDO-Me (2-cyano-3,12-dioxooleana- l,9-dien-28-oic acid), crizotinib, histamine or deferoxamine.
- a CMML associated with an increased level of immunosuppressive CD 14- /CD24+/CD15+ cells corresponds to a subject having a PBMC fraction with more than 1%, preferably more than 10%, and more preferably more than 20%, of CD 14- /CD24+/CD15+ cells.
- pharmaceutically acceptable refers to molecular entities and compositions that are physiologically tolerable and do not typically produce an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human.
- pharmaceutically acceptable means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
- carrier refers to a diluent, adjuvant, excipient, or vehicle with which the compound is administered.
- Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like.
- Water or aqueous solution saline solutions and aqueous dextrose and glycerol solutions are preferably employed as carriers, particularly for injectable solutions. Suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences” by E.W. Martin.
- a forth aspect of the invention relates to a method for treating a subject suffering from such a CMML associated with an increased level of immunosuppressive CD 14- /CD24+/CD15+ cells comprising the steps of administrating to said subject an effective amount of a compound that: i) promotes the differentiation of said cells; ii) promotes the decrease of said cells; and/or iii) inhibits the immunosupressor activity of said cells; eventually associated with a pharmaceutically acceptable carrier.
- a compound that: i) promotes the differentiation of said cells; ii) promotes the decrease of said cells; and/or iii) inhibits the immunosupressor activity of said cells; eventually associated with a pharmaceutically acceptable carrier.
- an "effective amount" of a composition is one which is sufficient to achieve a desired biological effect, in this case i) inducing the differentiation of MDSC, ii) the decrease of MDSC and/or, iii) the inhibition of the immunosupressor activity of said MDSCs.
- the effective dosage will be dependent upon the age, sex, health, and weight of the subject, kind of concurrent treatment, if any, frequency of treatment, and the nature of the effect desired.
- the ranges of effective doses provided below are not intended to limit the invention and represent preferred dose ranges. However, the preferred dosage can be tailored to the individual subject, as is understood and determinable by one of skill in the art, without undue experimentation.
- a fifth object of the invention relates to an in vitro method for monitoring a DNA methyltransferase inhibitor treatment in a patient suffering from such a CMML associated with an increased level of immunosuppressive CD14-/CD24+/CD15+ cells and being diagnosed for an under-expression of the dokl and/or dokl gene(s) before treatment, said method comprising the steps of:
- said method is for further determining the prognosis of said patient, wherein an increase of the expression of dokl and/or of dok2 genes is correlated to a good prognosis.
- the invention relates to an in vitro method for monitoring a DNA methyltransferase inhibitor treatment in a patient suffering from CMML and being diagnosed for an under-expression of dok2gem before treatment, said method comprising the steps of:
- the method comprises the step (i) of determining the level of expression of the dokl and/or dok2 gene(s) in the monocytes and/or immature granulocytes subset(s) of said biological sample.
- said DNA methyltransferase inhibitor is decitabine.
- a sixth object of the invention relates to a kit for diagnosing such a CMML associated with an increased level of immunosuppressive CD14-/CD24+/CD15+ cells in a subject comprising at least one nucleic acid probe or oligonucleotide or at least one antibody, which can be used in a method as disclosed previously, for determining the level of expression of the dokl and/or dok2 gene(s).
- the oligonucleotide is at least one PCR primer, preferably a set of PCR primers is provided, which allows amplifying the dokl and/or dok2 gene(s) or a fragment thereof.
- oligonucleotide or set of PCR primers which allows amplifying a region of the dokl and/or dok2 gene(s), provided that the nucleic acid sequence of dokl and/or dokl gene(s) is well known.
- the kit comprises at least the PCR primer pair: CCAAGCTCGGGTGAAGGA (SEQ id n°5) and GTGGCACAGCGTAGTCATCAGT (SEQ id n°6) for determining the level of expression of the DOK1 gene.
- the kit comprises at least the PCR primer pair: GGCAGTGAAACAAGGCTTCTTG (SEQ id n°7) and CGAAGCGGCGCCATT (SEQ id n°8) for determining the level of expression of the DOK2 gene.
- the kit comprises at least the both PCR primer pair SEQ id n°5-6 and SEQ id n°7-8 for determining the level of expression of the dokl and dok2 genes respectively.
- the term "kit” refers to any delivery system for delivering materials. In the context of reaction assays, such delivery systems include systems that allow for the storage, transport, or delivery of reaction reagents (e.g., oligonucleotides, enzymes, etc. in the appropriate containers) and/or supporting materials (e.g., buffers, written instructions for performing the assay etc.) from one location to another.
- reaction reagents e.g., oligonucleotides, enzymes, etc. in the appropriate containers
- supporting materials e.g., buffers, written instructions for performing the assay etc.
- kits include one or more enclosures (e.g., boxes) containing the relevant reaction reagents and/or supporting materials.
- the term “fragmented kit” refers to delivery systems comprising two or more separate containers that each contains a subportion of the total kit components. The containers may be delivered to the intended recipient together or separately.
- a first container may contain an enzyme for use in an assay, while a second container contains oligonucleotides.
- fragment kit is intended to encompass kits containing Analyte specific reagents (ASR's) regulated under section 520(e) of the Federal Food, Drug, and Cosmetic Act, but are not limited thereto.
- ASR's Analyte specific reagents
- any delivery system comprising two or more separate containers that each contains a subportion of the total kit components are included in the term “fragmented kit.”
- a “combined kit” refers to a delivery system containing all of the components of a reaction assay in a single container (e.g., in a single box housing each of the desired components).
- kit includes both fragmented and combined kits.
- kits can also include one or more reagents, buffers, hybridization media, nucleic acids, primers, nucleotides, probes, molecular weight markers, enzymes, solid supports, databases, computer programs for calculating dispensation orders and/or disposable lab equipment, such as multi-well plates, in order to readily facilitate implementation of the present methods.
- Enzymes that can be included in the present kits include nucleotide polymerases and the like.
- Solid supports can include beads and the like whereas molecular weight markers can include conjugatable markers, for example biotin and streptavidin or the like.
- the kit is made up of instructions for carrying out the method described herein for diagnosing a myeloid cancer in a subject.
- the instructions can be provided in any intelligible form through a tangible medium, such as printed on paper, computer readable media, or the like.
- the inventors have analysed the expression of Grl and CD24 markers in the blood of two control mice and two Dokl ⁇ Dol ⁇ 7" mice at 3, 6 and 12 months by FACS analysis.
- the Figure 1 A shows an example of the expression of Grl and CD24 markers in the blood of two control mice and two Dokl " " Dok2 " " mice at 3, 6 and 12 months.
- the median is represented by a black line. /
- the inventors further analysed by FACS the expression of monocytes (CDl lb + Ly6C +), granulocytes (SSC, Ly6G +) and myeloid (CDl lb + Grl +) markers in the blood of Dokl T>okr " mouse of 22 months.
- the figure 2A shows an example of comparison of the expression of monocytic markers (CDl lb + Ly6C +), granulocytes markers (SSC, Ly6G +) and myeloid markers (CDl lb + Grl +) in the blood of one control mouse and one Dokl "/" Dok2 "/" mouse of 22 months.
- CDl lb + Ly6C + monocytic markers
- SSC, Ly6G + granulocytes markers
- CDl lb + Grl + myeloid markers
- the median is represented by a black line.
- EO eosinophils
- PN PN
- MONO monocytes.
- mice exhibit a myeloproliferative disease with granular hyperplasia when they are aging 3) Increased suppressor granular cells in Dokl " " Dok2 "/" mice
- the inventors used spleen cells from OT-1 mice, which have CD8+ T cells expressing a transgenic TCR recognizing the peptide SIINFEKL.
- CD8+ T cells were purified from said mice with CD8 microbeads (MILTENYI BIOTEC) and stained 10 minutes with CFSE (Carboxyfluorescein diacetate succinimidyl ester) (1 ⁇ in PBS) at 37°C, then washed 3 times in complete medium.
- CD8+ cells were cultured with specific peptide SIINFEKL (BACHEM) (10 ⁇ ) in the presence of Grl+ cells isolated from control or Dokl-/-Dok2-/- mice (GrlWT abd GrlDKO, respectively) (1 :1 ratios). Three days later, proliferation of OT-1 cells was evaluated with CFSE dilution by flow cytometry.
- the figure 3 A shows the stimulation of CSFE loaded OT-I cells in presence of wt or Dokl " " Dok2 "/” Gr cells.
- the figure 3 B and C illustrate the proliferation of autologous T cells labeled with CFSE, cultured alone or in presence of an equivalent amount of monocytic cells (Ly6C +) or granulocytic cells (Ly6G +) sorted by flow cytometry from bone marrow of control (B) or Dokl ok2 " (C) mice of 22 months. The peak corresponding to the number of T cells on day 0 is not shown for clarity.
- top the peak corresponding to the number of T cells at day 2 cultured alone (black) is overlaid with the one corresponding to T cells at day 2 cultured in presence of monocytic cells (Ly6C +) or granulocytic cells (Ly6G +) (blue).
- the fluorescence intensity is represented on the abscissa, the number of cells on the ordinate.
- the inventors thus studied the expression level of messenger RNA by RT-qPCR (normalized to the gene L32) of DOK1 and DOK2 in CD14 + cells (niRNA was extracted from purified monocytes of healthy donors) of 152 patients suffering from CMML, which expression was compared to the average value obtained from 15 normal subjects.
- the figure 4 shows the observed DOK1 and DOK2 mRNA expression level in group #1 DOK1 and DOK2 low, ⁇ ; group #2 DOK1 low, O group #3 DOK2 low, ®; group #4 DOKl and DOK2 normal, ⁇ .
- Median black bar
- mR A expression units average value with standard deviation, ⁇ ).
- the inventors have next studied the mRNA and protein expression levels of the dokl and dok2 genes in monocytes and immature granulocytes of some patients.
- the proteins extracted from human monocytes and immature granulocytes were denaturated by boiling in LAEMMLI buffer then separated by SDS-PAGE and electro-blotted to nitrocellulose membranes.
- Membranes were blocked in IX PBS-T (0.1%) and BSA (5%) (blocking buffer) during lh at room temperature.
- Membranes were incubated with the primary antibody (DOKl or DOK2, CELL SIGNALING) diluted in the blocking buffer at 4°C overnight. Then, the membranes were washed three times in IX PBS-T (0.1%) during 10 min each. Secondary antibodies conjugated with horseradish peroxidase were added, and the membranes were incubated at room temperature during lh.
- the figure 5 shows the dokl and dok2 transcripts expression in cells of different healthy donors (1, 2 and 3) and in duplicate in some CMML patients (i.e., 432, 428, 440 and 441).
- CMML patients i.e., 432, 428, 440 and 441.
- the obtained expression of DOKl and DOK 2 protein in CD14 + and CD 14 " cells is shown as compared to the Bcl-X protein (control).
- dokl and/or dok.2 transcripts expression level confirmed in some CMML patients.
- the results further established that this transcripts decrease correlates with DOK1 and/or DOK2 protein decrease in the same monocyte and immature granulocytes.
- dokl and/or dok2 genes can be used as markers for said "some" CMML patients comprising a fraction of immature granulocytes (CD 14-, CD 15+, CD 16-, CD24+, HLA-DR low ).
- CMML patients accumulate immature granulocytes with a suppressor effect on T cells.
- the figure 6 A and B show for the CMML1 and CMML2 patients respectively the T cell proliferation induction in the absence of autologous CD147CD24 + cells, or in the presence of said CD147CD24 + cells in transwell or in co-culture.
- the fluorescence intensity is represented on the abscissa, the number of cells on the ordinate.
- the peak corresponding to the number of T cells at day 1 cultured alone (grey) is overlaid with the one corresponding to T cells at day 1 cultured in presence of immature granulocyte (CD 14-) in a transwell (middle panel) or in co-culture (right panel).
- CMML#2 cells are represented at day 1 according to their size (horizontal axis) and their granularity (y axis), the absolute number is the number of living cells in the window corresponding to T cells.
- the results show that the CD3 + CMML lymphocytes loaded with CFSE and stimulated with anti-CD3/28 antibodies disappeared when incubated with immature granulocytes compared with lymphocytes alone ( Figure 6 A and B). Moreover, this immunosuppression requires cell-cell contact since immature granulocytes incubated in an upper insert have no effect ( Figure 6 A and B).
- MDSCs which cells are probably critical in the evolution of the disease.
- the suppressive function of these CD14-/CD24+ immature granulocytes was measured by their ability to inhibit the proliferation of autologous T cells.
- Suppression assay wells were then analysed by flow cytometry for proliferation of T cells after 2 or 3 days. A total of 10,000 events per sample were collected and data were analysed using FLOWJO software.
- the figure 7 shows the percentage of alive lymphocytes in the presence of immature granulocytes with or without ROS inhibitor.
- Activated lymphocytes were arbitrary put at 100% of living cells and the percentage of living cells was calculated in accordance.
- the results show that human CD14-/CD24+ immature CMML granulocytes inhibit autologous CD3+ lymphocytes activation in a ROS-dependent manner.
- the MDSCs fraction is a prognosis marker
- the inventors determined, in a series of 110 CMML patients, the percentage of CD14-/CD24+ cells ranging from 0 to 95%.
- This first determination step identified a median level of expression of 20%, which was used as a cut off for determining the potential impact of this MDSC
- the Overall survival (OS) for the patients was defined as the time between inclusion onset and death.
- Univariate analyses were performed with the log-rank test and Cox model for dichotomic and continuous variables.
- Statistical analysis was performed on STATA Version 10 and R Version 2.10.1 software packages.
- the figure 8A shows the OS for the CMML patients as a function of the percentage of CD14-/CD24+ cells in the PBMC fraction.
- the figure 8B shows the PFS for the CMML patients as a function of the percentage of CD14-/CD24+ cells in the PBMC fraction.
- the inventors further determined the dok2 expression in CMML patients treated with decitabine and with different prognostic.
- Dok2 gene expression was determined by quantitative PCR analysis as previously in monocytes from CMML patients at inclusion and after 3 and 6 cycles of decitabine treatment.
- the peripheral blood mononuclear cells were selected from CMML patient before AutoMacs negative selection for monocyte enrichment.
- Side/forward scatters were analyzed by flow cytometry at inclusion and after 3 and 6 cycles of decitabine.
- the response to the treatment has been scored as following: 5: complete response; 1 : stable disease and 0: progression.
- the figure 9 shows the dok2 transcript expression in the peripheral blood monocytes for CMML patients at the inclusion, after 3 and 6 decitabine cycles treatment for two well responsive patients (i.e. Score 5, A and B), one low-responsive patient (i.e., Score 1, C) and one non-responsive patient (i.e., Score 0, D).
- Dok2 is an epigenetically regulated gene in CMML patients.
- the sequence of said gene was determined before and after said treatment using bisulfite sa as t identified methylated cytosine.
- FIG 10 shows the obtained sequence for the CMML patient described previously in Figure 9A at the inclusion (4a) and after 3 (4b) or 6 (4c) decitabine cycle treatment.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Hematology (AREA)
- Molecular Biology (AREA)
- Pathology (AREA)
- Oncology (AREA)
- Biomedical Technology (AREA)
- Cell Biology (AREA)
- Analytical Chemistry (AREA)
- Urology & Nephrology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Organic Chemistry (AREA)
- Physics & Mathematics (AREA)
- Hospice & Palliative Care (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Genetics & Genomics (AREA)
- Food Science & Technology (AREA)
- General Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
La présente invention concerne un procédé de détermination du pronostic d'un sujet souffrant de CMML, lequel comprend l'étape de détermination de la présence de cellules CD14-/CD24+/CD15+ dans la fraction de PBMC dudit sujet et où la présence desdites cellules dans la fraction de PBMC est indicatrice d'un pronostic sombre ; une composition pour le traitement d'une telle CMML spécifique ; une méthode de diagnostic d'une leucémie myolomonocytaire chronique (CMML) associée à un niveau accru de cellules immunosuppressives CD14-/CD24+/CD15+ chez un sujet, laquelle comprend les étapes de (i) détermination du niveau d'expression du ou des gènes dockland dokl dans un échantillon biologique provenant dudit sujet et (ii) comparaison dudit niveau d'expression des gènes dokland dok2 dans ledit échantillon biologique avec son niveau normal d'expression ; où une sous-expression des gènes dokland dok2 est associée avec CMML ; et une trousse pour le diagnostic d'une telle CMML chez un sujet comprenant au moins deux sondes acides nucléiques ou oligonucléotides ou au moins deux anticorps, lesquels peuvent être utilisés dans une telle méthode.
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US201261613545P | 2012-03-21 | 2012-03-21 | |
EPEP12002011.0 | 2012-03-21 | ||
USUS61/613,545 | 2012-03-21 | ||
EP12002011 | 2012-03-21 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2013139479A1 true WO2013139479A1 (fr) | 2013-09-26 |
Family
ID=49221861
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/EP2013/000852 WO2013139479A1 (fr) | 2012-03-21 | 2013-03-21 | Nouveaux marqueurs de diagnostic d'une leucémie myélomonocytaire chronique (cmml) spécifique |
Country Status (1)
Country | Link |
---|---|
WO (1) | WO2013139479A1 (fr) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2015176860A1 (fr) * | 2014-05-22 | 2015-11-26 | Institut Gustave-Roussy | Diagnostic de la leucémie myélomonocytaire chronique (lmmc) par cytométrie de flux |
WO2016042137A1 (fr) * | 2014-09-19 | 2016-03-24 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Procédé pour diagnostiquer la leucémie myélomonocytique chronique myéloproliférative ou le néoplasme myélodysplasique myéloprolifératif non classifié |
Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
US5854033A (en) | 1995-11-21 | 1998-12-29 | Yale University | Rolling circle replication reporter systems |
WO2002033050A2 (fr) | 2000-10-12 | 2002-04-25 | Maxim Pharmaceuticals, Inc. | Procedes et compositions stimulant la maturation de monocytes |
WO2007067567A2 (fr) | 2005-12-07 | 2007-06-14 | Albert Einstein College Of Medicine Of Yeshiva University | Procede de traitement ou de prevention des effets pathologiques d'augmentations aigues d'hyperglycemie et/ou d'augmentations aigues du flux d'acides gras libres |
US20110301110A1 (en) * | 2010-06-03 | 2011-12-08 | Aucagne Romain | TRIM33 (TIF1gamma) AS A NEW DIAGNOSTIC MARKER OF CHRONIC MYELOMONOCYTIC LEUKEMIA (CMML) |
EP2412825A1 (fr) * | 2009-03-24 | 2012-02-01 | Riken | Marqueurs de cellules souches leucémiques |
-
2013
- 2013-03-21 WO PCT/EP2013/000852 patent/WO2013139479A1/fr active Application Filing
Patent Citations (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
US4683202B1 (fr) | 1985-03-28 | 1990-11-27 | Cetus Corp | |
US5854033A (en) | 1995-11-21 | 1998-12-29 | Yale University | Rolling circle replication reporter systems |
WO2002033050A2 (fr) | 2000-10-12 | 2002-04-25 | Maxim Pharmaceuticals, Inc. | Procedes et compositions stimulant la maturation de monocytes |
WO2007067567A2 (fr) | 2005-12-07 | 2007-06-14 | Albert Einstein College Of Medicine Of Yeshiva University | Procede de traitement ou de prevention des effets pathologiques d'augmentations aigues d'hyperglycemie et/ou d'augmentations aigues du flux d'acides gras libres |
EP2412825A1 (fr) * | 2009-03-24 | 2012-02-01 | Riken | Marqueurs de cellules souches leucémiques |
US20110301110A1 (en) * | 2010-06-03 | 2011-12-08 | Aucagne Romain | TRIM33 (TIF1gamma) AS A NEW DIAGNOSTIC MARKER OF CHRONIC MYELOMONOCYTIC LEUKEMIA (CMML) |
Non-Patent Citations (26)
Title |
---|
ATRA, LEI ET AL., PLOS ONE., vol. 8, no. L, pages E53479 |
BARANY, PROC. NATL. ACAD. SCI. USA, vol. 88, 1991, pages 189 - 193 |
CHRISTIANSSON LISA H.: "Increased levels of myeloid-derived suppressor cells (MDSCs) in chronic myeloid leukemia and the effect of tyrosine kinase inhibitors on MDSCs in vitro", 11 December 2011 (2011-12-11), XP002697984, Retrieved from the Internet <URL:https://ash.confex.com/ash/2011/webprogram/Paper36605.html> [retrieved on 20130129] * |
COLE ET AL.: "Monoclonal Antibodies and Cancer Therapy", 1985, ALAN R. LISS,INC., pages: 77 - 96 |
COLIGAN ET AL.: "Current Protocols in Immunology", 1994, JOHN WILEY & SONS |
DROIN ET AL., BLOOD, vol. 115, no. 1, 2010, pages 78 - 88 |
DROIN NATHALIE ET AL: "Alpha-defensins secreted by dysplastic granulocytes inhibit the differentiation of monocytes in chronic myelomonocytic leukemia", BLOOD, vol. 115, no. 1, January 2010 (2010-01-01), pages 78 - 88, XP002683489 * |
DROIN NATHALIE: "Myeloid-derived supresssive cells belonging to the leukemic clone account for immunosuppression in CMML", 6 December 2010 (2010-12-06), XP002697983, Retrieved from the Internet <URL:https://ash.confex.com/ash/2010/webprogram/Paper27259.html> [retrieved on 20130129] * |
F. PETRELLI ET AL: "Targeted Therapies and other Agents as First-Line Maintenance and Beyond: Particular Benefit in Pulmonary Adenocarcinoma Patients", CURRENT MEDICINAL CHEMISTRY, vol. 18, no. 11, 1 April 2011 (2011-04-01), pages 1640 - 1650, XP055064623, ISSN: 0929-8673, DOI: 10.2174/092986711795471310 * |
GUAN ET AL.: "P-120 Low dose all-trans-retinoic acid and androgen therapy for patinets with myelodysplastic syndrome", LEUKEMIA RESEARCH, NEW YORK,NY, US, vol. 29, 1 January 2005 (2005-01-01), pages S69 - S70, XP027722013, ISSN: 0145-2126, [retrieved on 20050101] * |
GUATELLI ET AL., PROC. NATL. ACAD. SCI. USA, vol. 87, 1990, pages 1874 - 1878 |
KOHLER; MILSTEIN, NATURE, vol. 256, 1975, pages 495 - 497 |
KOZBOR ET AL., IMMUNOL., vol. 4, 1983, pages 72 |
KWOH ET AL., PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 1173 - 1177 |
LAMKIN THOMAS J ET AL: "All-trans retinoic acid induces p62(DOK1) and p56(DOK2) expression which enhances induced differentiation and G0 arrest of HL-60 leukemia cells", AMERICAN JOURNAL OF HEMATOLOGY, vol. 81, no. 8, August 2006 (2006-08-01), pages 603 - 615, XP002683490, ISSN: 0361-8609 * |
LE ET AL., INT. IMMUNOPHARMACOL., vol. 9, 2009, pages 900 - 909 |
LIZARDI ET AL., BIOL, TECHNOLOGY, vol. 6, 1988, pages 1197 |
MICHELS ET AL., J. IMMUNOTOXICOL., vol. 9, no. 3, 2012, pages 292 - 300 |
NAGARAJ ET AL., CLIN. CANCER RES., vol. 16, no. 6, 2010, pages 1812 - 23 |
NAJJAR; FINKE, FRONT. ONCOL., vol. 3, no. 49, 2013 |
NIKI MASARU ET AL: "Role of Dok-1 and Dok-2 in leukemia suppression", JOURNAL OF EXPERIMENTAL MEDICINE, vol. 200, no. 12, 20 December 2004 (2004-12-20), pages 1689 - 1695, XP002683492, ISSN: 0022-1007 * |
RAUH MICHAEL J.: "Arginase and KL-40, effectors of immunosuppressive myeloid cells, are over-expressed in the bon marrow of most chronic myelomonocytic leukemia patientsm and are potential prognositic biomarkers in myelodysplastic syndrom", 4 December 2010 (2010-12-04), XP002697982, Retrieved from the Internet <URL:https://ash.confex.com/ash/2010/webprogram/Paper30293.html> [retrieved on 20130129] * |
TU ET AL., CANCER PREV RES (PHILA), vol. 5, no. 2, 2012, pages 205 - 15 |
VINCENT ET AL., CANCER RES., vol. 70, 2010, pages 3052 - 3061 |
XIN ET AL., CANCER RES., vol. 69, no. 6, 2009, pages 2506 - 13 |
YASUDA TOMOHARU ET AL: "Role of Dok-1 and Dok-2 in myeloid homeostasis and suppression of leukemia", JOURNAL OF EXPERIMENTAL MEDICINE, vol. 200, no. 12, 20 December 2004 (2004-12-20), pages 1681 - 1687, XP002683491, ISSN: 0022-1007 * |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2015176860A1 (fr) * | 2014-05-22 | 2015-11-26 | Institut Gustave-Roussy | Diagnostic de la leucémie myélomonocytaire chronique (lmmc) par cytométrie de flux |
US10557849B2 (en) | 2014-05-22 | 2020-02-11 | Institut Gustave-Roussy | Diagnostic of chronic myelomonocytic leukemia (CMML) by flow cytometry |
WO2016042137A1 (fr) * | 2014-09-19 | 2016-03-24 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Procédé pour diagnostiquer la leucémie myélomonocytique chronique myéloproliférative ou le néoplasme myélodysplasique myéloprolifératif non classifié |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Ge et al. | Tumor associated CD70 expression is involved in promoting tumor migration and macrophage infiltration in GBM | |
Schulz et al. | Inflammatory cytokines and signaling pathways are associated with survival of primary chronic lymphocytic leukemia cells in vitro: a dominant role of CCL2 | |
Retz et al. | CXCR4 expression reflects tumor progression and regulates motility of bladder cancer cells | |
CN110446928B (zh) | 用于预测癌症免疫疗法临床效果的免疫学生物标志物 | |
Haines et al. | Human CD4+ T cell recent thymic emigrants are identified by protein tyrosine kinase 7 and have reduced immune function | |
Xu et al. | Role of osteopontin in amplification and perpetuation of rheumatoid synovitis | |
Seiffert et al. | Soluble CD14 is a novel monocyte-derived survival factor for chronic lymphocytic leukemia cells, which is induced by CLL cells in vitro and present at abnormally high levels in vivo | |
Neudoerfl et al. | The peripheral NK cell repertoire after kidney transplantation is modulated by different immunosuppressive drugs | |
Eluard et al. | The alternative RelB NF-κB subunit is a novel critical player in diffuse large B-cell lymphoma | |
Nakou et al. | Gene expression in systemic lupus erythematosus: bone marrow analysis differentiates active from inactive disease and reveals apoptosis and granulopoiesis signatures | |
Giannoni et al. | An interaction between hepatocyte growth factor and its receptor (c-MET) prolongs the survival of chronic lymphocytic leukemic cells through STAT3 phosphorylation: a potential role of mesenchymal cells in the disease | |
Desbois et al. | Specific follicular helper T cell signature in Takayasu arteritis | |
Van Brussel et al. | Fluorescent activated cell sorting: an effective approach to study dendritic cell subsets in human atherosclerotic plaques | |
Kshirsagar et al. | Enhanced Activity of Akt in Teff Cells From Children With Lupus Nephritis Is Associated With Reduced Induction of Tumor Necrosis Factor Receptor–Associated Factor 6 and Increased OX40 Expression | |
EP2678684A1 (fr) | Myh10 comme nouveau marqueur diagnostique de pathologies résultant de l'inactivation de runx1 | |
EP2738557A1 (fr) | Réponse immunitaire organisée dans le cancer | |
Karl et al. | Oxidative DNA damage in reconstituting T cells is associated with relapse and inferior survival after allo-SCT | |
WO2015169781A1 (fr) | Marqueurs prédictifs du succès d'une immunothérapie anticancéreuse | |
WO2013139479A1 (fr) | Nouveaux marqueurs de diagnostic d'une leucémie myélomonocytaire chronique (cmml) spécifique | |
US20220042996A1 (en) | Compositions and methods related to latrophilins as biomarkers for haematopoietic cell cancer | |
KR20230062834A (ko) | 암 치료에 대한 반응을 예측하기 위한 바이오마커 | |
Al-Rubaie et al. | Cd49d as prognostic marker in b-cell chronic lymphocytic leukemia in correlation with the expression of cd38, zap-70 and clinical Binet stage | |
Kyrcz-Krzemień et al. | The kinetics of mRNA transforming growth factor beta1 expression and its serum concentration in graft-versus-host disease after allogeneic hemopoietic stem cell transplantation for myeloid leukemias | |
EP4049029A1 (fr) | Biomarqueurs diagnostiques et pronostiques de la rémission d'une maladie dans la polyarthrite rhumatoïde | |
Chong et al. | Induced Sezary syndrome PBMCs poorly express immune response genes up-regulated in stimulated memory T cells |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13715603 Country of ref document: EP Kind code of ref document: A1 |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
122 | Ep: pct application non-entry in european phase |
Ref document number: 13715603 Country of ref document: EP Kind code of ref document: A1 |