Classifications

• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides
  • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
  • A61P31/12—Antivirals
  • A61P31/14—Antivirals for RNA viruses
  • A61P31/18—Antivirals for RNA viruses for HIV
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2/00—Peptides of undefined number of amino acids; Derivatives thereof
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
  • C12Q1/18—Testing for antimicrobial activity of a material
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
  • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
  • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
  • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
  • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
  • G01N33/502—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
  • G01N33/5041—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects involving analysis of members of signalling pathways
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
  • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
  • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
  • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
  • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
  • G01N33/56983—Viruses
  • G01N33/56988—HIV or HTLV
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2740/00—Reverse transcribing RNA viruses
  • C12N2740/00011—Details
  • C12N2740/10011—Retroviridae
  • C12N2740/16011—Human Immunodeficiency Virus, HIV
  • C12N2740/16311—Human Immunodeficiency Virus, HIV concerning HIV regulatory proteins
  • C12N2740/16322—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N2500/00—Screening for compounds of potential therapeutic value
  • G01N2500/10—Screening for compounds of potential therapeutic value involving cells

Definitions

• the present invention relates to synthetic peptide inhibitors (Seq ID No. 67-71 ) useful as anti-HIV therapeutics.
• the invention also relates to a novel screening method for screening anti-HIV molecules.
• the invention relates to mammalian two hybrid system and cell based model for physiological response for screening of anti- HIV therapeutics.
• the present invention further relates to a reporter gene construct for the detection of the Negative factor (Nef) - Apoptosis signal regulating kinasel (ASK1 ) interaction that is essential for inhibiting apoptosis, resulting immune evasion.
• Nef-ASK1 constructs that showed interaction in mammalian-two hybrid system said to inhibit apoptosis that is activated by ASK1 was detected in ATCC CRL-1573TM cells.
• the peptide inhibitor identified manages to switch from anti-apoptotic signaling to pro-apoptotic signaling in Nef transfected ATCC CRL-1573TM cells.
• the invention relates to a screening model based on Nef and ASK1 interaction in ATCC CRL-1573TM cells using a mammalian two-hybrid system and cell based model for physiological response to analyze apoptotic activity maintaining this interaction in ATCC CRL-1573TM cells, a method of screening for those inhibitors related to Nef-ASK1 interaction, a method of screening for inhibiting a pathway initiated with Nef-ASK1 interaction which inhibits apoptosis in HIV-1 infected cells causing immune evasion.
• HIV-I is the most prevalent infectious agent worldwide and a leading causative agent of acquired immuno deficiency syndrome (AIDS). HIV is a retrovirus, which is transmitted through human fluids either through natural interactions like sexual intercourse or through artificial methods like blood transfusions, infected needles used in injections.
• the 9-10 Kb of HIV-1 genome express viral proteins (categorized in structural, enzymatic and accessory proteins functions), whose function ranges from the successful viral infection in the cell to the complete life cycle for new virions, has been extensively studied. Every viral protein is considered to be a potential target for developing anti-HIV-1 therapy (Greene and Peterlin, 2002; Stevenson 2003).
• Nef accessory protein
• virus-1 pathogenesis (Mellors et. al., 1996) by the experiment where, Nef deleted SIVmac 239 infection in rhesus monkey showed low viral load with normal CD4 counts. These monkeys were found healthy with delayed progression to AIDS (Kestler et. al., 1991 ). Also, the HIV-1 patients who were long-term non-progressor, with no clinical sign of disease progression and normal CD4 counts, upon characterization of virus revealed that majority of them had Nef gene deleted from their genome (Deacon et. al., 1995, Kirchhoff et. al., 1995,).
• Nef is deludged with functions involving interaction with different host proteins; however, the individual function required for pathogenesis has not been identified till date.
• Nef is a 27kDa protein, expressed in HIV-1 infected cells even before the formation of provirus suggesting that it initiate functions soon after entry of virus in cell.
• Nef protein enhances viral infectivity and replication respectively in infected cells.
• Nef downregulates the MHC classl from cell surface, which primarily presents viral proteins to activate cytotoxic T lymphocytes.
• Nef functions include activation of Pak kinase, activates cascade of events leading to the activation of T cells without engaging T-cell receptor [TCR] and upregulation of Fas/FasL ligand for killing bystander cells, as well as activates anti-apoptotic pathways for the survival of infected cells. All these functions of Nef are carried out in cell after interaction with host proteins.
• FasL The one of the possible mechanism of immune evasion by HIV-1 is increase of expression of both Fas and FasL on virally infected cells (1 -3).
• the expression of FasL is induced by the presence of Nef in virally infected cells (Xu, X.N. et al., 1997. Hodge, S.ef a/., 1998.).
• the Fas and TNFa-R is known as death receptor signaling pathway which converge to a common signaling molecule known as apoptosis signaling Kinase-1 (ASK1 ).
• ASK1 appears to participate as a key signaling intermediate in both as Fas and TNFa-R pathways, that activated two different subgroup of MAP kinases kinases, SEK1 or (MKK4) and MKK3/MAPKK6(MKK5) which inturn activate JNK;c-Jun amino-terminal kinase and p38 subgroup of MAP kinase, respectively(Chang, H. Y et al., 1998). Ichijo, H. et al., 1997. Nishitoh, H. ei a/.1998). The unique cis-ligated mediated apoptosis in HIV-1 infected cell is inhibited by the presence of Nef.
• This protein interacts with ASK1 and inhibits the downstream signaling pathways that induce apoptosis.
• the molecular mechanism studied is Nef interaction with ASK1 appears by specifically preventing stimulus-coupled release of thioredoxin from ASK1 (Geleziunas. R, Xu et al., 2001 ). possibly, inhibition of thioredoxin release could not activate autophosphorylation of ASK1 kinase by phosphorylating 838 threonine in kinase domain. This cannot activate ASK1 mediated phosphorylation of MEKK-SEK1 kinase which activate JNK pathway (Geleziunas.
• the death receptor signaling - ASK1 -MEKK-SEK1 -JNK axis is involved in activating apoptosis in virally infected cells.
• Nef-ASK1 interaction is inhibited then the outcome in the virally infected cells would be falling in the line of apoptosis that helps selectively clearance of HIV-1 infected cell.
• Nef-ASK1 interaction represents a potential target for this approach.
• Nef is structurally conserved and the structure function analysis revealed that with maintaining the structure, the accessible Nef conserved domain to host proteins is responsible for the function interaction in the cell (Geyer et. al., 2001 ).
• the molecular mechanism studied showed that the apoptosis was induced by phosphorylation of JNK kinase which was inhibited by the presence of Nef.
• This model will help to screen the inhibitors designed for this interaction and perhaps, which could be used to develop an alternative therapy.
• Mammalian two hybrid models have been used in scientific research in a routine manner (Colas and Brent et al., 1998).
• the present invention uses this technique to enable the user to establish the Nef-ASK1 interactions in ATCC CRL-1573TM cells. No other group has developed such a model for the evaluation of Nef-ASK1 interactions earlier and the present invention is the first of it's kind.
• the present invention serves as a novel tool to identify inhibitors of the aforesaid interactions.
• Inhibitors which are so identified, will have property to activate apoptosis in cell based system and virally infected cells. There are no known drawbacks to the technique and it is amenable to high-throughput screening. The invention will efficiently allow for the screening of a large number of compounds in a relatively short time period of upto 48 hours. This will also allow for the search of structural analogs of inhibitors identified using the method of the present invention. Inhibitors, which are identified using the present invention, will act through a novel mechanism of inhibiting Nef-ASK1 interaction. This will be an alternate approach for anti-retroviral therapies including but not restricted to the Human immuno deficiency virus (HIV), which causes AIDS.
• HIV Human immuno deficiency virus
• the main objective of the present invention is to provide synthetic peptide inhibitor useful as anti- HIV therapeutic.
• Another object of the invention provides a novel screening method for screening anti- HIV molecules.
• Yet another object of the invention is to develop mammalian two-hybrid model for assessing Nef-ASK1 interaction in ATCC CRL-1573TM cells similar to HIV-I infected cells.
• the cell based assay for physiological response of Nef-ASK1 interaction said to inhibit apoptosis that is activated by ASK1 was detected in ATCC CRL-1573TM cells and ATCC TIB- 152TM
• Another object of the invention is to provide a novel screening method to identify the molecules useful for inhibition of Nef-ASK1 interaction in eukaryotic cells.
• ASK1 overlapping fragment (Fig-1A) cloned in pBIND vector of mammalian two hybrid system which make recombinant protein with GAL4 binding domain.
• HIV-1 Nef gene was cloned in pACT vector of mammalian two hybrid vector which make recombinant protein with activation domain.
• pACT vector of mammalian two hybrid vector which make recombinant protein with activation domain.
• reconstituted transcription factor activity comes from two different protein domains that are expressed from two separate vectors.
• the DNA binding domain of GAL4 protein and the activation domain of herpes simplex virus type 1 VP16 protein provide functional transcriptional activation from RNA polymerase II basal promoters with upstream GAL4 binding sites.
• the pBIND-ld and the pACT-MyoD Control Vectors are co-transfected into ATCC CRL-1573TM cells along with the pG5/t/c (Seq ID No. 3) Vector (FigI B). Vectors are transfected by Exgen500 (farmentas).
• Yet another object of the invention is to define the specific interaction of Nef and ASK1 by scanning of entire ASK1 gene by designing small ASK1 fragments.
• Yet another object of invention is to define the minimal region of ASK1 gene which interacts with Nef.
• Yet another object of the invention is to define the molecular mechanism of apoptosis induced by ASK1 fragment which is inhibited by interacting with Nef.
• Yet another object of the invention is to define the molecular mechanism of inhibiting apoptosis by Nef-ASK1 interaction in ATCC TIB- 152TM / ATCC CRL-1573TM cells.
• Still another object of the invention is to provide the mammalian two hybrid model as a novel screening/assay system to identify novel molecules for inhibiting viral-host protein interaction.
• Still another object of the invention is to provide the cell based model as a novel screening/assay system to identify novel molecules for inhibiting viral-host protein function.
• the present invention provides a synthetic peptide useful as anti-HIV therapeutic having sequence selected from the group consisting of Seq Id No.67-71 .
• the present invention also relates to a method for screening anti-HIV molecules comprising the steps of:
• step (a) analyzing the transfected cell as obtained in step (a) for luciferase activity after incubating for a period of 48 hours for demonstrating Nef-ASK1 interaction using dual luciferase kit and luminometer; c. adding the molecule to be screened in the transfected cell of step [a] and incubating for 6 to 24 hours followed by repeating step [b] to assess its inhibitory activity on the Nef-ASK1 interaction; and
• the construct of SEQ ID No. 1 represents Nefwt gene cloned in VP16pCDNA+pACT vector.
• the construct of SEQ ID No. 16 represents ASK1 gene cloned in pBIND vector.
• the construct of SEQ ID No.3 represents the reporter constructs pG5Luc.
• the mammalian cell is selected from the group consisting of ATCC CRL-1573TM cells, T cell lines, monocytic cell lines and fibroblast cells wherein Nef-ASK1 interaction is established.
• the molecule to be screened is added at a concentration of 5 to 1 .25 ⁇ .
• the molecule screened as a potential anti-HIV therapeutic is a DEVGEANN.
• Use of peptide is for screening Anti-HIV therapeutics.
• compound comprising peptide or variant or a derivative or pharmaceutically acceptable salt thereof and the compound inhibits the binding of HIV-Nef to human Ask1.
• a pharmaceutical composition comprising a therapeutically effective amount of compound variant or a derivative or pharmaceutically acceptable salt thereof and the compound inhibits the fusion of HIV Nef to human ASK 1 , in admixture with a pharmaceutically acceptable excipient.
• a method of treating HIV infection that comprises providing to a recipient a therapeutically effective or a prophylactically effective amount of a pharmaceutical composition comprising a therapeutically effective amount of peptide which inhibits the fusion of HIV-Nef to human ASK1 , in admixture with a pharmaceutically acceptable excipient.
• the peptide inhibits binding of HIV-Nef to human ASK1.
• ASK1 fragments interaction with Nef in ATCC CRL-1573TM cells A) Designing of ASK1 fragments from N to C termination of ASK1 gene, B) MyoD-ld interaction for positive protein-protein interaction, C) ASK1 a,b,c,d,e,f, fragments were transfected with Nef wt and showed luciferase activity in ATCC CRL-1573TM cells
• Figure 2 Characterization of minimal ASK1 region interaction with Nef
• ASK1 fragments were analysed for activating apoptosis: ASK1 g, h,l and j fragments were transfected with and without Nef in ATCC CRL-1573TM cells and after 48 hrs apoptosis was assayed.
• Inhibition of apoptosis by Nef is reversed by inhibitors: a) Cells transfected with ASK1 , ASK1 and Nef, Nef alone and Nef-ASK1 with peptides in ATCC CRL-1573TM cells were cultured for 48 hrs and analysed for apoptosis; b) crystal structure of Nef depicting tetramer structure.
• FIG. 6 Schematic representation of construction of mammalian expression vector VP16pcDNA.
• Figure 7 Vector map of fluorescent protein gene (GFP) variants a) pEYFP-N1 and b) pECFP-NL
• a “fusion protein” refers to a polypeptide formed by the joining of two or more polypeptides through a peptide bond formed between the amino terminus of one polypeptide and the carboxyl terminus of another polypeptide.
• the fusion protein may be formed by the chemical coupling of the constituent polypeptides or it may be expressed as a single polypeptide from nucleic acid sequence encoding the single contiguous fusion protein.
• a single chain fusion protein is a fusion protein halving a single contiguous polypeptide backbone.
• two-hybrid system refers to a system comprising two chimeric molecules one of which bears a nucleic acid binding region, the other of which bears an expression control element (e.g. a transactivation or repressor domain).
• the molecules further a cognate binding pair such that one chimeric molecule is capable of specifically binding to the other chimeric molecule.
• the two-hybrid system further comprises a nucleic acid encoding a protein binding site that is specifically bound by the protein binding domain on the chimeric molecule thereby anchoring the chimeric molecule to the nucleic acid.
• the domain of the chimeric molecule recognizes and binds to its cognate binding partner on the second chimeric molecule thereby recruiting that molecule to the nucleic acid whereby the expression control element alters (e.g. activates) expression of a gene or cDNA comprising the underlying nucleic acid.
• Transfection is used herein to mean the delivery of expressible nucleic acid to a target cell, such that the target cell is rendered capable of expressing said nucleic acid.
• nucleic acid includes both DNA and RNA without regard to molecular weight
• expression means any manifestation of the functional presence of the nucleic acid within the cell, including without limitation, both transient expression and stable expression.
• transactivator refers to a molecule that induces transcription and/or upregulates transcription of a gene or cDNA. The transactivator may be a complete "native" molecule or a domain of a molecule that is capable of inducing and/or upregulating transcription of a gene or cDNA.
• Reporter genes are genes or cDNAs that express an easily assayable (detectable and/or quantifiable) product. Detection of the assayable product indicates the expression and/or level of expression of the reporter gene. Reporter genes are well known to those of skill in the art. They include, but are not limited to, genes expressing bacterial chloramphenicol acetyl transferase (CAT), beta-galactosidase (.beta.
• GFP green fluorescent protein
• other fluorescent protein various bacterial luciferase genes, e.g., the luciferase genes encoded by Vibrio harveyi, Vibrio fischeri, and Xenorhabdus luminescens, the firefly luciferase gene Flux, and the like.
• transcriptional activators refers to proteins, which activate transcription in yeast, plant, insect and mammalian cells. These proteins contain two parts: one directs DNA binding and the other, called the activating region, presumably interacts with some component of the transcriptional machinery. Activating regions are typically acidic and require some poorly-understood aspect of structure, probably at least in part an alpha-helix.
• the "transcriptional activator system" utilized is the one, which is formed by fusing a DNA-binding fragment of the yeast activator GAL4 to a highly acidic portion of the herpes simplex virus protein VP16.
• VP16 activates transcription of immediate early viral genes by using its amino-terminal sequences to attach to one or more host-encoded proteins that recognize DNA sequences in their promoters.
• the full length ASK1 cDNA cloned in pCMVsport6 vector (BC054503) was purchased from SAF labs.
• the forward and reverse primers are designed for amplifying ASK1 fragments as shown in table 1.
• Nef gene was cloned in VP16pcDNA plasmid constructed in lab using pcDNA 3 (Invitrogen) as vector backbone, while the fragment containing the CMV promoter, intron, T7 promoter, nuclear localization signal and multiple cloning region was taken from the mammalian two-hybrid assay vector pACT. The resulting construct thus containing the cloned Nef gene was called
• ASK1 fragments ASK1 a (Seq ID No. 4), ASK1 b (Seq ID No. 6),
• ASK1 c (Seq ID No. 8), ASK1 d(Seq ID No. 10), ASK1 e(Seq ID No. 12),
• ASK1f (Seq ID No. 14), ASK1 g (Seq ID No. 16), ASK1 h (Seq ID No.
• ASKH (Seq ID No. 20)and ASK1j (Seq ID No. 22)were cloned in pBIND vector.
• the primers were custom-synthesized by Sigma, Operon and IDT.
• HIV-1 nef Gene of FPN 1 5' CATGGATCCGTGGAGCACTTACAAGCAGCA 3' Seq ID No accession no. RPN1 5' CATGGATCCTCAGCAGTCTTTGTAATACTCC 3' 35,36 GQ184335
• ASK1 gene of FP4 5 AGCGGATCCGTGCAGCAGACATCTGGTCTC3 ' Seq ID No accession RP3420 5 AGCGTCTAGAACTCTCAGATGCAAGGCTG3 ' 43,44 no.BC054503 for
• Plasmid was constructed by using primer containing Sail
• Table-2 primer sequence for cloning of AS 1 fragment in pEYFP-N1 vector
• HIV-1 Nef FP1 5'AGCAAGCTTATGGGGGGCAAGTGGTCAAAA3' Seq ID Gene of No
• HEK 293 cells were grown in Minimal Essential medium (low glucose, Sigma) supplemented with 10% fetal bovine serum, penicillin (100 units/ml), streptomycin (100 ⁇ g ml) and Gentamycin (50 ⁇ g ml) at 37°C with 5% C0 2 .
• 1X10 5 cells were seeded per well in twenty four well plates, one day before transfection.
• ExGen 500 (fermentas) transfection reagent all the required endotoxin free plasmid constructs were co-transfected into HEK 293 cells. 0.75 microgram of each plasmid and 5.0 micro liters per well ExGen 500 reagent were used.
• the cells were harvested and Luciferase activity was monitored using the Dual-Luciferase® Reporter assay kit (Promega). The data for basal control were used for the conversion of Luciferase activity to fold activation.
• the protein-protein interaction vectors pACTMyoD and pBIND-ID encoding the MyoD and ID control proteins, provided with the kit were used.
• Luciferase Assay The transfected cells were lysed in 1 X Passive Lysis Buffer (PLB) provided with the kit, and the cell extracts (containing Luciferase enzyme) were added to the luminometer tubes and the Luciferase and Renilla RLU were measured on Berthold luminometer using the respective substrates for 10s along with 2s delay time.
• PLB Passive Lysis Buffer
• the ASK1 interacts with Nef and inhibits apoptosis ( Geleziunas et al 2001 ), however, the region of ASK1 that is interacting with Nef is not known. To identify which region it is interacting, the ASK1 gene approximately 4.1 Kb, was divided in overlapping fragments of approximately 1 Kb from N-terminal to cover entire ASK1 gene. These fragments were cloned in pBIND mammalian two-hybrid vector, which has GAL4 DNA binding domain.
• the ASK1 fragment cloned in pBIND were; ASK1 a (1 -1035), ASK1 b (959-2010), ASKI c (1820-2712), ASKI d (2581 -3152), ASK1 e (3153-3552) and ASK1 f(3478-4100), as shown in figure(1 a).
• the full length Nef gene was cloned in pACT mammalian two hybrid vector, which has all the interacting domains (Accession no. GQ184335).
• the mammalian two-hybrid vectors cloned with or without Nef and ASK1 fragments were co-transfected along with G5Luc (luciferase) vector in ATCC CRL-1573TM cells.
• the reporter luciferase expression was measured after 48 hours of transfection.
• ASK1 fragments ASK1 a, ASK1 b and ASKI d showed 2.28, 1 .10 and 2.89 fold, respectively, luciferase activity compared to negative control pACT-pBIND.
• ASKI c, ASKI d and ASKIf showed no luciferase activity compared to control, as shown in fig-1 (b).
• the MyoD-ld protein was taken as positive control for showing interaction of proteins in mammalian-teo hybrid model, as shown in fig (1 c). In this model the set of vectors which is expressing luciferase gene in cells are considered to be interacting with each other.
• ASK1 a, ASK1 b and ASK1 d fragments showed interaction with Nef which indicate that these fragments may have tendency in ASK1 for its interaction ability.
• Constructs were made based by adding upstream and downstream sequences of ASK1 a and ASK1 d respectively. Larger constructs which were made are ASK1 g (contain both ASK1 a, ASK1 d and in between sequence), ASK1 h (Contain ASK1 d and upstream sequence), ASK1 i (contain ASK1 a and downstream sequence) and ASK1j (contain in between ASK1 a and ASK1 d fragment), as shown in Fig2a. All the ASK1 constructs were cloned in pBIND mammalian two-hybrid vectors. The ASK1 fragments and Nef were co-transfected along with G5Luc vector, in ATCC CRL- 1573TM cells and luciferase activity was measured 48 hrs post transfection.
• the ASK1 g fragment showed maximum luciferase activity 154 fold times compared to negative control pACT-pBIND, as shown in fig 2c.
• the ASK1 i and ASK1 h showed luciferase activity 2.72 and 8.41 fold respectively as compared to negative control, as shown in fig 2b.
• the ASK1j showed no luciferase activity 0.5 fold same as negative control was found (figure 2b).
• ASK1 g is the minimal region of ASK1 required for interaction with Nef, deletion of either ASK1 a or ASK1 d reduced substantially interaction with Nef and loss of both fragments from ASK1 g leads to complete loss of interaction. These results indicate that ASK1 g fragment interacts with Nef through ASK1 a and ASK1 d regions.
• ASK1 expression either by external stress stimuli or over expression of ASK1 gene activates apoptosis in cells.
• ASK1 is active in oligomeric state. The N and C region have oligomerization sequence.
• ASK1 is oligomerized with C region coiled coil region and at N-region after release of thioredoxin protein.
• ASK1 catalytic domain (670-940) forms a tight dimmer interacting in a head-to-tail fashion (Bunkoczi. et al 2007, Structure15, 1215-1226). The oligomerization activates self phosphorylation of 838 Threonine residue in the kinase domain. Nef inhibits apoptosis by interacting with ASK1 .
• the ASK1 g, h, i, j fragments showing interactions in mammalian two-hybrid model were studied for its function to induce apoptosis in ATCC CRL-1573TM cells and its inhibition by Nef.
• the ASK1 g, h, i,j fragments alone and with Nef were transfected in ATCC CRL- 1573TM cells.
• the transfected cells were cultured for 48 hours and were labeled with AnnexinV and PI staining for analyzing aspoptosis.
• the ASK1 g,h,l, fragments induces apoptosis in ATCC CRL-1573TM cells and percentage positive cells for annexinV staining were 42, 42 and 45% respectively compared to control cells.
• the Nef co-transfected with ASK1 g, ASK1 h and ASK1 i showed 20%, 38% and 26% respectively annexin V stained cells that show inhibition of apoptosis by 52%, 10% and 42% respectively.
• the ASK1j has 28% annexin V stained cells compared to Nef control 20% and after Nef co-transfection there is no reduction in apoptosis compared to ASK1j, as shown in (Figure3).
• Inhibitors were designed from the crystal structure of Nef solved in our laboratory (Pankaj et al., 2011 ) The inhibitors were cultured with cells transfected will Nef, ASK1 g and co-transfected with Nef-ASK1 g. The cells after 48 hours were analysed for apoptosis using annexin V and PI staining. The results show that the Nef-ASK1 expression in ATCC CRL-1573TM cells inhibited apoptosis by 50% compared to ASK1 alone. The inhibitors reversed the effect of Nef-ASK1 interaction that is inhibition of apoptosis by increasing annexin V stained cells same to ASK1 cells Fig4.
• Nef-ASK1 co-transfected in cells show inhibition of apoptosis and is reversed by inhibitors.
• ASK1 MAPKKK induces apoptosis by JNK and p38 pathway.
• the minimal ASK1 g fragment can activate JNK and p38 pathway to induce apoptosis and the presence of Nef can affect this pathway.
• the ASK1 g and Nef were transfected alone and co-transfected in ATCC CRL-1573TM cells.
• the JNK and p38 pathways were detected by analyzing phosphorylation of JNK or p38 kinases by using phosphorylated antibodies.
• the results showed that ASK1 g fragment activated JNK pathway by phosphorylated JNK kinase where as late effect was seen in p38 kinase (data not shown).
• Further in co-transfected cell with Nef inhibits the phosphorylation of JNK kinase whereas In presence of peptide the JNK phosphorylation is reversed, same as ASK-1 , inhibited by Nef-ASK-1 interaction(Figure5).
• the reporter gene construct is simple to use and does not involve human or animal models of testing.
• This method is amenable to screening a large number of compounds in a relatively short time when coupled with high-throughput technologies or as a stand-alone assay procedure.
• the present inhibitor(s) will be a novel therapeutic and will overcome HIV-I resistance issues.
• ASK1 signalregulating kinase 1
• Fackler 0., Moris, A., Tibroni, N., Giese, S., Glass, B., Schwartz, O. and Krausslich, H.G.

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Engineering & Computer Science (AREA)
• Immunology (AREA)
• Molecular Biology (AREA)
• General Health & Medical Sciences (AREA)
• Organic Chemistry (AREA)
• Medicinal Chemistry (AREA)
• Biomedical Technology (AREA)
• Biochemistry (AREA)
• Urology & Nephrology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Hematology (AREA)
• Virology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Analytical Chemistry (AREA)
• Physics & Mathematics (AREA)
• Microbiology (AREA)
• Biotechnology (AREA)
• Tropical Medicine & Parasitology (AREA)
• Biophysics (AREA)
• Genetics & Genomics (AREA)
• Gastroenterology & Hepatology (AREA)
• Food Science & Technology (AREA)
• Cell Biology (AREA)
• Pathology (AREA)
• General Physics & Mathematics (AREA)
• Toxicology (AREA)
• Animal Behavior & Ethology (AREA)
• Pharmacology & Pharmacy (AREA)
• Public Health (AREA)
• Veterinary Medicine (AREA)
• AIDS & HIV (AREA)
• Wood Science & Technology (AREA)
• Zoology (AREA)
• Epidemiology (AREA)
• General Engineering & Computer Science (AREA)
• Communicable Diseases (AREA)
• Oncology (AREA)

Priority Applications (1)

Applications Claiming Priority (2)

Publications (2)

Family

ID=48326351

Family Applications (1)

Country Status (3)

Families Citing this family (1)

Family Cites Families (5)

• 2013
  • 2013-03-01 WO PCT/IB2013/051641 patent/WO2013128418A2/en not_active Ceased
  • 2013-03-01 US US14/382,428 patent/US9327009B2/en not_active Expired - Fee Related
  • 2013-03-01 IN IN594DE2012 patent/IN2012DE00594A/en unknown

Non-Patent Citations (17)

Also Published As

Similar Documents

Legal Events