WO2013125967A1

WO2013125967A1 - An rna oligomer, methods for regulating a microrna production process and rna oligomers used as microrna production process regulators

Info

Publication number: WO2013125967A1
Application number: PCT/PL2013/000024
Authority: WO
Inventors: Anna KURZYŃSKA-KOKORNIAK; Natalia KORALEWSKA; Marek Figlerowicz; Agata Tyczewska; Tomasz Twardowski
Original assignee: Instytut Chemii Bioorganicznej Pan
Priority date: 2012-02-22
Filing date: 2013-02-20
Publication date: 2013-08-29
Also published as: EP2817408A1; PL398211A1

Abstract

The present invention relates to an RNA oligomer, methods for regulating ' a miRNA production process and RNA oligomers used as miRNA production process regulators. More precisely, the present invention relates to use of RNA oligomers disrupting a pre-miRNA structure as miRNA production process regulators. Oligomer interactions with a miRNA precursor (pre-miRNA) change the precursor' s secondary and tertiary structure. In consequence, the pre-miRNA is not specifically recognised and cleaved by the Dicer ribonuclease, and the specific miRNA is not produced.

Description

An KNA oligomer, methods for regulating a itiicroRNA production process and KNA oligomers used as microRNA production process regulators

The present invention relates to an RNA oligomer, methods for regulating a microRNA (miRNA) production process and RNA oligomers used as miRNA production process regulators. More particularly, the present invention relates to use of RNA oligomers disrupting a pre-miRNA structure as miRNA production process regulators. Oligomer interactions with a miRNA precursor (pre-miRNA) change the precursor's secondary and tertiary structure. In consequence, the pre-miRNA is not specifically recognised and cleaved by the Dicer ribonuclease, and the specific miRNA is not produced.

MiRNAs play a very important role in many physiological (e.g. developmental timing, growth, differentiation and apoptosis) as well as pathological (e.g. carcinogenesis, neurodegeneration, the immune system and rheumatic disorders) processes [1-3] . Results of recent studies indicate that miRNAs control the expression of over 60% of protein-coding genes [ ] .

Deciphering information encoded in genomes is one of the most important challenges faced by modern molecular biology and bioinformatics . It has been demonstrated that one gene can be a source of more than one transcript. Furthermore, many different mRNAs can be derived from one transcript. No simple correlation was found between genome size and an organism' s complexity. Most of a genome encodes proteins only in bacteria and simple animal or plant forms. In higher organisms, protein-encoding sequences represent only a small percentage of the genetic material (less than 5% in humans) . Decoding of the complete human genome sequence has shown that, contrary to earlier beliefs, it does not contain 150 thousand genes, but only about 25 thousand, i.e. roughly the same number as the simple model plant Arabidopsis thaliana. The real scientific breakthrough concerning mechanisms controlling the process of genetic information expression occurred, however, in recent years, mainly due to discovery of the RNA interference (RNAi) phenomenon and short regulatory RNAs, including the miRNA [5] . Further, it was found that eukaryotic genomes, including the human genome, contain sequences encoding regulatory RNAs, so- called miRNAs . These sequences may be present in protein- encoding genes (often in introns) or form independent genes, encoding not proteins but RNA alone. MiRNA-encoding transcripts are called pri-miRNAs. Their structure usually contains not-fully complementary, ca. 50-80 nucleotide, double-stranded regions, called hairpins due to their shape. It was found that miRNAs are produced both in plant and in animal cells; however, their biogenesis differs significantly in both types of cells. In human cells, three basic steps of miRNA production are distinguished [6]. . In the first, the Drosha enzyme excises a double-stranded hairpin segment from a pri-miRNA. In the second step, the newly produced 50-80 nucleotide molecule - pre-miRNA - is transported by exportin-5 from a nucleus to the cytoplasm. In the third step, the pre- miRNA is recognised by the Dicer ribonuclease, which generates a short 20-23 nucleotide duplex. This duplex is then transferred to another protein complex - RISC [RNA-induced silencing complex) . In the next step, the RISC is activated. During this process, one of the duplex strands is removed, while the other, called miRNA, remains in the complex and acts as a probe for specific recognition of fully or partially complementary RNAs [7,8]. The active RISC complex can bind to mRNAs . When an mRNA is fully complementary to the RISC miRNA, then it is cleaved (approximately in the middle of the mRNA/miRNA duplex) [9]. As a result, in a relatively short time, the whole mRNA pool is degraded and so-called posttranscriptional gene silencing (PTGS) occurs. However, when the mRNA is only partially complementary to the RISC miRNA, then it is not degraded but remains bound to the protein complex, and thus it cannot serve as a template for protein synthesis. Consequently, gene silencing by translational repression (TR) occurs.

The Dicer ribonuclease belongs to the RNase III family, i.e. to endoribonucleases specifically cleaving two-stranded RNA molecules. All enzymes in this family are characterised by the presence of one or two ribonuclease domains, referred to as the RNase III domain. RNase III digestion of dsRNAs results in specific products with phosphorylated 5' -termini and 2 nucleotide overhangs at the 3' -ends.

RNases III differ in their size, consisting of 200 to 2000 amino acids. Data collected so far suggests that the human genome encodes only one Dicer nuclease. In miRNA biogenesis, the Dicer ribonuclease is responsible for cleavage of pre-miRNAs and release of short, ca . 20-23 nucleotide, duplexes containing miRNAs . It was found that the human Dicer ribonuclease and a bacterial RNase III contain only one active site where - both RNA strands are cleaved [10, 11]. For the human Dicer, it was demonstrated, however, that its two RNase III domains function independently (each cleaves only one of the strands) [11] .

According to computer simulations, pre-miRNAs adopt a specific secondary structure, called RNA hairpin, including: i) the double-stranded region (hairpin stem) containing destabilising elements in the form of internal loops, bulges and mismatches , and ii) the single-stranded region (terminal loop) connecting sequences involved in the stem structure formation. The first reports on miRNA precursor structure significance in the miRNA production process showed that the characteristic structure and the two unpaired nucleotides at the 3' end play a crucial role in pre-miRNA recognition by the Dicer ribonuclease [12]. It was thought that the terminal loop did not influence the miRNA production process much [13]. Han et al. showed, however, that the binding efficiency of some proteins, participating in the miRNA production process, to precursors depends on a terminal loop size. Furthermore, the authors observed that the larger terminal loops present in precursors, the higher efficiency of pre-miRNA processing and thus the higher efficiency of miRNA production occurred. A similar correlation was observed by Zhang X. and Zeng Y. [14]. The authors hypothesized that large terminal loops may have an advantageous effect on the flexibility of a precursors' (pri- and pre-miRNA) secondary and tertiary structure, which in turn may facilitate the release of products resulting from either Drosha or Dicer cleavage (miRNA production efficiency increases). Another report published by G. Michlewski et al. indicated the crucial role of terminal loops present in pri- miRNAs in control of miRNA biogenesis [15] . The authors showed that use of 16-nucleotide RNA oligomers complementary to sequences in pri-miRNA terminal loops (LooptomiRs) prevented binding of key regulatory protein factors to that region, and in consequence, inhibited pre-miRNA production. Moreover, Kloosterman et al. showed that production of selected miRNAs can be inhibited by adding short RNA molecules (and their derivatives) complementary to RNA sequences present in miRNA precursors, being cleavage sites for Drosha and Dicer ribonucleases [16].

The patent application P-384455 (published on 17/8/2009) discloses that RNA aptamers binding the human Dicer ribonuclease can inhibit that enzyme activity, both in a competitive and in an allosteric way [17].

Recent results have shown that the solution related to inhibition of miRNA production by using RNA oligomers (and their derivatives) specifically binding to selected miRNA precursors and disrupting their structure, presented below, makes possible the design and produce inhibitor molecules selectively controlling specific miRNA production.

Currently, sequences of over 1500 various human miRNAs (hsa-miRNAs) are known. It is assumed that miRNAs control expression of over 60% of human genes. It is also known that miRNA-regulated genes play a crucial role in development processes, in differentiation - formation of specialised cells, tissues and organs, as well as in programmed cell death. Even small changes in miRNA biogenesis or processes responsible for correct functioning of these molecules may be associated with many types of diseases, neoplastic and degenerative processes or development disorders leading to organ dysfunctions and often to cell death.

Despite existing solutions, one of the largest challenges faced by contemporary biomedical sciences is designing and production of therapeutic tools acting selectively on specific biological targets, e.g. i) compounds selectively destroying neoplastic cells without exerting adverse effects on healthy cells; ii) compounds inhibiting specific protein activity and not binding to proteins of a structure and function similar to the targeted protein.

The present invention aims at facilitating the designing of regulatory molecules, controlling specific (particular) miRNA maturation and functioning, both in a general and in a selective way.

The proposed solution opens a way for designing new, specific therapeutic methods that can be used in treatment of diseases caused by changes in the expression levels of specific regulatory molecules, e.g. in treatment of cancer, neurodegenerative or infectious diseases.

The present invention relates to an RNA oligomer, characteristic in that it comprises:

a) sequences complementary to pre-miRNA single-stranded regions, or

b) sequences complementary to pre-miRNA double-stranded regions, or

c) sequences complementary to pre-miRNA single- and double-stranded regions,

where the oligomer interacts with pre-miRNA, disrupts a pre- miRNA structure and inhibits miRNA production from pre-miRNA. Preferably, the RNA oligomer acts at two stages: i) as a competitive inhibitor during binding to the Dicer ribonuclease, ii) as a molecule disrupting a pre-miRNA substrate structure during binding to the pre-miRNA substrate. Preferably, the RNA oligomer acts at one stage as a molecule disrupting a pre-miRNA substrate structure during binding to the pre-miRNA substrate.

Preferably, the oligomer is selected from: - RNA oligomers interacting with the Dicer ribonuclease,

- RNA oligomers interacting with the pre-miRNA substrate,

RNA oligomers interacting with pre-miRNA substrate single-stranded regions,

RNA oligomers interacting with pre-miRNA substrate double-stranded regions,

RNA oligomers interacting with pre-miRNA substrate single- and double-stranded regions,

RNA oligomers disrupting a pre-miRNA substrate structure,

RNA oligomers disrupting a pre-miRNA substrate structure so the substrate is not specifically recognised by the Dicer ribonuclease,

RNA oligomers disrupting a pre-miRNA substrate structure so specific miRNA products are not generated,

RNA oligomers disrupting a pre-miRNA substrate structure so functional miRNAs are not produced,

RNA oligomers complementary to pre-miRNA single- stranded regions,

RNA oligomers complementary to pre-miRNA double- stranded regions,

- RNA oligomers complementary to pre-miRNA single- and double-stranded regions,

- Modified oligoribonucleotides , where the modifications can be , introduced in the base, sugar or phosphate moieties .

where oligomers are up to 75 nt long.

Preferably, the oligomer contains sequences complementary to pre-miRNA single- and double-stranded regions, selected from sequences: seq. N°2, seq. N°3, seq. N°4, seq. N°7, seq. N°8, seq. N°9, seq. N°10.

The present invention also relates to the method for regulation of a miRNA production process, characterised in that it concerns stages in which the above oligomer interacts with pre-miRNAs, disrupts a pre-miRNA structure and inhibits miRNA production from pre-miRNA by the human Dicer ribonuclease .

Preferably, the method is a targeted and selective method for miRNA production inhibition.

Preferably, the RNA oligomer acts at two stages: a) it binds to Dicer, b) the product of oligomer cleavage by the human Dicer ribonuclease binds to an apical fragment of a pre-miRNA and influences the secondary and the tertiary pre-miRNA structure so a pre-miRNA is not specifically recognised and cleaved by the human Dicer ribonuclease, and miRNAs are not produced .

Preferably, the oligomer acts at one stage: forms a complex with a pre-miRNA and modifies (affects) its structure so a pre-miRNA is not specifically recognised and cleaved by the human Dicer ribonuclease and miRNAs are not produced.

Preferably, sequences complementary to pre-miRNA single- and double-stranded regions are selected from sequences:

seq. N°2, seq. N°3, seq. N°4, seq. N°7, seq. N°8, seq. N°9, seq. N°10.

The present invention also relates to use of RNA oligomers described above, disrupting a pre-miRNA structure, as regulators of the miRNA production process.

Preferably, sequences complementary to pre-miRNA single- and double-stranded regions are selected from sequences: seq. N°2, seq. N°3, seq. N°4, seq. N°7, seq. N°8, seq. N°9, seq. N°10.

To facilitate better understanding of the discussed issues, the solutions are presented in the figures, where:

Figure 1 shows the effects of the ATD_15.52 oligomer and products of ATD_15.52 cleavage by the Dicer ribonuclease on a hsa-miR-210 production process.

Reactions of pre-hsa-miR-210 cleavage were conducted in the presence of the ATD_15.52 oligoribonucleotide and synthetically obtained products of that oligomer cleavage by the human Dicer ribonuclease: 21-nucleotide 5' fragment (5'_ATD_15.52) and 35-nucleotide 3' fragment

( 3 ' _ATD_15.52 ) . (A) In reactions marked with number 1, the oligomer : Dicer molar ratio was 1:1, in reactions marked with number 2 - 10:1, and in reactions marked with number 3 -100:1. Additionally, two control reactions were always conducted: (K+) - standard reaction with no oligomer added and (K-) standard reaction without an enzyme. (B) Graphic presentation of pre-hsa-miR-210 cleavage efficiency by Dicer in the inhibitor's presence. Values shown for miRNA-210 production inhibition were determined versus a control reaction without an inhibitor molecules added. For the control reaction, pre- miRNA-210 cleavage efficiency by the human Dicer ribonuclease was determined by measuring signal intensity for the substrate - pre-miRNA and a product - miRNA.

Figure 2 shows :

(A) An autoradiogram showing native polyacrylamide gel electrophoresis results for: radiolabeled ATD_15.52 oligomer (lane 1) and ATD_15.52: pre-hsa-miR-210 complex (lane 2) ; radiolabeled 21-nucleotide 5' fragment of the ATD_15.52 oligomer (lane 3) and 5' _ATD_15.52 : pre-hsa-miR-210 complex (lane 4) ; radiolabeled 35-nucleotide 3' fragment of the ATD_15.52 oligomer (lane 5), and 3'_ATD_15.52 hybridisation with pre-hsa-miR-210 (lane 6) .

(B) An autoradiogram showing measurement results for 5' radiolabeled ATD_15.52 oligomer binding degree to the Dicer ribonuclease . Reaction mixtures containing Dicer and radiolabeled ATD_15.52 molecules were applied to a nitrocellulose membrane following: 0, 1, 2, 3, 4 and 5h incubation with an enzyme at 37 °C (during incubation with Dicer, the ATD_15.52 was cleaved into a 21-nucleotide 5' fragment and 35-nucleotide 3' fragment) .

Figure 3 shows structures, with the lowest free energy values, obtained by computer modeling for analysed pre-hsa-miR-210 molecule (A) and a complex formed by a pre-hsa-miR-210 and 21- nucleotide 5' fragment of the ATD_15.52 oligomer (B) .

Figure 4 shows an analysis of the effect of 12-nucleotide RNA oligonucleotides, specifically binding to pre-miRNA single- stranded regions, on the miRNA production process in the presence of the human Dicer ribonuclease:

(A) anti_Loop-16-l effect on pre-hsa-miR-16-1 cleavage

(B) anti_Loop-33a effect on pre-hsa-miR-33a cleavage

(C) anti_Loop-210 effect on pre-hsa-miR-210 cleavage

Figure description as in Figure 1 (A) and (B) .

Figure 5 shows the effect of the ATD_13.6 oligomer, interacting specifically with the pre-hsa-miR-210, on the miRNA production process in the presence of the human Dicer ribonuclease :

(A) An autoradiogram showing native polyacrylamide gel electrophoresis results for the radiolabeled ATD_13.6 oligomer (lane 1) and the ATD_13.6: pre-hsa-miR-210 complex (lane 2). (B) Structures, with the lowest free energy values, obtained by computer modeling for: pre-hsa-miR-210, ATD_13.6 and ATD_13.6: pre-hsa-miR-210 complex.

(C) An analysis of the ATD_13.6 effect on pre-hsa-miR-210 cleavage .

Figure description as in Figure 1 (A) and (B) .

Figure 6 shows effects of RNAs, being mRNA fragments binding specifically to pre-hsa-miR-210 single- and double-stranded regions, on the miRNA-210 production process in the presence of the human Dicer ribonuclease :

(A) Analysis of the PCDH21_fr effect on pre-hsa-miR-210 cleavage. PCDH21_fr is a fragment of the mRNA encoding a protocadherin protein (calcium-dependent cell adhesion protein) . This molecule is complementary to the pre-hsa-miR- 210 double-stranded region.

(B) Analysis of the THAP4_fr effect on pre-hsa-miR-210 cleavage. THAP4_fr is a fragment of the mRNA encoding the THAP4 protein (protein binding to DNA and metal ions). This molecule is complementary to the pre-hsa-miR-210 single- stranded region.

Figure description as in Figure 1 (A) and (B) .

Exemplary embodiments of the invention defined above are presented below.

Example

One of the crucial enzymes in the biogenesis of miRNAs and other short regulatory RNAs is the Dicer ribonuclease. It generates functional miRNA molecules, from double-stranded precursors (pre-miRNAs) . Therefore, we asked the question whether specifically designed oligoribonucleotides, interacting with pre-miRNAs and disrupting their structure, can influence a miRNA production process. (May the production process of short regulatory RNAs be controlled by other RNAs?) To solve that problem, the effect of RNA molecules (and their derivatives), binding specifically to pre-miRNAs single- and double-stranded regions, on a relevant miRNA production process with the human Dicer ribonuclease, was studied.

A) Effect of short RNA molecules , released by Dicer and interacting with pre-miRNAs, on a miRNA production process.

Previous studies, covered by the patent application P- 0384455 (published on 17/8/2009), clearly determined that the ATD_15.52 oligomer inhibits pre-hsa-miR-210 cleavage (when the oligomer was 100 times in excess of Dicer, only 15% of the substrate was cleaved - versus the control reaction without the inhibitor molecule added) [17]. It was then shown that following ATD_15.52 cleavage by Dicer, two products are obtained: a 21-nucleotide 5' fragment and a 35-nucleotide 3' fragment [17]. The experiments below show that the 5' fragment efficiently inhibits hsa-miR-210 production (when the 5' fragment was 100 times in excess of Dicer, only 9% of the substrate was cleaved) , while the 3' fragment has practically no effect on pre-hsa-miR-210 cleavage (Figure 1). Further studies · showed that the 5' fragment, resulting from ATD_15.52 cleavage by the Dicer ribonuclease, does not remain bound to the enzyme (Figure 2), but it can interact with the pre-hsa- miR-210 (Figure 2 and 3) .

The effect of the ATD_15.52 oligomer and synthetically obtained products of ATD_15.52 cleavage by the human Dicer ribonuclease: 21-nucleotide 5' fragment ( 5' _ATD_15.52 ) and 35- nucleotide 3' fragment (3' _ATD_15.52 ) , on the miRNA-210 production process was tested in vitro. For this purpose, standard digestion of human pre-hsa-miR-210 with Dicer was conducted. An individual experiment, repeated at least three times for each oligomer, included 5 reactions: two control (without the oligomer (K+) and without the enzyme (K-) ) and three reactions with various amounts of ATD_15.52, 5'_ATD_15.52 or 3'_ATD_15.52 added (the Dicer : oligomer molar ratio for these reactions was 1:1, 1:10 and 1:100) .

Selected molecule sequences :

pre-hsa-mlR-210 ( SEQ. ID No. 1)

5 ' gccccugcccaccgcacacugcgcugccccagacccacugugcgugugacagcggcug3 ' ATD_15.52 (SEQ. ID No. 2)

5' gggagaaucauaaguagcgcagugagucguugugcugcccauguuaacaguuagcc3' 5'_ATD_15.52 (SEQ. ID No. 3)

5' gggagaaucauaaguagcgca3'

3'_ATD_15.52 (SEQ. ID No. 4)

5' gugagucguugugcugcccauguuaacaguuagcc3'

The reactions were conducted at a volume of 10 μΐ in a standard Dicer ribonuclease buffer (250 mM NaCl, 20 mM Tris- HC1 pH 7.5, 2.5 mM MgCl₂) . In the reactions, a pre-miRNA labeled at the 5' end with radioactive phosphorus was used. RNA molecules were radiolabeled using the following procedure: single-stranded RNA (ssRNA) was denatured by heating to 95°C, and then it was rapidly cooled on ice. The reaction was conducted at a volume of 30 μΐ in the mixture specified in Table 1.

Table 1. Mixture composition for ssRNA radiolabelxng reaction

kinase buffer lx contains: 70 mM Tris-HCl pH 7.6, 10 mM MgCl₂, 5mM _D_T_T_._ - mixture was incubated at 37°C for 30 min.,

- reaction mixture was diluted to 200 μΐ, and 100 μΐ of phenol and 100 μΐ of chloroform was added,

-shaken and centrifuged at 14000 rpm for 1 min.,

- aqueous phase containing the nucleic acid was transferred to a new tube, 200 μΐ of chloroform was added, and then it was shaken and centrifuged at 14000 rpm for 1 min. (twice),

- 20 μΐ of 3M CH₃COONa and 3 volumes of 96% ethanol were added to the aqueous phase from extraction,

- solution was incubated at (-20°C) overnight,

- centrifuged at 14000 rpm for 20 min.,

- solution was decanted, and the precipitate was rinsed with 500 μΐ of 70% ethanol,

- centrifuged at 14000 rpm for 20 min.,

- solution was decanted, and the precipitate was dried and dissolved in 20 μΐ of H₂0,

- using a Beckman' s apparatus, the amount of radioactive material introduced to the resultant RNA pool was determined.

Radiolabeled pre-miRNA substrates were renatured by heating to 95°C followed by slow cooling to room temperature. At the next stage, various amounts of oligomers were pre- incubated with Dicer (Dicer: oligomer molar ratios of 1:1, 1:10 and 1:100) in the reaction buffer at 25°C for 10 minutes. The pre-miRNA was then added. Digestion was conducted at 37°C for 30 min. (Table 2). For each molecule, each reaction was repeated three times. Table 2. Oligomers' effect on the miRNA production process in the presence of the Dicer ribonuclease - reaction mixture composition

²buffer contains (lx): 250 mM NaCl, 20 mM Tris-HCl pH 7.5, 2.5 mM MgCl₂

When the reaction ended, the obtained products were denatured by heating to 95°C and rapidly cooled on ice and then analysed by electrophoresis on a 15% denaturing polyacrylamide gel. Electrophoretic separation was conducted in the following conditions:

- pre-electrophoresis : 1200V, 50W, 10mA for 30 min.

- electrophoresis: 1200V, 50W, 40mA for 4h.

After electrophoretic separation, the mixture composition was analysed using a scanner for radiolabeled materials (Fuji, FLA-5100) .

B) Effect of RNA oligomers binding to pre-miRNA single- and double-stranded regions on the miRNA production process .

Considering the results described in Example A, indicating that oligomers specifically interacting with the pre-miRNA may efficiently inhibit a selected miRNA production process (Figures 1, 2 and 3), a series of pre-miRNA digestion reactions with the Dicer ribonuclease was conducted in the presence of RNA oligomers complementary to single-stranded (including: terminal loops, internal loops and mismatches ) and double-stranded regions of selected precursors. The effect of 12-nucleotide RNA oligomers, specifically binding to: pre- hsa-miR-16-1 , -33a and -210 single-stranded regions, on a relevant miRNA production process was studied (Figure 4). Furthermore, the effect of the 56-nuleotide oligomer, ATD_13.6, specifically interacting with the pre-hsa-miR-210, on the miRNA-210 production process in the presence of the human Dicer ribonuclease was studied (Figure 5). According to published data [17], the ATD_13.6 oligomer also specifically binds to the human Dicer ribonuclease, but it is not cleaved by that enzyme. Reactions of pre-hsa-miR-210 digestion with Dicer were also conducted in the presence of THAP4_fr and PCDH21_fr (fragments of selected mRNA molecules), specifically binding to pre-hsa-miR-210 single- and double-stranded regions, respectively (Figure 6) .

The effect of RNA oligomers complementary to pre-miRNA single- and double stranded regions on the miRNA production process was tested in vitro. For this purpose, standard digestion of human pre-miRNAs with the Dicer ribonuclease was conducted. An individual experiment, repeated at least three times for each oligomer, included 5 reactions: two control (without the oligomer and without the enzyme) and three reactions with various amounts of the oligomer added (the pre- miRNA: oligomer molar ratio for these reactions was 1:1, 1:10 and 1 : 100) .

Selected molecule sequences :

pre-hsa-miR-16-1 (SEQ. ID No. 5)

5' uagcagcacguaaauauuggcguuaagauucuaaaauuaucuccaguauuaacugugcug cugaa3'

pre-hsa-m±R-33a (SEQ. ID No. 6)

5¹ gugcauuguaguugcauugcauguucuggugguacccaugcaauguuuccacagugcauc a3'

pre-hsa-miR-210 (SEQ. ID No. 1) 5 ' gccccugcccaccgcacacugcgcugccccagacccacugugcgugugacagcggcug3' ant±_Loop-16-l (SEQ. ID No. 7)

5' gaaucuuaacgc3'

ant±_Loop-33a (SEQ. ID No. 8)

5' ggguaccaccag3'

ant±_Loop-210 (SEQ. ID No. 9)

5' ggggcagcgcag3'

ATD_13.6 (SEQ. ID No. 10)

5' gggagaaucauaaguagcggugugugagucguggugccccauguuaacaguuagcc3 '

THAP4_fr (SEQ. ID No. 11)

5' ggagaagcaguaggagugcagugagucgaugagcu3'

PCDH21_fr (SEQ. ID No. 12)

5' ggaagaacagaaguagaggugugugaguc3 '

The reactions were conducted at a volume of 10 μΐ in a commercially available Dicer ribonuclease buffer. In the reactions, pre-miRNA labeled at the 5' end with radioactive phosphorus was used ( radiolabeling was conducted according to the procedure described above) . Radiolabeled pre-miRNA substrates were renatured by heating to 95°C followed by slow cooling to room temperature. At the next stage, various amounts of oligomers were pre-incubated with Dicer (Dicer: oligomer molar ratios of 1:1, 1:10 and 1:100) in the reaction buffer at 25°C for 10 minutes. The pre-miRNA was then added. Digestion was conducted at 37°C for 30 min. (Table 2) . For each oligomer, each reaction was repeated three times.

When the reaction ended, the obtained products were denatured by heating to 95°C, and then rapidly cooled on ice and analysed by electrophoresis -on a 15% denaturing polyacrylamide gel. Electrophoretic separation was conducted in the following conditions: - pre-electrophoresis : 1200V, 50W, 10mA for 30 min.

- electrophoresis: 1200V, 50 , 40mA for 4h.

Results of the experiments described above are presented below.

Table 3. Inhibition of selected pre-miRNA substrate cleavage by the human Dicer ribonuclease in the presence of RNA oligomers substrate inhibi or enzyme : inhibitor substrate

(oligomer) molar ratio cleavage

inhib tion

[in %]

1:1 13%

ATD 13.6 1:10 54%

1: 100 89%

1:1 20%

ATD 15.52 1:10 52%

1: 100 85%

1:1 36%

5' ATD 15.52 1 : 10 79%

1:100 91%

1:1 4%

pre-hsa-miR-210 3' ATD 15.52 1:10 9%

1: 100 15%

1:1 15%

5'+3' ATD 15.52 1:10 63%

1: 100 89%

1:1 15%

PCDH21 fr 1:10 40%

1: 100 60%

1:1 13%

THAP4 fr 1:10 25%

1: 100 56%

1:1 78%

anti Loop-210 1:10 83%

1:100 94%

1:1 51%

pre-hsa-miR-16-1 anti Loop-16-1 1:10 83%

1: 100 91%

1:1 72%

pre-hsa-miR-33a anti Loop-33a 1:10 91%

1: 100 98% The obtained results substantiate the statement that the studied RNA oligomers inhibit miRNA production by two different mechanisms. In the first case, the inhibitor molecule is a substrate for the human Dicer ribonuclease, and the products released by Dicer inhibit miRNA production (as described in section A) ; while in the second case, the inhibitor molecule may, but not necessarily, interact with Dicer - and when it interacts with Dicer, it is not cleaved by this ribonuclease (as described in section B; according to data in the report [17] concerning the ATD_13.6 oligomer, this oligomer binds to the human Dicer ribonuclease, but it is not cleaved by this enzyme) . In both cases, a key prerequisite is the oligomer (or its fragments) interaction with a miRNA precursor .

The conducted studies showed that the ATD_15.52 oligomer acts at two stages. In the first stage, the ATD_15.52 oligomer binds to Dicer more effectively than the substrate (pre-hsa- miR-210) ; thus it is digested instead of the pre-miRNA. In the second stage, a product of ATD_15.52 oligomer cleavage by the human Dicer ribonuclease (5' ATD__15.52 fragment) binds to an apical fragment of a pre-hsa-miR-210, changing the precursor secondary and tertiary structure. In consequence, the pre- miRNA is not specifically recognised and cleaved by the Dicer ribonuclease. The ATD_15.52 oligomer is, therefore, a bi- functional inhibitor. On one hand, by binding to the enzyme, it acts as a competitive inhibitor. On the other hand, by binding to the substrate, it can modify its structure so the substrate cannot bind to the enzyme active site. By adding the ATD_15.52 oligomer to the reaction of pre-hsa-miR-210 digestion by Dicer, the miRNA-210 production process is inhibited. Due to specific interactions between the oligomer and a selected precursor (sequence complementarity), the inhibition process is selective and concerns selective inhibition of a specific miRNA production (Figures 1-3).

Furthermore, the tested RNA oligomers, containing sequences complementary to single- and double-stranded regions of selected miRNA precursors, following interaction with precursors (forming a complex with precursors), modify

(affect) their structure so the substrates cannot any longer be specifically recognised and cleaved by the Dicer ribonuclease, and the selected miRNAs are not produced

(Figures 4-6) .

In the reaction conditions applied, efficient inhibition of selected miRNA production was observed even for the lowest RNA oligomer concentration (1 pmol of RNA oligomer, final concentration in the reaction mixture - 100 nM) . Moreover, it was observed that as the oligomer concentration increased, the inhibition process efficiency increased as well. The presented solution for inhibition of the miRNA production process by using RNA oligomers (and their derivatives) specifically binding to selected miRNA precursors makes possible the design and production of inhibitor molecules selectively inhibiting production of specific miRNAs.

Re erences :

1. Mattick, J.S. and I.V. Makunin, Small regulatory RNAs in mammals. Hum Mol Genet, 2005. 14 Spec No 1: p. R121-32.

2. Croce, CM. and G.A. Calin, miRNAs, cancer, and stem cell division.

Cell, 2005. 122 (1) : p. 6-7.

3. Giraldez, A. J., et al . , MicroRNAs regulate brain morphogenesis in zebrafish. Science, 2005. 308(5723): p. 833-8.

4. Olejniczak, M., et al . , Sequence-non-specific effects of RNA

interference triggers and microRNA regulators. Nucleic Acids Res., 2010. 38(1) : p. 1-16.

5. Fire, A., et al . , Potent and specific genetic interference by double- stranded RNA in Caenorhabditis elegans. Nature, 1998. 391(6669): p. 806-11.

6. Bartel, D.P., MicroRNAs: genomics, biogenesis, mechanism, and

function. Cell, 2004. 116(2): p. 281-97.

7. Nykanen, A., B. Haley, and P.D. Zamore, ATP requirements and small interfering RNA structure in the RNA interference pathway. Cell, 2001. 107(3) : p. 309-21.

8. Hammond, S.M., et al., An RNA-directed nuclease mediates post- transcriptional gene silencing in Drosophila cells. Nature, 2000. 40 (6775) : p. 293-6.

9. Haley, B. and P.D. Zamore, Kinetic analysis of the RNAi enzyme

complex. Nat Struct Mol Biol, 2004. 11(7): p. 599-606.

10. Zhang, K. and A.W. Nicholson, Regulation of ribonuclease III

processing by double-helical sequence antideterminants . Proc Natl Acad Sci U S A, 1997. 94(25): p. 13437-41.

11. Macrae, I.J., et al . , Structural basis for double-stranded RNA

processing by Dicer. Science, 2006. 311(5758): p. 195-8.

12. Zeng,Y. and B.R. Cullen, Sequence requirements for microRNA

processing and function in human cells. RNA, 2003. 9(1): p. 112-23.

13. Han, J., et al., Molecular Basis for the Recognition of Primary

microRNAs by the Drosha -DGCR8 Complex. Cell, 2006. 125(5): p. 887- 901.

14. Zhang, X. and Y. Zeng Y, The terminal loop region controls microRNA processing by Drosha and Dicer. Nucleic Acids Res., 2010. 38(21): p. 7689-97.

15. Michlewski, G., et al . , Posttranscriptional regulation of miRNAs

harboring conserved terminal loops. Mol Cell., 2008. 32(3): p. 383-93.

16. Kloosterman, W.P., et al . , Targeted inhibition of miRNA maturation with morpholinos reveals a role for miR-375 in pancreatic islet development. PLoS Biol., 2007. 5(8): p. e203.

17. Tyczewska, A., et al., Selection of RNA oligonucleotides that can modulate human Dicer activity in vitro. Nucleic Acid Ther., 2011. 21(5) :333-46.

Claims

Patent claims

1. RNA oligomer, characterised in that it comprises:

a) sequences complementary to pre-miRNA single-stranded regions, or

b) sequences complementary to pre-miRNA double-stranded regions, or

c) sequences complementary to pre-miRNA single- and double-stranded regions,

where the oligomer binds with pre-miRNAs, disrupts a pre- miRNA structure and inhibits the process of miRNA production from pre-miRNA.

2. An oligomer, according to claim 1, characterised in that the RNA oligomer acts at two stages: i) as a competitive inhibitor during binding to the Dicer ribonuclease, ii) as a molecule disrupting a pre-miRNA substrate structure during binding to the pre-miRNA substrate.

3. An oligomer, according to claim 1, characterised in that the RNA oligomer acts at one stage as a molecule disrupting a pre-miRNA substrate structure during binding to pre-miRNA substrate.

4. An oligomer, according to claim 1, characterised in that it is selected from: - RNA oligomers binding with the Dicer ribonuclease,

- RNA oligomers binding with the pre-miRNA substrate,

- RNA oligomers binding with pre-miRNA substrate single- stranded regions,

- RNA oligomers binding with pre-miRNA substrate double- stranded regions,

- RNA oligomers binding with pre-miRNA substrate single- and double-stranded regions,

RNA oligomers disrupting a pre-miRNA substrate structure,

RNA oligomers disrupting a pre-miRNA substrate structure so specific miRNA products are not produced,

RNA oligomers complementary to pre-miRNA single- stranded regions,

RNA oligomers complementary to pre-miRNA double- stranded regions,

- RNA oligomers complementary to pre-miRNA single- and double-stranded regions,

- modified oligoribonucleotides , where the modifications can be introduced in the base, sugar or phosphate moieties,

wherein oligomers are up to 75 nt long.

5. An oligomer, according to claim 1, characterised in that, it contains sequences complementary to pre-miRNA single- and double-stranded regions, selected from sequences: seq. N°2, seq. N°3, seq. N°4, seq. N°7, seq. N°8, seq. N°9, seq. N°10.

6. A method for control of the miRNA production process, characterised in that it includes stages in which the oligomer, described in claims 1 to 5, binds to pre-miRNA, disrupts a pre-miRNA structure and inhibits the process of miRNA production from pre-miRNA by the human Dicer ribonuclease .

7. A method, according to claim 6, characterised in that it is a selective and targeted method for miRNA production inhibition .

8. A method, according to claim 6 or 7, characterised in that the oligomer acts at two stages: a) it binds to Dicer, b) the product of oligomer cleavage by the human Dicer ribonuclease binds to an apical fragment of a pre-miRNA and changes the pre-miRNA secondary and tertiary structure so a pre-miRNA is not specifically recognised and cleaved by the human Dicer ribonuclease, and miRNAs are not produced.

9. A method, according to claim 6 or 7, characterised in that the oligomer acts at one stage: forms a complex with a pre- miRNA and modifies its structure so the pre-miRNA is not specifically recognised and cleaved by the human Dicer ribonuclease, and miRNAs are not produced.

10. A method, according to claim 6, characterised in that the sequences complementary to pre-miRNA single- and double- stranded regions are selected from sequences: seq. N°2, seq. N°3, seq. N°4, seq. N°7, seq. N°8, seq. N°9, seq. N°10.

11. Use of RNA oligomers, described in claims 1 to 5, disrupting a pre-miRNA structure, as miRNA production process regulators .

12. Use, according to claim 11, wherein sequences complementary to pre-miRNA single- and double-stranded regions are selected from the following sequences: seq. N°2, seq. N°3, seq. N°4, seq. N°7, seq. N°8, seq. N°9, seq. N°10.