WO2013120107A1 - Methods and compositions for treating a subject to inhibit hearing loss - Google Patents

Methods and compositions for treating a subject to inhibit hearing loss Download PDF

Info

Publication number
WO2013120107A1
WO2013120107A1 PCT/US2013/025644 US2013025644W WO2013120107A1 WO 2013120107 A1 WO2013120107 A1 WO 2013120107A1 US 2013025644 W US2013025644 W US 2013025644W WO 2013120107 A1 WO2013120107 A1 WO 2013120107A1
Authority
WO
WIPO (PCT)
Prior art keywords
foxo3
pharmaceutical composition
agents
hearing loss
agent
Prior art date
Application number
PCT/US2013/025644
Other languages
French (fr)
Inventor
Patricia WHITE
Felicia GILELS
Original Assignee
University Of Rochester
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University Of Rochester filed Critical University Of Rochester
Publication of WO2013120107A1 publication Critical patent/WO2013120107A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/13—Amines
    • A61K31/15—Oximes (>C=N—O—); Hydrazines (>N—N<); Hydrazones (>N—N=) ; Imines (C—N=C)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/205—Amine addition salts of organic acids; Inner quaternary ammonium salts, e.g. betaine, carnitine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/337—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having four-membered rings, e.g. taxol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/365—Lactones
    • A61K31/375—Ascorbic acid, i.e. vitamin C; Salts thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47—Quinolines; Isoquinolines
    • A61K31/475—Quinolines; Isoquinolines having an indole ring, e.g. yohimbine, reserpine, strychnine, vinblastine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/506—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim not condensed and containing further heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/519—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
    • A61K31/525—Isoalloxazines, e.g. riboflavins, vitamin B2
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/56—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7028—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
    • A61K31/7034—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin
    • A61K31/704—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin attached to a condensed carbocyclic ring system, e.g. sennosides, thiocolchicosides, escin, daunorubicin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K33/00—Medicinal preparations containing inorganic active ingredients
    • A61K33/06—Aluminium, calcium or magnesium; Compounds thereof, e.g. clay
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K33/00—Medicinal preparations containing inorganic active ingredients
    • A61K33/24—Heavy metals; Compounds thereof
    • A61K33/30—Zinc; Compounds thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0046—Ear
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6875—Nucleoproteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/14—Disorders of ear, nose or throat

Definitions

  • This invention relates to methods and compositions for treating a subject to inhibit hearing loss.
  • Noise exposure can cause a temporary loss of auditory function. Sound waves are detected by specialized mechanosensory cells, called inner hair cells, which send signals to the brain through spiral ganglion neurons ("SGNs"). The connection between neurons and inner hair cells is called a synapse. Loud noises cause inner hair cells to over-stimulate SGNs, a process called glutamate excitotoxicity. In response, SGNs temporarily withdraw their projections from the inner hair cells. Hearing recovery is dependent on the neurons re-connecting to the inner hair cells, which occurs naturally over several days after noise exposure. Often hearing sensitivity is compromised after this re-connection is established, probably through changes in synaptic structure. [0005] Noise exposure can also cause a permanent loss of auditory function.
  • Hearing acuity is dependent on activity by another set of mechanosensory cells, called the outer hair cells.
  • Outer hair cells physically amplify sound waves to improve inner hair cell sensitivity. Mechanical damage from noise can kill outer hair cells.
  • Noise-induced cochlear hair cell death may require stress signaling through Jun, Jun-kinase ("Jnk”), and mixed lineage kinase (“Mlk”) (Pirvola et al, "Rescue of Hearing, Auditory Hair Cells, and Neurons by CEP-1347/KT7515, an Inhibitor of c-Jun N-Terminal Kinase
  • sensorineural hearing loss In addition to apoptosis, sensorineural hearing loss also results from excitotoxic damage to inner hair cell synapses (Kujawa et al, "Adding Insult to Injury: Cochlear Nerve Degeneration after 'Temporary' Noise-Induced Hearing Loss," J.
  • human hearing disorders can stem from causes other than injury to the mechanoreceptors themselves. Mutations affecting the function of stria vascularis cells in the lateral wall of the cochlear duct result in deafness (Minowa et al, "Altered Cochlear Fibrocytes in a Mouse Model of DFN3 Nonsyndromic Deafness," Science 285(5432): 1408-11 (1999)). Animals treated with restraint stress, noise conditioning, or corticosteroid injection show resistance to noise induced hearing loss (Wang et al, "Restraint Stress and Protection From Acoustic Damage in Mice," Hear. Res.
  • a first aspect of the present invention relates to a method of treating a subject to inhibit hearing loss including administering to a subject exposed to a hearing loss event an effective amount of an agent that upregulates Foxo3 expression or enhances activity of Foxo3.
  • a second aspect of the present invention relates to a method of assessing susceptibility to Foxo3 -related hearing loss in a subject, including determining whether that subject has a variant Foxo3 gene that has reduced or absent function.
  • a third aspect of the present invention relates to a composition comprising an agent that upregulates Foxo3 expression levels in a delivery vehicle suitable for administration to the ear canal or cochlear duct.
  • Foxo3 in the cochlea was assessed by testing the auditory function of Foxo3 knockouts and wild- type littermates at two and four months of age. Foxo3 knockouts have normal hearing at two months, but experience mild age related hearing loss compared to normal littermates. In response to 105 dB noise exposure, Foxo3 knockouts have a significantly larger threshold shift and concomitant hair cell loss than their wild-type counterparts. Foxo3- dependent protection may be specific to apoptotic cell death, as no significant difference in hair cell loss was observed when neonatal Foxo3 knockout, heterozygous, and wild- type cochlea were cultured in cisplatin. Analysis of mRNA by RT-PCT hours after deafening enables the identification of apoptosis factors and potential Foxo3 targets.
  • Foxo3 is a novel deafness susceptibility gene.
  • the present invention is the first to investigate Foxo3 activity in the cochlea.
  • Foxo3 is an evolutionarily conserved transcription factor activated by mechanical or oxidative stress. Its function in cells is context-specific: it may block proliferation, initiate apoptosis, or promote recovery from stress.
  • the evidence presented herein ruled out that Foxo3 was necessary for hair cell apoptosis or governed proliferation in supporting cells. Instead, it was discovered that loss of Foxo3 function confers susceptibility to noise and accelerates hereditary deafness.
  • Foxo3 expression in both sensory hair cells and SGN's of the cochlea provides cell- intrinsic, innate protection from damage.
  • FDA-approved medicines including Paclitaxel and Doxorubicin, up-regulate Foxo3 activity and cause its nuclear localization (Sunters et al, "Paclitaxel-Induced Nuclear Translocation of FOX03a in Breast Cancer Cells is Mediated by C-Jun H2 -Terminal Kinase and Akt," Cancer Res. 66(l):212-20 (2006); Ho et al, "Phosphorylation of FOX03a on Ser-7 by p38 Promotes Its Nuclear Localization in Response to Doxorubicin, " J. Biol. Chem. 287(2): 1545-55 (2012), both of which are hereby incorporated by reference in their entirety).
  • the present invention contemplates administration of these or other medicines to mitigate cellular damage and threshold shifts in noise-exposed individuals.
  • compositions suitable for otic administration to the cochlear duct or ear canal and comprising these agents are contemplated.
  • Figures 1A-1M show Foxo3 and Foxol expression in sensory hair cells and neurons of the mouse cochlea.
  • Figure 1A shows quantitative PCR, measuring transcript levels in cells of the postnatal mouse cochlea, including the spiral ganglion. Foxo3, Foxol, and the hair cell marker Pou4f3 are shown.
  • 2-4 cochlea were shown.
  • Figures 1B-1G show that anti-Foxo3 staining ( Figures IE, IF, 1G, red) is detected in parvalbumin+ (green) hair cells at P7 ( Figures IB, IE) and P60 ( Figures 1C, IF). P60 neurotubulin+ SGNs ( Figure ID, green) also express Foxo3 ( Figure 1G).
  • Figures 1H-1M show that anti-Foxol staining (Figure IK, 1L, 1M, red) is detected in myosin 7+ (green) hair cells at P7 ( Figure 1H, IK) but not at P60 (Figure II, 1L), and is faintly visible in SGNs ( Figure U, 1M).
  • Figures 2A-2C illustrate hearing loss in PI 20 Foxo3-KO without apparent hair cell loss.
  • Figure 2B shows volume of otoacoustic emissions from the same animals, which measures outer hair cell health and function. No difference was observed between genotypes at 24 or 32 kHz.
  • Figure 2C shows a section through the basal region of a P 120 Foxo3-KO cochlea, stained with anti-myosin7 (red) and DAPI (blue). Outer hair cells appear normal. In this field, two inner hair cells are seen because of the plane section.
  • Figures 3A-3B show that neuronal density in the basal spiral ganglion is reduced in PI 20 Foxo3-KO.
  • Figure 3 A shows anti-neurotubulin (green) in PI 20 wildtype ganglion, counterstained with DAPI (blue).
  • Figure 3B shows basal ganglion from P120 Foxo3-KO, stained identically. Neuronal density is reduced by 23%.
  • Figures 4A-4E show the effects of moderate noise exposure on wild-type and Foxo3-KOs.
  • Figures 4A and 4B show typical ABR traces from a P60 wild-type mouse at 16 kHz before (Figure 4A) and 1 day post noise treatment (Figure 4B).
  • Figure 5C shows a comparison of hearing thresholds of wildtype (circles) and Foxo3-KO animals (x) before (black lines) and 14 days post noise treatment (red lines).
  • N 6 animals for genotype.
  • Figures 4D and 4E show confocal images of the basal cochlea for wild-type ( Figure 4D) and Foxo3-KO, stained with DAPI. Brackets indicate outer hair cell layer. More gaps are observed in Figure 4E. Size bar: 50 ⁇ .
  • Figures 5A-5E show Foxo3-KO in combination with Cdh23(753A) point mutation.
  • Figures 5A and 5B sequence analysis for Cdh23 for 2 Foxo3 heterozygotes bred to Balb/c.
  • Figure 5A is heterozygous at 753 and Figure 5B has two copies of the hearing loss allele.
  • Figure 5C illustrates ABR thresholds for 6 Foxo3-KO (red lines) and 10 wild-type, all with two copies of the Cdh23(753A) allele.
  • Figures 5D and 5E show whole mount views of outer hair cells in the middle turn of a wild-type (Figure 5D) and Foxo3-KO (Figure 5E) cochlea, both homozygous for Cdh23(753A) allele. More gaps are observed in Figure 5E.
  • FIGS 6A-6E illustrate that P2 Foxo3-KO hair cells are not more sensitive to cisplatin toxicity.
  • P2 parvalbumin+ hair cells Figure 6B
  • Figure 6A also express Foxo3
  • Figures 6C and 6D hair cells, marked by anti- parvalbumin, appear normal in the Foxo3-KO ( Figure 6D).
  • Figure 6E shows
  • FIG. 7 shows qPCR expression of Foxo3 -dependent oxidative stress proteins in the whole cochlea 24 hours after mild noise treatment.
  • Parvalbumin and Pou4f3 are hair cell markers; Pinkl (Pten-induced putative kinase 1), Cited2, Sod2 (Superoxide dismutase 2), Fbxo32 (F-box protein 32), Gabarapll (GABA-receptor associated protein like 1), Lcn2 (Lipocalin 2), and Cflar (CASP8 and FADD-like apoptosis regulator).
  • Figures 8A-8B show results of anti-Pou4f3 staining in deafened cochleae.
  • Figure 9 illustrates a breeding strategy for conditional knockout mice.
  • the present invention relates to novel methods of treating a subject to inhibit hearing loss by administering to a subject exposed to a hearing loss event an effective amount of an agent that upregulates Foxo3 expression or enhances activity of Foxo3, and assessing susceptibility to Foxo3 -related hearing loss in a subject, including determining whether that subject has a variant Foxo3 gene that has reduced or absent function.
  • Foxo3 (forkhead box 03) is the name assigned by the HUGO Gene
  • Foxo3 is a transcription factor, which means that it directs the production of other genes by binding near the DNA sequences that encode them. Foxo3 activity in cells is increased by mechanical damage or by the presence of oxidizing molecules. It can also be specifically induced or repressed by signaling pathways. Oxidizing molecules like peroxides damage proteins, inducing a process called oxidative stress. Excitotoxicity has similarities to oxidative stress.
  • Foxo3 activity directs different processes, all of which are stress-related: it can block cell division (tumor suppression), it can promote the expression of genes that reduce oxidative stress, or it can cause the cell to commit suicide (apoptosis). In cancer cells, Foxo3 expression is often reduced. Its functions in blocking cell division and in promoting cell suicide help prevent cells that express Foxo3 from becoming cancerous.
  • treating refers to curative therapy, prophylactic therapy, and preventive therapy.
  • prophylactic therapy refers to curative therapy, prophylactic therapy, and preventive therapy.
  • preventive therapy refers to curative therapy, prophylactic therapy, and preventive therapy.
  • prevention therapy or “prophylactic therapy” is the prevention of future hearing loss following exposure to an expected hearing loss event.
  • Those in need of treatment include those already exposed to a hearing loss event, those who have hearing loss, and those who are prone or predisposed to have future hearing loss.
  • Administration can be “chronic” administration which refers to administration of the agent(s) in a continuous mode as opposed to an acute mode, so as to maintain the initial therapeutic effect (activity) for an extended period of time.
  • Administration can also be “intermittent” administration which is treatment that is not consecutively done without interruption but, rather, is cyclic in nature.
  • Administration can also be “in combination with” one or more further therapeutic agents includes simultaneous (concurrent) and consecutive administration in any order, as discussed infra.
  • the subject to be treated in accordance with the present invention can be any mammal, but preferably a human.
  • Veterinary uses are also contemplated.
  • the individual to be treated can be an infant or juvenile, an elderly individual, an individual having a cardiopulmonary or immunosuppressive condition, or even an otherwise healthy adult.
  • the subject to be treated is not a patient undergoing chemotherapy treatment with any of the Foxo3 upregulating agents described herein.
  • the subject to be treated is characterized by Foxo3 expression levels in inner hair cells or SGNs that are lower than a normal range for individuals of the same age or other demographic group.
  • the cochlea a hollow tube coiled in the shape of a snail's shell, is filled with fluid.
  • the inside of the cochlea is divided into three regions, which is further defined by the position of the vestibular membrane and the basilar membrane.
  • the portion above the vestibular membrane is the scala vestibuli, which extends from the oval window to the apex of the cochlea and contains perilymph fluid, an aqueous liquid low in potassium and high in sodium content.
  • the basilar membrane defines the scala tympani region, which extends from the apex of the cochlea to the round window and also contains perilymph.
  • the basilar membrane contains thousands of stiff fibers, which gradually increase in length from the round window to the apex of the cochlea.
  • the fibers of the basement membrane vibrate when activated by sound.
  • the cochlear duct In between the scala vestibuli and the scala tympani is the cochlear duct, which ends as a closed sac at the apex of the cochlea.
  • the cochlear duct contains endolymph fluid, which is similar to cerebrospinal fluid and is high in potassium.
  • the Organ of Corti the sensory organ for hearing, is located on the basilar membrane and extends upward into the cochlear duct.
  • the Organ of Corti consists, in part, of about 20,000 specialized cells, called hair cells. These cells have small hairlike projections (cilia) that extend into the fluid. Sound vibrations transmitted from the ossicles in the middle ear to the oval window in the inner ear cause the fluid and cilia to vibrate. Hair cells in different parts of the cochlea vibrate in response to different sound frequencies and convert the vibrations into nerve impulses.
  • the nerve impulses are transmitted along fibers of the cochlear nerve to the brain. Despite the protective effect of the acoustic reflex, loud noise can damage and destroy hair cells.
  • a "hearing loss event” may be due to trauma, exposure to noise exceeding a decibel threshold per exposure time (see NIOSH and CDC 2002 guidelines), or exposure to ototoxins or infectious agents. Continued exposure to loud noise causes progressive damage, eventually resulting in hearing loss and sometimes noise or ringing in the ears (tinnitus).
  • the trauma may be further defined as
  • the hearing loss event may be a discrete event or it may be a cumulative event insofar as repeated exposures to loud noises or ototoxins over a course of time may also give rise to hearing loss.
  • the hearing loss can be age-related hearing loss, antibiotic-induced hearing loss, and chemotherapeutic-induced hearing loss.
  • Hearing thresholds are the least sound pressure level in decibels (db) at which a person or animal detects sound at a given frequency.
  • db decibels
  • human hearing varies from ⁇ 0 db to -100 db. If the threshold for hearing changes, it is called a threshold shift. The shift is simply the difference between the first measurement and the second measurement for any given animal. Since optimal hearing does not improve, greater shifts in threshold necessarily mean worse hearing outcomes.
  • inhibition of hearing loss in the context of the present invention means that the hearing loss concomitant with the treatment of the present invention is reduced as compared to an individual not receiving the treatment, but more preferably minimized (i.e., threshold shift of less than about 5-10 db at a particular frequency), or most preferably substantially inhibited (threshold shift of less than about 5 db) at a particular frequency.
  • the inhibition of hearing loss is measured as an average difference in threshold shift in mammals from baseline threshold sensitivity at 4, 8, and 16 kHz, as compared to an untreated control, which is at least 25 decibels after exposure to 120 decibel SPL Scripte Band Noise centered at 4 kHz for five hours.
  • the threshold shift in mammals treated in accordance with the present invention is expected to be at least 10 decibels lower than the threshold shift in mammals that are treated with a control saline solution, more preferably at least 15, 20, or 25 decibels lower than control.
  • the threshold shift is measured 10 days after exposure to the noise using ABR testing.
  • the threshold shift is measured 7 days following cessation of treatment in accordance with the present invention. Similar results would be anticipated using other alternative measures of auditory or sensory cell function, such as psychophysical tests or otoacoustic emission measures.
  • the inhibition of hearing loss is measured using outer hair cell loss and inner hair cell loss values as measured both in the whole cochlea and in a trauma region of the cochlea, where hair cell loss in the treatment population is less than hair cell loss in control animals.
  • outer hair cell loss in the whole cochlea is less than 10%, more preferably less than 5%
  • inner hair cell loss in the whole cochlea is less than 5%, more preferably less than 3%.
  • Outer cell hair loss in the trauma region is less than 20%, more preferably less than 10%, while inner hair cell loss in the trauma region is less than 10%, more preferably less than 5%.
  • any one of a number of agents that upregulate Foxo3 expression or enhance activity of Foxo3 can be used in the present invention.
  • exemplary agents include, without limitation, Paclitaxel/Taxol, Vinblastine, KP372-1, Imatinib,
  • conjugates include, without limitation, p97-Paclitaxel or p97-Doxorubicin (see WO 2002/013843 to Gabathuler et al, which is hereby
  • GR 1005 paclitaxel-Angiopep-2; see U.S. Patent Publication 2006/0189515 to Beliveau et al, which is hereby incorporated by reference in its entirety).
  • the use of other known conjugating moieties is also contemplated.
  • the agents that upregulate Foxo3 expression or enhance activity of Foxo3 are administered in an effective amount that is sufficient to induce a protective effect against hearing loss.
  • an effective amount refers to a dose sufficient to provide concentrations high enough to impart a beneficial effect on the recipient thereof.
  • the specific therapeutically effective dose level for any particular subject will depend upon a variety of factors including the hearing loss being treated, the severity of the hearing loss, the activity of the specific compound, the route of administration, the rate of clearance of the compound, the duration of treatment, the drugs used in combination or coincident with the compound, the age, body weight, sex, diet and general health of the subject, and like factors well known in the medical arts and sciences.
  • the lowest effective dose should be used. Suitable dosages are determined based on a variety of factors, but may include, without limitation, from about 5 mg/kg to about 1000 mg/kg of the agent, preferably from about 10 mg/kg to about 500 mg/kg of agent. While individual doses may vary, optimal ranges of the effective amounts may be determined by one of ordinary skill in the art.
  • the agent can also be present in the form of a composition that comprises a carrier, preferably a pharmaceutically acceptable carrier.
  • a carrier preferably a pharmaceutically acceptable carrier.
  • the compositions of the present invention can be in solid or liquid form, such as tablets, capsules, powders, solutions, suspensions, or emulsions.
  • a third aspect of the present invention relates to a composition comprising an agent that upregulates Foxo3 expression levels in a delivery vehicle suitable for administration to the ear canal or cochlear duct.
  • composition can be administered as a pharmaceutical composition wherein the invention compound is formulated with a pharmaceutically acceptable carrier as is well known in the art. Techniques for formulation and administration may be found, for example, in "Remington's Pharmaceutical Sciences,” (18th ed., Mack Publishing Co., Easton, Pa.), which is hereby incorporated by reference in its entirety. Accordingly, the invention compounds may be used in the manufacture of a medicament. Pharmaceutical compositions of the invention compounds may be formulated as solutions or lyophilized powders for parenteral administration. Powders may be reconstituted by addition of a suitable diluent or other pharmaceutically acceptable carrier prior to use. Powders also may be sprayed in dry form.
  • the liquid formulation may be a buffered, isotonic, aqueous solution.
  • suitable diluents are normal isotonic saline solution, standard 5% dextrose in water or buffered sodium or ammonium acetate solution.
  • Such formulation is especially suitable for parenteral administration, but may also be used for oral administration or contained in a metered dose inhaler or nebulizer for insufflation.
  • compositions may be encapsulated, tableted or prepared in a emulsion or syrup for oral administration.
  • Pharmaceutically acceptable solid or liquid carriers may be added to enhance or stabilize the composition, or to facilitate preparation of the composition.
  • Solid carriers include starch, lactose, calcium sulfate dihydrate, terra alba, magnesium stearate or stearic acid, talc, pectin, acacia, agar or gelatin.
  • Liquid carriers include syrup, peanut oil, olive oil, saline and water. For aqueous compositions used in vivo, the use of sterile pyrogen- free water is preferred.
  • Such formulations will contain an effective amount of the composition together with a suitable amount of an aqueous solution in order to prepare pharmaceutically acceptable compositions suitable for administration to a mammal, preferably a human.
  • the carrier may also include a sustained release material such as glyceryl monostearate or glyceryl distearate, alone or with a wax.
  • the amount of solid carrier varies but, preferably, will be between about 20 mg to about 1 g per dosage unit.
  • the pharmaceutical preparations are made following the conventional techniques of pharmacy involving milling, mixing, granulating, and compressing, when necessary, for tablet forms; or milling, mixing and filling for hard gelatin capsule forms. When a liquid carrier is used, the preparation will be in the form of a syrup, elixir, emulsion or an aqueous or non-aqueous suspension.
  • the tablets, capsules, and the like may also contain a binder such as gum tragacanth, acacia, corn starch, or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, lactose, or saccharin.
  • a binder such as gum tragacanth, acacia, corn starch, or gelatin
  • excipients such as dicalcium phosphate
  • a disintegrating agent such as corn starch, potato starch, alginic acid
  • a lubricant such as magnesium stearate
  • a sweetening agent such as sucrose, lactose, or saccharin.
  • a liquid carrier such as a fatty oil.
  • tablets may be coated with shellac, sugar, or both.
  • a syrup may contain, in addition to an active ingredient, sucrose as a sweetening agent, methyl and propylparabens as preservatives, a dye, and flavoring such as cherry or orange flavor.
  • the agents may be orally administered, for example, with an inert diluent, or with an assimilable edible carrier, or may be enclosed in hard or soft shell capsules, or may be compressed into tablets, or may be incorporated directly with food.
  • the compounds of the present invention may be incorporated with excipients and used in the form of tablets, capsules, elixirs, suspensions, syrups, and the like.
  • Such compositions and preparations should contain at least 0.1% of the agent.
  • the percentage of the agent in these compositions may, of course, be varied and may conveniently be between about 2% to about 60% of the weight of the unit.
  • the amount of agent in such therapeutically useful compositions is such that a suitable dosage will be obtained.
  • the active agents may also be administered parenterally.
  • Solutions or suspensions of the compounds can be prepared in water suitably mixed with a surfactant such as hydroxypropylcellulose.
  • Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof in oils.
  • Illustrative oils are those of petroleum, animal, vegetable, or synthetic origin, for example, peanut oil, soybean oil, or mineral oil.
  • water, saline, aqueous dextrose and related sugar solution, and glycols, such as propylene glycol or polyethylene glycol are preferred liquid carriers, particularly for injectable solutions. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
  • the pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions.
  • the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), suitable mixtures thereof, and vegetable oils.
  • the compounds of the present invention may also be administered directly to the airways in the form of an aerosol or other inhalable formulation.
  • the agent of the present invention in solution or suspension may be packaged in a pressurized aerosol container together with suitable propellants, for example, hydrocarbon propellants like propane, butane, or isobutane with conventional adjuvants.
  • An inhalable formulation typically is in the form of an inhalable powder, which may include a pharmaceutically acceptable carrier.
  • Suitable pharmaceutically acceptable carriers for inhalable powders may be composed of any pharmacologically inert material or combination of materials which is acceptable for inhalation.
  • the carrier particles are composed of one or more crystalline sugars; the carrier particles may be composed of one or more sugar alcohols or polyols.
  • the carrier particles are particles of dextrose or lactose.
  • Conventional dry powder inhalers include the Rotohaler, Diskhaler, and Turbohaler.
  • the particle size of the carrier particles may range from about 10 microns to about 1000 microns.
  • the particle size of the carrier particles may range from about 20 microns to about 120 microns.
  • the size of at least 90% by weight of the carrier particles is less than 1000 microns and preferably lies between 60 microns and 1000 microns.
  • the relatively large size of these carrier particles gives good flow and entrainment characteristics.
  • the amount of carrier particles will generally be up to 95%, for example, up to 90%, advantageously up to 80% and preferably up to 50% by weight based on the total weight of the powder.
  • the amount of any fine excipient material, if present, may be up to 50% and advantageously up to 30%, especially up to 20%, by weight, based on the total weight of the powder.
  • the compounds of the present invention also may be administered in a non-pressurized form such as in a nebulizer or atomizer, or in the form of an intranasal spray.
  • Sustained release formulations include implantable devices that include a slow-dissolving polymeric matrix and one or more of the above-described agents retained within the polymeric matrix.
  • the matrix can be designed to deliver substantially the entire payload of the vehicle over a predetermined period of time, such as about one to two weeks up to about one to three months.
  • compositions and compositions can also be delivered topically, it is also contemplated that the compositions can be delivered by various transdermal drug delivery systems, such as transdermal patches as known in the art.
  • transdermal patch may be applied to a subject's head adjacent the ear.
  • Active agents and compositions of the present invention may also be administered by introduction into the ear canal or cochlear duct, or introduced intranasally.
  • the formulations and compositions may be delivered directly to the ear canal (for example: topical otic drops or ointments; slow release devices in the ear or implanted adjacent to the ear; intratympanic injections; foams; solutions; emulsions; or otic paints).
  • Local administration routes include otic intramuscular, intratympanic cavity and intracochlear injection routes for the compositions, or application via canula and/or injection, via a drop dispenser, as a spray in the ear canal, or as a paint via a cotton tipped stick. It is further contemplated that certain compositions of the invention may be in the form of intraotic inserts or implant devices.
  • Otic formulations may include one or more additives including, without limitation, lubricants, antimicrobial agents and/or antibiotics, topical anesthetics, anti- allergic components, preservatives, co-solvents, soothing agents, viscogenic agents, bioadhesive agents, and permeability enhancers.
  • additives including, without limitation, lubricants, antimicrobial agents and/or antibiotics, topical anesthetics, anti- allergic components, preservatives, co-solvents, soothing agents, viscogenic agents, bioadhesive agents, and permeability enhancers.
  • Exemplary lubricants include, without limitation, propylene glycol, glycerin, polyethylene glycol, dextran, blended polyvinyl alcohols, polyvinyl alcohol, polyethylene glycol, light mineral oil, hydroxypropyl methylcellulose, hypromellose, carbopol, carbomer 940 (polyacrylic acid), polyvinyl pyrrolidone, white petrolatum, soy lecithin, and sodium carboxyl methylcellulose, as well as other agents known to those skilled in the art, or any combination thereof.
  • lubricants are employed at a level of from 0.1% to 2% by weight. In an embodiment, the lubricants are 1.0%
  • the total weight of a PVP-I, artificial-tear based lubricant is between 0.1% and 4.5%.
  • antibiotic/antimicrobial agents include, without limitation, fluoroquinolones (ciprofloxacin, levofloxacin, ofloxacin, moxifloxacin, gatifloxacin, and the like); aminoglycosides (tobramycin, gentamicin, neomycin, and the like); Polymyxin B Combinations (polymyxin B/trimethoprim, Polysporin polymyxin B/bacitracin Neosporin polymyxin B/neomycin/ gramicidin, and the like) and other antibiotics (azithromycin, ilotycin, erythromycin, bacitracin, and the like).
  • Exemplary topical anesthetics include, without limitation, lidocaine, tetracaine or a derivative or combination thereof.
  • Exemplary anti-allergic components include, without limitation, epinastine, emedastine difumarate azelastine hydrochloride, olopatadine hydrochloride, olopatadine, ketotifen fumarate, pemirolast potassium, nedocromil, lodoxamide, cromolyn and cromolyn salts, as well as zinc acetate.
  • Exemplary preservatives include, without limitation, benzalkonium chloride, thimerosal, chlorobutanol, methyl paraben, propyl paraben, phenylethyl alcohol, EDTA, sorbic acid, Onamer M, other agents known to those skilled in the art, or a combination thereof. Typically such preservatives are employed at a level of from 0.001% to 1.0% by weight of final composition.
  • compositions of the invention may contain one or more optional co- solvents.
  • the solubility of the components of the present compositions may be enhanced by a surfactant or other appropriate co-solvent in the composition.
  • exemplary co- solvents include, without limitation, polysorbate 20, 60, and 80,
  • polyoxyethylene/polyoxypropylene surfactants e.g. Pluronic F-68, F-84 and P-103
  • cyclodextrin e.g. Pluronic F-68, F-84 and P-103
  • cyclodextrin e.g. cyclodextrin, tyloxapol, other agents known to those skilled in the art, or a combination thereof.
  • co-solvents are employed at a level of from 0.01% to 2% by weight of the final composition.
  • compositions may also contain an effective amount of a chemical agent to provide a cooling sensation to relieve mild otic irritation, enhance comfort, and provide a refreshing effect and improved sensation, when the inventive composition is applied to the ear.
  • a chemical agent encompasses various chemicals and chemical classes, including, without limitation, cooling agents such as menthol, menthol derivatives including methone glycerin acetyl and menthyl esters, carboxamides, menthane glycerol ketals, alkyl substituted ureas, sulfonamides, terpene analogs, furanones, and phosphine oxides; or camphor, and borneol.
  • cooling agents such as menthol, menthol derivatives including methone glycerin acetyl and menthyl esters, carboxamides, menthane glycerol ketals, alkyl substituted ureas, sulfonamides, terpene analogs, furan
  • compositions of the invention may contain a viscogenic agent—that is, an agent that can increase viscosity.
  • a viscogenic agent that is, an agent that can increase viscosity.
  • viscogenic agents allow the composition to transform from a liquid-like state (e.g., flowable) at 25°C to a solid-like state (e.g., a gel), and can be non-biodegradable, i.e., not broken down by chemicals or enzymes naturally present in a mammal, or biodegradable. This may be desirable to increase otic absorption of the active compound, to decrease variability in dispensing the formulation, to decrease physical separation of components of a suspension or emulsion of the formulation and/or to otherwise improve efficacy of the otic formulation.
  • compositions include an amount of viscogenic agent effective to yield a viscosity of the composition of less than 100,000 cps at 25°C (e.g., less than 90,000, less than 60,000, less than 30,000, less than 20,000, or less than 10,000 cps).
  • a composition includes 0.05 to 10% of a viscogenic agent) (see U.S. Patent Publication No. 2004/0101560 to Sawchuk et al, which is hereby incorporated by reference in its entirety).
  • Exemplary viscogenic agents include, without limitation, polyvinyl alcohol, polyvinylpyrrolidone, methyl cellulose, hydroxypropylmethylcellulose, hydroxyethylcellulose, carboxymethylcellulose, hydroxypropylcellulose, gellan (Gelrite® or Kelcogel®), Carbopol® 940 with hydroxypropylmethylcellulose (HPMC), N- isopropyl acrylamide (NiPAAm) with sodium acrylate and n-N-alkylacrylamide, polyacrylic acid with polyethylene glycol (PEG) or polymethacrylic acid with PEG, cellulose acetate hydrogen phthalate latex (CAP), sodium alginate, and nonionic surfactants such as poloxamers (Pluronic®) and polyoxamine (Tetronic®) reversible temperature-dependent gelling systems.
  • polyvinyl alcohol polyvinylpyrrolidone
  • methyl cellulose hydroxypropylmethylcellulose
  • hydroxyethylcellulose carboxymethylcellulose
  • Gellan is a natural polymer, anionic deacetylated exocellular polysaccharide, secreted by Pseudomonas elodea.
  • the tetrasaccharide repeating unit consists of one a-L-rhamnose, one ⁇ -D-glucuronic acid, and two ⁇ -D- glucose moieties.
  • the in situ gelling mechanism of gellan is cation-induced (e.g., presence of calcium ions) and temperature-dependent (e.g., physiologic temperature). Gelation is thermally reversible.
  • Carbopol® 940 with HPMC gels in situ in a pH- dependent manner.
  • Carbopol® is the gelling agent and the HPMC is used to enhance the viscosity of the gel.
  • NiPAAm with sodium acrylate and n-N-alkylacrylamide is a terpolymer hydrogel that can undergo a temperature based reversible sol-gel
  • Sodium acrylate and n-N-alkylacrylamide are used to modify the properties of the hydrogel, and in particular, the transition temperature.
  • Polyacrylic acid with PEG or polymethacrylic acid with PEG is thought to gel based on hydrogen bonding. Polyacrylic acid can be dissolved in hydroalcoholic solution and after being injected, the alcohol diffuses out causing the polymers to precipitate and gelling of the solution.
  • CAP is a nanoparticulate system that gels in a pH-dependent manner.
  • the active compound (pharmacologic agent) is adsorbed partially onto the surface of the polymer particles.
  • Sodium alginate gels in the presence of calcium or other polyvalent ion (see U.S. Patent Publication No. 2004/0101560 to Sawchuk et al, which is hereby incorporated by reference in its entirety). Such agents are typically employed at a level of from 0.01% to 2% by weight of the final composition.
  • Bioadhesive agents can be used in the compositions to increase the retention time of the drug gradient over the biological substrates.
  • exemplary bioadhesive agents include, without limitation, polyvinylpyrrolidone (PVP), xanthan gum, locust bean gum, acacia gum, hydroxypropyl methylcellulose (HPMC), sodium alginate, pectin, gelatin, carbomer, polyvinylalcohol, gellan gum, tragacanth, acacia, and sodium carboxymethyl cellulose.
  • PVP polyvinylpyrrolidone
  • HPMC hydroxypropyl methylcellulose
  • sodium alginate sodium alginate
  • pectin gelatin
  • carbomer polyvinylalcohol
  • gellan gum tragacanth
  • acacia sodium carboxymethyl cellulose
  • Exemplary permeability enhancer include, without limitation, polyols selected from glycerol, propylene glycol, polyethylene glycol, sorbitol, xylitol, and maltitol.
  • the permeability enhancer is typically present at a final concentration of about 0.1% to about 35%, more preferably about 1% to about 30%, or about 5% to about 25%.
  • the compositions are formulated for pH, and a practical osmolality and/or osmolarity to ensure that homeostasis of the target auris structure is maintained.
  • a perilymph-suitable osmolarity/osmolality is a practical/deliverable osmolarity/osmolality that maintains the homeostasis of the target auris structure during administration of the pharmaceutical formulations described herein.
  • the osmolarity of the perilymph is between about 270-300 mOsm/L, and the compositions described herein are optionally formulated to provide a practical osmolarity of about 150 to about 1000 mOsm/L.
  • the pH of the perilymph is about 7.2-7.4
  • the pH of the present formulations is formulated (e.g., with the use of buffers) to provide a perilymph-suitable pH of about 5.5 to about 9.0, about 6.0 to about 8.0 or about 7.0 to about 7.6. See U.S. Patent Publication No. 201 1/0319377 to Lichter et al, which is hereby incorporated by reference in its entirety.
  • the active agents can be administered by using a delivery vehicle for passive or targeted delivery to inner hair cells or SGNs.
  • the active agents may be administered in an amount effective to upregulate Foxo3 expression in inner hair cells or spiral ganglions.
  • Any suitable passive or targeted delivery vehicle can be employed, including liposomes, polymeric nanoparticles, polyethylene glycol conjugates, and cell uptake peptides.
  • Targeting the delivery vehicle to inner hair cells or SGNs can be achieved through the use of antibodies, binding fragments thereof, or nucleic acid aptamers that are bound or suspended to the surface of the delivery vehicle.
  • Target cell-specific receptors include, without limitation, ERBB family receptors and Trk receptors, which are expressed in both SGNs and sensory epithelia (Bitsche et al., "Neurotrophic Receptors as Potential Therapy Targets in Postnatal Development, in Adult, and in
  • Formulations and compositions of the present invention may be formulated to include other medically useful drugs or biological agents. These include, without limitation, one or more antioxidants, steroids (e.g., corticosteroids such as cortisone, dexamethasone, etc.), vasoactive agents (e.g., magnesium), agents that reduce insulin resistance, Jnk signal transduction inhibitors, and inhibitors of proteins that stimulate the production of reactive oxidative species.
  • steroids e.g., corticosteroids such as cortisone, dexamethasone, etc.
  • vasoactive agents e.g., magnesium
  • Exemplary salicylates include, without limitation, salicylic acid, salts of salicylic acid (e.g., sodium salicylate), and combinations thereof.
  • the salicylate is typically present in the composition in a total amount of at least 3.2 international units (IU), more preferably from 3.2 IU to 29.0 IU, most preferably about 3.8 IU for an adult dosage, with the composition typically administered twice daily.
  • Vitamin E is a generic term for all tocols and tocotrienol derivatives with a biological activity of alpha- tocopherol.
  • Primary dietary forms of vitamin E include vitamin E itself and alpha- tocopherol.
  • Trolox® a water-soluble analogue of alpha-tocopherol that is commercially available from Hoffman-Laroche, Ltd.
  • Vitamin E and its derivatives and analogs are typically present in the composition in an amount of at least 60 IU, more preferably from 60 IU to 540 IU, most preferably from 300 IU to 540 IU.
  • an antioxidant useful for treating hearing loss includes free radical scavengers such as edaravone, resveratrol, ebselen and iron chelator and compounds from the family of antioxidant compounds including, but not limited to, N- acetylcysteine (NAC), Acetyl-L-Carnitine (ALCAR), glutathione monoethylester, ebselen, D-methionine and carbamathione (see U.S. Patent Publication No. 2010/0022458 to Kopke et al, which is hereby incorporated by reference in its entirety).
  • free radical scavengers such as edaravone, resveratrol, ebselen and iron chelator
  • compounds from the family of antioxidant compounds including, but not limited to, N- acetylcysteine (NAC), Acetyl-L-Carnitine (ALCAR), glutathione monoethylester, ebsele
  • an antioxidant useful for treating hearing loss includes R-N6-Phenylisopropyl adenosine (R-PIA) in combination with one or more of agents that increase glutathione levels such as L-2-oxothiazolidine-4-carboxylic acid (OTC), L-N-acetylcysteine (L-NAC), methionine and S-adenosyl-L-methionine (SAMe) (see U.S. Patent Publication No. 2001/0007871 to Kopke et al, which is hereby incorporated by reference in its entirety).
  • R-PIA R-N6-Phenylisopropyl adenosine
  • agents that increase glutathione levels such as L-2-oxothiazolidine-4-carboxylic acid (OTC), L-N-acetylcysteine (L-NAC), methionine and S-adenosyl-L-methionine (SAMe)
  • Another example of an antioxidant useful for treating hearing loss includes
  • L-carnitine (see U.S. Patent Publication No. 2005/0049305 to Kalinec et al., which is hereby incorporated by reference in its entirety). This antioxidant is particularly useful for treating children treated with aminoglycoside antibiotics.
  • a further example of antioxidants includes a combination of one or more of arginine, ascorbate, folate, glutathione and glutathione prodrugs (n-acetylcysteine), alpha-lipoic acid, melatonin, nicotinamide, riboflavin, selenium, taurine, vitamins E, A, B6, B12, D, and zinc, and optionally including chromium and/or vanadium to reduce insulin resistance, coenzyme Q 10 to prevent hypoxia- induced damage, ginko biloba to regulate blood flow, and Mg 2+ to promote vascular health (see U.S. Patent Publication No. 2002/0061870 to Pearson et al; U.S. Patent Publication No. 2007/0105782 to Campbell, each of which is hereby incorporated by reference in its entirety).
  • Another use antioxidants includes two or more of a glutathione peroxidase mimic, a xanthine oxidase inhibitor, and glutathione or a glutathione precursor (see U.S. Patent Publication No. 2004/0220145 to Kil et al, which is hereby incorporated by reference in its entirety).
  • antioxidants involve the use of 3,3'-diindolyl- methane and/or its derivatives (see U.S. Patent Publication No. 2011/0190367 to Hug et al, which is hereby incorporated by reference in its entirety).
  • Suitable agents that reduce insulin resistance include, without limitation, lipoic acid and their salts, and tetrahydrobiopterin bis lipoate, which are disclosed in U.S. Patent Publication No. 2009/0068264 to Richardson et al, which is hereby incorporated by reference in its entirety.
  • proteins that stimulate the production of reactive oxidative species and their inhibitors include, without limitation, an NADPH oxidase (e.g., NOX3) and the inhibitors disclosed in U.S. Patent Publication No. 2009/0263323 to Krause et al, and U.S. Patent Publication No. 201 1/0142917 to Alpert et al, each of which is hereby incorporated by reference in its entirety).
  • NADPH oxidase e.g., NOX3
  • JNK stress signaling pathway inhibitors include those described in U.S. Patent Publication No. 2002/0115706 to Ylikoski et al, and U.S. Patent Publication No. 2003/0108539 to Bonny, each of which is hereby incorporated by reference in its entirety.
  • the administering may be repeated. In one embodiment, the administering is carried out one or more times daily for more than two days. In another embodiment, the administering is carried out until hearing loss is minimized. In yet another embodiment, the administering is carried out for up to about two to about 10 weeks.
  • the composition of the present invention may be administered within about 72 hours of hearing loss event or trauma to a middle or inner ear of the mammal. Treatment within 72 hours is most appropriate when the mammal has sustained trauma to the middle or inner ear through unexpected loud noise or other trauma. It is to be appreciated that by administrating the composition within 72 hours of trauma, treatment prior to trauma is also contemplated through the method of the present invention. Ideally, the composition is administered to the mammal prior to trauma to the middle or inner ear. Treatment prior to trauma is most feasible when the mammal is preparing for sustaining trauma to the middle or inner ear. For example, the composition may be administered prior to restoration surgery performed on the middle or inner ear.
  • the person may begin treatment prior to sustaining the trauma to the middle or inner ear to attain the best results.
  • the composition is preferably administered as soon as possible after the trauma to the middle or inner ear of the mammal. Even so, treatment within 72 hours with the composition of the present invention is also effective.
  • the composition is typically administered to the mammal each day for at least 10 weeks following the trauma to the middle or inner ear of the mammal.
  • Other treatment regimens may also prove efficacious for purposes of the present invention.
  • a second aspect of the present invention relates to a method of assessing susceptibility to Foxo3 -related hearing loss in a subject, including determining whether that subject has a variant Foxo3 gene that has reduced or absent function.
  • the determining includes detecting whether Foxo3 gene has a mutation selected from the group of a truncation, a single nucleotide polymorphism (SNP), a translocon, and insertion, or any other sequence variation that interferes with function the Foxo3 gene.
  • SNP single nucleotide polymorphism
  • Exemplary Foxo3 nucleic acid and amino acid sequences are reported at NM_001455, NP_001446, and NM_201559, which are hereby incorporated by reference in their entirety.
  • SEQ ID NO: 1 In the sequence shown below (SEQ ID NO: 1), confirmed or suspected allelic variations in Foxo3 are identified by the substitution identified below the modified amino acid residue. If a frameshift (FS- ⁇ ) is indicated, then all amino acid residues toward the C-terminus will be modified as a result of the SNP.
  • SEQ ID NO: 1 is as follows:
  • Exemplary confirmed or suspected Foxo3 SNPs include, without limitation, the following SEQ ID NOS: 2-19, listed in Table 1.
  • Detecting the presence or absence of the one or more mutations in the one or more above identified genes can be carried out using methods that are well known in the art.
  • Common genotyping methods include, but are not limited to, restriction fragment length polymorphism assays, amplification based assays such as molecular beacon assays, nucleic acid arrays, allele-specific PCR; primer extension assays, such as allele-specific primer extension (e.g., Illumina ® Infinium ® assay), arrayed primer extension (see Krjutskov et al, "Development of a Single Tube 640-ples Genotyping Method for Detection of Nucleic Acid Variations on Microarrays," Nucleic Acids Res.
  • 573 (1-2): 103-10 (2005), which is hereby incorporated by reference in its entirety); 5' nuclease assays, such as the TaqMan ® assay (see U.S. Patent Nos. 5,210,015 to Gelfand et al. and 5,538,848 to Livak et al, which are hereby incorporated by reference in their entirety); oligonucleotide ligation assays, such as ligation with rolling circle amplification, homogeneous ligation, OLA (see U.S. Patent No.
  • the presence or absence of the one or more mutations as shown supra can be detected by direct sequencing of the genes, or preferably identified gene regions, from the patient sample. High-throughput next generation sequencing
  • NGS NGS
  • Various NGS sequencing chemistries are available and suitable for use in carrying out the claimed invention, including pyrosequencing (Roche ® 454), sequencing by reversible dye terminators (Illumina ® HiSeq, Genome Analyzer and MiSeq systems), sequencing by sequential ligation of oligonucleotide probes (Life Technologies ® SOLiD), and hydrogen ion semiconductor sequencing (Life Technologies ® , Ion TorrentTM), extension-based (Helicos Bioscience HelioscopeTM Sequencer).
  • classic sequencing methods such as the Sanger chain termination method or Maxam-Gilbert sequencing, which are well known to those of skill in the art, can be used to carry out the methods of the present invention.
  • mice were created on 129Sv/J and were then crossed for three generations to FVB/n. They have been maintained on this background.
  • Foxo3-KO mice are viable, but adults typically die around PI 80 from B cell hyperproliferation (Paik et al, "FoxOs are Lineage-Restricted Redundant Tumor Suppressors and Regulate Endothelial Cell Homeostasis," Cell 128(2):309-23 (2007), which is hereby incorporated by reference in its entirety). Foxo3-KO mice have similar numbers of outer and inner hair cells compared to wild-type littermates at birth, without any obvious gaps or duplications (see Figures 6A-6E). Moreover, at P60, Foxo3-KO mice have similar pure tone hearing thresholds to their wild-type littermates ( Figure 2A, black lines).
  • DPOAE otoacoustic emissions
  • Neuronal density and the size of the ganglion will be calculated, and significant differences will be determined with one-way ANOVA and adjusted two-tailed Student's t-tests.
  • TEM on semithin resin sections of basal turn SGN-hair cell synapses will be used in PI 20 Foxo3-KO and wild- type animals to look for swollen dendritic terminals (Hakuba et al, "Exacerbation of Noise-Induced Hearing Loss in Mice Lacking the Glutamate Transporter GLAST," J. Neurosci. 20(23):8750-3 (2000), which is hereby incorporated by reference in its entirety).
  • Presynaptic structures in inner hair cells will also be quantified with an antibody to Ribeye/Ctbp2 in whole mount preparations of PI 20 basal cochleae of both genotypes (Kujawa et al, "Adding Insult to Injury: Cochlear Nerve Degeneration after 'Temporary' Noise-Induced Hearing Loss," J. Neurosci. 29: 14077-85 (2009), which is hereby incorporated by reference in its entirety). Finally, signs of oxidative stress in surviving neurons will be examined at PI 20 with qPCR, westerns, and immunostaining.
  • the IHC afferent synapse will also be examined for evidence of excitotoxicity, including ultrastructural analyses of synaptic morphology and counts of ribbon synapses in wild-type and Foxo3-KO basal inner hair cells. Based on the results presented in this Example, it is believed that Foxo3-KO SGN's will be more sensitive to noise damage compared to wild-type SGN's. It has been found that a two hour treatment of 100 dB sound pressure is sufficient to induce excitotoxic stress in normal SGN's
  • a dose response will be performed for noise on P60 Foxo3-KO and wild-type mice, testing 30 minutes of white noise, at sound pressure levels of 90, 95, and 100 dB (5 animals each level and genotype).
  • Hearing thresholds and DPOAE's will be measured at 1 day and 14 days post treatment.
  • Swollen dendritic terminals will be stained for in whole mount with anti-neurofilament and anti-Ribeye, and imaged with confocal microscopy, 1 day after noise treatment, as in Kujawa et al, "Adding Insult to Injury: Cochlear Nerve
  • mR A levels of oxidative stress response genes reported to be regulated by Foxo3 in the cochlea after a mild noise treatment are shown in Figure 7.
  • the hair cell specific genes parvalbumin and Pou4f3 are shown for comparison, as are Foxo3 and Foxo 1. This work will be extended by measuring Foxo3 mRNA, Foxo3 protein levels and phosphorylation state in cochlear outer hair cells 1, 2, and 3 days after noise treatment, using qPCR and Western blots. 4-5 separate biological replicates will be tested.
  • NF- ⁇ p50 will be used as a positive control, as its up-regulation after noise has been reported previously (Nagashima et al, "Acoustic Overstimulation Facilitates the Expression of Glutamate-Cysteine Ligase Catalytic Subunit Probably Through Enhanced DNA Binding of Activator Protein- 1 and/or NF-kappaB in the Murine Cochlea," Neurochem. Int. 51(2-4):209-15 (2007), which is hereby incorporated by reference in its entirety). Foxo3 protein in the organ of Corti will be immunolocalized in whole mount after noise treatment to assess its subcellular localization.
  • Activated Foxo3 will be in the nucleus. Reported Foxo3 target mRNAs will be screened for. Levels of Pinkl, Cited2, Sod2, and Gabarapll, four oxidative stress response genes reported regulated by Foxo3, also will be measured (Sengupta et al, "FoxO Transcription Factors Promote Autophagy in Cardiomyocytes," J. Biol. Chem. 284(41):28319-31 (2009); Mei et al., "FOX03a-Dependent Regulation of Pinkl (Park6) Mediates Survival Signaling in
  • outer hair cells will have greater levels of nuclear Foxo3 and lower levels of p-Foxo3 1-2 days after noise, in comparison with controls. It is further predicted that mRNA for down-stream targets of Foxo3 that mitigate oxidative stress, including Pinkl, Cited2, Sod2, and Gabarapll, will be up-regulated 1 -2 days after noise. These outcomes will be interpreted as evidence that the mechanical damage to outer hair cells resulting from acoustic over-exposure promotes Foxo3 activation and up- regulation of oxidative stress reduction enzymes to repair or mitigate the cellular injury.
  • Cdh23 is a crucial tip link component (Alagramam et al, "Mutations in Protocadherin 15 and Cadherin 23 Affect Tip Links and Mechanotransduction in Mammalian Sensory Hair Cells," PLoS One 6(4):el9183 (201 1), which is hereby incorporated by reference in its entirety), and mutations in Cdh23 affect hair bundle morphology and mechanotransduction (Furness et al, "The Dimensions and Structural Attachments of Tip Links in Mammalian Cochlear Hair Cells and the Effects of Exposure to Different Levels of Extracellular Calcium,” Neuroscience 154(1): 10-21 (2008), which is hereby incorporated by reference in its entirety).
  • This point mutation is responsible for the age related hearing loss and noise susceptibility observed in many mouse lines, including Balb/c (Johnson et al, "A Major Gene Affecting Age-Related Hearing Loss is Common to At Least Ten Inbred Strains of Mice," Genomics 70: 171-80 (2000), which is hereby incorporated by reference in its entirety).
  • Cisplatin kills cells by damaging DNA integrity through covalent crosslinking (F symbolize et al, "Induction of Nuclear Accumulation of the Tumor-Suppressor Protein p53 by DNA-Damaging Agents," Oncogene 8:307-18 (1993), which is hereby incorporated by reference in its entirety). This process activates the DNA damage response, including nucleotide excision, but differs from oxidative stress (reviewed in Lagerwerf et al, "DNA Damage Response and Transcription,” DNA Repair (Amst) 10(7):743-50 (2011), which is hereby incorporated by reference in its entirety).
  • Foxgl is expressed at E8.5 throughout the otic placode, and this line is commonly used to achieve cochlea-specific recombination (Hebert et al, “Targeting of Cre to the Foxgl (BF-1) Locus Mediates LoxP Recombination in the Telencephalon and Other Developing Head Structures," Dev. Biol. 222(2):296-306 (2000), which is hereby incorporated by reference in its entirety).
  • Foxo3 will be ablated in hair cells but not neurons or other cochlear cells, using the Gfil-Cre mouse (Yang et al., "Gfil-Cre Knock-In Mouse Line: A Tool for Inner Ear Hair Cell-Specific Gene Deletion," Genesis 48(6):400-6 (2010), which is hereby incorporated by reference in its entirety).
  • the mechanism of hearing loss in the aging Foxo3-KO will be better resolved by testing whether Foxo3 is specifically required in SGN's.
  • Ngnl-CreER mouse line will be used: Ngnl is expressed only otic neural precursors at E9.5 (Raft et al, "Cross-Regulation of Ngnl and Mathl Coordinates the Production of Neurons and Sensory Hair Cells During Inner Ear Development," Development 134(24):4405-15 (2007), which is hereby incorporated by reference in its entirety). If neurons are lost through excitotoxicity because they require intrinsic Foxo3 activity, then the spiral ganglion-specific knockout will phenocopy the PI 20 untreated Foxo3-KO. If, instead, Foxo3 acts in another cell type, then no loss of function will be observed.
  • Gfil-Cre mice are the gift of Professor Lin Gan of the Flaum Eye Institute of URMC (Yang et al, "Gfi 1 -Cre Knock-In Mouse Line: A Tool for Inner Ear Hair Cell-Specific Gene Deletion," Genesis 48(6):400-6 (2010), which is hereby incorporated by reference in its entirety).
  • Each of the Cre lines to the Foxo3-KO will be bred, and then the floxed-Foxo3, to obtain (Foxo3 KO/flox X Cre) progeny (Figure 9). All three Cre lines are on B6. It will be verified that the mice used in the experiments described do not have the Cdh23 735A hearing loss susceptibility allele by sequencing (see Figures 5A-5E).
  • the Cdh23 735A allele is on the wild-type (+) chromosome.
  • expression will be induced by injecting dams carrying (Foxo3 KO/flox X Ngnl-CreER) progeny with tamoxifen at E9.5, similar to work done in (Raft et al, "Cross-Regulation of Ngnl and Mathl Coordinates the Production of Neurons and Sensory Hair Cells During Inner Ear Development," Development 134(24):4405-15 (2007), which is hereby incorporated by reference in its entirety).
  • These mice may need to be delivered by C-section, as prenatal tamoxifen exposure can sometimes result in lethality during birth. Since Foxo3-KO mice survive to PI 50, no other lethality issues are anticipated with the conditional knockouts.
  • mice and Cre-negative littermates will be tested for hearing thresholds and DPOAE levels at P60, when their hearing thresholds should be identical. 10-12 mice of each genotype will be exposed one day later to 105 dB of 8-16 kHz white noise for one hour. Temporary threshold shifts will be tested one day later, and differences in permanent threshold shifts will be determined 13 days after that.
  • Tissue will be collected for histological processing, and hair cells in whole mounts will be counted.
  • Pou4f3 staining and DAPI will be used to unambiguously identify hair cell nuclei ( Figures 8A-8B).
  • Noise-treated and untreated Foxo3-CKO mice will be compared to noise-treated and untreated Cre-negative littermates. Planned conditional knockout combinations are shown infra, in Table 2.
  • Floxed-Foxo3 Gfil-Cre Sensory hair cells [0117] It is believed that injury to SGN's in the Foxo3-KO is cell-intrinsic. This belief will be tested by assessing hearing thresholds in 20 untreated P120 (Foxo3 KO/flox X Ngnl -CreER) mice and comparing to 20 Cre-negative littermates. Levels of neuronal stress will also be assessed in both genotypes at P120, using qPCR, westerns, and immunostaining for markers of oxidative stress, as described in Example 2 above. The density of SGN in the basal turns of their spiral ganglia will be quantified.
  • the Foxo3-CKO generated with either the hair cell specific Gfil -Cre or the cochlear-specific Foxgl-Cre will show an identical phenotype to the traditional Foxo3-KO: they will have increased thresholds for hearing 14 days after noise treatment compared to the Cre-negative littermates. It is also predicted that they will have decreased outer hair cell function and fewer outer hair cells after noise treatment than their Cre-negative littermates. If this result occurs with the cochlear- specific Foxgl-Cre CKO's, it will then be concluded that Foxo3 acts within the cochlea to protect outer hair cells from apoptosis due to noise damage.
  • Paclitaxel/taxol is a FDA- approved drug for treating solid tumors in humans. It is normally dissolved in an oily solute called Cremphor prior to intravenous infusion for chemotherapy. Cremphor is necessary in these treatments, because Paclitaxel/taxol has a fairly short half-life in aqueous solution at neutral pH and body temperature ( ⁇ 1 hour). Thus, for the purposes of cancer treatment, an oily carrier is necessary to get sufficient concentrations of drug distributed throughout the body.
  • a rapid, local infusion of Paclitaxel/taxol is proposed as a prophylactic for noise damage, and sterile saline will be used as a carrier instead.
  • intratympanic injections are preferred to systemic injections, such as intraperitoneal or intravenous, for several reasons.
  • Paclitaxel/taxol is a FDA-approved, it is only used in life-threatening illnesses such as solid tumors because it has significant side effects. Local application of Paclitaxel/taxol through intratympanic injections will result in a total dosage level that is many orders of magnitude lower than a systemic injection.
  • Paclitaxel/taxol does not cross the blood-brain barrier, and so is not predicted to reach the cochlea from a systemic injection.
  • mice To perform an intratympanic injection, an adult mouse will be anesthetized with ketamine-acepromazine cocktail and its tympanic membrane (ear drum) observed under a surgical stereomicroscope. A fine needle (25-30 gauge) will be inserted through the inferior anterior quadrant of the tympanic membrane. A micro-syringe will be used to gently transfer no more than 10 ⁇ of drug in sterile injectable saline into the mouse's middle ear. Drugs injected in this fashion cross the round window and enter the cochlear perilymph fluid in 15-30 minutes. The concentration of drugs delivered in this fashion peaks at one hour and is cleared after a day. The mouse is left on its side for twenty minutes to facilitate drug transfer. Afterwards, the other ear of the mouse is injected with the same volume of control saline, and then the mouse is allowed to recover. The mice will be injected one time per day, every other day, up to five times, prior to testing for drug effects.
  • Paclitaxel/taxol promotes noise damage recovery. Mice will be exposed to noise within 2 days of completing their Paclitaxel/taxol injections. The hearing of both ears of each mouse with autonomic brainstem response and with distortion product otoacoustic emission detection will be tested as previously described herein. Animals will have their hearing tested one day after noise treatment and then again 14 days after noise treatment. Animals will be sacrificed at two weeks after noise treatment for cochleograms, to assess hair cell survival.
  • the present application illustrates the discovery of the following facts.
  • SGNs normally express Foxo3. It is both nuclear (possibly functional) and cytoplasmic (not functioning, sequestered).
  • Foxo3-KO mice have mild, high frequency age-related hearing loss compared to control mice. Third, this hearing loss is not associated with outer hair cell death or loss of outer hair cell function. Fourth, the Foxo3-KO mice have fewer SGNs in the regions that detect higher frequencies.
  • Foxo3 activity in outer hair cells may prevent them from dying in response to mechanical stress. While it is known that Foxo3 activity helps prevent outer hair cells from dying after noise, it is possible that Foxo3 is acting in the hair cells and not indirectly.
  • Foxo3 activity may protect SGNs from excitotoxicity. The simplest explanation for the loss of hearing in the Foxo3-KO is that their SGNs are over-stimulated by normal noise levels. This explanation points to the idea that Foxo3 function in SGNs protects them from damage.
  • Third, increasing the amount or duration of Foxo3 activation after noise exposure will decrease the permanent damage it causes.

Abstract

The present invention relates to a method of treating a subject to inhibit hearing loss comprising administering to a subject exposed to a hearing loss event an effective amount of an agent that upregulates Foxo3 expression or enhances activity of Foxo3. The present invention further relates to a method of assessing Foxo3 -related susceptibility to hearing loss comprising a determination of whether a subject has a variant Foxo3 gene that has reduced or absent function. The invention further discloses a pharmaceutical composition for otic delivery including an effective amount of an agent that upregulates Foxo3 expression or enhances activity of Foxo3 and a pharmaceutically acceptable carrier or delivery vehicle.

Description

METHODS AND COMPOSITIONS FOR TREATING A SUBJECT
TO INHIBIT HEARING LOSS
[0001] This application claims the benefit of U.S. Provisional Patent Application Serial Nos. 61/597, 110, filed February 9, 2012 and 61/603, 105, filed February 24, 2012, which are hereby incorporated by reference in their entirety.
FIELD OF THE INVENTION
[0002] This invention relates to methods and compositions for treating a subject to inhibit hearing loss. BACKGROUND OF THE INVENTION
[0003] Age and noise-related hearing loss confer a significant health burden to society. Hearing loss affects 17 million adults in the United States (National Institute on Deafness and Other Communication Disorders (NIDCD), "Quick Statistics on Hearing Loss," Bethesda, MD: National Institute of Health (updated June 16, 2010)). A lifetime of noise and toxin exposure drives hearing loss in the aged, where one in three individuals over 65 years old report problems with spoken communication (Hannula et al, "Self- Reported Hearing Problems Among Older Adults: Prevalence and Comparison to Measured Hearing Impairment," J. Am. Acd. Audiol. 22:550-9 (201 1)). Notably, in 2010 hearing damage from excessive noise was the most frequently cited basis for disability claims among combat veterans (Annual Benefit Report FY 2010: Dept. of Veterans
Affairs Veterans Benefits Administration (2010)). Despite the widespread nature of the problem and its cost in health services, there are currently no predictive mechanisms to identify individuals at higher risk for damage, and no significant treatment options after noise exposure to mitigate the cellular damage that precedes hearing loss.
[0004] Noise exposure can cause a temporary loss of auditory function. Sound waves are detected by specialized mechanosensory cells, called inner hair cells, which send signals to the brain through spiral ganglion neurons ("SGNs"). The connection between neurons and inner hair cells is called a synapse. Loud noises cause inner hair cells to over-stimulate SGNs, a process called glutamate excitotoxicity. In response, SGNs temporarily withdraw their projections from the inner hair cells. Hearing recovery is dependent on the neurons re-connecting to the inner hair cells, which occurs naturally over several days after noise exposure. Often hearing sensitivity is compromised after this re-connection is established, probably through changes in synaptic structure. [0005] Noise exposure can also cause a permanent loss of auditory function.
Hearing acuity is dependent on activity by another set of mechanosensory cells, called the outer hair cells. Outer hair cells physically amplify sound waves to improve inner hair cell sensitivity. Mechanical damage from noise can kill outer hair cells.
[0006] All of these specialized cochlear cells, inner and outer hair cells and SGNs, are generated only during early fetal development. If they are lost to damage, they are not replaced. Hence, hearing losses accumulate with age. In addition, noise exposure early in life predisposes individuals to hearing loss years later, a process called presbycusis. Individuals with hearing loss are given prosthetics, i.e. hearing aids or cochlear implants, which do not allow the noise discrimination that the human ear provides.
[0007] Multiple avenues for treatment have been tried without success. Loss of outer hair cells to apoptosis is one mechanism underlying human hearing loss (Juers, "Clinical Observations on End-Organ Deafness; A Correlation With Cochlear Anatomy," Laryngoscope 64(3): 190-207 (1954)). Aminoglycoside antibiotics induce hair cell death through the generation of reactive oxidative species ("ROS") (Stephens, "A Case of
Gentamicin Accentuated Hearing Loss," J. Laryngol. Otol. 82(9): 803 -8 (1968)). While antioxidants such as L-carnitine or N-acetyl-cysteine can reduce cochlear damage during aminoglycoside treatment in children (Kalinec et al, "Pivotal Role of Harakiri in the Induction and Prevention of Gentamicin- Induced Hearing Loss," Proc. Natl. Acad. Set U.S.A. 102: 16019-24 (2005)), they have modest effects on hearing thresholds after noise damage (Coleman et al. "Dosing Study on the Effectiveness of Salicylate/N- Acetylcysteine for Prevention of Noise-Induced Hearing Loss," Noise & Health 12: 159- 65 (2010)). Caloric restriction, which systematically reduces ROS generation, also has not yet shown a protective effect for age-related hearing loss in primates (Fowler et al, "Auditory Function in Rhesus Monkeys: Effects of Aging and Caloric Restriction in the Wisconsin Monkeys Five Years Later," Hear. Res. 261 :75-81 (2010)). Noise-induced cochlear hair cell death may require stress signaling through Jun, Jun-kinase ("Jnk"), and mixed lineage kinase ("Mlk") (Pirvola et al, "Rescue of Hearing, Auditory Hair Cells, and Neurons by CEP-1347/KT7515, an Inhibitor of c-Jun N-Terminal Kinase
Activation," J. Neurosci. 20(l):43-50 (2000)).
[0008] Several groups have investigated interfering with stress signaling to identify new treatment options for adult hearing loss. Although clinical trials of Mlk inhibitors in Parkinson's disease were ultimately deemed ineffective, inhibitors of this pathway have not been tested in humans for their impact on hearing loss (Investigators PSGP, "Mixed Lineage Kinase Inhibitor CEP-1347 Fails to Delay Disability in Early Parkinson Disease," Neurology 69: 1480-90 (2007)). Finally, apoptosis inhibitors have also been shown to reduce hair cell death after damage (Knauer et al, "An Otoprotective Role for the Apoptosis Inhibitor Protein Survivin," Cell Death Dis. I :e51 (2010); Wang et al, "Overexpression of X-Linked Inhibitor of Apoptosis Protein Protects Against Noise-Induced Hearing Loss in Mice," Gene Ther. 18(560-8) (2011)), but the clinical utility of this approach is unclear. In sum, blocking the pathways that activate apoptosis in cochlear hair cells has not yet been shown to improve hearing outcomes after noise damage.
[0009] In addition to apoptosis, sensorineural hearing loss also results from excitotoxic damage to inner hair cell synapses (Kujawa et al, "Adding Insult to Injury: Cochlear Nerve Degeneration after 'Temporary' Noise-Induced Hearing Loss," J.
Neurosci. 29:14077-85 (2009)). Inner hair cells release glutamate to excite Type I SGN's (Bobbin, "Glutamate and Aspartate Mimic the Afferent Transmitter in the Cochlea," Exp. Brain Res. 34:389-93 (1979)). Immediately following prolonged intense noise exposure, SGNs retract their neurites from the inner hair cell. This response protects them from glutamatergic excitotoxicity, but also results in temporary threshold shifts (Puel et al, "Synaptic Regeneration and Functional Recovery After Excitotoxic Injury in the Guinea Pig Cochlea," C.R. Acad. Sci. Ill 318:67-75 (1995)). After noise exposure, the neurites can re-innervate the inner hair cell, but synaptic ribbons within the inner hair cell are often reduced, resulting in loss of auditory sensitivity (Kujawa et al, "Adding Insult to Injury: Cochlear Nerve Degeneration after 'Temporary' Noise-Induced Hearing Loss," J. Neurosci. 29:14077-85 (2009)). Chronic excitotoxicity is seen in mice without the p50 subunit of NF-κΒ, and this results in neuronal loss (Lang et al, "Nuclear Factor KappaB Deficiency is Associated With Auditory Nerve Degeneration and Increased Noise- Induced Hearing Loss," J. Neurosci. 26:3541 -50 (2006)).
[0010] Lastly, human hearing disorders can stem from causes other than injury to the mechanoreceptors themselves. Mutations affecting the function of stria vascularis cells in the lateral wall of the cochlear duct result in deafness (Minowa et al, "Altered Cochlear Fibrocytes in a Mouse Model of DFN3 Nonsyndromic Deafness," Science 285(5432): 1408-11 (1999)). Animals treated with restraint stress, noise conditioning, or corticosteroid injection show resistance to noise induced hearing loss (Wang et al, "Restraint Stress and Protection From Acoustic Injury in Mice," Hear. Res. 165(1 -2):96- 102 (2002); Yoshida et al, "Sound Conditioning Reduces Noise-Induced Permanent Threshold Shift in Mice," Hear. Res. 148(l-2):213-9 (2000)). Many physicians treat sudden hearing loss with corticosteroid injections, although the utility of this protocol has been disputed (Conlin et al, "Treatment of Sudden Sensorineural Hearing Loss: I. A Systematic Review," Arch. Otolaryngol Head Neck Surg. 133(6):573-81 (2007); Conlin et al, "Treatment of Sudden Sensorineural Hearing Loss: II. A Meta-Analysis," Arch. Otolaryngol Head Neck Surg. 133(6):582-6 (2007)). Corticosteroids are thought to activate NF-κΒ (Tahera et al, "NF-kappaB Mediated Glucocorticoid Response in the Inner Ear After Acoustic Trauma," J. Neurosci. Res. 83(6): 1066-76 (2006)). Significant NF-KB activity has been detected in the lateral wall of the cochlea (Adams et al, "Selective Activation of Nuclear Factor Kappa B in the Cochlea by Sensory and
Inflammatory Stress," Neuroscience 160(2):530-9 (2009)). All of this data points to a role by cells in the lateral wall in responding to mechanical stress.
[0011] To date, human genomic studies on age-related hearing loss have identified few candidate susceptibility genes. Common wisdom holds that hearing loss in the aged runs in families. However, identifying susceptibility to deafness in the aged is a far more complex problem than it is for early onset hereditary hearing loss, in part due to the complex interplay between genetics and experience in age-related hearing loss. To date, large-scale, quantitative genomic studies on populations of aged humans have found few such genes (Friedman et al, "GRM7 Variants Confer Susceptibility to Age-Related Hearing Impairment," Hum. Mol. Genet. 18(4):785-96 (2009); Van Eyken et al, "KCNQ4: A Gene for Age-Related Hearing Impairment?," Hum. Mutat. 27(10): 1007-16 (2006); Van Laer et al, "The Grainyhead Like 2 Gene (GRHL2), Alias TFCP2L3, is Associated with Age-Related Hearing Impairment," Hum. Mol. Genet. 17(2): 159-69 (2008)). Mouse genetics can fill in this gap.
[0012] From the foregoing, there remains a need for identifying treatments that can be used to inhibit or reduce hearing loss in individuals that have been exposed to a hearing loss event, as well as identifying individuals who are genetically predisposed or susceptible to hearing loss, whether age-related or injury- induced. The present invention is directed to overcoming these and other deficiencies in the art. SUMMARY OF THE INVENTION
[0013] A first aspect of the present invention relates to a method of treating a subject to inhibit hearing loss including administering to a subject exposed to a hearing loss event an effective amount of an agent that upregulates Foxo3 expression or enhances activity of Foxo3.
[0014] A second aspect of the present invention relates to a method of assessing susceptibility to Foxo3 -related hearing loss in a subject, including determining whether that subject has a variant Foxo3 gene that has reduced or absent function.
[0015] A third aspect of the present invention relates to a composition comprising an agent that upregulates Foxo3 expression levels in a delivery vehicle suitable for administration to the ear canal or cochlear duct.
[0016] Hearing loss occurs when the mechanoreceptors of the cochlea are damaged and can be a consequence of prolonged noise exposure, ototoxic agents, and aging. Understanding natural mechanisms that promote hair cell survival might enable construction of a therapeutic to protect human hearing. The present invention is focused on the FOXO transcription factor family. FOXO family activation as a protective response to mechanical trauma has been conserved through evolution and is seen in worms, flies, and mammals. It is believed that members of this family play a pro-survival role in the noise-damaged mouse cochlea. It is shown herein that Foxo3 is present in the sensory region of the mouse cochlea from birth to adulthood. The function of Foxo3 in the cochlea was assessed by testing the auditory function of Foxo3 knockouts and wild- type littermates at two and four months of age. Foxo3 knockouts have normal hearing at two months, but experience mild age related hearing loss compared to normal littermates. In response to 105 dB noise exposure, Foxo3 knockouts have a significantly larger threshold shift and concomitant hair cell loss than their wild-type counterparts. Foxo3- dependent protection may be specific to apoptotic cell death, as no significant difference in hair cell loss was observed when neonatal Foxo3 knockout, heterozygous, and wild- type cochlea were cultured in cisplatin. Analysis of mRNA by RT-PCT hours after deafening enables the identification of apoptosis factors and potential Foxo3 targets.
[0017] Based on the evidence presented herein, it is believed that Foxo3 is a novel deafness susceptibility gene. The present invention is the first to investigate Foxo3 activity in the cochlea. Foxo3 is an evolutionarily conserved transcription factor activated by mechanical or oxidative stress. Its function in cells is context-specific: it may block proliferation, initiate apoptosis, or promote recovery from stress. The evidence presented herein ruled out that Foxo3 was necessary for hair cell apoptosis or governed proliferation in supporting cells. Instead, it was discovered that loss of Foxo3 function confers susceptibility to noise and accelerates hereditary deafness. It is therefore believed that Foxo3 expression in both sensory hair cells and SGN's of the cochlea provides cell- intrinsic, innate protection from damage. A number of FDA-approved medicines, including Paclitaxel and Doxorubicin, up-regulate Foxo3 activity and cause its nuclear localization (Sunters et al, "Paclitaxel-Induced Nuclear Translocation of FOX03a in Breast Cancer Cells is Mediated by C-Jun H2 -Terminal Kinase and Akt," Cancer Res. 66(l):212-20 (2006); Ho et al, "Phosphorylation of FOX03a on Ser-7 by p38 Promotes Its Nuclear Localization in Response to Doxorubicin, " J. Biol. Chem. 287(2): 1545-55 (2012), both of which are hereby incorporated by reference in their entirety). The present invention contemplates administration of these or other medicines to mitigate cellular damage and threshold shifts in noise-exposed individuals.
Compositions suitable for otic administration to the cochlear duct or ear canal and comprising these agents are contemplated.
BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figures 1A-1M show Foxo3 and Foxol expression in sensory hair cells and neurons of the mouse cochlea. Figure 1A shows quantitative PCR, measuring transcript levels in cells of the postnatal mouse cochlea, including the spiral ganglion. Foxo3, Foxol, and the hair cell marker Pou4f3 are shown. 2-4 cochlea were
independently processed for each time point. Figures 1B-1G show that anti-Foxo3 staining (Figures IE, IF, 1G, red) is detected in parvalbumin+ (green) hair cells at P7 (Figures IB, IE) and P60 (Figures 1C, IF). P60 neurotubulin+ SGNs (Figure ID, green) also express Foxo3 (Figure 1G). Figures 1H-1M show that anti-Foxol staining (Figure IK, 1L, 1M, red) is detected in myosin 7+ (green) hair cells at P7 (Figure 1H, IK) but not at P60 (Figure II, 1L), and is faintly visible in SGNs (Figure U, 1M).
[0019] Figures 2A-2C illustrate hearing loss in PI 20 Foxo3-KO without apparent hair cell loss. Figure 2A shows autonomic brainstem response ("ABR") pure tone hearing thresholds in Foxo3-KO and wild-type mice at P60 and P120. N=9 or more animals per condition; p=0.02 and 0.01 at 24 and 32 kHz respectively for P120 and KO only (student's 2-tailed t-test). Figure 2B shows volume of otoacoustic emissions from the same animals, which measures outer hair cell health and function. No difference was observed between genotypes at 24 or 32 kHz. Figure 2C shows a section through the basal region of a P 120 Foxo3-KO cochlea, stained with anti-myosin7 (red) and DAPI (blue). Outer hair cells appear normal. In this field, two inner hair cells are seen because of the plane section.
[0020] Figures 3A-3B show that neuronal density in the basal spiral ganglion is reduced in PI 20 Foxo3-KO. Figure 3 A shows anti-neurotubulin (green) in PI 20 wildtype ganglion, counterstained with DAPI (blue). Figure 3B shows basal ganglion from P120 Foxo3-KO, stained identically. Neuronal density is reduced by 23%.
[0021] Figures 4A-4E show the effects of moderate noise exposure on wild-type and Foxo3-KOs. Figures 4A and 4B show typical ABR traces from a P60 wild-type mouse at 16 kHz before (Figure 4A) and 1 day post noise treatment (Figure 4B). Figure 5C shows a comparison of hearing thresholds of wildtype (circles) and Foxo3-KO animals (x) before (black lines) and 14 days post noise treatment (red lines). N=6 animals for genotype. P-values for 12, 16, 24, and 32 kHz, Foxo3-KO vs. wild-type: 0.0012, 0.0052, 0.0005, 0.0010, student's two-tailed t-test. Figures 4D and 4E show confocal images of the basal cochlea for wild-type (Figure 4D) and Foxo3-KO, stained with DAPI. Brackets indicate outer hair cell layer. More gaps are observed in Figure 4E. Size bar: 50 μιη.
[0022] Figures 5A-5E show Foxo3-KO in combination with Cdh23(753A) point mutation. In Figures 5A and 5B, sequence analysis for Cdh23 for 2 Foxo3 heterozygotes bred to Balb/c. Figure 5A is heterozygous at 753 and Figure 5B has two copies of the hearing loss allele. Figure 5C illustrates ABR thresholds for 6 Foxo3-KO (red lines) and 10 wild-type, all with two copies of the Cdh23(753A) allele. Figures 5D and 5E show whole mount views of outer hair cells in the middle turn of a wild-type (Figure 5D) and Foxo3-KO (Figure 5E) cochlea, both homozygous for Cdh23(753A) allele. More gaps are observed in Figure 5E.
[0023] Figures 6A-6E illustrate that P2 Foxo3-KO hair cells are not more sensitive to cisplatin toxicity. In Figures 6A and 6B, P2 parvalbumin+ hair cells (Figure 6B) also express Foxo3 (Figure 6A). In Figures 6C and 6D, hair cells, marked by anti- parvalbumin, appear normal in the Foxo3-KO (Figure 6D). Figure 6E shows
quantification of hair cells in P2 organ cultures treated for 1 day with 100 μΜ cisplatin. No significant difference is seen between wild-type and Foxo3-KO cultures. [0024] Figure 7 shows qPCR expression of Foxo3 -dependent oxidative stress proteins in the whole cochlea 24 hours after mild noise treatment. Parvalbumin and Pou4f3 are hair cell markers; Pinkl (Pten-induced putative kinase 1), Cited2, Sod2 (Superoxide dismutase 2), Fbxo32 (F-box protein 32), Gabarapll (GABA-receptor associated protein like 1), Lcn2 (Lipocalin 2), and Cflar (CASP8 and FADD-like apoptosis regulator).
[0025] Figures 8A-8B show results of anti-Pou4f3 staining in deafened cochleae.
DAPI (Figure 8A) and anti-Pou4f3 (Figure 8B) in the mid-turn of a P62 mouse wild-type cochlea are shown, 1 day after noise treatment.
[0026] Figure 9 illustrates a breeding strategy for conditional knockout mice.
DETAILED DESCRIPTION OF THE INVENTION
[0027] The present invention relates to novel methods of treating a subject to inhibit hearing loss by administering to a subject exposed to a hearing loss event an effective amount of an agent that upregulates Foxo3 expression or enhances activity of Foxo3, and assessing susceptibility to Foxo3 -related hearing loss in a subject, including determining whether that subject has a variant Foxo3 gene that has reduced or absent function.
[0028] Foxo3 (forkhead box 03) is the name assigned by the HUGO Gene
Nomenclature Committee to the gene that, according to the present invention, is central to treating and inhibiting hearing loss in the ear. Foxo3 is a transcription factor, which means that it directs the production of other genes by binding near the DNA sequences that encode them. Foxo3 activity in cells is increased by mechanical damage or by the presence of oxidizing molecules. It can also be specifically induced or repressed by signaling pathways. Oxidizing molecules like peroxides damage proteins, inducing a process called oxidative stress. Excitotoxicity has similarities to oxidative stress.
Depending on the kind of cell, Foxo3 activity directs different processes, all of which are stress-related: it can block cell division (tumor suppression), it can promote the expression of genes that reduce oxidative stress, or it can cause the cell to commit suicide (apoptosis). In cancer cells, Foxo3 expression is often reduced. Its functions in blocking cell division and in promoting cell suicide help prevent cells that express Foxo3 from becoming cancerous.
[0029] There is natural variation in humans with respect to Foxo3, meaning that the sequence encoding this gene can be slightly different between individuals. Different gene sequences for the same gene are called alleles. One human allele for Foxo3, dFOXO allele, strongly correlates with longevity: people who live to be over a hundred years old more often have a particular Foxo3 allele (Greer et al, "FOXO Transcription Factors at the Interface Between Longevity and Tumor Suppression," Oncogene 24:7410- 7425 (2005); Wilcox et al, "FOX03A Genotype is Strongly Associated with Human Longevity," PNAS 105(37): 13987-13992 (2008), both of which are hereby incorporated by reference in their entirety). A different allele correlates with female infertility, which is one hallmark of Foxo3 loss of function (Wang et al., "Analysis of FOX03 Mutation in 114 Chinese Women With Premature Ovarian Failure," Reprod. Biomed. Online
20(4):499-503 (2010) (finding women with premature ovarian failure had six novel single-nucleotide variants C.710A (p.Pro24His), C.140OT (p.Pro47Leu), c. l84G>A (p.Asp62Asn), C.16520T (p.Ser551Phe), C.16970G (p.Gly566Ala) and c. l l85G>A (silent)), which is hereby incorporated by reference in its entirety). This confirms that some humans may have dysfunctional Foxo3 genes.
[0030] As used herein, the terms "treating," "treatment," and "therapy" refer to curative therapy, prophylactic therapy, and preventive therapy. An example of
"preventive therapy" or "prophylactic therapy" is the prevention of future hearing loss following exposure to an expected hearing loss event. Those in need of treatment include those already exposed to a hearing loss event, those who have hearing loss, and those who are prone or predisposed to have future hearing loss. Administration can be "chronic" administration which refers to administration of the agent(s) in a continuous mode as opposed to an acute mode, so as to maintain the initial therapeutic effect (activity) for an extended period of time. Administration can also be "intermittent" administration which is treatment that is not consecutively done without interruption but, rather, is cyclic in nature. Administration can also be "in combination with" one or more further therapeutic agents includes simultaneous (concurrent) and consecutive administration in any order, as discussed infra.
[0031] It is contemplated that the subject to be treated in accordance with the present invention can be any mammal, but preferably a human. Veterinary uses are also contemplated. The individual to be treated can be an infant or juvenile, an elderly individual, an individual having a cardiopulmonary or immunosuppressive condition, or even an otherwise healthy adult. In certain embodiments, the subject to be treated is not a patient undergoing chemotherapy treatment with any of the Foxo3 upregulating agents described herein. In other embodiments, the subject to be treated is characterized by Foxo3 expression levels in inner hair cells or SGNs that are lower than a normal range for individuals of the same age or other demographic group.
[0032] The cochlea, a hollow tube coiled in the shape of a snail's shell, is filled with fluid. The inside of the cochlea is divided into three regions, which is further defined by the position of the vestibular membrane and the basilar membrane. The portion above the vestibular membrane is the scala vestibuli, which extends from the oval window to the apex of the cochlea and contains perilymph fluid, an aqueous liquid low in potassium and high in sodium content. The basilar membrane defines the scala tympani region, which extends from the apex of the cochlea to the round window and also contains perilymph. The basilar membrane contains thousands of stiff fibers, which gradually increase in length from the round window to the apex of the cochlea. The fibers of the basement membrane vibrate when activated by sound. In between the scala vestibuli and the scala tympani is the cochlear duct, which ends as a closed sac at the apex of the cochlea. The cochlear duct contains endolymph fluid, which is similar to cerebrospinal fluid and is high in potassium.
[0033] The Organ of Corti, the sensory organ for hearing, is located on the basilar membrane and extends upward into the cochlear duct. The Organ of Corti consists, in part, of about 20,000 specialized cells, called hair cells. These cells have small hairlike projections (cilia) that extend into the fluid. Sound vibrations transmitted from the ossicles in the middle ear to the oval window in the inner ear cause the fluid and cilia to vibrate. Hair cells in different parts of the cochlea vibrate in response to different sound frequencies and convert the vibrations into nerve impulses. The nerve impulses are transmitted along fibers of the cochlear nerve to the brain. Despite the protective effect of the acoustic reflex, loud noise can damage and destroy hair cells.
[0034] As used herein, a "hearing loss event" may be due to trauma, exposure to noise exceeding a decibel threshold per exposure time (see NIOSH and CDC 2002 guidelines), or exposure to ototoxins or infectious agents. Continued exposure to loud noise causes progressive damage, eventually resulting in hearing loss and sometimes noise or ringing in the ears (tinnitus). The trauma may be further defined as
mechanically-induced metabolic trauma, mechanical/metabolic trauma, stress trauma, stress-induced damage, or environmental stress. One example of trauma includes restoration surgery performed on the middle or inner ear. Thus, in certain embodiments - l i the hearing loss event may be a discrete event or it may be a cumulative event insofar as repeated exposures to loud noises or ototoxins over a course of time may also give rise to hearing loss. In other embodiments, the hearing loss can be age-related hearing loss, antibiotic-induced hearing loss, and chemotherapeutic-induced hearing loss.
[0035] Hearing thresholds are the least sound pressure level in decibels (db) at which a person or animal detects sound at a given frequency. By way of example, human hearing varies from ~0 db to -100 db. If the threshold for hearing changes, it is called a threshold shift. The shift is simply the difference between the first measurement and the second measurement for any given animal. Since optimal hearing does not improve, greater shifts in threshold necessarily mean worse hearing outcomes. Thus, inhibition of hearing loss in the context of the present invention means that the hearing loss concomitant with the treatment of the present invention is reduced as compared to an individual not receiving the treatment, but more preferably minimized (i.e., threshold shift of less than about 5-10 db at a particular frequency), or most preferably substantially inhibited (threshold shift of less than about 5 db) at a particular frequency.
[0036] In one embodiment, the inhibition of hearing loss is measured as an average difference in threshold shift in mammals from baseline threshold sensitivity at 4, 8, and 16 kHz, as compared to an untreated control, which is at least 25 decibels after exposure to 120 decibel SPL Octave Band Noise centered at 4 kHz for five hours. More specifically, the threshold shift in mammals treated in accordance with the present invention is expected to be at least 10 decibels lower than the threshold shift in mammals that are treated with a control saline solution, more preferably at least 15, 20, or 25 decibels lower than control. In one embodiment, the threshold shift is measured 10 days after exposure to the noise using ABR testing. In another embodiment, the threshold shift is measured 7 days following cessation of treatment in accordance with the present invention. Similar results would be anticipated using other alternative measures of auditory or sensory cell function, such as psychophysical tests or otoacoustic emission measures.
[0037] In another embodiment, the inhibition of hearing loss is measured using outer hair cell loss and inner hair cell loss values as measured both in the whole cochlea and in a trauma region of the cochlea, where hair cell loss in the treatment population is less than hair cell loss in control animals. After treatment according to the method of the present invention, outer hair cell loss in the whole cochlea is less than 10%, more preferably less than 5%, and inner hair cell loss in the whole cochlea is less than 5%, more preferably less than 3%. Outer cell hair loss in the trauma region is less than 20%, more preferably less than 10%, while inner hair cell loss in the trauma region is less than 10%, more preferably less than 5%.
[0038] Any one of a number of agents that upregulate Foxo3 expression or enhance activity of Foxo3 can be used in the present invention. Exemplary agents include, without limitation, Paclitaxel/Taxol, Vinblastine, KP372-1, Imatinib,
Doxorubicin, wortmannin, LY294002, and Psammaplysene A, or a conjugate comprising one of these agents, or any combination thereof.
[0039] Examples of such conjugates include, without limitation, p97-Paclitaxel or p97-Doxorubicin (see WO 2002/013843 to Gabathuler et al, which is hereby
incorporated by reference in its entirety), and GR 1005 (paclitaxel-Angiopep-2; see U.S. Patent Publication 2006/0189515 to Beliveau et al, which is hereby incorporated by reference in its entirety). The use of other known conjugating moieties is also contemplated.
[0040] The agents that upregulate Foxo3 expression or enhance activity of Foxo3 are administered in an effective amount that is sufficient to induce a protective effect against hearing loss. As employed herein, the phrase "an effective amount" refers to a dose sufficient to provide concentrations high enough to impart a beneficial effect on the recipient thereof. The specific therapeutically effective dose level for any particular subject will depend upon a variety of factors including the hearing loss being treated, the severity of the hearing loss, the activity of the specific compound, the route of administration, the rate of clearance of the compound, the duration of treatment, the drugs used in combination or coincident with the compound, the age, body weight, sex, diet and general health of the subject, and like factors well known in the medical arts and sciences. Various general considerations taken into account in determining the "therapeutically effective amount" are known to those of skill in the art and are described, e.g., in Gilman et al, eds., Goodman And Gilman's: The Pharmacological Bases of Therapeutics, 8th ed., Pergamon Press, 1990; and Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Co., Easton, Pa., 1990, which are hereby incorporated by reference in their entirety.
[0041] Generally, the lowest effective dose should be used. Suitable dosages are determined based on a variety of factors, but may include, without limitation, from about 5 mg/kg to about 1000 mg/kg of the agent, preferably from about 10 mg/kg to about 500 mg/kg of agent. While individual doses may vary, optimal ranges of the effective amounts may be determined by one of ordinary skill in the art.
[0042] The agent can also be present in the form of a composition that comprises a carrier, preferably a pharmaceutically acceptable carrier. The compositions of the present invention can be in solid or liquid form, such as tablets, capsules, powders, solutions, suspensions, or emulsions.
[0043] A third aspect of the present invention relates to a composition comprising an agent that upregulates Foxo3 expression levels in a delivery vehicle suitable for administration to the ear canal or cochlear duct.
[0044] The composition can be administered as a pharmaceutical composition wherein the invention compound is formulated with a pharmaceutically acceptable carrier as is well known in the art. Techniques for formulation and administration may be found, for example, in "Remington's Pharmaceutical Sciences," (18th ed., Mack Publishing Co., Easton, Pa.), which is hereby incorporated by reference in its entirety. Accordingly, the invention compounds may be used in the manufacture of a medicament. Pharmaceutical compositions of the invention compounds may be formulated as solutions or lyophilized powders for parenteral administration. Powders may be reconstituted by addition of a suitable diluent or other pharmaceutically acceptable carrier prior to use. Powders also may be sprayed in dry form. The liquid formulation may be a buffered, isotonic, aqueous solution. Examples of suitable diluents are normal isotonic saline solution, standard 5% dextrose in water or buffered sodium or ammonium acetate solution. Such formulation is especially suitable for parenteral administration, but may also be used for oral administration or contained in a metered dose inhaler or nebulizer for insufflation.
[0045] Alternately, compositions may be encapsulated, tableted or prepared in a emulsion or syrup for oral administration. Pharmaceutically acceptable solid or liquid carriers may be added to enhance or stabilize the composition, or to facilitate preparation of the composition. Solid carriers include starch, lactose, calcium sulfate dihydrate, terra alba, magnesium stearate or stearic acid, talc, pectin, acacia, agar or gelatin. Liquid carriers include syrup, peanut oil, olive oil, saline and water. For aqueous compositions used in vivo, the use of sterile pyrogen- free water is preferred. Such formulations will contain an effective amount of the composition together with a suitable amount of an aqueous solution in order to prepare pharmaceutically acceptable compositions suitable for administration to a mammal, preferably a human. The carrier may also include a sustained release material such as glyceryl monostearate or glyceryl distearate, alone or with a wax. The amount of solid carrier varies but, preferably, will be between about 20 mg to about 1 g per dosage unit. The pharmaceutical preparations are made following the conventional techniques of pharmacy involving milling, mixing, granulating, and compressing, when necessary, for tablet forms; or milling, mixing and filling for hard gelatin capsule forms. When a liquid carrier is used, the preparation will be in the form of a syrup, elixir, emulsion or an aqueous or non-aqueous suspension.
[0046] The tablets, capsules, and the like may also contain a binder such as gum tragacanth, acacia, corn starch, or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, lactose, or saccharin. When the dosage unit form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier such as a fatty oil.
[0047] Various other materials may be present as coatings or to modify the physical form of the dosage unit. For instance, tablets may be coated with shellac, sugar, or both. A syrup may contain, in addition to an active ingredient, sucrose as a sweetening agent, methyl and propylparabens as preservatives, a dye, and flavoring such as cherry or orange flavor.
[0048] The agents may be orally administered, for example, with an inert diluent, or with an assimilable edible carrier, or may be enclosed in hard or soft shell capsules, or may be compressed into tablets, or may be incorporated directly with food. For oral therapeutic administration, the compounds of the present invention may be incorporated with excipients and used in the form of tablets, capsules, elixirs, suspensions, syrups, and the like. Such compositions and preparations should contain at least 0.1% of the agent. The percentage of the agent in these compositions may, of course, be varied and may conveniently be between about 2% to about 60% of the weight of the unit. The amount of agent in such therapeutically useful compositions is such that a suitable dosage will be obtained.
[0049] The active agents may also be administered parenterally. Solutions or suspensions of the compounds can be prepared in water suitably mixed with a surfactant such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof in oils. Illustrative oils are those of petroleum, animal, vegetable, or synthetic origin, for example, peanut oil, soybean oil, or mineral oil. In general, water, saline, aqueous dextrose and related sugar solution, and glycols, such as propylene glycol or polyethylene glycol, are preferred liquid carriers, particularly for injectable solutions. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
[0050] The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. The form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), suitable mixtures thereof, and vegetable oils.
[0051] The compounds of the present invention may also be administered directly to the airways in the form of an aerosol or other inhalable formulation. For use as aerosols, the agent of the present invention in solution or suspension may be packaged in a pressurized aerosol container together with suitable propellants, for example, hydrocarbon propellants like propane, butane, or isobutane with conventional adjuvants.
[0052] An inhalable formulation typically is in the form of an inhalable powder, which may include a pharmaceutically acceptable carrier. Suitable pharmaceutically acceptable carriers for inhalable powders may be composed of any pharmacologically inert material or combination of materials which is acceptable for inhalation.
Advantageously, the carrier particles are composed of one or more crystalline sugars; the carrier particles may be composed of one or more sugar alcohols or polyols. In one embodiment, the carrier particles are particles of dextrose or lactose. Conventional dry powder inhalers include the Rotohaler, Diskhaler, and Turbohaler. The particle size of the carrier particles may range from about 10 microns to about 1000 microns.
Alternatively, the particle size of the carrier particles may range from about 20 microns to about 120 microns. In certain embodiments, the size of at least 90% by weight of the carrier particles is less than 1000 microns and preferably lies between 60 microns and 1000 microns. The relatively large size of these carrier particles gives good flow and entrainment characteristics. Where present, the amount of carrier particles will generally be up to 95%, for example, up to 90%, advantageously up to 80% and preferably up to 50% by weight based on the total weight of the powder. The amount of any fine excipient material, if present, may be up to 50% and advantageously up to 30%, especially up to 20%, by weight, based on the total weight of the powder.
[0053] The compounds of the present invention also may be administered in a non-pressurized form such as in a nebulizer or atomizer, or in the form of an intranasal spray.
[0054] Sustained release formulations include implantable devices that include a slow-dissolving polymeric matrix and one or more of the above-described agents retained within the polymeric matrix. The matrix can be designed to deliver substantially the entire payload of the vehicle over a predetermined period of time, such as about one to two weeks up to about one to three months.
[0055] Although the formulations and compositions can also be delivered topically, it is also contemplated that the compositions can be delivered by various transdermal drug delivery systems, such as transdermal patches as known in the art. The transdermal patch may be applied to a subject's head adjacent the ear.
[0056] Active agents and compositions of the present invention may also be administered by introduction into the ear canal or cochlear duct, or introduced intranasally.
[0057] Various otic administration techniques are also contemplated. In particular embodiments, the formulations and compositions may be delivered directly to the ear canal (for example: topical otic drops or ointments; slow release devices in the ear or implanted adjacent to the ear; intratympanic injections; foams; solutions; emulsions; or otic paints). Local administration routes include otic intramuscular, intratympanic cavity and intracochlear injection routes for the compositions, or application via canula and/or injection, via a drop dispenser, as a spray in the ear canal, or as a paint via a cotton tipped stick. It is further contemplated that certain compositions of the invention may be in the form of intraotic inserts or implant devices.
[0058] Otic formulations may include one or more additives including, without limitation, lubricants, antimicrobial agents and/or antibiotics, topical anesthetics, anti- allergic components, preservatives, co-solvents, soothing agents, viscogenic agents, bioadhesive agents, and permeability enhancers.
[0059] Exemplary lubricants include, without limitation, propylene glycol, glycerin, polyethylene glycol, dextran, blended polyvinyl alcohols, polyvinyl alcohol, polyethylene glycol, light mineral oil, hydroxypropyl methylcellulose, hypromellose, carbopol, carbomer 940 (polyacrylic acid), polyvinyl pyrrolidone, white petrolatum, soy lecithin, and sodium carboxyl methylcellulose, as well as other agents known to those skilled in the art, or any combination thereof. Typically, such lubricants are employed at a level of from 0.1% to 2% by weight. In an embodiment, the lubricants are 1.0%
Propylene glycol, 0.3% glycerin, 2.7% blended polyvinyl alcohols, 1% polyvinyl alcohol, 1% polyethylene glycol, light mineral oil, 0.3% hydroxypropyl methylcellulose, 1.0% soy lecithin, 0.25% or 0.5% sodium carboxyl methylcellulose. In another embodiment, the total weight of a PVP-I, artificial-tear based lubricant is between 0.1% and 4.5%.
[0060] Exemplary antibiotic/antimicrobial agents include, without limitation, fluoroquinolones (ciprofloxacin, levofloxacin, ofloxacin, moxifloxacin, gatifloxacin, and the like); aminoglycosides (tobramycin, gentamicin, neomycin, and the like); Polymyxin B Combinations (polymyxin B/trimethoprim, Polysporin polymyxin B/bacitracin Neosporin polymyxin B/neomycin/ gramicidin, and the like) and other antibiotics (azithromycin, ilotycin, erythromycin, bacitracin, and the like).
[0061] Exemplary topical anesthetics include, without limitation, lidocaine, tetracaine or a derivative or combination thereof.
[0062] Exemplary anti-allergic components include, without limitation, epinastine, emedastine difumarate azelastine hydrochloride, olopatadine hydrochloride, olopatadine, ketotifen fumarate, pemirolast potassium, nedocromil, lodoxamide, cromolyn and cromolyn salts, as well as zinc acetate.
[0063] Exemplary preservatives include, without limitation, benzalkonium chloride, thimerosal, chlorobutanol, methyl paraben, propyl paraben, phenylethyl alcohol, EDTA, sorbic acid, Onamer M, other agents known to those skilled in the art, or a combination thereof. Typically such preservatives are employed at a level of from 0.001% to 1.0% by weight of final composition.
[0064] The compositions of the invention may contain one or more optional co- solvents. The solubility of the components of the present compositions may be enhanced by a surfactant or other appropriate co-solvent in the composition. Exemplary co- solvents include, without limitation, polysorbate 20, 60, and 80,
polyoxyethylene/polyoxypropylene surfactants (e.g. Pluronic F-68, F-84 and P-103), cyclodextrin, tyloxapol, other agents known to those skilled in the art, or a combination thereof. Typically such co-solvents are employed at a level of from 0.01% to 2% by weight of the final composition.
[0065] The compositions may also contain an effective amount of a chemical agent to provide a cooling sensation to relieve mild otic irritation, enhance comfort, and provide a refreshing effect and improved sensation, when the inventive composition is applied to the ear. Such an agent encompasses various chemicals and chemical classes, including, without limitation, cooling agents such as menthol, menthol derivatives including methone glycerin acetyl and menthyl esters, carboxamides, menthane glycerol ketals, alkyl substituted ureas, sulfonamides, terpene analogs, furanones, and phosphine oxides; or camphor, and borneol.
[0066] The compositions of the invention may contain a viscogenic agent— that is, an agent that can increase viscosity. When included in a composition of the invention, viscogenic agents allow the composition to transform from a liquid-like state (e.g., flowable) at 25°C to a solid-like state (e.g., a gel), and can be non-biodegradable, i.e., not broken down by chemicals or enzymes naturally present in a mammal, or biodegradable. This may be desirable to increase otic absorption of the active compound, to decrease variability in dispensing the formulation, to decrease physical separation of components of a suspension or emulsion of the formulation and/or to otherwise improve efficacy of the otic formulation. Compositions include an amount of viscogenic agent effective to yield a viscosity of the composition of less than 100,000 cps at 25°C (e.g., less than 90,000, less than 60,000, less than 30,000, less than 20,000, or less than 10,000 cps). Typically, a composition includes 0.05 to 10% of a viscogenic agent) (see U.S. Patent Publication No. 2004/0101560 to Sawchuk et al, which is hereby incorporated by reference in its entirety).
[0067] Exemplary viscogenic agents include, without limitation, polyvinyl alcohol, polyvinylpyrrolidone, methyl cellulose, hydroxypropylmethylcellulose, hydroxyethylcellulose, carboxymethylcellulose, hydroxypropylcellulose, gellan (Gelrite® or Kelcogel®), Carbopol® 940 with hydroxypropylmethylcellulose (HPMC), N- isopropyl acrylamide (NiPAAm) with sodium acrylate and n-N-alkylacrylamide, polyacrylic acid with polyethylene glycol (PEG) or polymethacrylic acid with PEG, cellulose acetate hydrogen phthalate latex (CAP), sodium alginate, and nonionic surfactants such as poloxamers (Pluronic®) and polyoxamine (Tetronic®) reversible temperature-dependent gelling systems. Gellan is a natural polymer, anionic deacetylated exocellular polysaccharide, secreted by Pseudomonas elodea. The tetrasaccharide repeating unit consists of one a-L-rhamnose, one β-D-glucuronic acid, and two β-D- glucose moieties. The in situ gelling mechanism of gellan is cation-induced (e.g., presence of calcium ions) and temperature-dependent (e.g., physiologic temperature). Gelation is thermally reversible. Carbopol® 940 with HPMC gels in situ in a pH- dependent manner. Carbopol® is the gelling agent and the HPMC is used to enhance the viscosity of the gel. NiPAAm with sodium acrylate and n-N-alkylacrylamide is a terpolymer hydrogel that can undergo a temperature based reversible sol-gel
transformation. Sodium acrylate and n-N-alkylacrylamide are used to modify the properties of the hydrogel, and in particular, the transition temperature. Polyacrylic acid with PEG or polymethacrylic acid with PEG is thought to gel based on hydrogen bonding. Polyacrylic acid can be dissolved in hydroalcoholic solution and after being injected, the alcohol diffuses out causing the polymers to precipitate and gelling of the solution. CAP is a nanoparticulate system that gels in a pH-dependent manner. The active compound (pharmacologic agent) is adsorbed partially onto the surface of the polymer particles. Sodium alginate gels in the presence of calcium or other polyvalent ion (see U.S. Patent Publication No. 2004/0101560 to Sawchuk et al, which is hereby incorporated by reference in its entirety). Such agents are typically employed at a level of from 0.01% to 2% by weight of the final composition.
[0068] Bioadhesive agents can be used in the compositions to increase the retention time of the drug gradient over the biological substrates. Exemplary bioadhesive agents include, without limitation, polyvinylpyrrolidone (PVP), xanthan gum, locust bean gum, acacia gum, hydroxypropyl methylcellulose (HPMC), sodium alginate, pectin, gelatin, carbomer, polyvinylalcohol, gellan gum, tragacanth, acacia, and sodium carboxymethyl cellulose. Several of these agents can also serve to enhance viscosity of the formulation, as noted above.
[0069] Exemplary permeability enhancer include, without limitation, polyols selected from glycerol, propylene glycol, polyethylene glycol, sorbitol, xylitol, and maltitol. The permeability enhancer is typically present at a final concentration of about 0.1% to about 35%, more preferably about 1% to about 30%, or about 5% to about 25%.
[0070] In some embodiments, the compositions are formulated for pH, and a practical osmolality and/or osmolarity to ensure that homeostasis of the target auris structure is maintained. A perilymph-suitable osmolarity/osmolality is a practical/deliverable osmolarity/osmolality that maintains the homeostasis of the target auris structure during administration of the pharmaceutical formulations described herein. For example, the osmolarity of the perilymph is between about 270-300 mOsm/L, and the compositions described herein are optionally formulated to provide a practical osmolarity of about 150 to about 1000 mOsm/L. Similarly, the pH of the perilymph is about 7.2-7.4, and the pH of the present formulations is formulated (e.g., with the use of buffers) to provide a perilymph-suitable pH of about 5.5 to about 9.0, about 6.0 to about 8.0 or about 7.0 to about 7.6. See U.S. Patent Publication No. 201 1/0319377 to Lichter et al, which is hereby incorporated by reference in its entirety.
[0071] In addition, the active agents can be administered by using a delivery vehicle for passive or targeted delivery to inner hair cells or SGNs. The active agents may be administered in an amount effective to upregulate Foxo3 expression in inner hair cells or spiral ganglions. Any suitable passive or targeted delivery vehicle can be employed, including liposomes, polymeric nanoparticles, polyethylene glycol conjugates, and cell uptake peptides. Targeting the delivery vehicle to inner hair cells or SGNs can be achieved through the use of antibodies, binding fragments thereof, or nucleic acid aptamers that are bound or suspended to the surface of the delivery vehicle. Target cell- specific receptors include, without limitation, ERBB family receptors and Trk receptors, which are expressed in both SGNs and sensory epithelia (Bitsche et al., "Neurotrophic Receptors as Potential Therapy Targets in Postnatal Development, in Adult, and in
Hearing Loss-affected Inner Ear," 0to/ Newroto/ 32(5):761-73 (2011); Hume et al., "ErbB Expression: The Mouse Inner Ear and Maturation of the Mitogenic Response to
Heregulin," J4R0 4(3): 422-43 (2003); Gomez-Casati et al., "Nonneuronal Cells Regulate Synapse Formation in the Vestibular Sensory Epithelium Via erbB-dependent BDNF Expression," Proc. Natl. Acad. Sci USA 107(39): 17005-10 (2010), each of which is hereby incorporated by reference in its entirety). These active agents can be administered systemically.
[0072] Formulations and compositions of the present invention may be formulated to include other medically useful drugs or biological agents. These include, without limitation, one or more antioxidants, steroids (e.g., corticosteroids such as cortisone, dexamethasone, etc.), vasoactive agents (e.g., magnesium), agents that reduce insulin resistance, Jnk signal transduction inhibitors, and inhibitors of proteins that stimulate the production of reactive oxidative species. [0073] One example of suitable antioxidant combinations includes a salicylate and a scavenger of peroxyl radicals such as Vitamin E and its derivatives or analogs (see U.S. Patent No. 7,786,100 to Miller et al, which is hereby incorporated by reference in its entirety). Exemplary salicylates include, without limitation, salicylic acid, salts of salicylic acid (e.g., sodium salicylate), and combinations thereof. The salicylate is typically present in the composition in a total amount of at least 3.2 international units (IU), more preferably from 3.2 IU to 29.0 IU, most preferably about 3.8 IU for an adult dosage, with the composition typically administered twice daily. Vitamin E is a generic term for all tocols and tocotrienol derivatives with a biological activity of alpha- tocopherol. Primary dietary forms of vitamin E include vitamin E itself and alpha- tocopherol. Trolox®, a water-soluble analogue of alpha-tocopherol that is commercially available from Hoffman-Laroche, Ltd. of Basel, Switzerland, is another form of vitamin E with biological activity. Vitamin E and its derivatives and analogs are typically present in the composition in an amount of at least 60 IU, more preferably from 60 IU to 540 IU, most preferably from 300 IU to 540 IU.
[0074] Another example of an antioxidant useful for treating hearing loss includes free radical scavengers such as edaravone, resveratrol, ebselen and iron chelator and compounds from the family of antioxidant compounds including, but not limited to, N- acetylcysteine (NAC), Acetyl-L-Carnitine (ALCAR), glutathione monoethylester, ebselen, D-methionine and carbamathione (see U.S. Patent Publication No. 2010/0022458 to Kopke et al, which is hereby incorporated by reference in its entirety).
[0075] Yet another example of an antioxidant useful for treating hearing loss includes R-N6-Phenylisopropyl adenosine (R-PIA) in combination with one or more of agents that increase glutathione levels such as L-2-oxothiazolidine-4-carboxylic acid (OTC), L-N-acetylcysteine (L-NAC), methionine and S-adenosyl-L-methionine (SAMe) (see U.S. Patent Publication No. 2001/0007871 to Kopke et al, which is hereby incorporated by reference in its entirety).
[0076] Another example of an antioxidant useful for treating hearing loss includes
L-carnitine (see U.S. Patent Publication No. 2005/0049305 to Kalinec et al., which is hereby incorporated by reference in its entirety). This antioxidant is particularly useful for treating children treated with aminoglycoside antibiotics.
[0077] A further example of antioxidants includes a combination of one or more of arginine, ascorbate, folate, glutathione and glutathione prodrugs (n-acetylcysteine), alpha-lipoic acid, melatonin, nicotinamide, riboflavin, selenium, taurine, vitamins E, A, B6, B12, D, and zinc, and optionally including chromium and/or vanadium to reduce insulin resistance, coenzyme Q 10 to prevent hypoxia- induced damage, ginko biloba to regulate blood flow, and Mg2+ to promote vascular health (see U.S. Patent Publication No. 2002/0061870 to Pearson et al; U.S. Patent Publication No. 2007/0105782 to Campbell, each of which is hereby incorporated by reference in its entirety).
[0078] Another use antioxidants includes two or more of a glutathione peroxidase mimic, a xanthine oxidase inhibitor, and glutathione or a glutathione precursor (see U.S. Patent Publication No. 2004/0220145 to Kil et al, which is hereby incorporated by reference in its entirety).
[0079] A further example of antioxidants involves the use of 3,3'-diindolyl- methane and/or its derivatives (see U.S. Patent Publication No. 2011/0190367 to Hug et al, which is hereby incorporated by reference in its entirety).
[0080] One example of suitable agents that reduce insulin resistance include, without limitation, lipoic acid and their salts, and tetrahydrobiopterin bis lipoate, which are disclosed in U.S. Patent Publication No. 2009/0068264 to Richardson et al, which is hereby incorporated by reference in its entirety.
[0081] Examples of proteins that stimulate the production of reactive oxidative species and their inhibitors include, without limitation, an NADPH oxidase (e.g., NOX3) and the inhibitors disclosed in U.S. Patent Publication No. 2009/0263323 to Krause et al, and U.S. Patent Publication No. 201 1/0142917 to Alpert et al, each of which is hereby incorporated by reference in its entirety).
[0082] Examples of JNK stress signaling pathway inhibitors include those described in U.S. Patent Publication No. 2002/0115706 to Ylikoski et al, and U.S. Patent Publication No. 2003/0108539 to Bonny, each of which is hereby incorporated by reference in its entirety.
[0083] The administering may be repeated. In one embodiment, the administering is carried out one or more times daily for more than two days. In another embodiment, the administering is carried out until hearing loss is minimized. In yet another embodiment, the administering is carried out for up to about two to about 10 weeks.
[0084] The composition of the present invention may be administered within about 72 hours of hearing loss event or trauma to a middle or inner ear of the mammal. Treatment within 72 hours is most appropriate when the mammal has sustained trauma to the middle or inner ear through unexpected loud noise or other trauma. It is to be appreciated that by administrating the composition within 72 hours of trauma, treatment prior to trauma is also contemplated through the method of the present invention. Ideally, the composition is administered to the mammal prior to trauma to the middle or inner ear. Treatment prior to trauma is most feasible when the mammal is preparing for sustaining trauma to the middle or inner ear. For example, the composition may be administered prior to restoration surgery performed on the middle or inner ear. As another example, if a person will be firing a weapon or attending an event such as a rock concert, the person may begin treatment prior to sustaining the trauma to the middle or inner ear to attain the best results. As such, the composition is preferably administered as soon as possible after the trauma to the middle or inner ear of the mammal. Even so, treatment within 72 hours with the composition of the present invention is also effective.
[0085] After initial administration of the composition, the composition is typically administered to the mammal each day for at least 10 weeks following the trauma to the middle or inner ear of the mammal. Other treatment regimens may also prove efficacious for purposes of the present invention.
[0086] A second aspect of the present invention relates to a method of assessing susceptibility to Foxo3 -related hearing loss in a subject, including determining whether that subject has a variant Foxo3 gene that has reduced or absent function. In one embodiment, the determining includes detecting whether Foxo3 gene has a mutation selected from the group of a truncation, a single nucleotide polymorphism (SNP), a translocon, and insertion, or any other sequence variation that interferes with function the Foxo3 gene. Exemplary Foxo3 nucleic acid and amino acid sequences are reported at NM_001455, NP_001446, and NM_201559, which are hereby incorporated by reference in their entirety.
[0087] In the sequence shown below (SEQ ID NO: 1), confirmed or suspected allelic variations in Foxo3 are identified by the substitution identified below the modified amino acid residue. If a frameshift (FS-^) is indicated, then all amino acid residues toward the C-terminus will be modified as a result of the SNP. SEQ ID NO: 1 is as follows:
MAEAPASPAP LSPLEVELDP EFEPQSRPRS CTWPLQRPEL QASPAKPSGE TAADSMIPEE EDDEDDEDGG GRAGSAMAIG GGGGSGTLGS GLLLEDSARV LAPGGQDPGS GPATAAGGLS 120
w GGTQALLQPQ QPLPPPQPGA AGGSGQPRKC SSRRNAWGNL SYADLITRAI ESSPDKRLTL
V s
SQIYEWMVRC VPYFKDKGDS NSSAGWKNSI RHNLSLHSRF MRVQNEGTGK SSWWIINPDG 240
GKSGKAPRRR AVSMDNSNKY TKSRGRAAKK KAALQTAPES ADDSPSQLSK WPGSPTSRSS
G N
DELDAWTDFR SRTNSNASTV SGRLSPIMAS TELDEVQDDD APLSPMLYSS SASLSPSVSK 360
C T I
PCTVELPRLT DMAGTMNLND GLTENLMDDL LDNITLPPSQ PSPTGGLMQR SSSFPYTTKG
FS > T L
SGLGSPTSSF NSTVFGPSSL NSLRQSPMQT IQENKPATFS SMSHYGNQTL QDLLTSDSLS 480 S
HSDVMMTQSD PLMSQASTAV SAQNSRRNVM LRNDPMMSFA AQPNQGSLVN QNLLHHQHQT
c s
QGALGGSRAL SNSVSNMGLS ESSSLGSAKH QQQSPVSQSM QTLSDSLSGS SLYSTSANLP 600
VMGHEKFPSD LDLDMFNGSL ECDMESIIRS ELMDADGLDF NFDSLISTQN WGLNVGNFT
FS >
GAKQASSQSW VPG
[0088] Exemplary confirmed or suspected Foxo3 SNPs include, without limitation, the following SEQ ID NOS: 2-19, listed in Table 1.
Table 1: Foxo Single Nucleotide Polymorphisms
SNP Ref. Nucleotide Sequence [SNP] Change rsl81686373
(SEQ ID NO: 2) ATGATCCGATGATGTCCTTTGCT [G/T] CCCAGCCTAACCAGGGAAGTTT Ala521Ser rsl48405845
(SEQ ID NO: 3) CCGCTGTGTCTGCCCAGAATTCC [C/T] GCCGGAACGTGATGCTTCGCAA Arg506CyS rsl45756480
(SEQ ID NO: 4) CTAACGCCAGCACAGTCAGTGGC [C/T] GCCTGTCGCCCATCATGGCAAG Arg323CyS rsl45259784
(SEQ ID NO: 5) ATGAAGTCCAGGACGATGAT [A/G] CGCCTCTCTCGCCCATGCT Ala341Thr rsl41893794
(SEQ ID NO: 6) ATAGCAACAAGTATACCAAG [A/G] GCCGTGGCCGCGCAGCCAA Ser263Gly rsl41876866
(SEQ ID NO: 7) GCAGCGGAGCTCTAGCTTCC [C/T] GTATACCACCAAGGGCTCG Pro415Leu rsl40968061
(SEQ ID NO: 8) CAGCCCCCGAATCAGCTGAC [A/G] ACAGTCCCTCCCAGCTCTC Asp283Asn rsl38742093
(SEQ ID NO: 9) ACTCATGCAGCGGAGCTCTA [C/G] CTTCCCGTATACCACCAAG Ser413Thr rsl l l556510
(SEQ ID NO: 10) GCCACCGCCGCAGCCGGGGG [C/T] GGCTGGGGGCTCCGGGCAG Alal40Val rs79884776
(SEQ ID NO: 11) TGCTCCTTGAGGACTCGGCC [C/T ] GGGTGCTGGCACCCGGAGG Arg99Trp rs34600091
(SEQ ID NO: 12) GTCATGGGCCATGAGAAGTT [-/C] CCCCAGCGACTTGGACCTG Phe607->FS rs34488332
(SEQ ID NO: 13) CCACCAAGGGCTCGGGCCTG [A/G] GCTCCCCAACCAGCTCCTT Gly424Ser Table 1: Foxo Single Nucleotide Polymorphisms
SNP Ref. Nucleotide Sequence [SNP] Change rs34223850
(SEQ ID NO: 14) GCCGTGCACGGTGGAACTGC [ C / T ] ACGGCTGACTGATATGGCA Pro367Leu rs34133353 Asp380/Gly381 (SEQ ID NO: GCACCATGAATCTGAATGAT [ - /G ] GGGCTGACTGAAAACCTCA
15) ->FS rsl3204476
(SEQ ID NO: 16) GGGGGCTCCGGGCAGCCGAG [ G/ T ] AAATGTTCGTCGCGGCGGA Argl48Ser rsl l551770
(SEQ ID NO: 17) GCTCTACAGCAGCTCAGCCA [ G/ T ] CCTGTCACCTTCAGTAAGC Ser353Ile
In addition to these SNPs that affect the sequence of Foxo3, there are over 500 NCBI SNPs in Foxo3, many of which are within the untranscribed regions or within the intron but do not result in protein modifications (allelic variants). These SNPs may affect the expression levels of the encoded Foxo3 or the conditions under which expression occurs.
[0089] Detecting the presence or absence of the one or more mutations in the one or more above identified genes can be carried out using methods that are well known in the art. Common genotyping methods include, but are not limited to, restriction fragment length polymorphism assays, amplification based assays such as molecular beacon assays, nucleic acid arrays, allele-specific PCR; primer extension assays, such as allele-specific primer extension (e.g., Illumina® Infinium® assay), arrayed primer extension (see Krjutskov et al, "Development of a Single Tube 640-ples Genotyping Method for Detection of Nucleic Acid Variations on Microarrays," Nucleic Acids Res. 36(12):e75 (2008), which is hereby incorporated by reference in its entirety), homogeneous primer extension assays, primer extension with detection by mass spectrometry (e.g. , Sequenom® iPLEX SNP genotyping assay) (see Zheng et al, "Cumulative Association of Five Genetic Variants with Prostate Cancer," N. Eng. J. Med. 358(9):910-919 (2008), which is hereby incorporated by reference in its entirety), multiplex primer extension sorted on genetic arrays; flap endonuclease assays (e.g., the Invader® assay) (see Olivier M., "The Invader Assay for SNP Genotyping," Mutat. Res. 573 (1-2): 103-10 (2005), which is hereby incorporated by reference in its entirety); 5' nuclease assays, such as the TaqMan® assay (see U.S. Patent Nos. 5,210,015 to Gelfand et al. and 5,538,848 to Livak et al, which are hereby incorporated by reference in their entirety); oligonucleotide ligation assays, such as ligation with rolling circle amplification, homogeneous ligation, OLA (see U.S. Patent No. 4,988,617 to Landgren et al, which is hereby incorporated by reference in its entirety), multiplex ligation reactions followed by PCR, wherein zipcodes are incorporated into ligation reaction probes, and amplified PCR products are determined by electrophoretic or universal zipcode array readout (see U.S. Patent Nos. 7,429,453 and 7,312,039 to Barany et al, which are hereby incorporated by reference in their entirety). Such methods may be used in combination with detection mechanisms such as, for example, luminescence or chemiluminescence detection, fluorescence detection, time- resolved fluorescence detection, fluorescence resonance energy transfer, fluorescence polarization, mass spectrometry, and electrical detection.
[0090] Alternatively, the presence or absence of the one or more mutations as shown supra can be detected by direct sequencing of the genes, or preferably identified gene regions, from the patient sample. High-throughput next generation sequencing
("NGS") can be used to identify genetic variation. Various NGS sequencing chemistries are available and suitable for use in carrying out the claimed invention, including pyrosequencing (Roche® 454), sequencing by reversible dye terminators (Illumina® HiSeq, Genome Analyzer and MiSeq systems), sequencing by sequential ligation of oligonucleotide probes (Life Technologies® SOLiD), and hydrogen ion semiconductor sequencing (Life Technologies®, Ion Torrent™), extension-based (Helicos Bioscience Helioscope™ Sequencer). Alternatively, classic sequencing methods, such as the Sanger chain termination method or Maxam-Gilbert sequencing, which are well known to those of skill in the art, can be used to carry out the methods of the present invention.
[0091] It is to be appreciated that certain aspects, modes, embodiments, variations and features of the present invention are described in various levels of detail in order to provide a substantial understanding of the present technology. The definitions of certain terms as used in this specification are also provided. Unless defined otherwise, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
EXAMPLES
[0092] The following examples are provided to illustrate embodiments of the present invention but are by no means intended to limit its scope.
Example 1— Foxo3 Expression in the Mouse Cochlea, and Analysis of Hearing
Function in the Foxo3-KO
[0093] The expression of Foxo3 and its closely related family member Foxol was characterized in the mouse cochlea during postnatal development, using qPCR and immunofluorescence. Expression was assessed before, during, and after the onset of hearing, which occurs between P10 and P18 (Figures 1A-1M). In whole cochlear extracts, derived from cochlear duct tissue and spiral ganglion, it was found that transcripts for both genes are present at each stage, but that Foxo3 levels were at least ten- fold higher than Foxol (Figure 1A). At P7, prior to hearing onset, both proteins can be detected in outer hair cells (Figures IE, IK). In the young adult cochlea (P60), anti- Foxo3 staining is prominent in both hair cells and SGN's (Figures IF, 1G) whereas Foxol protein is much fainter (Figures 1L, 1M, matched exposures). Note that Foxo3 immunoreactivity is observed in the nuclei of SGN's (Figure 1G), which is consistent with a role in promoting cell survival. Based on this data, the function of Foxo3 in the mouse cochlea was selected for further investigation.
[0094] To understand what function Foxo3 might play in the mouse cochlea, hair cell differentiation and hearing in Foxo3 -KO mice were examined. Mice in which the second exon of Foxo3 was deleted were bred and used (Castrillon et al, "Suppression of Ovarian Follicle Activation in Mice by the Transcription Factor Foxo3a," Science
301 :215-8 (2003), which is hereby incorporated by reference in its entirety). Originally, the mice were created on 129Sv/J and were then crossed for three generations to FVB/n. They have been maintained on this background.
[0095] Foxo3-KO mice are viable, but adults typically die around PI 80 from B cell hyperproliferation (Paik et al, "FoxOs are Lineage-Restricted Redundant Tumor Suppressors and Regulate Endothelial Cell Homeostasis," Cell 128(2):309-23 (2007), which is hereby incorporated by reference in its entirety). Foxo3-KO mice have similar numbers of outer and inner hair cells compared to wild-type littermates at birth, without any obvious gaps or duplications (see Figures 6A-6E). Moreover, at P60, Foxo3-KO mice have similar pure tone hearing thresholds to their wild-type littermates (Figure 2A, black lines). To assess OHC function, the volume of evoked otoacoustic emissions (DPOAE) to pure tones at 65 and 55 dB were measured. At P60, their DPOAE levels were similar to their wild-type littermates (Figure 2B, black lines). Hearing development appears unaffected in young Foxo3-KO adults.
[0096] At PI 20, Foxo3-KO littermates have mild high-frequency hearing loss compared to wild-type (Figure 2A, red lines). The Foxo3-KO allele is maintained on FVB/n (Taketo et al, "FVB/N: An Inbred Mouse Strain Preferable for Transgenic Analyses," PNAS 88(6):2065-9 (1991), which is hereby incorporated by reference in its entirety), a strain derived from Swiss Webster without early-onset hearing loss (Johnson et al, "A Major Gene Affecting Age-Related Hearing Loss is Common to At Least Ten Inbred Strains of Mice," Genomics 70: 171-80 (2000), which is hereby incorporated by reference in its entirety). Foxo3-KO mice have an increased threshold of 13 dB at 24 kHz (n=l 1, p=0.03, two-tailed student's t-test) and 18 dB at 32 kHz (n=l 1, p=0.01, two-tailed student's t-test). Their DPOAE levels, however, are unchanged at these frequencies, indicating that basal outer hair cell function is unaltered in the older Foxo3-KO. In agreement, immunostaining in the basal cochleae of PI 20 Foxo3-KOs reveals the normal complement of outer hair cells (Figure 2C). From these results, it is reasonable to conclude that this mild hearing loss in Foxo3-KO is due to a mechanism other than premature outer hair cell death.
[0097] One likely explanation for the hearing loss is that SGN's are affected. To test whether SGN survival is dependent on Foxo3 function, P-tubulin+ neurons in the basal turns of Foxo3-KO and wild-type cochlear sections from P120 mice were counted. Foxo3-KO mice have 23% fewer neurons, relative to ganglion size, compared to wild- type animals (Figures 3A-3B).
[0098] Further experiments will determine the stage at which this loss occurs, and whether the surviving neurons show evidence of oxidative stress. First, neuronal development will be documented to find out the age when Foxo3-KO SGN numbers differ from those in wild-type animals. Four to five Foxo3-KO and wild-type cochleae from P2, P14, P60, and P120 mice will be cryosectioned. Anti-acetylated β-tubulin (Figures 3A-3B) will be used to identify neurons. Using standard stereological methods, neurons will be counted on cryosections of both genotypes in both basal and mid-turns. Neuronal density and the size of the ganglion will be calculated, and significant differences will be determined with one-way ANOVA and adjusted two-tailed Student's t-tests. To characterize the morphology of cochlear synapses, TEM on semithin resin sections of basal turn SGN-hair cell synapses will be used in PI 20 Foxo3-KO and wild- type animals to look for swollen dendritic terminals (Hakuba et al, "Exacerbation of Noise-Induced Hearing Loss in Mice Lacking the Glutamate Transporter GLAST," J. Neurosci. 20(23):8750-3 (2000), which is hereby incorporated by reference in its entirety). Presynaptic structures in inner hair cells will also be quantified with an antibody to Ribeye/Ctbp2 in whole mount preparations of PI 20 basal cochleae of both genotypes (Kujawa et al, "Adding Insult to Injury: Cochlear Nerve Degeneration after 'Temporary' Noise-Induced Hearing Loss," J. Neurosci. 29: 14077-85 (2009), which is hereby incorporated by reference in its entirety). Finally, signs of oxidative stress in surviving neurons will be examined at PI 20 with qPCR, westerns, and immunostaining. Focus will be on expression of calcium binding proteins, such as synaptophysin, calbindin, Ncsl and Pcma3, as these proteins are up-regulated in stressed SGN's (Lang et al, "Nuclear Factor KappaB Deficiency is Associated With Auditory Nerve Degeneration and Increased Noise-Induced Hearing Loss," J. Neurosci. 26:3541-50 (2006), which is hereby incorporated by reference in its entirety). The mRNA and protein levels of oxidative stress proteins such as Hmoxl and Slc2a will also be measured (Mazurek et al, "Expression of Genes Implicated in Oxidative Stress in the Cochlea of Newborn Rats," Hear. Res. 277(l-2):54-60 (201 1), which is hereby incorporated by reference in its entirety). Four to six PI 20 animals of each genotype will be used for each of these experiments. Note that none of these oxidative stress proteins chosen for analysis are Foxo3 -dependent.
[0099] The IHC afferent synapse will also be examined for evidence of excitotoxicity, including ultrastructural analyses of synaptic morphology and counts of ribbon synapses in wild-type and Foxo3-KO basal inner hair cells. Based on the results presented in this Example, it is believed that Foxo3-KO SGN's will be more sensitive to noise damage compared to wild-type SGN's. It has been found that a two hour treatment of 100 dB sound pressure is sufficient to induce excitotoxic stress in normal SGN's
(Kujawa et al, "Adding Insult to Injury: Cochlear Nerve Degeneration after 'Temporary' Noise-Induced Hearing Loss," J. Neurosci. 29:14077-85 (2009), which is hereby incorporated by reference in its entirety). Western blots and immunostaining will first be used to determine if this level of noise causes Foxo3 to localize to the nucleus of wild- type SGN's. Secondly, noise levels that are below the threshold that induce stress in wild-type mice will be used to determine if they damage Foxo3-KO SGNs. A dose response will be performed for noise on P60 Foxo3-KO and wild-type mice, testing 30 minutes of white noise, at sound pressure levels of 90, 95, and 100 dB (5 animals each level and genotype). Hearing thresholds and DPOAE's will be measured at 1 day and 14 days post treatment. Swollen dendritic terminals will be stained for in whole mount with anti-neurofilament and anti-Ribeye, and imaged with confocal microscopy, 1 day after noise treatment, as in Kujawa et al, "Adding Insult to Injury: Cochlear Nerve
Degeneration after 'Temporary' Noise-Induced Hearing Loss," J. Neurosci. 29: 14077-85 (2009), which is hereby incorporated by reference in its entirety. The percentage of damaged terminals in each condition for both Foxo3-KO and wild -type animals will be determined. Choosing the sound pressure treatment that demonstrates the greatest differences, the assays described herein will be repeated, to assess oxidative stress in P60 Foxo3-KO SGN's 1 day post noise. Neuronal density will also be measured at 60 days post-treatment, to assess neuronal death (8 animals per genotype plus controls).
[0100] It is expected that excitotoxicity is the underlying mechanism driving neuronal loss in the untreated Foxo3-KO. It is predicted, therefore, that neuronal loss will be observed after the onset of hearing, and that synapses in P 120 Foxo3-KOs will have swollen dendrites, visible in TEM. It is further predicted that pre-synaptic terminals labeled by Ribeye will be reduced in the P120 Foxo3-KO. Finally, it is predicted that oxidative stress proteins will be up-regulated in Foxo3-KO SGN's. Each of these findings would be consistent with the interpretation that excitotoxic oxidative stress kills SGN's in the absence of Foxo3 function. It is also expected that levels of noise readily tolerated by SGN's in normal animals will prove toxic to Foxo3-KO animals. It is predicted that Foxo3-KO mice treated with these sub-damaging noise levels will exhibit signs of excitotoxic stress, including reduced pre-synaptic inner hair cell structures, swollen spiral ganglion dendrites, and up-regulated oxidative stress proteins. It is also predicted that Foxo3-KO animals will have reduced neuronal numbers 60 days after treatment.
Example 2— Hearing and Hair Cell Survival After Oxidative Stress in the Foxo3- KO Mouse
[0101] To know if Foxo3 mitigates oxidative stress in the cochlea, wild-type and Foxo3-KO mice were challenged with a moderate amount of noise. An asymmetric noise exposure box was built to provide a relatively uniform white noise field spanning the octave range of 8 to 16 kHz with a sound pressure of 105 dB. The hearing thresholds were measured with ABR of 6 wild-type and 6 Foxo3-KO mice at P60 one day before and one day after noise treatment. Figures 4A and 4B show screen captures of ABR data from a wild-type mouse. This noise treatment causes a temporary loss of hearing.
Fourteen days after treatment, wild-type mice have partially recovered their hearing thresholds (Figure 4C, red circles). In contrast, Foxo3-KO mice (Figure 4C, red X's) have significantly worse hearing outcomes. This finding provides direct evidence that Foxo3 plays a role in hearing recovery after damage. [0102] In the basal region of wild-type (Figure 4D) and Foxo3-KO cochlea
(Figure 4E), outer hair cell losses are evident. This finding is consistent with at least part of the mechanism of Foxo3 damage sensitivity being due to hair cell apoptosis.
Experiments in progress will also measure DPOAE levels in noise-treated Foxo3-KO and wild-type mice. Initial experiments of the present invention to explore hair cell losses used only DAPI, and hair cells are identified by their relative positions.
[0103] This experimental work will be repeated using 20 FVB/n strain Foxo3-KO mice and 20 wild-type littermates, which will be tested at P60. 8-10 mice per genotype will be reserved for controls. At P60, the hearing thresholds of both genotypes are identical. Ten to twelve P60 mice of each genotype will be exposed for one hour with 105 dB white noise, spanning the octave range between 8 and 16 kHz. Unlike the preceding experimental work where DAPI was used alone, these tests will use an antibody to the hair cell specific marker Pou4f3. Pou4f3 is readily detectable after noise treatment, providing unambiguous hair cell quantification. Together, Pou4f3 staining and DAPI will unambiguously identify hair cell nuclei (see Figures 8A-8B). Microdissected pieces of stained cochleae will be imaged with confocal microscopy. For quantification, 100-200 μιη long rectangles will be overlaid on organ of Corti images using Photoshop, and hair cells will be counted. The Massachusettes Eye and Ear ImageJ plug-in will be used to convert these counts to a tonotopic map (Massachussetts Eye and Ear Infirmary, EPL Histology Resources, Boston (2012), which is hereby incorporated by reference in its entirety). One-way ANOVA and two-tailed Student's t-tests, adjusted for multiple comparisons, will be used to determine statistical significance.
[0104] mR A levels of oxidative stress response genes reported to be regulated by Foxo3 in the cochlea after a mild noise treatment are shown in Figure 7. One hour of noise spanning the octave range of 8 to 16 kHz, with a sound pressure level of 105 dB, causes temporary hearing loss in most mice including the Foxo3-KO's strain FVB/n. The hair cell specific genes parvalbumin and Pou4f3 are shown for comparison, as are Foxo3 and Foxo 1. This work will be extended by measuring Foxo3 mRNA, Foxo3 protein levels and phosphorylation state in cochlear outer hair cells 1, 2, and 3 days after noise treatment, using qPCR and Western blots. 4-5 separate biological replicates will be tested. The ganglion will be removed from these preparations to confine the analysis to the organ of Corti. NF-κΒ p50 will be used as a positive control, as its up-regulation after noise has been reported previously (Nagashima et al, "Acoustic Overstimulation Facilitates the Expression of Glutamate-Cysteine Ligase Catalytic Subunit Probably Through Enhanced DNA Binding of Activator Protein- 1 and/or NF-kappaB in the Murine Cochlea," Neurochem. Int. 51(2-4):209-15 (2007), which is hereby incorporated by reference in its entirety). Foxo3 protein in the organ of Corti will be immunolocalized in whole mount after noise treatment to assess its subcellular localization. Activated Foxo3 will be in the nucleus. Reported Foxo3 target mRNAs will be screened for. Levels of Pinkl, Cited2, Sod2, and Gabarapll, four oxidative stress response genes reported regulated by Foxo3, also will be measured (Sengupta et al, "FoxO Transcription Factors Promote Autophagy in Cardiomyocytes," J. Biol. Chem. 284(41):28319-31 (2009); Mei et al., "FOX03a-Dependent Regulation of Pinkl (Park6) Mediates Survival Signaling in
Response to Cytokine Deprivation," Proc. Natl. Acad. Sci. U.S.A. 106(13):5153-8 (2009); Bakker et al., "Differential Regulation of Foxo3a Target Genes in Erythropoiesis," Mol. Cell Biol. 27(10):3839-54 (2007); Olmos et al, "Mutual Dependence of Foxo3a and PGC-lalpha in the Induction of Oxidative Stress Genes," J. Biol. Chem. 284(21): 14476- 84 (2009), all of which are hereby incorporated by reference in their entirety). Levels of Fbxo32, TnfsflO, FasL, Cflar/Flip, Bbc3/Puma, Pmaipl/Noxa, and Bcl2111/Bim, all apoptosis-related genes reported regulated by Foxo3, also will be measured (Modur et al, "FOXO Proteins Regulate Tumor Necrosis Factor-Related Apoptosis Inducing Ligand Expression. Implications for PTEN Mutation in Prostate Cancer," J. Biol. Chem.
277(49):47928-37 (2002); Sandri et al, "Foxo Transcription Factors Induce the Atrophy- Related Ubiquitin Ligase Atrogin-1 and Cause Skeletal Muscle Atrophy," Cell
117(3):399-412 (2004); Suhara et al, "Suppression of Akt Signaling Induces Fas Ligand Expression: Involvement of Caspase and Jun Kinase Activation in Akt-Mediated Fas Ligand Regulation," Mol. Cell Biol. 22(2):680-91 (2002); Skurk et al, "The Akt- Regulated Forkhead Transcription Factor FOX03a Controls Endothelial Cell Viability Through Modulation of the Caspase-8 Inhibitor FLIP," J. Biol. Chem. 279(2): 1513-25 (2004); You et al, "FOX03a-Dependent Regulation of Puma in Response to
Cytokine/Growth Factor Withdrawal," J. Exp. Med. 203(7): 1657-63 (2006); Obexer et al, "FKHRL1 -Mediated Expression of Noxa and Bim Induces Apoptosis Via the
Mitochondria in Neuroblastoma Cells," Cell Death Differ. 14(3):534-47 (2007), all of which are hereby incorporated by reference in their entirety).
[0105] It is predicted that outer hair cells will have greater levels of nuclear Foxo3 and lower levels of p-Foxo3 1-2 days after noise, in comparison with controls. It is further predicted that mRNA for down-stream targets of Foxo3 that mitigate oxidative stress, including Pinkl, Cited2, Sod2, and Gabarapll, will be up-regulated 1 -2 days after noise. These outcomes will be interpreted as evidence that the mechanical damage to outer hair cells resulting from acoustic over-exposure promotes Foxo3 activation and up- regulation of oxidative stress reduction enzymes to repair or mitigate the cellular injury.
Example 3— Affect of Foxo3-KO on Cdh23-mediated Age Related Hearing Loss and Noise Susceptibility
[0106] To further characterize the role of Foxo3 in the stress response of hair cells, the Foxo3-KO allele was combined with a presbycusis mutation, the Cdh23753A point mutation (Noben-Trauth et al, "Association of Cadherin 23 With Polygenic Inheritance and Genetic Modification of Sensorineural Hearing Loss," Na£. Genet. 35:21- 3 (2003), which is hereby incorporated by reference in its entirety). Cdh23 is a crucial tip link component (Alagramam et al, "Mutations in Protocadherin 15 and Cadherin 23 Affect Tip Links and Mechanotransduction in Mammalian Sensory Hair Cells," PLoS One 6(4):el9183 (201 1), which is hereby incorporated by reference in its entirety), and mutations in Cdh23 affect hair bundle morphology and mechanotransduction (Furness et al, "The Dimensions and Structural Attachments of Tip Links in Mammalian Cochlear Hair Cells and the Effects of Exposure to Different Levels of Extracellular Calcium," Neuroscience 154(1): 10-21 (2008), which is hereby incorporated by reference in its entirety). This point mutation is responsible for the age related hearing loss and noise susceptibility observed in many mouse lines, including Balb/c (Johnson et al, "A Major Gene Affecting Age-Related Hearing Loss is Common to At Least Ten Inbred Strains of Mice," Genomics 70: 171-80 (2000), which is hereby incorporated by reference in its entirety).
[0107] Because Cdh23 and Foxo3 are both on chromosome 10, the Foxo3-KO line was bred for three generations to Balb/c to get both mutations on the same chromosome. The data presented in Figures 5A-5E shows results after 3 successive generations. This cross-over event was verified by sequencing the seventh exon of Cdh23 in Foxo3 heterozygotes (Figures 5A, 5B).
[0108] Hearing was measured and hair cell survival examined in these Balb/C-
(Ν3) Foxo3-KO and wild-type mice. The Foxo3-KO mice have worse hearing thresholds than their wild-type littermates (Figure 5C). Inspection of outer hair cells in the midturn region of the wholemount cochlea reveals somewhat more gaps than a comparable stretch of wild -type cochlea (Figures 5D, 5E).
[0109] Experiments in progress will further characterize outer hair cell function and survival in this combination mutant, once they are congenic on the Balb/C line. 10- 12 6th generation Balb/c Foxo3-KO and 10-12 wild-type animals will be tested at P30 and P60, prior to the age when the Cdh23735A mutation alone causes severe hearing loss. Histological analysis will be performed at both times and hair cell survival in whole mounts stained with Pou4f3 will be quantified. Example 4— Hair Cell Survival After Ototoxin-induced Damage in the Foxo3-KO
Mouse
[0110] Cisplatin kills cells by damaging DNA integrity through covalent crosslinking (Frische et al, "Induction of Nuclear Accumulation of the Tumor-Suppressor Protein p53 by DNA-Damaging Agents," Oncogene 8:307-18 (1993), which is hereby incorporated by reference in its entirety). This process activates the DNA damage response, including nucleotide excision, but differs from oxidative stress (reviewed in Lagerwerf et al, "DNA Damage Response and Transcription," DNA Repair (Amst) 10(7):743-50 (2011), which is hereby incorporated by reference in its entirety).
[0111] P2 mouse cochleae were analyzed for Foxo3 protein expression (Figures 6A, 6B) and it was found that cochlear hair cells were positive for Foxo3. The effects of cisplatin on cultured Foxo3-KO and wild-type basal cochleae at P2 were then tested. A concentration of cisplatin that preliminary experiments suggested would kill about half of the wild-type outer hair cells was selected. It was reasoned that this would best determine if Foxo3 protected outer hair cells from DNA damage. 100 μΜ cisplatin kills 54.1% ± 9.8% of wild-type basal outer hair cells after 24 hours of culture (n=7). It kills 74.0% ± 12.0% of Foxo3-KO basal outer hair cells during the same period (n=6), which is not significantly different (p=0.19). Hair cells, marked by anti-parvalbumin, appear normal in the Foxo3-KO (compare Figures 6C, 6D). Similar results were seen for the middle turn of outer hair cells (Figure 6E). These results demonstrate that the sensitivity observed to oxidative stress caused by loss of Foxo3 function is not due to a general predisposition towards OHC apoptosis.
[0112] The results presented in Figures 6A-6E will be extended into a dose response comprised of 10, 30, 100 and 300 μΜ cisplatin, using 6-8 cochleae per genotype and per dose, and it will be confirmed that cisplatin-induced apoptosis is not potentiated by Foxo3 loss of function. A dose response will also be performed in vitro for gentamicin on wild-type and Foxo3-KO neonatal cochlear cultures. 5, 10, 30, 50 μΜ gentamicin will be tested, using 5-8 cochleae per genotype and condition. Previous trials indicated that 100 μΜ gentamicin kills 98% of P2 outer hair cells in both wild-type and Foxo3-KO cochlear explants. Thus, lower concentrations are indicated. Note that the Foxo-KO mouse does not have the neomycin resistance gene that confers resistance to antibiotic damage (Castrillon et al, "Suppression of Ovarian Follicle Activation in Mice by the Transcription Factor Foxo3 a," Science 301 :215-8 (2003), which is hereby incorporated by reference in its entirety). For all in vitro experiments, cultures will be fixed 24 hours after ototoxin addition, stained with anti-parvalbumin antibody, imaged, and quantified as in Figures 5A-5E. 100-200 μιη long rectangles will be overlaid on organ of Corti images using Photoshop, and hair cells in the rectangles are counted. Oneway ANOVA and two-tailed Student's t-tests, adjusted for multiple comparisons, will be used to determine statistical significance.
[0113] It is predicted that Foxo3-KO animals will have fewer surviving hair cells when exposed to gentamicin, but not during cisplatin toxicity. These outcomes are consistent with the interpretation that Foxo3 reduces oxidative stress in hair cells, promoting their survival and function.
Example 5— Generation of Conditional FOX03-KO Mice
[0114] It will be tested whether Foxo3's protective role for sensory hair cell survival after noise damage is cell-intrinsic by generating conditional knockouts that ablate Foxo3 in different cochlear cells. The floxed-Foxo3 line will be bred, which are already in the lab, to different established recombinant mouse strains. First, Foxo3 will be ablated throughout the cochlea using Foxgl-Cre recombinant mice. Foxgl is expressed at E8.5 throughout the otic placode, and this line is commonly used to achieve cochlea-specific recombination (Hebert et al, "Targeting of Cre to the Foxgl (BF-1) Locus Mediates LoxP Recombination in the Telencephalon and Other Developing Head Structures," Dev. Biol. 222(2):296-306 (2000), which is hereby incorporated by reference in its entirety). Second, Foxo3 will be ablated in hair cells but not neurons or other cochlear cells, using the Gfil-Cre mouse (Yang et al., "Gfil-Cre Knock-In Mouse Line: A Tool for Inner Ear Hair Cell-Specific Gene Deletion," Genesis 48(6):400-6 (2010), which is hereby incorporated by reference in its entirety). Third, the mechanism of hearing loss in the aging Foxo3-KO will be better resolved by testing whether Foxo3 is specifically required in SGN's. The Ngnl-CreER mouse line will be used: Ngnl is expressed only otic neural precursors at E9.5 (Raft et al, "Cross-Regulation of Ngnl and Mathl Coordinates the Production of Neurons and Sensory Hair Cells During Inner Ear Development," Development 134(24):4405-15 (2007), which is hereby incorporated by reference in its entirety). If neurons are lost through excitotoxicity because they require intrinsic Foxo3 activity, then the spiral ganglion-specific knockout will phenocopy the PI 20 untreated Foxo3-KO. If, instead, Foxo3 acts in another cell type, then no loss of function will be observed.
[0115] There are both Foxgl-Cre mice and the conditional floxed-Foxo3 mice in the laboratory used for the present invention (Paik et al, "FoxOs are Lineage-Restricted Redundant Tumor Suppressors and Regulate Endothelial Cell Homeostasis," Cell 128(2):309-23 (2007), which is hereby incorporated by reference in its entirety). Ngnl - CreER mice will be obtained from Jackson Labs. Gfil-Cre mice are the gift of Professor Lin Gan of the Flaum Eye Institute of URMC (Yang et al, "Gfi 1 -Cre Knock-In Mouse Line: A Tool for Inner Ear Hair Cell-Specific Gene Deletion," Genesis 48(6):400-6 (2010), which is hereby incorporated by reference in its entirety). Each of the Cre lines to the Foxo3-KO will be bred, and then the floxed-Foxo3, to obtain (Foxo3KO/flox X Cre) progeny (Figure 9). All three Cre lines are on B6. It will be verified that the mice used in the experiments described do not have the Cdh23735A hearing loss susceptibility allele by sequencing (see Figures 5A-5E). The Cdh23735A allele is on the wild-type (+) chromosome. For progeny carrying the Ngnl-CreER transgene, expression will be induced by injecting dams carrying (Foxo3KO/flox X Ngnl-CreER) progeny with tamoxifen at E9.5, similar to work done in (Raft et al, "Cross-Regulation of Ngnl and Mathl Coordinates the Production of Neurons and Sensory Hair Cells During Inner Ear Development," Development 134(24):4405-15 (2007), which is hereby incorporated by reference in its entirety). These mice may need to be delivered by C-section, as prenatal tamoxifen exposure can sometimes result in lethality during birth. Since Foxo3-KO mice survive to PI 50, no other lethality issues are anticipated with the conditional knockouts.
[0116] These experiments will use the Foxgl -Cre crosses and the Gfil-Cre crosses; for brevity in description, they will be collectively called Foxo3-CKO.
Approximately 20 Foxo3-CKO mice and 20 Cre-negative littermates will be tested for hearing thresholds and DPOAE levels at P60, when their hearing thresholds should be identical. 10-12 mice of each genotype will be exposed one day later to 105 dB of 8-16 kHz white noise for one hour. Temporary threshold shifts will be tested one day later, and differences in permanent threshold shifts will be determined 13 days after that.
Tissue will be collected for histological processing, and hair cells in whole mounts will be counted. Pou4f3 staining and DAPI will be used to unambiguously identify hair cell nuclei (Figures 8A-8B). Noise-treated and untreated Foxo3-CKO mice will be compared to noise-treated and untreated Cre-negative littermates. Planned conditional knockout combinations are shown infra, in Table 2.
Table 2: Planned mouse conditional knockout combinations
Mouse line 1 Mouse line 2 Cells without Foxo3 function
Foxo3-KO - All cells
Floxed-Foxo3 Ngnl-CreER Spiral ganglion neurons
Floxed-Foxo3 Foxgl-Cre Entire cochlea
Floxed-Foxo3 Gfil-Cre Sensory hair cells [0117] It is believed that injury to SGN's in the Foxo3-KO is cell-intrinsic. This belief will be tested by assessing hearing thresholds in 20 untreated P120 (Foxo3KO/flox X Ngnl -CreER) mice and comparing to 20 Cre-negative littermates. Levels of neuronal stress will also be assessed in both genotypes at P120, using qPCR, westerns, and immunostaining for markers of oxidative stress, as described in Example 2 above. The density of SGN in the basal turns of their spiral ganglia will be quantified.
[0118] It is predicted that the Foxo3-CKO generated with either the hair cell specific Gfil -Cre or the cochlear-specific Foxgl-Cre will show an identical phenotype to the traditional Foxo3-KO: they will have increased thresholds for hearing 14 days after noise treatment compared to the Cre-negative littermates. It is also predicted that they will have decreased outer hair cell function and fewer outer hair cells after noise treatment than their Cre-negative littermates. If this result occurs with the cochlear- specific Foxgl-Cre CKO's, it will then be concluded that Foxo3 acts within the cochlea to protect outer hair cells from apoptosis due to noise damage. If this result occurs with the Gfil-Cre CKO, it will then be concluded that Foxo3 acts in a cell-intrinsic manner to protect outer hair cells from apoptosis due to noise damage. [0119] It is predicted that animals derived from the Ngnl-CreER cross will have mild hearing loss at P120, similar to Foxo3-KO animals. It is also predicted that they will show signs of neuronal stress, similar to the Foxo3-KO animals. This result would indicate that Foxo3 acts within SGNs to mitigate excitotoxic stress. Example 6— Effect of Paclitaxel/Taxol Intratympanic Injections to Protect the
Cochlea from Noise Damage
[0120] It will be tested whether intratympanic injections of Paclitaxel/taxol are protective against noise damage in 2-3 month old mice. Paclitaxel/taxol is a FDA- approved drug for treating solid tumors in humans. It is normally dissolved in an oily solute called Cremphor prior to intravenous infusion for chemotherapy. Cremphor is necessary in these treatments, because Paclitaxel/taxol has a fairly short half-life in aqueous solution at neutral pH and body temperature (~1 hour). Thus, for the purposes of cancer treatment, an oily carrier is necessary to get sufficient concentrations of drug distributed throughout the body. Here, a rapid, local infusion of Paclitaxel/taxol is proposed as a prophylactic for noise damage, and sterile saline will be used as a carrier instead.
[0121] For treating the cochlea, intratympanic injections are preferred to systemic injections, such as intraperitoneal or intravenous, for several reasons. First, although Paclitaxel/taxol is a FDA-approved, it is only used in life-threatening illnesses such as solid tumors because it has significant side effects. Local application of Paclitaxel/taxol through intratympanic injections will result in a total dosage level that is many orders of magnitude lower than a systemic injection. Second, Paclitaxel/taxol does not cross the blood-brain barrier, and so is not predicted to reach the cochlea from a systemic injection. However, by infusing the middle ear with sterile saline containing Paclitaxel/taxol, it is expected that the drug will pass through the round window and subsequently reach the cochlea sensory region directly. This method has been used to test multiple drugs as well as siRNA effects on the cochlea, with little harm to the animal or to its hearing. Third, intratympanic injections of corticosteroids are used clinically to treat humans with sudden sensorineural hearing loss. It is proposed to use the same method and the same equipment on mice to perform the present experiment.
[0122] To perform an intratympanic injection, an adult mouse will be anesthetized with ketamine-acepromazine cocktail and its tympanic membrane (ear drum) observed under a surgical stereomicroscope. A fine needle (25-30 gauge) will be inserted through the inferior anterior quadrant of the tympanic membrane. A micro-syringe will be used to gently transfer no more than 10 μΐ of drug in sterile injectable saline into the mouse's middle ear. Drugs injected in this fashion cross the round window and enter the cochlear perilymph fluid in 15-30 minutes. The concentration of drugs delivered in this fashion peaks at one hour and is cleared after a day. The mouse is left on its side for twenty minutes to facilitate drug transfer. Afterwards, the other ear of the mouse is injected with the same volume of control saline, and then the mouse is allowed to recover. The mice will be injected one time per day, every other day, up to five times, prior to testing for drug effects.
[0123] Effects of Paclitaxel/taxol on Foxo3 expression will be observed in culture at 4-10 nM. Injections of up to 10 μΐ of 2 μΜ Paclitaxel/taxol are proposed. This is equal to 7 x 10"4mg/kg, which is significantly lower than a typical systemic injection of 20 mg/kg to induce apoptosis in introduced tumor cells. This very low dosage is only expected to be effective because it is placed directly adjacent to the cochlea.
[0124] The noise treatment of Paclitaxel/taxol and control mice will be extended from one hour to up to two hours. As the mouse's hearing is already temporarily disrupted after one hour of noise treatment, the extended exposure will not cause them increased discomfort. However, it will permanently increase their hearing thresholds. This will allow for a determination of whether the intratympanic injection of
Paclitaxel/taxol promotes noise damage recovery. Mice will be exposed to noise within 2 days of completing their Paclitaxel/taxol injections. The hearing of both ears of each mouse with autonomic brainstem response and with distortion product otoacoustic emission detection will be tested as previously described herein. Animals will have their hearing tested one day after noise treatment and then again 14 days after noise treatment. Animals will be sacrificed at two weeks after noise treatment for cochleograms, to assess hair cell survival.
[0125] In summary, the present application illustrates the discovery of the following facts. First, like outer hair cells, SGNs normally express Foxo3. It is both nuclear (possibly functional) and cytoplasmic (not functioning, sequestered). Second, Foxo3-KO mice have mild, high frequency age-related hearing loss compared to control mice. Third, this hearing loss is not associated with outer hair cell death or loss of outer hair cell function. Fourth, the Foxo3-KO mice have fewer SGNs in the regions that detect higher frequencies. Fifth, Foxo3-KO mice and normal littermates treated to noise levels that previously had shown cause a temporary loss of hearing produced very interesting results. Foxo3-KO mice did not recover their hearing after this treatment, but their normal littermates did. Looking at their outer hair cells, it was discovered that Foxo3-KO mice had lost large numbers of outer hair cells compared to controls. These findings provide compelling evidence that Foxo3 activity is required after noise damage for hearing recovery.
[0126] It is believed that the following three biochemical scenarios are rational alternatives for explaining Foxo3 activity. First, Foxo3 activity in outer hair cells may prevent them from dying in response to mechanical stress. While it is known that Foxo3 activity helps prevent outer hair cells from dying after noise, it is possible that Foxo3 is acting in the hair cells and not indirectly. Second, Foxo3 activity may protect SGNs from excitotoxicity. The simplest explanation for the loss of hearing in the Foxo3-KO is that their SGNs are over-stimulated by normal noise levels. This explanation points to the idea that Foxo3 function in SGNs protects them from damage. Third, increasing the amount or duration of Foxo3 activation after noise exposure will decrease the permanent damage it causes.
[0127] Although the invention has been described in detail for the purpose of illustration, it is understood that such detail is solely for that purpose, and variations can be made therein by those skilled in the art without departing from the spirit and scope of the invention which is defined by the following claims.

Claims

WHAT IS CLAIMED:
1. A method of treating a subject to inhibit hearing loss comprising:
administering to a subject exposed to a hearing loss event an effective amount of an agent that upregulates Foxo3 expression or enhances activity of Foxo3.
2. The method according to claim 1, wherein the hear loss event comprises exposure to noise exceeding a decibel threshold per exposure time or exposure to ototoxins or infectious agents.
3. The method according to claim 1, wherein the agent is selected from the group consisting of Paclitaxel/Taxol, Vinblastine, KP372-1, Imatinib, Doxorubicin, wortmannin, LY294002, and Psammaplysene A, or a conjugate comprising one of these agents, or any combination thereof.
4. The method according to claim 3, wherein a conjugate is administered.
5. The method according to claim 4, wherein the conjugate is p97- Paclitaxel or p97-Doxorubicin, or GRN1005 (paclitaxel-Angiopep-2).
6. The method according to claim 1, wherein the agent is present in a pharmaceutical composition comprising a pharmaceutically acceptable carrier or delivery vehicle.
7. The method according to claim 1, wherein said administering is effective to upregulate Foxo3 expression in inner hair cells or spiral ganglion neurons.
8. The method according to claim 1, wherein said administering is carried out systemically.
9. The method according to claim 1, wherein said administering is carried out via transdermal patch.
10. The method according to claim 9, wherein the transdermal patch is applied to the subject's head adjacent the ear.
11. The method according to claim 1, wherein said administering is carried out using a solution or emulsion comprising the agent, which solution or emulsion is introduced into the ear canal or cochlear duct.
12. The method according to claim 1, wherein said administering is carried out using a solution or emulsion comprising the agent, which solution or emulsion is introduced intranasally.
13. The method according to claim 1, wherein said administering is carried out beginning within about 72 hours following the hearing loss event.
14. The method according to claim 1, wherein said administering is repeated.
15. The method according to claim 14, wherein said administering is carried out one or more times daily for more than two days.
16. The method according to claim 15, wherein said administering is carried out until hearing loss is minimized.
17. The method according to claim 15, wherein said administering is carried out for up to about two to about 10 weeks.
18. The method according to claim 1, wherein the subject is not a cancer patient receiving a chemotherapeutic agent.
19. The method according to claim 1 further comprising:
administering an effective amount of one or more antioxidants, steroids, vasoactive agents, agents that reduce insulin resistance, Jnk signal transduction inhibitors, and inhibitors of NOX3.
20. The method according to claim 19, wherein the antioxidant comprises a combination of vitamin E, or a derivative or analog thereof, and salicylate.
21. The method according to claim 19, wherein the antioxidant comprises N- acetylcysteine (NAC), Acetyl-L-Carnitine (ALCAR), glutathione monoethylester, ebselen, D-methionine, or carbamathione.
22. The method according to claim 19, wherein the antioxidant comprises R- N6-Phenylisopropyl adenosine (R-PIA).
23. The method according to claim 19, wherein the antioxidant comprises L- carnitine.
24. The method according to claim 19, wherein the antioxidant comprises a combination of one or more of arginine, ascorbate, folate, glutathione and glutathione prodrugs, alpha-lipoic acid, melatonin, nicotinamide, riboflavin, selenium, taurine, vitamins E, A, B6, B12, D, and zinc.
25. The method according to claim 19, wherein the antioxidant comprises two or more of a glutathione peroxidase mimic, a xanthine oxidase inhibitor, and glutathione or a glutathione precursor.
26. The method according to claim 19, wherein the antioxidant comprises 3,3 '-diindolylmethane and/or its derivatives.
27. The method according to claim 19, wherein the agent that reduces insulin resistance is selected from the group of lipoic acid and their salts, and tetrahydrobiopterin bis lipoate.
28. The method according to claim 19, wherein the steroid is a corticosteroid.
29. The method according to claim 19, wherein the vasoactive agent is magnesium.
30. The method according to claim 6, wherein the composition is suitable for otic administration.
31. The method according to claim 30, wherein the otic composition comprises one or more additives selected from the group of lubricants, antimicrobial agents and/or antibiotics, topical anesthetics, anti-allergic components, preservatives, co- solvents, soothing agents, viscogenic agents, bioadhesive agents, and permeability enhancers.
32. A pharmaceutical composition for otic delivery comprising:
an effective amount of an agent that upregulates Foxo3 expression or enhances activity of Foxo3; and
a pharmaceutically acceptable carrier or delivery vehicle.
33. The pharmaceutical composition according to claim 32, wherein the agent is selected from the group consisting of Paclitaxel/Taxol, Vinblastine, KP372-1, Imatinib, Doxorubicin, wortmannin, LY294002, and Psammaplysene A, or a conjugate comprising one of these agents, or any combination thereof.
34. The pharmaceutical composition according to claim 33, wherein the conjugate is present.
35. The pharmaceutical composition according to claim 34, wherein the conjugate is p97- Paclitaxel or p97-Doxorubicin, or GR 1005 (paclitaxel-Angiopep-2).
36. The pharmaceutical composition according to claim 32 further comprising an effective amount of one or more antioxidants, steroids, vasoactive agents, agents that reduce insulin resistance, Jnk signal transduction inhibitors, or inhibitors of NOX3.
37. The pharmaceutical composition according to claim 36, wherein the antioxidant comprises a combination of vitamin E, or a derivative or analog thereof, and salicylate.
38. The pharmaceutical composition according to claim 36, wherein the antioxidant comprises N-acetylcysteine (NAC), Acetyl-L-Carnitine (ALCAR), glutathione monoethylester, ebselen, D-methionine, or carbamathione.
39. The pharmaceutical composition according to claim 36, wherein the antioxidant comprises R-N6-Phenylisopropyl adenosine (R-PIA).
40. The pharmaceutical composition according to claim 36, wherein the antioxidant comprises L-carnitine.
41. The pharmaceutical composition according to claim 36, wherein the antioxidant comprises a combination of one or more of arginine, ascorbate, folate, glutathione and glutathione prodrugs, alpha-lipoic acid, melatonin, nicotinamide, riboflavin, selenium, taurine, vitamins E, A, B6, B12, D, and zinc.
42. The pharmaceutical composition according to claim 36, wherein the antioxidant comprises two or more of a glutathione peroxidase mimic, a xanthine oxidase inhibitor, and glutathione or a glutathione precursor.
43. The pharmaceutical composition according to claim 36, wherein the antioxidant comprises 3,3 '-diindolylmethane and/or its derivatives.
44. The pharmaceutical composition according to claim 36, wherein the agent that reduces insulin resistance is selected from the group of lipoic acid and their salts, and tetrahydrobiopterin bis lipoate.
45. The pharmaceutical composition according to claim 36, wherein the steroid is a corticosteroid.
46. The pharmaceutical composition according to claim 36, wherein the vasoactive agent is magnesium.
47. The pharmaceutical composition according to claim 32, further comprising one or more additives selected from the group of lubricants, antimicrobial agents and/or antibiotics, topical anesthetics, anti-allergic components, preservatives, co-solvents, soothing agents, viscogenic agents, bioadhesive agents, and permeability enhancers.
48. The pharmaceutical composition according to claim 47, wherein the composition comprises a viscogenic agent and has a viscosity of less than 100,000 cps at 25°C.
49. The pharmaceutical composition according to claim 47, wherein composition comprises a bioadhesive agent.
50. A method of assessing susceptibility to Foxo3 -related hearing loss comprising:
determining whether a subject has a variant Foxo3 gene that has reduced or absent function.
51. The method according to claim 50 wherein said determining comprises: detecting whether said Foxo3 gene has a mutation selected from the group of a truncation, a single nucleotide polymorphism (SNP), a translocation, an insertion, or any other sequence variation that interferes with function of said Foxo3 gene.
PCT/US2013/025644 2012-02-09 2013-02-11 Methods and compositions for treating a subject to inhibit hearing loss WO2013120107A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201261597110P 2012-02-09 2012-02-09
US61/597,110 2012-02-09
US201261603105P 2012-02-24 2012-02-24
US61/603,105 2012-02-24

Publications (1)

Publication Number Publication Date
WO2013120107A1 true WO2013120107A1 (en) 2013-08-15

Family

ID=48948109

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2013/025644 WO2013120107A1 (en) 2012-02-09 2013-02-11 Methods and compositions for treating a subject to inhibit hearing loss

Country Status (1)

Country Link
WO (1) WO2013120107A1 (en)

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8710013B2 (en) 2008-04-18 2014-04-29 Angiochem Inc. Pharmaceutical compositions of paclitaxel, paclitaxel analogs or paclitaxel conjugates and related methods of preparation and use
US8828925B2 (en) 2008-10-15 2014-09-09 Angiochem Inc. Etoposide and doxorubicin conjugates for drug delivery
US8853353B2 (en) 2008-12-17 2014-10-07 Angiochem, Inc. Membrane type-1 matrix metalloprotein inhibitors and uses thereof
US8921314B2 (en) 2008-10-15 2014-12-30 Angiochem, Inc. Conjugates of GLP-1 agonists and uses thereof
US9161988B2 (en) 2009-07-02 2015-10-20 Angiochem Inc. Multimeric peptide conjugates and uses thereof
US9173891B2 (en) 2009-04-20 2015-11-03 Angiochem, Inc. Treatment of ovarian cancer using an anticancer agent conjugated to an angiopep-2 analog
US9221867B2 (en) 2003-01-06 2015-12-29 Angiochem Inc. Method for transporting a compound across the blood-brain barrier
US9365634B2 (en) 2007-05-29 2016-06-14 Angiochem Inc. Aprotinin-like polypeptides for delivering agents conjugated thereto to tissues
US9914754B2 (en) 2008-12-05 2018-03-13 Angiochem Inc. Conjugates of neurotensin or neurotensin analogs and uses thereof
KR20200125163A (en) 2019-04-26 2020-11-04 가톨릭대학교 산학협력단 Pharmaceutical Composition for Treating Ear Disease Comprising Anti-Oxidant Loaded NanoParticle As Active Ingredient
US10980892B2 (en) 2015-06-15 2021-04-20 Angiochem Inc. Methods for the treatment of leptomeningeal carcinomatosis
CN113061574A (en) * 2021-03-17 2021-07-02 中国科学院北京基因组研究所(国家生物信息中心) Application of Vc derivative in promoting red blood cell regeneration and product
WO2022040584A1 (en) * 2020-08-21 2022-02-24 Neuronasal, Inc. Methods of administering glutathione precursors
US11857551B1 (en) 2020-07-10 2024-01-02 Ting Therapeutics Llc Methods for the prevention and treatment of hearing loss

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020119095A1 (en) * 1992-07-10 2002-08-29 Reinhard Gabathuler Chemotherapeutic agents conjugated to p97 and their methods of use in treating neurological tumours
US20070098679A1 (en) * 2002-11-27 2007-05-03 Regents Of The University Of Minnesota Methods and Compositions for Applying Pharmacologic Agents to the Ear
US20090068264A1 (en) * 2005-01-14 2009-03-12 Chronorx Llc Clinical Applications of Tetrahydrobiopterin, Lipoic Acid and Their Salts and Methods of Preparing Tetrahydrobiopterin Bis-Lipoate
WO2009100438A2 (en) * 2008-02-07 2009-08-13 Massachusetts Eye & Ear Infirmary Compounds that enhance atoh-1 expression
US20100022458A1 (en) * 2006-07-25 2010-01-28 Richard Dana Kopke Methods for treating acute acoustic trauma
US20110028460A1 (en) * 2006-03-06 2011-02-03 Fqubed, Inc. Topical formulation
US20110190367A1 (en) * 2008-02-19 2011-08-04 Hubert Hug Novel use of 3,3'-diindolylmethane
US20110280964A1 (en) * 2006-01-19 2011-11-17 The Regents Of The University Of Michigan Composition And Method of Treating Hearing Loss

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020119095A1 (en) * 1992-07-10 2002-08-29 Reinhard Gabathuler Chemotherapeutic agents conjugated to p97 and their methods of use in treating neurological tumours
US20070098679A1 (en) * 2002-11-27 2007-05-03 Regents Of The University Of Minnesota Methods and Compositions for Applying Pharmacologic Agents to the Ear
US20090068264A1 (en) * 2005-01-14 2009-03-12 Chronorx Llc Clinical Applications of Tetrahydrobiopterin, Lipoic Acid and Their Salts and Methods of Preparing Tetrahydrobiopterin Bis-Lipoate
US20110280964A1 (en) * 2006-01-19 2011-11-17 The Regents Of The University Of Michigan Composition And Method of Treating Hearing Loss
US20110028460A1 (en) * 2006-03-06 2011-02-03 Fqubed, Inc. Topical formulation
US20100022458A1 (en) * 2006-07-25 2010-01-28 Richard Dana Kopke Methods for treating acute acoustic trauma
WO2009100438A2 (en) * 2008-02-07 2009-08-13 Massachusetts Eye & Ear Infirmary Compounds that enhance atoh-1 expression
US20110190367A1 (en) * 2008-02-19 2011-08-04 Hubert Hug Novel use of 3,3'-diindolylmethane

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
HO, K ET AL.: "Phosphorylation Of FOX03a On Ser-7 By p38 Promotes Its Nuclear Localization In Response To Doxorubicin.", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 287, 29 November 2011 (2011-11-29), pages 1545 - 1555, XP055078866 *
HU, BH ET AL.: "R-phenylisopropyladenosine Attenuates Noise-Induced Hearing Loss In The Chinchilla.", HEARING RESEARCH., vol. 113, 25 July 1997 (1997-07-25), pages 198 - 206, XP055078869 *
WHITE, P ET AL.: "Presenting The 2011 DRF Grantees.", HEARING HEALTH: A PUBLICATION OF DEAFNESS RESEARCH FOUNDATION., 2011, pages 42 - 50, XP055078864, Retrieved from the Internet <URL:www.hearinghealthmag.com> *

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9221867B2 (en) 2003-01-06 2015-12-29 Angiochem Inc. Method for transporting a compound across the blood-brain barrier
US9365634B2 (en) 2007-05-29 2016-06-14 Angiochem Inc. Aprotinin-like polypeptides for delivering agents conjugated thereto to tissues
US8710013B2 (en) 2008-04-18 2014-04-29 Angiochem Inc. Pharmaceutical compositions of paclitaxel, paclitaxel analogs or paclitaxel conjugates and related methods of preparation and use
US8921314B2 (en) 2008-10-15 2014-12-30 Angiochem, Inc. Conjugates of GLP-1 agonists and uses thereof
US8828925B2 (en) 2008-10-15 2014-09-09 Angiochem Inc. Etoposide and doxorubicin conjugates for drug delivery
US9914754B2 (en) 2008-12-05 2018-03-13 Angiochem Inc. Conjugates of neurotensin or neurotensin analogs and uses thereof
US8853353B2 (en) 2008-12-17 2014-10-07 Angiochem, Inc. Membrane type-1 matrix metalloprotein inhibitors and uses thereof
US9173891B2 (en) 2009-04-20 2015-11-03 Angiochem, Inc. Treatment of ovarian cancer using an anticancer agent conjugated to an angiopep-2 analog
US9161988B2 (en) 2009-07-02 2015-10-20 Angiochem Inc. Multimeric peptide conjugates and uses thereof
US10980892B2 (en) 2015-06-15 2021-04-20 Angiochem Inc. Methods for the treatment of leptomeningeal carcinomatosis
KR20200125163A (en) 2019-04-26 2020-11-04 가톨릭대학교 산학협력단 Pharmaceutical Composition for Treating Ear Disease Comprising Anti-Oxidant Loaded NanoParticle As Active Ingredient
US11857551B1 (en) 2020-07-10 2024-01-02 Ting Therapeutics Llc Methods for the prevention and treatment of hearing loss
WO2022040584A1 (en) * 2020-08-21 2022-02-24 Neuronasal, Inc. Methods of administering glutathione precursors
CN113061574A (en) * 2021-03-17 2021-07-02 中国科学院北京基因组研究所(国家生物信息中心) Application of Vc derivative in promoting red blood cell regeneration and product

Similar Documents

Publication Publication Date Title
WO2013120107A1 (en) Methods and compositions for treating a subject to inhibit hearing loss
ES2952032T3 (en) Administration of nicotinamide mononucleotide in the treatment of dry eye
US20200179313A1 (en) Composition and method for the treatment of neurological diseases and cerebral injury
JP6502863B2 (en) Method of treating colorectal cancer
US10918697B2 (en) Co-activation of mTOR and STAT3 pathways to promote neuronal survival and regeneration
JP2016106120A (en) Thioxanthone-based autophagy inhibitor therapies to treat cancer
US20110244059A1 (en) Inhibiting obesity progression by inhibiting adipocyte differentiation with a pre-adipocyte autophagy inhibitor
US9517238B2 (en) Compositions and methods for treating allergic inflammation through inhibition of NTRK1
TW201728334A (en) Compositions and methods for treating cancer
He et al. Promoting TFEB nuclear localization with curcumin analog C1 attenuates sensory hair cell injury and delays age-related hearing loss in C57BL/6 mice
US11007154B2 (en) Treatment of central nervous tumours
US20200368257A1 (en) Compositions and Methods for the Treatment of Inflammation in Urological Pathology
ES2750125T3 (en) SiRNA and its use in methods and compositions for the treatment and / or prevention of eye conditions
EP4230226A1 (en) Composition for treating retinal or choroidal diseases, containing acta2 inhibitor as active ingredient
US20230390283A1 (en) Uses of chk2 inhibitors
US20230390282A1 (en) Treatment of eye conditions
US20230220395A1 (en) Methods and compositions for treatment of age-related macular degeneration
US11723912B2 (en) Staufen1 agents and associated methods
WO2021263281A9 (en) Methods and compositions for the treatment of covid-19 and associated respiratory distress and multi-organ failure, sepsis, acute respiratory distress syndrome, and cordiovascular diseases
KR20220048954A (en) Pharmaceutical composition for treating retinal or choroidal disease comprising an ACTA2 inhibitor as an active ingredient
WO2022217035A1 (en) Activators of integrated stress response pathway for protection against ferroptosis
WO2023211779A1 (en) Treatment of headache disorders with nk3 modulators
Yu Gene and Protein Expression Patterns in the Rat Inner Ear during Ototoxicity and Otoprotection

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13747287

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13747287

Country of ref document: EP

Kind code of ref document: A1