KR20220048954A - Pharmaceutical composition for treating retinal or choroidal disease comprising an ACTA2 inhibitor as an active ingredient - Google Patents

Abstract

The present invention relates to a composition for treating retinal or choroidal diseases, containing an ACTA2 inhibitor as an active ingredient, and the like. The present inventors have identified that, since an increase in ACTA2 induces a decrease in perivascular cells and induces the proliferation and distribution of smooth muscle cells, the proliferation and distribution of vascular smooth muscle cells are inhibited, the distribution of perivascular cells is increased, and the expansion and leakage of choroid vessels are inhibited, as a result of administration of ACTA2 inhibitors siRNA and miRNA to an animal model having a retinal or choroidal disease. Therefore, an ACTA2 inhibitor is expected to be effectively used in the treatment of retinal or choroidal diseases.

Description

A composition for treating retinal or choroidal disease comprising an ACTA2 inhibitor as an active ingredient {Pharmaceutical composition for treating retinal or choroidal disease comprising an ACTA2 inhibitor as an active ingredient}

The present invention relates to a composition for treating retinal or choroidal diseases, etc. comprising an ACTA2 inhibitor as an active ingredient.

The nervous tissue located in the center of the inner retina of the eye is called the macula, and most of the photoreceptor cells responding to light stimuli are gathered here, and the place where the image of an object is formed is also the center of the macula, so it plays a very important role in vision. Age-related macular degeneration (AMD) is a chronic disease characterized by degeneration of the retinal pigment epithelium and Bruch's membrane and choroidal capillaries of the macula. Anatomically, the sensory nerve retina is located in front of the retinal pigment epithelium and depends on the retinal pigment epithelium for nutrition, support, recycling, and waste disposal. Bruch's membrane is a five-layered structure sandwiched between the choroid and retinal pigment epithelium. The innermost layer is the basement membrane of retinal pigment epithelium, and the outermost layer is the basement membrane of choroidal capillary endothelial cells. That is, age-related macular degeneration is a degenerative disease that occurs in the retinal pigment epithelium, Bruch's membrane, and the choroidal capillary complex.

This disease mainly occurs in the age group over 50 years old, and it is already the main cause of blindness in the population over 60 years old in the West, and it is increasing in Korea as well. Although the exact cause of age-related macular degeneration is not yet known, known risk factors include age (particularly, a steep increase after the age of 75), smoking, the most notable environmental factor, hypertension, obesity, genetic predisposition, and excessive UV rays. exposure, and low blood antioxidant levels.

There are two types of macular degeneration: dry (non-exudative) macular degeneration and wet (exudative) macular degeneration. In dry AMD (nonexudative AMD, nonneovascular AMD), waste products form yellow deposits called drusen under the retina and accumulate. obstacles begin to arise. Although dry macular degeneration does not cause sudden loss of vision, it can progress to wet macular degeneration. Wet macular degeneration (wet AMD, exudative AMD, neovascular AMD) is caused by the growth of new blood vessels in the choroid under the retina. These weak new blood vessels rupture, causing bleeding and exudation, which causes degeneration in the macular area of the retina, resulting in visual impairment. It is known that wet macular degeneration progresses very quickly, causing rapid deterioration of vision within a few weeks and blindness within 2 months to 3 years.

Meanwhile, as known treatments for macular degeneration, photodynamic therapy (PDT) and angiogenesis factor antibody (anti-VEGF) injection are used. Photodynamic therapy selectively irradiates the eye with a special laser that responds only to the photosensitive material when the photosensitive material reaches the new blood vessels of the retina after a certain period of time after injecting the photosensitive material Visudyne through the blood vessel. A method of destroying new blood vessels. However, there are many cases of recurrence even after treatment, so repeated treatment is often required, and repeated treatment can cause damage to the retina itself.

Antibody injection therapy is a method in which an antibody (anti-VEGF) that selectively binds to vascular endothelial growth factor (VEGF), which is important for the creation and progression of angiogenesis, and inhibits the formation and proliferation of angiogenesis, is directly injected into the vitreous (intravitreal). injection). Protein antibody drugs used in antibody injection therapy include Lucentis and Avastin. Lucentis is a drug approved by the FDA for the treatment of wet macular degeneration, and Avastin is a drug approved for cancer diseases for eye diseases. are using However, the protein-antibody injection therapy is expensive, it is impossible to administer eye drops, so it must be directly injected into the eye, and periodic administration is required about once a month, resulting in bleeding, pain, infection, and retinal detachment. There are risks such as

Age-related macular degeneration, diabetic retinopathy, and diabetic choroidopathy are commonly caused by abnormalities in the structure and function of choroidal blood vessels in the eye. Changes in choroidal blood vessel perivascular cells in the state have not been studied so far. Perivascular cells surround endothelial cells and are the most important cells for maintaining the structure and function of blood vessels. Currently, intraocular injection of an anti-vascular endothelial growth factor (VEGF) antibody is currently used as a treatment for both diseases to inhibit angiogenesis and vascular leakage of choroidal vessels, but choroidal vessels, which are important cells for the stability of blood vessels, It is presumed that it will not affect the distribution and function of perivascular cells.

Therefore, in order to maintain the stable structure and function of choroidal vessels, it is important to maintain the normal distribution and function of perivascular cells, and it is necessary to develop new technologies to treat diseases while maintaining the ultra-fine structure and function of these choroidal vessels.

Korean Patent Publication No. 10-2012-0085052

Accordingly, the present inventors confirmed that the ACTA2 inhibitor induces normalization of perivascular cells of choroidal vessels for the treatment of retinal diseases including age-related macular degeneration and diabetic chorioretinopathy, and completed the present invention.

Accordingly, it is an object of the present invention to provide a pharmaceutical composition for preventing or treating retinal or choroidal disease comprising an ACTA2 inhibitor as an active ingredient.

Another object of the present invention is to provide a quasi-drug composition for the prevention or treatment of retinal or choroidal diseases comprising an ACTA2 inhibitor as an active ingredient.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problems, and other problems not mentioned will be clearly understood by those skilled in the art from the following description.

In order to solve the above problems, the present invention provides a pharmaceutical composition for preventing or treating retinal or choroidal disease comprising an ACTA2 inhibitor as an active ingredient.

In one embodiment of the present invention, the inhibitor may be an ACTA2 activity inhibitor or an expression inhibitor, but is not limited thereto.

In another embodiment of the present invention, the activity inhibitor may be at least one selected from the group consisting of a compound that specifically binds to the ACTA2 protein, a peptide, a peptidomimetic, a matrix analog, an aptamer, and an antibody, but is not limited thereto .

In another embodiment of the present invention, the expression inhibitor may be at least one selected from the group consisting of antisense nucleotides complementary to mRNA of ACTA2 gene, RNAi, siRNA, miRNA, shRNA, and ribozyme, but is limited thereto not.

In another embodiment of the present invention, the siRNA may include one or more base sequences selected from the group consisting of SEQ ID NOs: 3 to 8, but is not limited thereto.

In another embodiment of the present invention, the siRNA is SEQ ID NO: 3 and 4; SEQ ID NOs: 5 and 6; And it may include one or more siRNA selected from the group consisting of SEQ ID NOs: 7 and 8, but is not limited thereto.

In another embodiment of the present invention, the miRNA may be miR-4524a, but is not limited thereto.

In another embodiment of the present invention, the retinal or choroidal disease is retinitis pigmentosa (RP), Leber's congenital amaurosis (LCA), Stargardt's disease, Usher's syndrome, choroidal insufficiency, Rod-con or Con-Rod's disease. Trophy, ciliopathy, mitochondrial disorder, progressive retinal atrophy, degenerative retinal disease, age-related macular degeneration (AMD), wet AMD, dry AMD, central serous chorioretinopathy, choroidal thickening disease group, myopia degenerative, nodular chorioretinopathy, choroid Retinitis, choroidal tumor, choroidal neovascularization, hereditary choroidal disease, map atrophy, familial or acquired maculopathy, retinal photoreceptor disease, retinal pigment epithelial-system disease, diabetic retinopathy, diabetic chorioretinopathy, cystic macular edema, uveitis , retinal detachment, traumatic retinal injury, iatrogenic retinal injury, macular hole, macular telangiectasia, ganglion cell disease, optic nerve cell disease, glaucoma, optic neuropathy, ischemic retinal disease, retinopathy of prematurity, retinal vessel occlusion, familial macroneurism, It may be one or more selected from the group consisting of retinal vascular disease, ophthalmic vascular disease, retinal nerve cell degeneration due to glaucoma, and ischemic optic neuropathy, but is not limited thereto.

In another embodiment of the present invention, the ACTA2 protein may include the amino acid sequence shown in SEQ ID NO: 1, but is not limited thereto.

In another embodiment of the present invention, the composition may be administered by one or more routes selected from the group consisting of oral, subcutaneous, intraperitoneal, intrapulmonary, intranasal, intramuscular, intravenous, intraarterial and ophthalmic administration. However, the present invention is not limited thereto.

In another embodiment of the present invention, the topical administration may be one selected from the group consisting of intraconjunctival sac administration, intravitreal administration, subretinal administration, suprachoroidal administration, subconjunctival administration, and subtenon's capsule administration. It is not limited.

In another embodiment of the present invention, the composition may further include an anti-VEGF agent, but is not limited thereto.

In another embodiment of the present invention, the pharmaceutical composition may be administered simultaneously or sequentially with the anti-VEGF agent, but is not limited thereto.

In another embodiment of the present invention, the composition may have one or more effects selected from the group consisting of the following items, but is not limited thereto.

inhibition of proliferation or distribution of smooth muscle cells;

promoting proliferation or distribution of perivascular cells;

drusen reduction;

inhibition of retinal neovascularization or vascular leakage; and

Inhibition of dilation or leakage of choroidal vessels.

In addition, the present invention provides a quasi-drug composition for preventing or treating retinal or choroidal diseases comprising an ACTA2 inhibitor as an active ingredient.

In addition, the present invention provides a method for preventing, improving or treating retinal or choroidal diseases, comprising administering to an individual a composition comprising an ACTA2 inhibitor as an active ingredient.

In addition, the present invention provides the use of a composition comprising an ACTA2 inhibitor as an active ingredient for preventing, improving or treating retinal or choroidal diseases.

The present invention also provides the use of an ACTA2 inhibitor for the production of a medicament for preventing or treating retinal or choroidal disease.

The present inventors found that siRNA and miRNA, which are inhibitors of ACTA2, were administered to an animal model of retinal or choroidal disease, based on the assumption that an increase in ACTA2 causes a decrease in perivascular cells and proliferation and distribution of smooth muscle cells. It was confirmed that while inhibiting the proliferation and distribution of perivascular cells, the distribution of perivascular cells was increased, and the expansion and leakage of choroidal vessels was inhibited. Therefore, it is expected that ACTA2 inhibitors can be usefully used for the treatment of retinal or choroidal diseases.

1 shows the results of observing smooth muscle cells and perivascular cells of the choroidal capillary layer according to the age of a person according to an embodiment of the present invention.
2 shows the expression patterns of smooth muscle cell-related genes and perivascular cell-related genes in the choriocapillaris according to the age of a person according to an embodiment of the present invention.
Figure 3 shows the expression level of ACTA2 as a result of processing ACTA2 siRNA in mouse choroidal tissue according to an embodiment of the present invention.
4 shows the expression levels of perivascular cell marker PDGFRβ and smooth muscle cell marker TAGLN (Transgelin) as a result of injecting ACTA2 siRNA into the vitreous cavity of an elderly mouse according to an embodiment of the present invention.
5 is a result of injection of ACTA2 siRNA and miRNA into the vitreous cavity of an elderly mouse according to an embodiment of the present invention, confirming smooth muscle cells in the retina and choroid.
6 shows the drusen inhibitory effect through intravitreal ACTA2 siRNA and miRNA injection in a dry age-related macular degeneration (dAMD) mouse model according to an embodiment of the present invention.
7 shows the results of intravitreal injection of ACTA2 siRNA and miRNA into a dry age-related macular degeneration (dAMD) mouse model according to an embodiment of the present invention, confirmed by electroretinography.
8 shows the distribution of choroidal neovascularization, perivascular cells and smooth muscle cells as a result of intravitreal injection of ACTA2 siRNA and miRNA into a wet age-related macular degeneration (wAMD) mouse model according to an embodiment of the present invention.
FIG. 9 shows intravitreal ACTA2 siRNA and miRNA injection into a diabetic mouse model according to an embodiment of the present invention, and fluorescein angiography (FAG) and indocyanine green angiography (ICGA) to confirm angiogenesis and vascular leakage. one result is shown.
10 shows the effect of inhibiting retinal microaneurysms as a result of intravitreal injection of ACTA2 siRNA and miRNA into a diabetic mouse model according to an embodiment of the present invention.
Figure 11 shows the effect of reducing the expansion and leakage of choroidal vessels as a result of injecting ACTA2 siRNA and miRNA in the vitreous cavity in a diabetic mouse model according to an embodiment of the present invention.
12 shows the effect of relieving choroidal inflammation by confirming aggregation of microglia as a result of intravitreal injection of ACTA2 siRNA and miRNA into a diabetic mouse model according to an embodiment of the present invention.
13A to 13C show information on ACTA2 siRNAs #1 to #3 used according to an embodiment of the present invention.
14 shows the mechanism of the improvement effect of retinal degeneration through ACTA2 inhibition.

The present inventors, based on the increase in smooth muscle cells in the choroidal capillaries of the diabetic retinopathy mouse model and the age-related macular degeneration (AMD) mouse model through the Examples,

It was confirmed that, by intravitreal administration of an ACTA2 inhibitor, excessive proliferation and distribution of smooth muscle cells in the choroidal blood vessels of elderly mice was inhibited, and the distribution of perivascular cells increased (see Example 4),

By administering an ACTA2 inhibitor into the vitreous cavity of an AMD animal model, it was confirmed that the generation of drusen was effectively suppressed and the function of photoreceptors was also restored (see Examples 5 and 6),

By administering the ACTA2 inhibitor into the vitreous cavity of the wet AMD animal model, it was confirmed that the size of choroidal neovascularization was significantly reduced and the distribution of smooth muscle cells was also significantly decreased, while the distribution of perivascular cells was significantly increased (see Example 7). ),

By administering an ACTA2 inhibitor into the vitreous cavity of a diabetic animal model, it was confirmed that choroidal neovascularization and vascular leakage were reduced, retinal microvascularization was reduced, choroidal vessel dilatation and leakage were reduced, and choroidal inflammation was alleviated ( See Example 8), the present invention was completed.

Accordingly, the present invention relates to a pharmaceutical composition for preventing or treating retinal or choroidal disease comprising an ACTA2 inhibitor as an active ingredient.

Hereinafter, the present invention will be described in detail.

As used herein, the term "protein" is used interchangeably with 'polypeptide' or 'peptide', eg, refers to a polymer of amino acid residues as commonly found in proteins in their natural state.

As used herein, "polynucleotide" or "nucleic acid" refers to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) in the form of single or double strands. Unless otherwise limited, known analogs of natural nucleotides that hybridize to nucleic acids in a manner analogous to naturally occurring nucleotides are also included. In general, DNA consists of four bases: adenine (A), guanine (G), cytosine (C), and thymine (T), and RNA consists of uracil (U) instead of thymine (Uracil, U). has a In a double-stranded nucleic acid, A forms a hydrogen bond with T or U, and C forms a G base.

On the other hand, 'mRNA (messenger RNA or messenger RNA)' is an RNA that serves as a blueprint for polypeptide synthesis (protein translation, translation) by transferring the genetic information of the base sequence of a specific gene to the ribosome during protein synthesis. Using the gene as a template, single-stranded mRNA is synthesized through the transcription process.

In the present specification, "ACTA2 (Actin Alpha 2, Smooth Muscle)" is also referred to as smooth muscle actin, SMA, a-SMA, AAT6 or ACTSA, a gene located on chromosome 10 (#chr10:90,682,710-90,735,753 (53,043)) , and its specific nucleotide sequence and protein information are known from NCBI (NCBI Reference Sequence: NP_001135417.1, NP_001307784.1, or NP_001604.1).

In the present invention, the ACTA2 protein may include or consist of the amino acid sequence of SEQ ID NO: 1, but is not limited thereto.

In the present invention, the gene encoding the ACTA2 protein may include the nucleotide sequence represented by SEQ ID NO: 2, but is not limited thereto. In the present specification, the "gene encoding the ACTA2 protein" may include the gene nucleotide sequence represented by SEQ ID NO: 2, and preferably may consist of the nucleotide sequence represented by SEQ ID NO: 2. Also, the above genetic variants are included in the scope of the present invention. Specifically, the gene may include a nucleotide sequence having a sequence homology of 70% or more, more preferably 80% or more, and most preferably 90% or more to the nucleotide sequence of SEQ ID NO: 2. For example, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85 %, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% sequence homology It includes a polynucleotide having

As used herein, the term "complementary" means that a targeting moiety in a nucleic acid molecule is selectively directed to a target (eg, ACTA2 gene) under certain hybridization or annealing conditions, specifically physiological conditions (in a cell). It means that it is sufficiently complementary to hybridize, it may have one or more mismatched nucleotide sequences, and has a meaning encompassing both substantially complementary and perfectly complementary. , more specifically meaning completely complementary.

In the present specification, the inhibitor may be an ACTA2 activity inhibitor or an expression inhibitor, but is not limited thereto.

In the present specification, the activity inhibitor may be one or more selected from the group consisting of a compound that specifically binds to the ACTA2 protein, a peptide, a peptidomimetic, a matrix analog, an aptamer, and an antibody, but is not limited thereto.

In the present specification, the expression inhibitor may be one or more selected from the group consisting of antisense nucleotides complementary to the mRNA of the ACTA2 gene, RNAi, siRNA, miRNA, shRNA, and ribozyme, but is not limited thereto.

As used herein, the term "siRNA" means that the sense strand (eg, a sequence corresponding to the ACTA2 gene mRNA sequence) and the antisense strand (eg, a sequence complementary to the ACTA2 gene mRNA sequence) are located opposite to each other Thus, it may have a structure forming a double chain. In addition, the siRNA molecule that can be used in the present invention may have a single-stranded structure having self-complementary sense and antisense strands. siRNA is not limited to the complete pairing of double-stranded RNA segments that pair with each other, but pairing occurs due to mismatch (the corresponding bases are not complementary), bulge (there is no base corresponding to one chain), etc. It may contain parts that are not. Specifically, the total length is from 10 to 100 bases, more specifically from 15 to 80 bases, and even more specifically from 20 to 70 bases. In the present invention, the siRNA may include one or more base sequences selected from the group consisting of SEQ ID NOs: 3 to 8, but is not limited thereto. In addition, in the present invention, the siRNA is SEQ ID NO: 3 and 4 (siRNA #1); SEQ ID NOs: 5 and 6 (siRNA #2); And it may include one or more siRNA selected from the group consisting of SEQ ID NOs: 7 and 8 (siRNA #3), but is not limited thereto.

In the present specification, the siRNAs #1, #2, and #3 are 1 to 10: 1 to 10: 1 to 10, 1 to 5: 1 to 5: 1 to 5, 1-3: 1 to 3: 1 to 3, 1 to 2: 1 to 2: 1 to 2, or 1: 1 may be included in a molar ratio of 1: 1, but is not limited thereto.

As used herein, the term "shRNA (small hairpin RNA or short hairpin RNA)" refers to a sequence of RNA that makes a strong hairpin turn, which can be used to silence gene expression through RNA interference. shRNA can be introduced into cells using any promoter capable of functioning in eukaryotic cells. The shRNA hairpin structure is degraded into siRNA, an intracellular machinery, and bound to an RNA-induced silencing complex. The complex described above binds to and degrades mRNA corresponding to the siRNA bound thereto. shRNA is transcribed by RNA polymerase III, and shRNA production in mammalian cells can also trigger an interferon response, as the cell recognizes shRNA as a viral attack and seeks a defense mechanism.

As used herein, the term "miRNA (microRNA, microRNA)" refers to a substance that binds to the 3'-UTR of mRNA (messengerRNA) as a single-stranded RNA molecule of 21-25 nucleotides to control gene expression in eukaryotes ( Bartel DP, et al., Cell, 23;116(2): 281-297 (2004)). Generation of miRNA is made into stem-loop precursor miRNA (pre-miRNA) by Drosha (RNase III type enzyme), moves to the cytoplasm, and is cleaved by Dicer to make mature miRNA. In the present invention, the miRNA may be miR-4524a, but is not limited thereto. The miR-4524a may include SEQ ID NO: 9 or may consist of SEQ ID NO: 9, but is not limited thereto.

As used herein, the term "antisense oligonucleotide" refers to DNA or RNA or a derivative thereof containing a nucleic acid sequence complementary to a sequence of a specific mRNA, and binds to a complementary sequence in the mRNA to convert the mRNA into a protein acts as an inhibitor. For example, the antisense sequence of the present invention refers to a DNA or RNA sequence that is complementary to ACTA2 and capable of binding to ACTA2 mRNA, and includes translation of ACTA2 mRNA, translocation into the cytoplasm, maturation, or any other overall It may inhibit essential activity for biological function. The length of the antisense nucleic acid is 6 to 100 bases, specifically 8 to 60 bases, and more specifically 10 to 40 bases.

As used herein, the term “ribozyme” is a type of RNA and is an RNA having the same function as an enzyme that recognizes the base sequence of a specific RNA and cuts it by itself. A ribozyme is a complementary nucleotide sequence of a target messenger RNA strand and consists of a region that binds with specificity and a region that cuts the target RNA. As used herein, the term “aptamer” refers to an oligonucleotide (generally, an RNA molecule) that binds to a specific target. Specifically, “aptamer” as used herein refers to an oligonucleotide aptamer ( For example, RNA aptamer).

In the present specification, siRNA or shRNA may be modified with various modifications for improving in vivo stability of oligonucleotides, conferring nuclease resistance, and reducing non-specific immune responses. Modifications of the oligonucleotide include: -CH ₃ (methyl), -OCH ₃ (methoxy), -NH ₂ , -F, -O-2-methoxyethyl; -O-propyl, -O-2-methylthioethyl, -O-3-aminopropyl, -O-3-dimethylaminopropyl, -ON-methylacetamido or -O-dimethylamido modification by substitution with dooxyethyl; a modification in which the oxygen in the sugar structure in the nucleotide is substituted with sulfur; Or one or more modifications selected from the transformation of nucleotide bonds into phosphorothioate or boranophosphate, methyl phosphonate bonds may be used in combination, and PNA (peptide nucleic acid); Modification to LNA (locked nucleic acid) or UNA (unlocked nucleic acid) form is also possible.

In the present invention, the retinal or choroidal disease may be a vascular permeability-related retinal or choroidal disease, but is not limited thereto. The term "vascular permeability-related retinal or choroidal disease" refers to a retinal disease caused by disruption of normal regulation of vascular permeability, and generally refers to a retinal or choroidal disease that causes bleeding, edema, and inflammation by changing blood vessels and increasing permeability.

In the present invention, the retinal or choroidal disease is retinitis pigmentosa (RP), Leber's congenital amaurosis (LCA), Stargardt's disease, Usher syndrome, choroidal insufficiency, Rod-Con or Con-Rod's dystrophy, ciliopathy, Mitochondrial disorder, progressive retinal atrophy, degenerative retinal disease, age-related macular degeneration (AMD), wet AMD, dry AMD, central serous chorioretinopathy, choroidal thickening disease group, myopia degenerative, nodular chorioretinopathy, chorioretinitis, choroidal tumor, Choroidal neovascularization, hereditary choroidal disease, superficial atrophy, familial or acquired maculopathy, retinal photoreceptor disease, retinal pigment epithelial-system disease, diabetic retinopathy, diabetic chorioretinopathy, cystic macular edema, uveitis, retinal detachment, traumatic Retinal damage, iatrogenic retinal damage, macular hole, macular telangiectasia, ganglion cell disease, optic nerve cell disease, glaucoma, optic neuropathy, ischemic retinal disease, retinopathy of prematurity, retinal vessel occlusion, familial macroanurism, retinal vascular disease, eye It may be one or more selected from the group consisting of vascular disease, retinal nerve cell degeneration due to glaucoma, and ischemic optic neuropathy, but is not limited thereto.

In the present invention, “age-related macular degeneration (AMD)” refers to a disease that occurs with aging in the macular part of the retina, which plays a very important role in vision. In the present invention, the age-related macular degeneration may include dry (non-exudative) or wet (exudative). “Dry AMD” refers to a case in which a lesion such as drusen or retinal pigment epithelium atrophy occurs in the retina, and accounts for nearly 90% of AMD. The photoreceptor cells in the macula gradually atrophy, and as time goes by, the visual acuity gradually decreases, and it can develop into a wet form. In “wet AMD”, choroidal new blood vessels grow under the retina, and severe visual impairment is likely to occur due to bleeding or exudation of the new blood vessels themselves or from blood vessels, and blindness occurs due to disc atrophy and severe bleeding between months and years after the onset. may cause

In the present invention, “diabetic retinopathy” is one of the microvascular complications appearing in diabetes, and increased retinal vascular permeability due to hyperglycemia and various biochemical changes accompanying it. Functional forms of capillaries such as ischemia and neovascularization caused by academic changes. In the present invention, the diabetic retinopathy may include non-proliferative or proliferative retinopathy, but is not limited thereto. “Non-proliferative retinopathy” refers to a condition in which small blood vessels in the retina are weakened, resulting in serum leakage or blockage of blood vessels, leading to a cessation of nutrient supply. "Proliferative retinopathy" is known to cause blindness within 5 years due to bleeding from new blood vessels if not treated properly because new blood vessels form in places with poor blood circulation.

In the present invention, "diabetic chorioretinopathy (diabetic choroidopathy)" is one of the microvascular complications appearing in choroidal vessels in diabetes, chronic hyperglycemia inhibits perforation and endothelial transport in the choroidal capillary layer, and It occurs as endothelial transport of macromolecules between the retina is impaired by diabetes. In addition, structural and functional changes of large choroidal vessels such as choroidal arteries and veins are also accompanied by loss and degeneration of perivascular cells, leading to inflammation and ischemia of the choroidal tissue. The diabetic chorioretinopathy may be a disease in which visual acuity deteriorates due to structural and functional abnormalities of the choroid that cause retinal malnutrition and accumulation of metabolic wastes.

In the present invention, the “choroid” is one of the eye walls located between the sclera and the retina, and is a thin membrane rich in blood vessels and melanocytes at the back of the eyeball. The choroid plays a role in preventing light coming from the outside from being dispersed, and is known to act as the choroid at the back of the eye and the iris at the front of the eye.

In the present invention, the composition may inhibit the proliferation or distribution of smooth muscle cells, but is not limited thereto.

In the present invention, the composition may promote proliferation or distribution of perivascular cells, but is not limited thereto.

In the present invention, the composition may reduce drusen, but is not limited thereto.

In the present invention, the composition may inhibit retinal neovascularization or vascular leakage, but is not limited thereto.

In the present invention, the composition may be to inhibit the expansion or leakage of choroidal vessels, but is not limited thereto.

In the present invention, the composition may further include an anti-VEGF agent, but is not limited thereto. In the present invention, the anti-VEGF agent is, for example, bevacizumab, ranibizumab, pegaptanib, pazopanib, sunitinib, sorafenib, regorafenib, caboxantinib, lenvatinib, ponatinib, It may be one or more selected from the group consisting of axitinib, tibotanib, ramucirumab, vandetanib, brolucizumab, parisimab and aflibercept, but is not limited thereto. In addition, the anti-VEGF agent may include a peptide that binds to vascular epithelial growth factor (VEGF) and prevents or reduces its binding to a receptor, an antibody that binds to VEGF, or a nucleic acid capable of binding to VEGF. However, the present invention is not limited thereto.

The composition of the present invention may be administered simultaneously or sequentially with the anti-VEGF agent, but is not limited thereto. In the present invention, the composition comprising the ACTA2 inhibitor as an active ingredient may be formulated to exist in one container in the form of a mixture with the anti-VEGF agent, and may be formulated to be present in a separate container and administered simultaneously or sequentially. can In addition, the composition comprising the ACTA2 inhibitor as an active ingredient may be administered as a secondary therapy after treatment with an anti-VEGF agent, but is not limited thereto.

The present invention may also include a pharmaceutically acceptable salt of an ACTA2 inhibitor as an active ingredient. As used herein, the term “pharmaceutically acceptable salt” includes salts derived from pharmaceutically acceptable inorganic acids, organic acids, or bases. As used herein, the term “food pharmaceutically acceptable salt” includes salts derived from pharmaceutically acceptable organic acids, inorganic acids, or bases. As used herein, the term "veterinary acceptable salt" includes salts derived from veterinary acceptable inorganic acids, organic acids, or bases.

Examples of suitable acids include hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, perchloric acid, fumaric acid, maleic acid, phosphoric acid, glycolic acid, lactic acid, salicylic acid, succinic acid, toluene-p-sulfonic acid, tartaric acid, acetic acid, citric acid, methanesulfonic acid, formic acid , benzoic acid, malonic acid, gluconic acid, naphthalene-2-sulfonic acid, benzenesulfonic acid, and the like. Acid addition salts can be prepared by conventional methods, for example, by dissolving the compound in an aqueous solution of an excess of acid, and precipitating the salt using a water-miscible organic solvent such as methanol, ethanol, acetone or acetonitrile. It can also be prepared by heating an equimolar amount of the compound and an acid or alcohol in water and then evaporating the mixture to dryness, or by suction filtration of the precipitated salt.

Salts derived from suitable bases may include, but are not limited to, alkali metals such as sodium and potassium, alkaline earth metals such as magnesium, and ammonium. The alkali metal or alkaline earth metal salt can be obtained, for example, by dissolving the compound in an excess alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the undissolved compound salt, and then evaporating and drying the filtrate. In this case, as the metal salt, it is pharmaceutically suitable to prepare a sodium, potassium or calcium salt, and the corresponding silver salt can be obtained by reacting an alkali metal or alkaline earth metal salt with a suitable silver salt (eg, silver nitrate).

The content of the ACTA2 inhibitor in the composition of the present invention can be appropriately adjusted according to the symptoms of the disease, the degree of progression of the symptoms, the condition of the patient, etc., for example, 0.0001 to 99.9% by weight, or 0.001 to 50% by weight based on the total weight of the composition may be, but is not limited thereto. The content ratio is a value based on the dry amount from which the solvent is removed.

The pharmaceutical composition according to the present invention may further include suitable carriers, excipients and diluents commonly used in the preparation of pharmaceutical compositions. The excipient may be, for example, at least one selected from the group consisting of a diluent, a binder, a disintegrant, a lubricant, an adsorbent, a humectant, a film-coating material, and a controlled-release additive.

The pharmaceutical composition according to the present invention can be prepared according to a conventional method, respectively, in powders, granules, sustained-release granules, enteric granules, liquids, eye drops, elsilic, emulsions, suspensions, alcohols, troches, fragrances, and limonaade. , tablets, sustained release tablets, enteric tablets, sublingual tablets, hard capsules, soft capsules, sustained release capsules, enteric capsules, pills, tinctures, soft extracts, dry extracts, fluid extracts, injections, capsules, perfusates, Warnings, lotions, pasta, sprays, inhalants, patches, sterile injection solutions, or external preparations such as aerosols can be formulated and used, and the external preparations are creams, gels, patches, sprays, ointments, warning agents , lotion, liniment, pasta, or cataplasma.

Carriers, excipients and diluents that may be included in the pharmaceutical composition according to the present invention include lactose, dextrose, sucrose, oligosaccharide, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

In the case of formulation, it is prepared using commonly used diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants.

Corn starch, potato starch, wheat starch, lactose, sucrose, glucose, fructose, di-mannitol, precipitated calcium carbonate, synthetic aluminum silicate, phosphoric acid as additives for tablets, powders, granules, capsules, pills, and troches according to the present invention Calcium monohydrogen, calcium sulfate, sodium chloride, sodium hydrogen carbonate, purified lanolin, microcrystalline cellulose, dextrin, sodium alginate, methyl cellulose, sodium carboxymethyl cellulose, kaolin, urea, colloidal silica gel, hydroxypropyl starch, hydroxypropyl methyl excipients such as cellulose (HPMC), HPMC 1928, HPMC 2208, HPMC 2906, HPMC 2910, propylene glycol, casein, calcium lactate, and Primogel; Gelatin, gum arabic, ethanol, agar powder, cellulose acetate phthalate, carboxymethylcellulose, calcium carboxymethylcellulose, glucose, purified water, sodium caseinate, glycerin, stearic acid, sodium carboxymethylcellulose, sodium methylcellulose, methylcellulose, microcrystalline cellulose, dextrin , hydroxycellulose, hydroxypropyl starch, hydroxymethylcellulose, purified shellac, starch powder, hydroxypropylcellulose, hydroxypropylmethylcellulose, polyvinyl alcohol, polyvinylpyrrolidone, etc. Hydroxypropyl methylcellulose, corn starch, agar powder, methylcellulose, bentonite, hydroxypropyl starch, sodium carboxymethylcellulose, sodium alginate, calcium carboxymethylcellulose, calcium citrate, sodium lauryl sulfate, silicic anhydride, 1-hydroxy Propyl cellulose, dextran, ion exchange resin, polyvinyl acetate, formaldehyde treated casein and gelatin, alginic acid, amylose, guar gum, sodium bicarbonate, polyvinylpyrrolidone, calcium phosphate, gelled starch, gum arabic, Disintegrants such as amylopectin, pectin, sodium polyphosphate, ethyl cellulose, sucrose, magnesium aluminum silicate, di-sorbitol solution, light anhydrous silicic acid; Calcium stearate, magnesium stearate, stearic acid, hydrogenated vegetable oil, talc, lycopodite, kaolin, petrolatum, sodium stearate, cacao fat, sodium salicylate, magnesium salicylate, polyethylene glycol (PEG) 4000, PEG 6000, liquid paraffin, hydrogen Added soybean oil (Lubri wax), aluminum stearate, zinc stearate, sodium lauryl sulfate, magnesium oxide, macrogol, synthetic aluminum silicate, silicic anhydride, higher fatty acid, higher alcohol, silicone oil, paraffin oil, polyethylene glycol fatty acid ether, A lubricant such as starch, sodium chloride, sodium acetate, sodium oleate, dl-leucine, light anhydrous silicic acid; may be used.

As additives for the liquid formulation according to the present invention, water, diluted hydrochloric acid, diluted sulfuric acid, sodium citrate, monostearate sucrose, polyoxyethylene sorbitol fatty acid esters (Twinester), polyoxyethylene monoalkyl ethers, lanolin ethers, Lanolin esters, acetic acid, hydrochloric acid, aqueous ammonia, ammonium carbonate, potassium hydroxide, sodium hydroxide, prolamine, polyvinylpyrrolidone, ethyl cellulose, sodium carboxymethyl cellulose, etc. can be used.

In the syrup according to the present invention, a sucrose solution, other sugars or sweeteners may be used, and if necessary, a fragrance, colorant, preservative, stabilizer, suspending agent, emulsifying agent, thickening agent, etc. may be used.

Purified water may be used in the emulsion according to the present invention, and if necessary, an emulsifier, preservative, stabilizer, fragrance, etc. may be used.

Suspension agents according to the present invention include acacia, tragacantha, methylcellulose, carboxymethylcellulose, sodium carboxymethylcellulose, microcrystalline cellulose, sodium alginate, hydroxypropylmethylcellulose (HPMC), HPMC 1828, HPMC 2906, HPMC 2910, etc. An agent may be used, and a surfactant, a preservative, a stabilizer, a colorant, and a fragrance may be used as needed.

The injection according to the present invention includes distilled water for injection, 0.9% sodium chloride injection solution, ring gel injection solution, dextrose injection solution, dextrose + sodium chloride injection solution, PEG (PEG), lactated ring gel injection solution, ethanol, propylene glycol, non-volatile oil-sesame oil , solvents such as cottonseed oil, peanut oil, soybean oil, corn oil, ethyl oleate, isopropyl myristate, and benzene benzoate; Solubilizing aids such as sodium benzoate, sodium salicylate, sodium acetate, urea, urethane, monoethylacetamide, butazolidine, propylene glycol, tweens, nijeongtinamide, hexamine, and dimethylacetamide; Weak acids and their salts (acetic acid and sodium acetate), weak bases and their salts (ammonia and ammonium acetate), organic compounds, proteins, buffers such as albumin, peptone, gum; isotonic agents such as sodium chloride; sodium bisulfite (NaHSO ₃ ) carbon dioxide gas, sodium metabisulfite (Na ₂ S ₂ O ₅ ), sodium sulfite (Na ₂ SO ₃ ), nitrogen gas (N ₂ ), stabilizers such as ethylenediaminetetraacetic acid; sulphating agents such as sodium bisulfide 0.1%, sodium formaldehyde sulfoxylate, thiourea, disodium ethylenediaminetetraacetate, acetone sodium bisulfite; analgesic agents such as benzyl alcohol, chlorobutanol, procaine hydrochloride, glucose, and calcium gluconate; suspending agents such as SiMC sodium, sodium alginate, Tween 80, or aluminum monostearate.

The suppository according to the present invention includes cacao fat, lanolin, witepsol, polyethylene glycol, glycerogelatin, methyl cellulose, carboxymethyl cellulose, a mixture of stearic acid and oleic acid, Subanal, cottonseed oil, peanut oil, palm oil, cacao butter + Cholesterol, Lecithin, Lanet Wax, Glycerol Monostearate, Tween or Span, Imhausen, Monolene (Propylene Glycol Monostearate), Glycerin, Adeps Solidus, Butyrum Tego -G), Cebes Pharma 16, Hexalide Base 95, Cotomar, Hydroxote SP, S-70-XXA, S-70-XX75 (S-70-XX95), Hydro Hydrokote 25, Hydrokote 711, Idropostal, Massa estrarium, A, AS, B, C, D, E, I, T, Massa-MF, Masupol, Masupol-15, Neosupostal-N, Paramound-B, Suposiro (OSI, OSIX, A, B, C, D, H, L), Suppository IV type (AB, B, A, BC, BBG, E, BGF, C, D, 299), supostal (N, Es), Wecobi (W, R, S, M, Fs), tester triglyceride base (TG-95, MA, 57) and The same mechanism may be used.

Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations include at least one excipient in the extract, for example, starch, calcium carbonate, sucrose ) or lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used.

Liquid formulations for oral administration include suspensions, internal solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. there is. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.

The pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is determined by the type, severity, drug activity, and type of the patient's disease; Sensitivity to the drug, administration time, administration route and excretion rate, treatment period, factors including concurrent drugs and other factors well known in the medical field may be determined.

The pharmaceutical composition according to the present invention may be administered as an individual therapeutic agent or may be administered in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or multiple times. In consideration of all of the above factors, it is important to administer an amount capable of obtaining the maximum effect with a minimum amount without side effects, which can be easily determined by a person skilled in the art to which the present invention pertains.

The pharmaceutical composition of the present invention may be administered to an individual by various routes. All modes of administration can be contemplated, for example, oral administration, subcutaneous injection, intraperitoneal administration, intravenous injection, intramuscular injection, paraspinal space (intrathecal) injection, sublingual administration, buccal administration, rectal insertion, vaginal It can be administered according to internal insertion, ocular administration, ear administration, nasal administration, inhalation, spraying through the mouth or nose, skin administration, transdermal administration, and the like.

The pharmaceutical composition of the present invention is determined according to the type of drug as an active ingredient along with several related factors such as the disease to be treated, the route of administration, the patient's age, sex, weight, and the severity of the disease.

In the present invention, "individual" means a subject in need of treatment for a disease, and is not limited if it is a vertebrate, specifically, a human, a mouse, a rat, a guinea pig, a rabbit, a monkey, a pig, a horse, a cow, Applicable to sheep, antelopes, dogs, cats, fish and reptiles.

In the present invention, "administration" means providing a predetermined composition of the present invention to an individual by any suitable method.

In the present invention, “prevention” means any action that suppresses or delays the onset of a target disease, and “treatment” means that the target disease and its metabolic abnormalities are improved or It means all actions that are beneficially changed, and “improvement” means all actions that reduce the desired disease-related parameters, for example, the degree of symptoms by administration of the composition according to the present invention.

In addition, the present invention provides a quasi-drug composition for preventing or treating retinal or choroidal diseases comprising an ACTA2 inhibitor as an active ingredient.

Among items used for the purpose of diagnosing, treating, ameliorating, alleviating, treating, or preventing diseases of humans or animals, it refers to items with a milder action than pharmaceuticals. Textiles and rubber products used for the treatment or prevention of human and animal diseases, those that do not have a slight or direct action on the human body and are not instruments or machines, and sterilizers and insecticides to prevent infectious diseases are also included in this category. Included.

In the present invention, the quasi-drug composition can be formulated and used in the form of an ophthalmic composition, for example, one or more formulations selected from the group consisting of ophthalmic solutions, eye drops, eye ointments, injections, and eyewash. However, it is not limited thereto.

Since the present invention can apply various transformations and can have various embodiments, specific embodiments are illustrated in the drawings and described in detail in the detailed description. However, this is not intended to limit the present invention to specific embodiments, it should be understood to include all modifications, equivalents and substitutes included in the spirit and scope of the present invention. In describing the present invention, if it is determined that a detailed description of a related known technology may obscure the gist of the present invention, the detailed description thereof will be omitted.

Hereinafter, preferred examples are presented to help the understanding of the present invention. However, the following examples are only provided for easier understanding of the present invention, and the contents of the present invention are not limited by the following examples.

[Example]

Example 1. Experimental method

1-1. experimental material

In order to suppress the excessive proliferation and division of smooth muscle cells in the elderly and diabetes, an siRNA that inhibits ACTA2, a major functional gene of smooth muscle cells, was custom-made by Bioneer (Bioneer, KR). In addition, has-miR-4524a-3p mimic (hereinafter, miRNA) was purchased from Bioneer, KR. The prepared siRNA and purchased miRNA sequences are shown in Table 1 below.

Name Sequence SEQ ID NO: siRNA #1
sense CGU ACA CAA GAC UCU CAC A 3 siRNA #1
antisense UGU GAG AGU CUU GUG UAC G 4 siRNA #2
sense CAC UAU GCA CCU GGA UCA U 5 siRNA #2
antisense AUG AUC CAG GUG CAU AGU G 6 siRNA #3
sense GAU UUG UUA CUC GUG GUU U 7 siRNA #3
antisense AAA CCA CGA GUA ACA AAU C 8 has-miR-4524a-3p
mimic GAACGAUAGCAGCAUGAACCUGUCUCACUGCAGAAUUAUUUUGAGACAGGCUUAUGCUGCUAUCCUUCA 9

1-2. Construction of Diabetes Induced Animal Models

Diabetic chorioretinopathy is a disease in which retinal degeneration occurs due to structural and functional changes in choroidal blood vessels due to long-term diabetes, leading to decreased visual acuity. In diabetic chorioretinopathy, various changes in choroidal blood vessels such as expansion of choroidal vessels and loss of choroidal capillaries have been reported. Among them, changes in choroidal capillaries are the most important for maintaining retinal function. For the production of diabetic chorioretinopathy animal model, first, STZ (streptozotocin, Sigma) was administered to the abdominal cavity of 7-8 week old male C57BL6/J mice at a dose of 200 mg/kg, and then blood glucose was measured one week later to induce hyperglycemia. was confirmed. Mice whose blood sugar was induced to 400 mg/dL or higher were selected and used for subsequent experiments. The initial symptoms of diabetic chorioretinopathy started appearing about 8 weeks after STZ administration.

1-3. Preparation of an age-related macular degeneration (AMD) animal model with reduced perivascular cells

By crossing PDGFRβ-cre ^ERT2 mice with ROSA-DTA (Diphtheria Toxin A) mice, pericyte (pericytes) expressing PDGFRβ (PDGF Receptor beta) was selectively removed from the mouse, thereby producing an age-related macular degeneration model. . Specifically, PDGFRβ, an inducible pericyte specific DTA expressing Cell ablation mouse, by inducing pericyte-specific DTA expression in combination by crossing PDGFRβ-cre ^ERT2 corresponding to the Cre-Flox system and ROSA-DTA mice -cre ^ERT2 ;DTA (PDGFRβ-cre ^ERT2 ; DTA ^+/+ and PDGFRβ-cre ^ERT2 ; DTA ^+/- or less, ΔPC) genotype mice were used. When tamoxifen drug is administered to iΔPC, Cyclic Recombinase (Cre) activated by ERT2 (tamoxifen-induced estrogen receptor) is made, and the FLOX cassette is circularly linked and the STOP gene present between them. It was manufactured using a system that allows the DTA gene located behind the cassette to be transcribed by removing the .

1-4. Fabrication of laser-induced choroidal neovascularization model

At 7 weeks of age, siRNA or miRNA was injected into the eyes of mice, and a choroidal neovascularization model mimicking wet macular degeneration was prepared using a laser at 8 weeks of age, 1 week later. After laser irradiation, two weeks were set as the time for angiogenesis to proceed sufficiently. Afterwards, the mouse eyeballs were collected and biopsied.

1-5. Electroretinogram (ERG)

Electroretinogram plays an important role in diagnosing and researching abnormalities in retinal function. A decrease in the amplitude of a and b wave is observed under dark adaptation. A decrease in the amplitude of a wave indicates a decrease in photoreceptor function, and a decrease in the amplitude of the b wave indicates a decrease in the function of a bipolar cell. The electroretinogram test method was performed with reference to the document [Documenta Ophthalmologica volume 130, pages 1-12 (2015)].

1-6. Fluorescein angiography (FAG), Indocyanine-green angiography and Fundus photography

For fluorescein angiography (FAG), indocyanine green choroidal angiography (ICGA), and fundus photography (Fundus Photography), mice were subjected to general anesthesia and dilated using a pupil dilator, then fluorescein sodium injection and (Fluorescein sodium injection, Alcon) was intraperitoneally injected at 5 mg per mouse and indocyanine-Green injection (Indocyanine-Green injection, per dorsum) at 0.05 mg per mouse, respectively. Wide-angle fundus imaging and wide-angle angiography were taken using the Optos California System (Optos plc, Scotland, UK).

1-7. Whole-mount Immunofluorescence and Confocal Microscopy of the Retina

Eyeballs of sacrificed mice were collected and immediately fixed with ice-cold methanol for 1 hour at -20°C or 4% PFA overnight. The fixed eye was carefully trimmed to remove the lens and RPE choroid. Retina and choroidal tissues were incubated in Blocking Solution for 1 hour at room temperature, and then incubated overnight at 4° C. with each primary antibody diluted in blocking solution (1:200). The primary antibodies used were: CD31; BD 550274; Franklin Lakes, NJ, USA, Endomucin; Santacruz SC65495; Dallas, TX, USA, anti-actin ACTA2; Sigma-Aldrich A5228; St. Louis, MO, USA. Samples were washed 3 times for 5 min in 0.2% PBST and incubated with secondary antibody diluted in 0.1% PBST (1:1000) overnight at 4°C. The samples were then washed three times for 5 min, mounted with a Prolong Glass Antifade Mountant (Invitrogen P36980; Waltham, MA, USA), and imaged and analyzed with a confocal laser scanning microscope (Leica TCS SP2 and TCS SP8X; Wetzlar; Germany). did Three-dimensional vessel images and projected images were generated from the Z-series image set using the included software LasX (v.3.6.0).

1-8. image analysis

Morphometric and colocalization analyzes performed in the retina and choroid were performed as follows. First, to measure the morphology of blood vessels, the length and area were measured using the LasX program and then the measured values were extracted (exported), and the colocalization analysis was performed using Java-based imaging software (ImageJ, v.1.52p, in the public domain at http: //rsb.info.nih.gov/ij; National Institutes of Health (NIH), Bethesda, MD, USA, and FIJI) and JaCoP plugins were used. In order to reduce the background sensitivity, the threshold was set as the most default value and applied to all samples. Subject Background The Manders coefficient was chosen for the selective colocalization evaluation. The coefficient M2 is the coefficient for perivascular cells versus vascular distribution.

1-9. statistical analysis

Mouse samples were not randomized during the experiment and were not excluded from the experiment. In addition, they were not blinded during the experiment and analysis of the results. Values are expressed as mean ± SEM (standard error). Statistical significance was calculated using Welch's t-test, Student's t-test, 1-way ANOVA and Tukey multiple comparison test using PASW Statistics 18 (SPSS v.23). When p < 0.05, it was set as statistically significant.

Example 2. Confirmation of increase in smooth muscle cells (SMC) in the choriocapillaris due to aging

2-1. Acquisition and preparation of donated eyes

The distribution of smooth muscle cells in aging patients was investigated by checking the medical records of the underlying disease in donor eyes, and the obtained eyes were used. For classification according to age, only the eyes of donors without underlying ophthalmic disease and metabolic underlying disease were used. Ages were classified into young and 60 years old or older. In the case of human donated eyes, the sclera and vitreous were removed after corneal transplantation was completed. Then, after separating the retina and choroid, each part was cut and divided into mRNA analysis samples and immunofluorescence staining. Tissues for mRNA analysis were stored at -80°C in RNA later solution (Invitrogen, USA), and tissues for immunofluorescence staining were fixed overnight with 4% PFA.

2-2. Whole-mount immunofluorescence staining and confocal microscopy of donor eye tissue

Retina and choroidal tissues were incubated in Blocking Solution for 3 hours at room temperature, and then incubated overnight at 4° C. with each primary antibody diluted in blocking solution (1:200). The primary antibodies used were: CD31 (abcam ab28364; UK), anti-actin ACTA2 (Sigma-Aldrich A5228; USA). Samples were washed 5 times for 5 min in 0.2% PBST and incubated with secondary antibody diluted in 0.1% PBST (1:1000) overnight at 4°C. The samples were then washed 5 times for 5 min each, mounted with a Prolong Glass Antifade Mountant (Invitrogen P36980; Waltham, MA, USA), and imaged and analyzed with a confocal laser scanning microscope (Leica TCS SP2 and TCS SP8X; Wetzlar; Germany). . Three-dimensional vessel images and projected images were generated from the Z-series image set using the included software LasX (v.3.6.0).

As shown in FIG. 1 , it was confirmed that, while the pericyte of the choroidal blood vessels decreased with age, the distribution of smooth muscle cells (SMC) increased.

2-3. Analysis of mRNA expression through next-generation sequencing of donor eye tissue

Retinal and choroidal tissues were each contained in RNA later solution and packaged in dry ice, and then mRNA next-generation sequencing was requested to e-biogen (KR). Analysis was requested by dividing the tissue of the young group and the tissue of the old group. After receiving the results, using the ExDEGA program of eBiogen, the expression of perivascular cell-related genes in the young group versus the old group was compared and The expression of perivascular cell-related genes of

As shown in Figure 2, the perivascular cell-related genes PDGFRβ (Platelet Derived Growth Factor Receptor β), ANGPT2 (Angiopoietin 2), and ANGPT1 (Angiopoietin 1) decrease with age, while the smooth muscle cell-related gene ACTA2 (Actin) decreases. Alpha 2, Smooth Muscle) was confirmed to increase.

Therefore, it indicates that the increase in choriocapillaris smooth muscle cells according to aging interferes with the supply of nutrients from the blood vessels to the retina and the discharge of waste products from the retina to the blood vessels, which may lead to retinal degeneration.

Example 3. Confirmation of effect of ACTA2 inhibitor on mouse choroidal tissue

The present inventors described [Int. J. Mol. Sci. 2020, 21, 2158], it was confirmed that smooth muscle cells and their related gene, ACTA2 (αSMA), increased in the capillaries of the retina and choroid in diabetes-induced experimental animals.

Therefore, in order to suppress the excessive proliferation and distribution of smooth muscle cells, the present inventors prepared siRNA that inhibits ACTA2, a major functional gene of smooth muscle cells, treated the choroidal tissue of 8-week-old mice, and confirmed the expression of ACTA2 mRNA did siRNA was pooled with #1, #2, #3 alone and #1 to #3.

The lyophilized siRNA and miRNA ordered in a dose of 10 nmole were dissolved in 20 μl of tertiary sterile distilled water and diluted to a concentration of 500 pmol/μl, and then, using a 38 G INCYTO micro-needle (INCYTO, KR), the vitreous body of the mouse eye 1 μl of each was injected (0.5 nmole/eye). In the case of siRNA, #1, #2, and #3 were injected, respectively, or #1, #2, and #3 were mixed in a molar ratio of 1:1:1 and then injected.

As a result, as shown in FIG. 3 , it was confirmed that the prepared siRNAs significantly inhibited ACTA2 compared to the negative control group. was found to be the best.

Therefore, when siRNA was required in the experiments conducted below, #1, #2, and #3 were mixed in a molar ratio of 1:1:1 and used.

Example 4. Confirmation of the effect of intravitreal ACTA2 siRNA injection in elderly mice

To determine whether ACTA2 inhibition improves choroidal vasculature in elderly mice, intravitreal ACTA2 siRNA and miRNA were injected. After injection of siRNA and miRNA for ACTA2 inhibition into 1.5-year-old mice, the patterns of smooth muscle cells and perivascular cells in the retina and choroid were analyzed by Whole-mount immunofluorescence staining method one week later. For Vehicle, tertiary sterile distilled water was used, and Control (CTL) is a control in which scramble siRNA was mixed with sterile distilled water.

As a result, as shown in FIG. 4, cells expressing PDGFRβ, a perivascular cell marker gene, which were reduced by aging, were significantly increased by siRNA treatment, and cells expressing TAGLN, a smooth muscle cell marker, were significantly decreased. confirmed that

This indicates that excessive proliferation and distribution of smooth muscle cells in the choroidal vessels was inhibited by administration of siRNA, and the distribution of perivascular cells was increased.

In addition, as shown in FIG. 5 , it was confirmed that smooth muscle cells were significantly reduced in both the retina and choroid of elderly mice according to the administration of siRNA and miRNA.

These results indicate that ACTA2 inhibitors can be used for the treatment of retinal or choroidal diseases caused by aging.

Example 5. Confirmation of drusen production inhibitory effect of ACTA2 inhibitor on age-related macular degeneration (AMD)

The effect of the ACTA2 inhibitor was confirmed using the AMD model prepared in Examples 1-3. Two weeks after AMD induction, ACTA2 inhibitor siRNA and miRNA were respectively injected into the vitreous cavity, and drusen generation was analyzed by fundus imaging after 4 weeks. Control (CTL) is a control in which scramble siRNA is mixed with sterile distilled water.

As shown in FIG. 6 , it was confirmed that the generation of drusen was effectively inhibited in the experimental group injected with the ACTA2 inhibitor compared to the control group.

Therefore, it was confirmed that AMD could be effectively treated by inhibiting ACTA2.

Example 6. Confirmation of retinal function recovery effect of ACTA2 inhibitor on age-related macular degeneration (AMD)

The effect of the ACTA2 inhibitor was confirmed using the AMD model prepared in Examples 1-3. Two weeks after AMD induction, ACTA2 inhibitor siRNA and a control vehicle (tertiary sterile distilled water + scramble siRNA) were each injected into the vitreous cavity, and visual function was measured by performing electroretinalography two weeks later.

As shown in FIG. 7 , as the ACTA2 inhibitor was injected, the electric potential waveform was restored similar to that of normal mice, the a-wave amplitude indicating the functional recovery of photoreceptors also increased, and the b-wave amplitude indicating the restoration of retinal blood vessels. also significantly increased. In addition, latency was also reduced, indicating that the functions of horizontal cells and bipolar cells were also restored.

Example 7. Confirmation of the angiogenesis inhibitory effect of ACTA2 inhibitors on wet AMD

The angiogenesis inhibitory effect on wet AMD was confirmed using the laser-induced choroidal neovascularization model prepared in Examples 1-4. 1 μl of ACTA2 inhibitor (siRNA and miRNA) diluted to a concentration of 500 pmol/μl in 7-week-old mice was injected into the vitreous of the mouse eye using a 38 G INCYTO microneedle (INCYTO, KR) (0.5 nmole/eye) . Wet AMD was induced by laser use one week after administration. In 10-week-old mice, blood vessels, perivascular cells, and smooth muscle cells were stained using immunofluorescence staining, and then choroidal neovascularization was analyzed by imaging with a confocal microscope. The area of new blood vessels was analyzed using the method 1-8 above for images acquired with a confocal microscope, and the degree of neovascularization coverage of perivascular cells and smooth muscle cells was compared through colocalization analysis. Control (CTL) is a control in which scramble siRNA is mixed with sterile distilled water.

As shown in Figure 8, both siRNA and miRNA significantly reduced the size of choroidal neovascularization (CNV) compared to the control, and accordingly, the distribution of smooth muscle cells in the corresponding region compared to the CNV size in the ROI of CNV was significantly reduced. could confirm that In addition, it was confirmed that PDGFRβ, a distribution marker of perivascular cells, was significantly increased.

Example 8. Confirmation of therapeutic effect of ACTA2 inhibitor on diabetic mouse model

8-1. Confirmation of the effect of reducing angiogenesis and vascular leakage

Using the diabetic mouse model prepared in Example 1-2, abnormal angiogenesis and vascular leakage inhibitory effects were confirmed on diabetic retinopathy and diabetic chorioretinopathy models. ACTA2 inhibitor miRNA diluted to a concentration of 500 pmole/μl in 16-week-old mice was injected into the vitreous of the mouse eye using a 38G INCYTO microneedle (INCYTO, KR) by 1 μl (0.5 nmole/eye). 3 weeks after administration, fluorescence angiography (FAG), fundus photography, and indocyanine green angiography (ICGA) were performed. Control (CTL) is a control in which scramble siRNA is mixed with sterile distilled water.

As shown in FIG. 9 , it was confirmed that, as a result of administering the ACTA2 inhibitor, abnormal retinal neovascularization and vascular leakage were significantly reduced compared to the control group. It was confirmed that, by the administration of the ACTA2 inhibitor, the abnormal hyperfluorescence response indicating choroidal leakage on the ICGA was also reduced.

8-2. Confirmation of the effect of reducing the formation of microaneurysm in the retina

After 3 weeks of administration of ACTA2 inhibitors (siRNA and miRNA) to 16-week-old mice, fluorescence fundus imaging was performed to observe retinal microvascularization. The ACTA2 inhibitor was administered in the same manner as in 8-1.

As shown in FIG. 10 , as a result of administering an ACTA2 inhibitor to a diabetic mouse model, it was confirmed that microvascular flow in the retina, which corresponds to a typical vascular change in diabetic retinopathy, was significantly reduced.

8-3. Confirmation of the effect of dilation of choroidal vessels and reducing leakage

By indocyanine green angiography (ICGA) 3 weeks after ACTA2 inhibitor (siRNA and miRNA) administration to 16-week-old mice, the appearance of choroidal vessels was observed. The ACTA2 inhibitor was administered in the same manner as in 8-1.

As shown in FIG. 11 , as a result of administering an ACTA2 inhibitor to a diabetic mouse model, it was confirmed that dilation and leakage of choroidal vessels, which are typical symptoms of diabetic chorioretinopathy, were significantly reduced.

8-4. Confirmation of choroidal inflammation relief effect

The effect of alleviating choroidal inflammation was confirmed by performing immunofluorescence staining 3 weeks after the administration of ACTA2 inhibitors (siRNA and miRNA) to 16-week-old mice. The ACTA2 inhibitor was administered in the same manner as in 8-1.

As shown in FIG. 12 , as a result of administering an ACTA2 inhibitor to a diabetic mouse model, microglia aggregated in the retinal pigment epithelium and choroidal tissue were reduced, indicating that choroidal inflammation, a characteristic of diabetic chorioretinopathy, was improved. It is a supporting result.

The above description of the present invention is for illustration, and those of ordinary skill in the art to which the present invention pertains can understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive.

<110> THE ASAN FOUNDATION University of Ulsan Foundation For Industry Cooperation <120> Pharmaceutical composition for treating retinal or choroidal disease comprising an ACTA2 inhibitor as an active ingredient <130> MP20-200P1 <150> KR 10-2020-0131954 <151> 2020-10-13 <160> 9 <170> KoPatentIn 3.0 <210> 1 <211> 377 <212> PRT <213> Artificial Sequence <220> <223> ACTA2, protein, NP_001135417.1 <400> 1 Met Cys Glu Glu Glu Asp Ser Thr Ala Leu Val Cys Asp Asn Gly Ser 1 5 10 15 Gly Leu Cys Lys Ala Gly Phe Ala Gly Asp Asp Ala Pro Arg Ala Val 20 25 30 Phe Pro Ser Ile Val Gly Arg Pro Arg His Gln Gly Val Met Val Gly 35 40 45 Met Gly Gln Lys Asp Ser Tyr Val Gly Asp Glu Ala Gln Ser Lys Arg 50 55 60 Gly Ile Leu Thr Leu Lys Tyr Pro Ile Glu His Gly Ile Ile Thr Asn 65 70 75 80 Trp Asp Asp Met Glu Lys Ile Trp His His Ser Phe Tyr Asn Glu Leu 85 90 95 Arg Val Ala Pro Glu Glu His Pro Thr Leu Leu Thr Glu Ala Pro Leu 100 105 110 Asn Pro Lys Ala Asn Arg Glu Lys Met Thr Gln Ile Met Phe Glu Thr 115 120 125 Phe Asn Val Pro Ala Met Tyr Val Ala Ile Gln Ala Val Leu Ser Leu 130 135 140 Tyr Ala Ser Gly Arg Thr Thr Gly Ile Val Leu Asp Ser Gly Asp Gly 145 150 155 160 Val Thr His Asn Val Pro Ile Tyr Glu Gly Tyr Ala Leu Pro His Ala 165 170 175 Ile Met Arg Leu Asp Leu Ala Gly Arg Asp Leu Thr Asp Tyr Leu Met 180 185 190 Lys Ile Leu Thr Glu Arg Gly Tyr Ser Phe Val Thr Thr Ala Glu Arg 195 200 205 Glu Ile Val Arg Asp Ile Lys Glu Lys Leu Cys Tyr Val Ala Leu Asp 210 215 220 Phe Glu Asn Glu Met Ala Thr Ala Ala Ser Ser Ser Ser Leu Glu Lys 225 230 235 240 Ser Tyr Glu Leu Pro Asp Gly Gln Val Ile Thr Ile Gly Asn Glu Arg 245 250 255 Phe Arg Cys Pro Glu Thr Leu Phe Gln Pro Ser Phe Ile Gly Met Glu 260 265 270 Ser Ala Gly Ile His Glu Thr Thr Tyr Asn Ser Ile Met Lys Cys Asp 275 280 285 Ile Asp Ile Arg Lys Asp Leu Tyr Ala Asn Asn Val Leu Ser Gly Gly 290 295 300 Thr Thr Met Tyr Pro Gly Ile Ala Asp Arg Met Gln Lys Glu Ile Thr 305 310 315 320 Ala Leu Ala Pro Ser Thr Met Lys Ile Lys Ile Ile Ala Pro Pro Glu 325 330 335 Arg Lys Tyr Ser Val Trp Ile Gly Gly Ser Ile Leu Ala Ser Leu Ser 340 345 350 Thr Phe Gln Gln Met Trp Ile Ser Lys Gln Glu Tyr Asp Glu Ala Gly 355 360 365 Pro Ser Ile Val His Arg Lys Cys Phe 370 375 <210> 2 <211> 1805 <212> DNA <213> Artificial Sequence <220> <223> ACTA2, mRNA, NM_001141945.2 <400> 2 gcaggctctc tccccgcccc cgcggggcgg cgcgcactca cccacccgcg ccggagcgga 60 cctttggctt ggcttgtcag ggcttgtcca ggagttccgc tcctctctcc aaccggggtc 120 cccctccagc gaccctaaag cttcccagac ttccgcttca attcctgtcc gcaccccacg 180 cccacctcaa cgtggagcgc agtggtctcc gaggagcgcc ggagctgccc cgcctgccca 240 gcggggtcag cacttcgcat caaggcccaa gaaaagcaag tcctccagcg ttctgagcac 300 ccgggcctga gggaaggtcc taacagcccc cgggagccag tctccaacgc ctcccgcagc 360 agcccgccgc tcccaggtgc ccgcgtgcgc cgctgccgcc gcaatcccgc acgcgtcccg 420 cgcccgcccc actttgccta tccccgggac taagacggga atcctgtgaa gcagctccag 480 ctatgtgtga agaagaggac agcactgcct tggtgtgtga caatggctct gggctctgta 540 aggccggctt tgctggggac gatgctccca gggctgtttt cccatccatt gtgggacgtc 600 ccagacatca gggggtgatg gtgggaatgg gacaaaaaga cagctacgtg ggtgacgaag 660 cacagagcaa aagaggaatc ctgaccctga agtacccgat agaacatggc atcatcacca 720 actgggacga catggaaaag atctggcacc actctttcta caatgagctt cgtgttgccc 780 ctgaagagca tccccaccctg ctcacggagg cacccctgaa ccccaaggcc aaccgggaga 840 aaatgactca aattatgttt gagactttca atgtcccagc catgtatgtg gctatccagg 900 cggtgctgtc tctctatgcc tctggacgca caactggcat cgtgctggac tctggagatg 960 gtgtcaccca caatgtcccc atctatgagg gctatgcctt gccccatgcc atcatgcgtc 1020 tggatctggc tggccgagat ctcactgact acctcatgaa gatcctgact gagcgtggct 1080 attccttcgt tactactgct gagcgtgaga ttgtccggga catcaaggag aaactgtgtt 1140 atgtagctct ggactttgaa aatgagatgg ccactgccgc atcctcatcc tcccttgaga 1200 agagttacga gttgcctgat gggcaagtga tcaccatcgg aaatgaacgt ttccgctgcc 1260 cagagaccct gttccagcca tccttcatcg ggatggagtc tgctggcatc catgaaacca 1320 cctacaacag catcatgaag tgtgatattg acatcaggaa ggacctctat gctaacaatg 1380 tcctatcagg gggcaccact atgtaccctg gcattgccga ccgaatgcag aaggagatca 1440 cggccctagc acccagcacc atgaagatca agatcattgc ccctccggag cgcaaatact 1500 ctgtctggat cggtggctcc atcctggcct ctctgtccac cttccagcag atgtggatca 1560 gcaaacagga atacgatgaa gccgggcctt ccattgtcca ccgcaaatgc ttctaaaaca 1620 ctttcctgct cctctctgtc tctagcacac aactgtgaat gtcctgtgga attatgcctt 1680 cagttctttt ccaaatcatt cctagccaaa gctctgactc gttacctatg tgttttttaa 1740 taaatctgaa ataggctact ggtaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1800 aaaaa 1805 <210> 3 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> siRNA 1_sense <400> 3 cguacacaag acucucaca 19 <210> 4 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> siRNA 1_antisense <400> 4 ugugagaguc uuguguacg 19 <210> 5 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> siRNA 2_sense <400> 5 cacauugcac cuggaucau 19 <210> 6 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> siRNA 2_antisense <400> 6 augauccagg ugcauagug 19 <210> 7 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> siRNA 3_sense <400> 7 gauuuguuac ucgugguuu 19 <210> 8 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> siRNA 3_antisense <400> 8 aaaccacgag uaacaaauc 19 <210> 9 <211> 69 <212> RNA <213> Artificial Sequence <220> <223> has-miR-4524a-3p <400> 9 gaacgauagc agcaugaacc ugucucacug cagaauuauu uugagacagg cuuaugcugc 60 uauuccuuca 69

Claims (15)

A pharmaceutical composition for preventing or treating retinal or choroidal disease comprising an ACTA2 (Actin Alpha 2, Smooth Muscle) inhibitor as an active ingredient.
According to claim 1,
The inhibitor is an ACTA2 activity inhibitor or expression inhibitor, characterized in that the retina or choroidal disease prevention or treatment pharmaceutical composition.
3. The method of claim 2,
The activity inhibitor is a compound that specifically binds to the ACTA2 protein, a peptide, a peptidomimetic, a matrix analogue, an aptamer, and a pharmaceutical composition for preventing or treating retinal or choroidal disease, characterized in that at least one selected from the group consisting of an antibody .
3. The method of claim 2,
The expression inhibitor is an antisense nucleotide complementary to the mRNA of ACTA2 gene, RNAi, siRNA, miRNA, shRNA, characterized in that at least one selected from the group consisting of ribozyme, retinal or choroidal disease prevention or treatment pharmaceutical composition .
5. The method of claim 4,
The siRNA is a pharmaceutical composition for preventing or treating retinal or choroidal disease, characterized in that it comprises one or more nucleotide sequences selected from the group consisting of SEQ ID NOs: 3 to 8.
6. The method of claim 5,
The siRNA is SEQ ID NO: 3 and 4; SEQ ID NOs: 5 and 6; And SEQ ID NOs: 7 and 8, characterized in that it comprises one or more siRNA selected from the group consisting of, retinal or choroidal disease prevention or treatment pharmaceutical composition.
5. The method of claim 4,
The miRNA is a pharmaceutical composition for preventing or treating retinal or choroidal disease, characterized in that miR-4524a.
According to claim 1,
Said retinal or choroidal disease is retinitis pigmentosa (RP), Leber congenital amaurosis (LCA), Stargardt's disease, Usher syndrome, choroidal insufficiency, Rod-Con or Con-Rod's dystrophy, ciliopathy, mitochondrial disorder, progressive Retinal atrophy, degenerative retinal disease, age-related macular degeneration (AMD), wet AMD, dry AMD, central serous chorioretinopathy, choroid thickening disease group, degenerative myopia, nodular chorioretinopathy, chorioretinitis, choroid tumor, choroidal neovascularization, Hereditary choroidal disease, map atrophy, familial or acquired maculopathy, retinal photoreceptor disease, retinal pigment epithelial-system disease, diabetic retinopathy, diabetic chorioretinopathy, cystic macular edema, uveitis, retinal detachment, traumatic retinal injury, clinic Sexual retinal damage, macular foramen, macular telangiectasia, ganglion cell disease, optic nerve cell disease, glaucoma, optic neuropathy, ischemic retinal disease, retinopathy of prematurity, retinal vascular occlusion, familial macroanurism, retinal vascular disease, ophthalmic vascular disease, glaucoma A pharmaceutical composition for preventing or treating retinal or choroidal disease, characterized in that at least one selected from the group consisting of retinal nerve cell degeneration and ischemic optic neuropathy due to.
4. The method of claim 3,
The ACTA2 protein is a pharmaceutical composition for preventing or treating retinal or choroidal disease, characterized in that it comprises the amino acid sequence represented by SEQ ID NO: 1.
According to claim 1,
The composition is characterized in that it is administered by one or more routes selected from the group consisting of oral, subcutaneous, intraperitoneal, intrapulmonary, intranasal, intramuscular, intravenous, intraarterial and ophthalmic administration, retinal or choroidal disease prevention or A therapeutic pharmaceutical composition.
11. The method of claim 10,
The eye topical administration is for preventing or treating retinal or choroidal disease, characterized in that one selected from the group consisting of intraconjunctival sac administration, intravitreal administration, subretinal administration, suprachoroidal administration, subconjunctival administration and subtenon's capsule administration pharmaceutical composition.
According to claim 1,
The composition is characterized in that it further comprises an anti-VEGF agent, a pharmaceutical composition for preventing or treating retinal or choroidal disease.
13. The method of claim 12,
The composition defined in claim 1 is a pharmaceutical composition for preventing or treating retinal or choroidal disease, characterized in that it is administered simultaneously or sequentially with the anti-VEGF agent.
According to claim 1,
The composition is characterized in that it has one or more effects selected from the group consisting of the following items, a pharmaceutical composition for preventing or treating retinal or choroidal disease:
inhibition of proliferation or distribution of smooth muscle cells;
promoting proliferation or distribution of perivascular cells;
drusen reduction;
inhibition of retinal neovascularization or vascular leakage; and
Inhibition of dilation or leakage of choroidal vessels.
A quasi-drug composition for preventing or treating retinal or choroidal diseases comprising an ACTA2 inhibitor as an active ingredient.

Images