WO2013120086A1 - Inhibition of the glycine cleavage system for treatment of cancer - Google Patents
Inhibition of the glycine cleavage system for treatment of cancer Download PDFInfo
- Publication number
- WO2013120086A1 WO2013120086A1 PCT/US2013/025601 US2013025601W WO2013120086A1 WO 2013120086 A1 WO2013120086 A1 WO 2013120086A1 US 2013025601 W US2013025601 W US 2013025601W WO 2013120086 A1 WO2013120086 A1 WO 2013120086A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- tumor
- gcs
- shmt2
- cell
- inhibitor
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/13—Amines
- A61K31/145—Amines having sulfur, e.g. thiurams (>N—C(S)—S—C(S)—N< and >N—C(S)—S—S—C(S)—N<), Sulfinylamines (—N=SO), Sulfonylamines (—N=SO2)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61N—ELECTROTHERAPY; MAGNETOTHERAPY; RADIATION THERAPY; ULTRASOUND THERAPY
- A61N5/00—Radiation therapy
- A61N5/10—X-ray therapy; Gamma-ray therapy; Particle-irradiation therapy
- A61N5/1001—X-ray therapy; Gamma-ray therapy; Particle-irradiation therapy using radiation sources introduced into or applied onto the body; brachytherapy
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61N—ELECTROTHERAPY; MAGNETOTHERAPY; RADIATION THERAPY; ULTRASOUND THERAPY
- A61N5/00—Radiation therapy
- A61N5/10—X-ray therapy; Gamma-ray therapy; Particle-irradiation therapy
- A61N5/1077—Beam delivery systems
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/5011—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing antineoplastic activity
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/573—Immunoassay; Biospecific binding assay; Materials therefor for enzymes or isoenzymes
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57557—Immunoassay; Biospecific binding assay; Materials therefor for cancer of other specific parts of the body, e.g. brain
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61N—ELECTROTHERAPY; MAGNETOTHERAPY; RADIATION THERAPY; ULTRASOUND THERAPY
- A61N5/00—Radiation therapy
- A61N5/10—X-ray therapy; Gamma-ray therapy; Particle-irradiation therapy
- A61N2005/1085—X-ray therapy; Gamma-ray therapy; Particle-irradiation therapy characterised by the type of particles applied to the patient
- A61N2005/1087—Ions; Protons
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61N—ELECTROTHERAPY; MAGNETOTHERAPY; RADIATION THERAPY; ULTRASOUND THERAPY
- A61N5/00—Radiation therapy
- A61N5/10—X-ray therapy; Gamma-ray therapy; Particle-irradiation therapy
- A61N2005/1085—X-ray therapy; Gamma-ray therapy; Particle-irradiation therapy characterised by the type of particles applied to the patient
- A61N2005/1089—Electrons
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61N—ELECTROTHERAPY; MAGNETOTHERAPY; RADIATION THERAPY; ULTRASOUND THERAPY
- A61N5/00—Radiation therapy
- A61N5/10—X-ray therapy; Gamma-ray therapy; Particle-irradiation therapy
- A61N2005/1085—X-ray therapy; Gamma-ray therapy; Particle-irradiation therapy characterised by the type of particles applied to the patient
- A61N2005/109—Neutrons
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/90—Enzymes; Proenzymes
- G01N2333/91—Transferases (2.)
- G01N2333/91005—Transferases (2.) transferring one-carbon groups (2.1)
- G01N2333/91028—Hydroxymethyl-, formyl-transferases (2.1.2)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
- G01N2500/04—Screening involving studying the effect of compounds C directly on molecule A (e.g. C are potential ligands for a receptor A, or potential substrates for an enzyme A)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis
Definitions
- Cancer is a major cause of death and was responsible for approximately 7.6 million deaths worldwide (around 13% of all deaths) in 2008 according to the World Health Organization. Although notable successes have been achieved in the pharmacological therapy of a number of tumor types, many tumors remain difficult to treat. For example, the median life expectancy of people with glioblastoma multiforme (GBM), the most common primary brain tumor in adults, is about 12-18 months post-diagnosis, even when treated with current state of the art therapies. There is a need for new targets and therapeutic approaches for the treatment of cancer.
- GBM glioblastoma multiforme
- the present disclosure provides a method of inhibiting proliferation or survival of a tumor cell, the method comprising inhibiting the glycine cleavage system (GCS) of the cell.
- the method comprises contacting the tumor cell with a GCS inhibitor.
- the tumor cell overexpresses serine hydroxymethyltransferase 2 (SHMT2).
- the disclosure provides a method of inhibiting tumor
- the method comprising contacting a tumor with a GCS inhibitor.
- the tumor overexpresses SI 1MT2.
- the disclosure provides method of treating a subject in need f treatment for a tumor the method comprising treating the subject with a GCS inhibitor.
- a method of treating a subject comprises (a) providing a subject in need of treatment for a tumor, and (b) administering a GCS inhibitor to the subject.
- the tumor overexpresses SHMT2.
- a method comprises
- a method comprises (a) diagnosing a subject as having a tumor; and (b) treating the subject with a GCS inhibitor.
- a method comprises (a) diagnosing a subject as having a tumor; and
- a method comprises determining that the subject has a tumor that overexpresses SHMT2.
- the disclosure provides a method of classifying a tumor cell, tumor cell line, or tumor, the method comprising assessing SHMT2 expression in the tumor cell, tumor cell line, or tumor, and (b) classifying the tumor cell, tumor cell line, or tumor based on the result of step (a).
- step (b) comprises classifying the tumor cell, tumor cell line, or tumor as having increased likelihood of being sensitive to GCS inhibition if the tumor cell, tumor cell line, or tumor oveexpresses SHMT2.
- the disclosure provides a method of identifying a subject who is a suitable candidate for treatment with a GCS inhibitor, the method comprising assessing SHMT2 expression in a tumor sample obtained from the subject.
- FIGS 1A-1C shRNAs which knock down GLDC are toxic to GBMSCs.
- BT145 cells were either infected with a lentivirus expressing hairpins targeting GLDC (Gl to G5) or a control hairpin targeting GFP.
- A Western blotting for GLDC demonstrates strong suppression of GLDC expression for hairpins Gl, G4, and G5.
- B When cell viability was measured using a ATP assay , we found that shRNAs Gl, G4, and G5 significantly impaired cell viability relative to GFP control hairpin, but not G2 or G3 shRNAs.
- Gl, G4, and G5 to the GFP control were each statistically significant at 5 days and 7.5 days (p ⁇ 0.05) (error bars not shown for clarity).
- C Morphology of BT145 neurospheres following GLDC knockdown indicates toxicity. As shown, G2, G3, and GFP infected neurospheres form large, round, and regular spheres, indicating viability. On the other hand, Gl. G4. or G5 infected spheres are small, irregular, and are in the process of disintegrating, indicating cell death and impaired growth.
- FIG. 1 Different cell lines are either sensitive or insensitive to shRNA- tnediated knockdown of GLDC. As shown on the left table in red font, cell lines of varying origins are sensitive to GLDC knockdown. "Sensitivity%” indicates the average % drop in viability following Gl or G5 shRNA expression, where 100% would indicate complete loss of viability. On the right, a plot for BT145 viability (from Figure 1) is shown as an example of a "sensitive" group cell.
- BT145DIF and 308DIF indicates BT145 and 0308 GBMSC lines which were differentiated by serum treatment prior to shRNA infection.
- FIGS. 3A-3C GLDC shRNA sensitive lines, but not insensitive lines, are also sensitive to pharmacological inhibition of the GCS, and to shRNA knockdown of another GCS component (GCSH).
- GCSH GCS component
- A Various cell lines were treated with ImM cysteamine for 4 days. Cell viability, shown as relative light units, was measured and data from multiple experiments is shown ⁇ S.D.
- B Western blotting for GCSH demonstrates strong suppression of GCSH expression by GSl, GS2, GS3, and GS4 lentiviral shRNAs directed against GCSH, in LN229 cells.
- C Various cells lines were infected with GS l, GS2, GS3, or GS4 shRNAs for 6 days.
- FIG. 4 Mitochondrial serine hydroxylmethyltransferase expression is tightly correlated with sensitivity to GLDC knockdown/GCS inhibition.
- Numerous cell lines were grown in identical media (neurobasal media supplemented with EGF and FGF) for two days prior to harvesting cells and performing Western blot for various genes involved in the glycine cleavage complex, or proximal metabolic enzymes.
- Red font indicates cell lines which we had previously determined, as shown in Figure 2, to be sensitive to GLDC knockdown; blue font indicates insensitive cell lines.
- 'BT145 Dif and '0308 Dif indicates BT145 and 0308 GBM-SC lines which were induced to differentiate by growing in media containing 10% inactivated fetal bovine serum.
- FIGS 5A-5E Knockdown of SHMT2 rescues against the toxic effects of GLDC knockdown.
- A ShR As S 1-S5, directed against SHMT2, effectively knock down SHMT2. Shown are Western Blot analyses from BT145 cells infected with S1-S5 or control (GFP) shRNAs for 5 days. Similar results were observed across various cell lines (not shown).
- B Various cell lines were infected with S1-S5 or control (GFP) shRNAs for 6 days then measured for cell viability. The blue line indicates cell viability for each cell line when infected with control (GFP) shRNA, which was set as 100%. Thus, data for each cell line is shown as a % relative to viability when infected with shGFP.
- Dotted line indicates the level of cell viability of cells initially expressing GFP shRNAs then infected with Gl for 7 days. Viability is expressed as a % of the viability when each stable line was secondarily infected with GFP shRNAs, which was set at 100%.
- E Representative light micrographs of neurospheres initially expressing either GFP or S3 shRNAs then secondarily infected with Gl, G4, or G5 shRNAs. As shown, Gl , G4, or G5 infection of shGFP-expressing cells results in small, disintegrating neurospheres indicative of cell death, while cells expressing S3 are protected.
- FIGS 6A-6B SHMT2 protein expression is elevated in GBM.
- A IHC micrograph of a representative normal brain (white matter region) and three representative GBM tumors. The three images represent the range of signal that is observed across 7 GBMs. Fields of view are at 100X magnification.
- B High magnification micrographs showing cytoplasmic punctate staining pattern of SHMT2 in normal brain and GBM tumors. In some cells in GBM, the signal is so strong that individual punctae are not easily distinguished. DAB incubation times were identical for all samples. Fields of view are at 600X
- Agent is used herein to refer to any substance, compound (e.g., molecule), supramolecular complex, material, or combination or mixture thereof.
- a compound may be any agent that can be represented by a chemical formula, chemical structure, or sequence.
- agents include, e.g., small molecules, polypeptides, nucleic acids (e.g., RNAi agents, antisense oligonucleotide, aptamers), lipids, polysaccharides, etc.
- agents may be obtained using any suitable method known in the art. The ordinary skilled artisan will select an appropriate method based, e.g., on the nature of the agent.
- An agent may be at least partly purified.
- an agent may be provided as part of a composition, which may contain, e.g., a counter-ion, aqueous or non-aqueous diluent or carrier, buffer, preservative, or other ingredient, in addition to the agent, in various embodiments.
- an agent may be provided as a salt, ester, hydrate, or solvate.
- an agent is cell-permeable, e.g., within the range of typical agents that are taken up by cells and act intracellularly, e.g., within mammalian cells, to produce a biological effect. Certain compounds may exist in particular geometric or stereoisomeric forms.
- Such compounds including cis- and trans-isomers, E- and Z-isomers, R- and S ⁇ enantiomers, diastereomers, (D)-isomers, (L)-isomers, (-)- and (+)-isomers, racemic mixtures thereof, and other mixtures thereof are encompassed by this disclosure in various embodiments unless otherwise indicated.
- Certain compounds may exist in a variety or protonation states, may have a variety of configurations, may exist as solvates (e.g., with water (i.e. hydrates) or common solvents) and/or may have different crystalline forms (e.g., polymorphs) or different tautomeric forms. Embodiments exhibiting such alternative protonation states, configurations, solvates, and forms are encompassed by the present disclosure where applicable.
- An "analog" of a first agent refers to a second agent that is .structurally and/or functionally similar to the first agent.
- A"structural analog" of a first agent is an analog that is structurally similar to the first agent.
- a structural analog of an agent may have substantially similar physical, chemical, biological, and/or pharmacological propert(ies) as the agent or may differ in at least one physical, chemical, biological, or pharmacological property. In some embodiments at least one such property may be altered in a manner that renders the analog more suitable for a purpose of interest.
- a structural analog of an agent differs from the agent in that at least one atom, functional group, or substructure of the agent is replaced by a different atom, functional group, or substructure in the analog.
- a structural analog of an agent differs from the agent in that at least one hydrogen or substituent present in the agent is replaced by a different moiety (e.g., a different substituent) in the analog.
- Substrate analog refers to an agent that structurally resembles the substrate of an enzymatic reaction. The structure of a substrate analog may be sufficiently similar to that of a normal substrate so that the substrate analog can substitute for the normal substrate in a physical interaction (e.g., binding) with an enzyme.
- the structure of a substrate analog is sufficiently different from that of a normal substrate so that the substrate analog may not undergo a chemical reaction as would a normal substrate (e.g., the reaction may not detectably occur or may occur more slowly.
- Transition state analog refers to an agent that structurally resembles the transition state of a substrate in an enzymatic reaction.
- the structure of a transition state analog may be sufficiently similar to that of a normal transition state so that the transition state analog can physically interact with (e.g., bind to) an enzyme.
- the structure of a transition state analog is sufficiently different to that of a normal transition state so that the transition state analog may not undergo a chemical reaction as would a normal transition state.
- a substrate analog or transition state analog may act as an enzyme inhibitor by, e.g., by blocking the enzyme active site.
- a substrate analog or transition state analog may comprise a moiety that reacts with an enzyme to form a covalent bond.
- antibody refers to an immunoglobulin, whether natural or wholly or partially synthetically produced.
- An antibody may be a member of any immunoglobulin class, including any of the mammalian, e.g.. human, classes: IgG. IgM, IgA, IgD, and IgE, or subclasses thereof, and may be an antibody fragment, in various embodiments.
- an antibody may originate from any of a variety of vertebrate (e.g., mammalian or avian) organisms, e.g., mouse, rat, rabbit, hamster, goat, chicken, human, camelid, shark, etc., or may be encoded at least in part by immunoglobulin gene sequences derived from any of the foregoing organisms.
- an antibody is a nanobody.
- the term "antibody fragment" refers to any of various portions of an antibody that contain less than a complete antibody structure (e.g., less than the complete structure of a conventional antibody composed of two heavy and two light chains). In general, an antibody fragment retains at least a significant portion of the complete antibody's specific binding ability.
- antibody fragments include, but are not limited to, Fab, Fab', F(ab')2, scFv, Fv, dsFv diabody, minibody, Fd fragments, and single domain antibodies. Standard methods of antibody identification and production known in the art can be used to produce an antibody that binds to a polypeptide of interest.
- an antibody is a monoclonal antibody. Monoclonal antibodies can be identified and/or produced using, e.g., hybridoma technology or recombinant nucleic acid technology in various embodiments.
- an antibody is selected from a library, e.g., a phage or yeast display library.
- an antibody is a chimeric, humanized, or fully human antibody. In some embodiments an antibody is a polyclonal antibody. In some embodiments an antibody comprises at least two distinct antigen-binding sites that bind to distinct epitopes. In some embodiments an antibody has a label attached (e.g., covalently attached) thereto (e.g., the label may comprise a radioisotope, fluorescent agent, enzyme, hapten). In some
- a single chain antibody may be created by joining the antigen-binding variable regions of heavy chain (VH) and light chain (VL) with a linking domain.
- a linking domain may comprise a peptide of, e.g., about 10 to about 25 amino acids.
- aptamer refers to an oligonucleotide that binds specifically and with high affinity to a target of interest, e.g., a polypeptide. (It will be understood that the term “aptamer” is typically employed when the target of interest is not a nucleic acid
- An aptamer may be identified through a selection process using, e.g., systematic evolution of ligands by exponential enrichment (SELEX) or various directed evolution techniques. See, e.g., Turek, C. and Gold, L., Science 249: 505-10, 1990; Brody EN and Gold LJ, Biotechnol. J, 74(1):5-13, 2000; L. Cerchia and V. de
- An aptamer is typically single-stranded (although it may form regions of double-stranded secondary structure through intramolecular complementarity).
- an "assay” may encompass any procedure or process of sequence of procedures or processes that may be used to identify or assess something.
- assess encompass characterizing, detecting, determining, measuring, evaluating, estimating, analyzing, testing, etc.
- the thing being identified or assessed may be, e.g., a gene, gene product, reactant or product of a reaction, a pathway, an agent, a composition, a cell, a cell line, a tumor, a subject, a reagent for use in a composition or method, etc.
- an assay may be qualitative or may be at least in part quantitative, e.g., it may provide a measurement, which may be expressed numerically.
- a measurement may be relative or absolute in various embodiments.
- an assay provides a measurement of a magnitude, concentration, level, amount, intensity, degree of modulation (e.g., reduction or enhancement), activity, or a change in any of the foregoing, etc.
- a screen may comprise assessing an entity for one or more properties of interest or for its suitability for one or more purposes or applications of interest or may comprise identifying an entity that has one or more properties of interest or that is or may be suitable for one or more purposes or applications of interest.
- a screen may comprise, e.g., one or more assays, a computer-aided procedure or process, etc.
- the thing being or to identified or assessed may be, e.g., a gene, gene product, reactant or product of a reaction, a pathway, an agent, a composition, a cell, a cell line, a tumor, a subject, a reagent for use in a composition or method, etc., or may be a sequence, structure, or other information or representation that may be manipulated, analyzed, processed, or displayed using a computer.
- a screen comprises assessing multiple entities (e.g., multiple agents, e.g., multiple test agents) in a coordinated manner, e.g., under common direction or control.
- a screen may comprise performing the same or essentially the same assay multiple times, e.g., using multiple different test agents.
- the assays may be performed using the same assay system (e.g.. using the same equipment/instrumentation).
- the assays may be performed using essentially the same assay composition, differing in the identity of the test agent.
- the assays may be performed using a predetermined set of test agents, e.g., a library of agents.
- Cellular marker refers to a molecule (e.g., a protein, RNA, DNA, lipid, carbohydrate) or portion thereof, the level of which in or on a cell (e.g., at least partly exposed at the cell surface) characterizes, indicates, or identifies one or more cell type(s), cell lineage(s), or tissue type(s) or characterizes, indicates, or identifies a particular state (e.g., a diseased or physiological state such as cancerous or normal, a differentiation state, a stem cell state).
- a level may be reported in a variety of different ways, e.g., high/low; +/-;
- a cell surface marker is a receptor.
- a targeting moiety may bind to an extracellular domain of a receptor.
- a receptor is a growth factor receptor, hormone receptor, integrin receptor, folate receptor, or transferrin receptor.
- a cellular marker may be cell type specific.
- a cell type specific marker is generally expressed or present at a higher level in or on (at the surface of) a particular cell type or cell types than in or on many or most other cell types (e.g., other cell types in the body or in an artificial environment).
- a cell type specific marker is present at detectable levels only in or on a particular cell type of interest.
- useful cell type specific markers may not be and often are not absolutely specific for the cell type of interest.
- a cellular marker e.g., a cell type specific marker
- a cellular marker e.g., a cell type specific marker
- a cellular marker e.g., a cell surface marker
- tumor cells e.g., a cell surface marker
- normal cells e.g., normal cells derived from the same organ and/or cell type.
- tumor cellular marker e.g., tumor cellular marker
- a tumor marker present on or at the surface of a tumor cell may be referred to as a "tumor cell surface marker”.
- a tumor cell surface marker is a molecule (or portion thereof) that is differentially expressed by at least some tumor cells as compared with non-tumor cells.
- a useful tumor cell surface marker may be expressed or overexpressed by one or more tumor types or a subset of tumors of one or more tumor types.
- a tumor cell surface marker is overexpressed by at least a factor of 1.5 in at least some cells of a tumor, relative to expression by normal cells, e.g.. normal cells derived from the same organ and/or cell type, as measured using a suitable assay.
- Tumor cell surface markers may include, e.g., proteins that are normally produced in very small quantities and are expressed in larger quantities by tumor cells, proteins that are normally produced only in certain stages of development (e.g., prior to birth), proteins whose structure (e.g..).
- a tumor cell surface marker is an expression product of a mutated gene, e.g., an oncogene or mutated tumor suppressor gene, an overexpressed or aberrantly expressed cellular protein, or an oncofetal antigen.
- a mutated gene e.g., an oncogene or mutated tumor suppressor gene, an overexpressed or aberrantly expressed cellular protein, or an oncofetal antigen.
- the level of a cellular marker may be determined using standard techniques such as Northern blotting, in situ hybridization, RT-PCR.
- a cell surface marker e.g., a cell type specific cell surface marker or a tumor cell surface marker, may be used to detect or isolate cells or as a target in order to deliver an agent to cells.
- the agent may be linked to a moiety that binds to a cell surface marker.
- Suitable binding moieties include, e.g., antibodies or Iigands, e.g., small molecules, aptamer, polypeptides.
- Computer-aided encompasses methods in which a computer system is used to gather, process, manipulate, display, visualize, receive, transmit, store, or otherwise handle information (e.g., data, results, structures, sequences, etc.).
- a method may comprise causing the processor of a computer to execute instructions to gather, process, manipulate, display, receive, transmit, or store data or other information.
- the instructions may be embodied in a computer program product comprising a computer-readable medium.
- a method comprises transmitting or receiving data or other information over a communication network.
- a communication network may, for example, comprise one or more intranets or the Internet.
- an "effective amount” or “effective dose” of an agent refers to the amount sufficient to achieve a desired biological and/or
- pharmacological effect e.g., when delivered to a cell or organism according to a selected administration form, route, and/or schedule.
- the absolute amount of a particular agent or composition that is effective may vary depending on such factors as the desired biological or pharmacological endpoint, the agent to be delivered, the target tissue, etc.
- an "effective amount" may be contacted with cells or administered in a single dose, or through use of multiple doses, in various embodiments.
- a biological effect may be, e.g., reducing expression or activity of one or more gene products, reducing activity of a metabolic nathwav or reaction, reducing cell proliferation or survival of cells (e.g., tumor cell proliferation or survival), reducing tumor maintenance, size, growth, or progression.
- expression encompasses the processes by which polynucleic acids (e.g., DNA) are transcribed to produce RNA, and (where applicable) RNA transcripts are translated into polypeptides.
- gene product encompasses products resulting from expression of a gene, such as RNA transcribed from a gene and polypeptides arising from translation of such RNA. It will be appreciated that certain gene products may undergo processing or modification, e.g., in a cell. For example, RNA transcripts may be spliced, polyadenylated, etc., prior to mRNA translation, and/or polypeptides may undergo co-translational or post-translational processing such as removal of secretion signal sequences, removal of organelle targeting sequences, or modifications such as phosphorylation, fatty acylation, etc.
- Genomic, mRNA, polypeptide sequences from a variety of species, including human, are known in the art and are available in publicly accessible databases such as those available at the National Center for Biotechnology Information (www.ncbi.nih.gov) or Universal Protein Resource (www.uniprot.org).
- Exemplary databases include, e.g., GenBank, RefSeq, Gene, UniProtKB/SwissProt, UniProtKB/Trembl, and the like.
- sequences e.g., mRNA and polypeptide sequences, in the NCBI Reference Sequence database may be used as gene product sequences for a gene of interest.
- multiple alleles of a gene may exist among individuals of the same species. For example, differences in one or more nucleotides (e.g., up to about 1%, 2%, 3-5% of the nucleotides) of the nucleic acids encoding a particular protein may exist among individuals of a given species.
- dbSNP Single Nucleotide Polymorphism Database
- dbSNP the NCBI database of genetic variation.
- embodiments may be directed to particular sequence(s), e.g., particular allele(s) or isoform(s).
- Identity or “percent identity” is a measure of the extent to which the sequence of two or more nucleic acids or polypeptides is the same.
- the percent identity between a sequence of interest A and a second sequence B may be computed by aligning the sequences, allowing the introduction of gaps to maximize identity, determining the number of residues (nucleotides or amino acids) that are opposite an identical residue, dividing by the minimum of TG A and TGB (here TG A and TG B are the sum of the number of residues and internal gap positions in sequences A and B in the alignment), and multiplying by 100.
- TG A and TG B are the sum of the number of residues and internal gap positions in sequences A and B in the alignment
- Sequences can be aligned with the use of a variety of computer programs known in the art.
- computer programs such as BLAST2, BLASTN, BLASTP, Gapped BLAST, etc.
- BLAST2 Altschul, Proc. Natl. Acad. Sci. USA 87:22264-2268, 1990
- the algorithm of Karlin and Altschul modified as in Karlin and Altschul, Proc. Natl. Acad Sci. USA 90:5873-5877, 1993 is incorporated into the NBLAST and XBLAST programs of Altschul et al. (Altschul, et al., J. Mol. Biol. 215:403-410, 1990).
- Gapped BLAST is utilized as described in Altschul et al. (Altschul, et al. Nucleic Acids Res. 25: 3389-3402, 1997).
- Altschul et al. Altschul, et al. Nucleic Acids Res. 25: 3389-3402, 1997.
- the default parameters of the respective programs may be used. See the Web site having URL
- a window of evaluation may have a length of at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 8U7o. 83 90%, 95%, 96%, 97%, 98%, 99%, or more, e.g., 100%, of the length of the shortest of the sequences being compared.
- a window of evaluation is at least 100; 200; 300; 400; 500; 600; 700; 800; 900; 1,000; 1,200; 1 ,500; 2,000; 2,500; 3,000; 3,500; 4,000; 4,500; or 5,000 amino acids.
- no more than 20%, 10%, 5%, or 1% of positions in either sequence or in both sequences over a window of evaluation are occupied by a gap. In some embodiments no more than 20%, 10%, 5%, or 1 % of positions in either sequence or in both sequences are occupied by a gap.
- “Inhibit” may be used interchangeably with terms such as “suppress”, “decrease”, “reduce” and like terms, as appropriate in the context. It will be understood that the extent of inhibition may vary. For example, inhibition may refer to a reduction of the relevant level by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%., 80%), 85%, 90%, 95%, 96%, 97%, 98%, or 99%. In some embodiments inhibition refers to a decrease of 100%, e.g., to background levels or undetectable levels. In some embodiments inhibition is statistically significant.
- Isolated means 1) separated from at least some of the components with which it is usually associated in nature; 2) prepared or purified by a process that involves the hand of man; and/or 3) not occurring in nature, e.g., present in an artificial environment.
- Nucleic acid is used interchangeably with “polynucleotide” and encompasses polymers of nucleotides.
- Oligonucleotide refers to a relatively short nucleic acid, e.g., typically between about 4 and about 100 nucleotides (nt) long, e.g., between 8-60 nt or between 10-40 nt long. Nucleotides include, e.g., ribonucleotides or deoxyribonucleotides.
- a nucleic acid comprises or consists of DNA or RNA.
- a nucleic acid comprises or includes only standard nucleobases (often referred to as "bases").
- a nucleic acid may comprise one or more non-standard nucleobases, which may be naturally occurring or non- natural ly occurring (i.e., artificial; not found in nature) in various embodiments.
- a nucleic acid may comprise chemically or biologically modified bases (e.g., alkylated (e.g., methylated) bases), modified sugars (e.g., 2'-0-alkyribose (e.g., 2'-0 methylribose), 2'-fluororibose, arabinose, or hexose), modified phosphate groups (e.g., phosphorothioates or 5'-N-phosphoramidite linkages).
- a nucleic acid comprises subunits (residues), e.g., nucleotides, that are linked by phosphodiester bonds.
- a nucleic acid comprises a locked nucleic acid, morpholino, or peptide nucleic acid.
- a nucleic acid may be linear or circular in various embodiments.
- a nucleic acid may be single-stranded, double- stranded, or partially double-stranded in various embodiments.
- An at least partially double- stranded nucleic acid may be blunt-ended or may have one or more overhangs, e.g., 5' and/or 3' overhang(s).
- Nucleic acid modifications e.g., base, sugar, and/or backbone
- RNA interference RNA interference
- modifications may, for example, increase stability (e.g., by reducing sensitivity to cleavage by nucleases), decrease clearance in vivo, increase cell uptake, or confer other properties that improve the potency, efficacy, specificity, or otherwise render the nucleic acid more suitable for an intended use.
- nucleic acid modifications are described in, e.g.. Deleavey GF, et al., Chemical modificatio of siRNA. Curr.
- a "polypeptide” refers to a polymer of amino acids linked by peptide bonds.
- a protein is a molecule comprising one or more polypeptides.
- a peptide is a relatively short polypeptide, typically between about 2 and 100 amino acids (aa) in length, e.g., between 4 and 60 aa; between 8 and 40 aa; between 10 and 30 aa.
- the terms "protein”, “polypeptide”, and “peptide” may be used interchangeably.
- a polypeptide may contain only standard amino acids or may comprise one or more non-standard amino acids (which may be naturally occurring or non-naturally occurring amino acids) and/or amino acid analogs in various embodiments.
- a “standard amino acid” is any of the 20 L-amino acids that are commonlv utilized in the synthesis of proteins by mammals and are encoded by the genetic code.
- a “non-standard amino acid” is an amino acid that is not commonly utilized in the synthesis of proteins by mammals.
- Non-standard amino acids include naturally occurring amino acids (other than the 20 standard amino acids) and non-naturally occurring amino acids.
- a non-standard, naturally occurring amino acid is found in mammals. For example, ornithine, citrulline, and homocysteine are naturally occurring nonstandard amino acids that have important roles in mammalian metabolism.
- nonstandard amino acids include, e.g., singly or multiply halogenated (e.g., fluorinated) amino acids, D-amino acids, homo-amino acids, N-alkyi amino acids (other than proline), dehydroamino acids, aromatic amino acids (other than histidine, phenylalanine, tyrosine and tryptophan), and , disubstituted amino acids.
- amino acid e.g., one or more of the amino acids in a polypeptide
- Polypeptides may be conjugated with, encapsulated by, or embedded within a polymer or polymeric matrix, dendrimer, nanoparticle, microparticle, liposome, or the like. Modification may occur prior to or after an amino acid is incorporated into a polypeptide in various embodiments.
- Polypeptides may, for example, be purified from natural sources, produced in vitro or in vivo in suitable expression systems using recombinant DNA technology (e.g., by recombinant host cells or in transgenic animals or plants), synthesized through chemical means such as conventional solid phase peptide synthesis, and/or methods involving chemical ligation of synthesized peptides (see, e.g., Kent, S., J Pept Sci., 9(9):574-93, 2003 or U.S. Pub. No. 200401 15774), or any combination of the foregoing.
- recombinant DNA technology e.g., by recombinant host cells or in transgenic animals or plants
- synthesized through chemical means such as conventional solid phase peptide synthesis, and/or methods involving chemical ligation of synthesized peptides (see, e.g., Kent, S., J Pept Sci., 9(9):574-93, 2003 or U.S. Pub. No.
- purified refers to agents that have been separated from most of the components with which they are associated in nature or when originally generated. In general, such purification involves action of the hand of man. Purified agents may be partially purified, substantially purified, or pure. Such agents may be, for example, at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more than 99% pure.
- a nucleic acid, polypeptide, or small molecule is purified such that it constitutes at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more, of the total nucleic acid , polypeptide, or small molecule material, respectively, present in a preparation.
- an organic substance e.g., a nucleic acid, polypeptide, or small molecule, is purified such that it constitutes at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%), 99%, or more, of the total organic material present in a preparation.
- Purity may be based on, e.g., dry weight, size of peaks on a chromatography tracing (GC, HPLC, etc.), molecular abundance, electrophoretic methods, intensity of bands on a gel, spectroscopic data (e.g., NMR), elemental analysis, high throughput sequencing, mass spectrometry, or any art- accepted quantification method.
- GC chromatography tracing
- spectroscopic data e.g., NMR
- elemental analysis e.g., high throughput sequencing, mass spectrometry, or any art- accepted quantification method.
- water, buffer substances, ions, and/or small molecules e.g., synthetic precursors such as nucleotides or amino acids
- a purified agent may be prepared by separating it from other substances (e.g., other cellular materials), or by producing it in such a manner to achieve a desired degree of purity.
- partially purified with respect to a molecule produced by a cell means that a molecule produced by a cell is no longer present within the cell, e.g., the cell has been lysed and, optionally, at least some of the cellular material (e.g., cell wall, cell membrane(s), cell organelle(s)) has been removed and/or the molecule has been separated or segregated from at least some molecules of the same type (protein, RNA, DNA, etc.) that were present in the lysate.
- the cellular material e.g., cell wall, cell membrane(s), cell organelle(s)
- RNA interference encompasses processes in which a molecular complex known as an RNA-induced silencing complex (RISC) silences or "knocks down" gene expression in a sequence-specific manner in, e.g., eukaryotic cells, e.g., vertebrate cells, or in an appropriate in vitro system.
- RISC may incorporate a short nucleic acid strand (e.g., about 16 - about 30 nucleotides (nt) in length) that pairs with and directs or "guides" sequence-specific degradation or translational repression of RNA (e.g., mRNA) to which the strand has complementarity.
- the short nucleic acid strand may be referred to as a "guide strand” or "antisense strand " .
- An RNA strand to which the guide strand has complementarity may be referred to as a "target RNA”.
- a guide strand may initially become associated with RISC components (in a complex sometimes termed the RISC loading complex) as part of a short double-stranded RNA (dsRNA), e.g.. a short interfering RNA (siRNA).
- dsRNA short double-stranded RNA
- siRNA short interfering RNA
- the other strand of the short dsRNA may be referred to as a "passenger strand” or "sense strand”.
- the complementarity of the structure formed by hybridization of a target RNA and the guide strand may be such that the strand can (i) guide cleavage of the target RNA in the RNA-induced silencing complex (RISC) and/or (ii) cause translational repression of the target RNA.
- Reduction of expression due to RNAi may be essentially complete (e.g., the amount of a gene product is reduced to background levels) or may be less than complete in various embodiments.
- mRNA and/or protein level may be reduced by 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%. or more, in various embodiments.
- the complementarity between the guide strand and a target RNA need not be perfect (100%) but need only be sufficient to result in inhibition of gene expression.
- 1 , 2, 3, 4, 5, or more nucleotides of a guide strand may not be matched to a target RNA.
- “Not matched” or “unmatched” refers to a nucleotide that is mismatched (not complementary to the nucleotide located opposite it in a duplex, i.e., wherein Watson-Crick base pairing does not take place) or forms at least part of a bulge.
- mismatches include, without limitation, an A opposite a G or A, a C opposite an A or C, a U opposite a C or U, a G opposite a G.
- a bulge refers to a sequence of one or more nucleotides in a strand within a generally duplex region that are not located opposite to nucleotide(s) in the other strand.
- Partly complementary refers to less than perfect complementarity.
- a guide strand has at least about 80%, 85%, or 90%, e.g., least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence complementarity to a target RNA over a continuous stretch of at least about 15 nt, e.g., between 15 nt and 30 nt, between 17 nt and 29 nt, between 18 nt and 25 nt, between 19 nt and 23 nt, of the target RNA.
- at least the seed region of a guide strand is perfectly complementary to a target RNA.
- a guide strand and a target RNA sequence may form a duplex that contains no more than 1, 2, 3, or 4 mismatched or bulging nucleotides over a continuous stretch of at least 10 nt, e.g., between 10-30 nt.
- a guide strand and a target RNA sequence may form a duplex that contains no more than 1, 2, 3, 4, 5, or 6 mismatched or bulging nucleotides over a continuous stretch of at least 12 nt, e.g., between 10-30 nt.
- a guide strand and a target RNA sequence may form a duplex that contains no more than 1, 2, 3, 4, 5, 6, 7, or 8 mismatched or bulging nts over a continuous stretch of at least 15 nt, e.g., between 10-30 nt.
- a guide strand and a target RNA sequence may form a duplex that contains no mismatched or bulging nucleotides over a continuous stretch of at least 10 nt, e.g., between 10-30 nt.
- between 10-30 nt isl O, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nt.
- RNAi agent encompasses nucleic acids that can be used to achieve RNAi in eukaryotic cells.
- Short interfering RNA siRNA
- shRNA short hairpin RNA
- miRNA microRNA
- siRNAs typically comprise two separate nucleic acid strands that are hybridized to each other to form a structure that contains a double stranded (duplex) portion at least 15 nt in length, e.g., about 15- about 30 nt long, e.g., between 17-27 nt long, e.g., between 18-25 nt long , e.g., between 19-23 nt long, e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.
- the strands of an siRNA are perfectly complementary to each other within the duplex portion.
- the duplex portion may contain one or more unmatched nucleotides, e.g., one or more mismatched (non-complementary) nucleotide pairs or bulged nucleotides.
- either or both strands of an siRNA may contain up to about 1, 2, 3, or 4 unmatched nucleotides within the duplex portion.
- a strand may have a length of between 15-35 nt, e.g., between 17-29 nt, e.g., 19-25 nt, e.g., 21-23 nt. Strands may be equal in length or may have different lengths in various embodiments. In some embodiments strands may differ by between 1-10 nt in length.
- a strand may have a 5' phosphate group and /or a 3' hydroxyl (-OH) group.
- Either or both strands of an siRNA may comprise a 3' overhang of, e.g., about 1-10 nt (e.g., 1-5 nt, e.g., 2 nt). Overhangs may be the same length or different in lengths in various
- an overhang may comprise or consist of
- deoxyribonucleotides ribonucleotides, or modified nucleotides or modified ribonucleotides such as 2'-0-methylated nucleotides, or 2'-0-methyl-uridine.
- An overhang may be perfectly complementary, partly complementary, or not complementary to a target RNA in a hybrid formed by the guide strand and the target RNA in various embodiments.
- shRNAs are nucleic acid molecules that comprise a stem-loop structure and a length typically between about 40 - 150 nt, e.g., about 50-100 nt, e.g., 60-80 nt.
- a "stem- loop structure” (also referred to as a "hairpin” structure) refers to a nucleic acid having a secondary structure that includes a region of nucleotides which are known or predicted to form a double strand (stem portion; duplex) that is linked on one side by a region of (usually) predominantly single-stranded nucleotides (loop portion).
- stem- loop structure also referred to as a "hairpin” structure
- Such structures are well known in the art and the term is used consistently with its meaning in the art.
- a guide strand sequence may be positioned in either arm of the stem, i.e., 5' with respect to the loop or 3' with respect to the loop in various embodiments.
- the stem structure does not require exact base-pairing (perfect complementarity).
- the stem may include one or more unmatched residues or the base-pairing may be exact, i.e., it may not include any mismatches or bulges.
- the stem is between 15-30 nt, e.g., between 17- 29 nt, e.g., 19-25 nt.
- the stem is between 15- 19 nt.
- the stem is between 19-30 nt.
- the primary sequence and number of nucleotides within the loop may vary. Examples of loop sequences include, e.g., UGGU; ACUCGAGA; UUCAAGAGA.
- a loop sequence found in a naturally occurring miRNA precursor molecule e.g., a pre-miRNA
- a loop sequence may be absent (in which case the termini of the duplex portion may be directly linked).
- a loop sequence may be at least partly self-complementary.
- the loop is between 1 and 20 nt in length, e.g., 1 -15 nt, e.g., 4-9 nt.
- the shRNA structure may comprise a 5' or 3' overhang.
- an shRNA may undergo intracellular processing, e.g., by the ribonuclease (RNase) III family enzyme known as Dicer, to remove the loop and generate an siRNA.
- RNase ribonuclease
- Mature endogenous miRNAs are short (typically 18-24 nt, e.g., about 22 nt), single-stranded RNAs that are generated by intracellular processing from larger,
- miRNA precursors endogenously encoded precursor RNA molecules termed miRNA precursors (see, e.g., Bartel, D., MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 1 16(2):281-97 (2004); Bartel DP. MicroRNAs: target recognition and regulatory functions. Cell.
- Artificial miRNA may be designed to take advantage of the endogenous RNAi pathway in order to silence a target RNA of interest.
- RNAi agent that contains a strand sufficiently complementary to an RNA of interest so as to result in reduced expression of the RNA of interest (e.g., as a result of degradation or repression of translation of the RNA) in a cell or in an in vitro system capable of mediating RNAi and/or that comprises a sequence that is at least 80%, 90%, 95%, or more (e.g., 100%) complementary to a sequence comprising at least 10, 12, 15, 17, or 19 consecutive nucleotides of an RNA of interest may be referred to as being "targeted to" the RNA of interest.
- An RNAi agent targeted to an RNA transcript may also considered to be targeted to a gene from which the transcript is transcribed.
- an RNAi agent is a vector (e.g., an expression vector) suitable for causing intracellular expression of one or more transcripts that give rise to a siRNA, shRNA, or miRNA in the cell.
- a vector may be referred to as an "RNAi vector”.
- An RNAi vector may comprise a template that, when transcribed, yields transcripts that may form a siRNA (e.g., as two separate strands that hybridize to each other), shRNA, or miRNA precursor (e.g., pri-miRNA or pre-mRNA).
- RNAi agent may be produced in any of variety of ways in various
- nucleic acid strands may be chemically synthesized (e.g., using standard nucleic acid synthesis techniques) or may be produced in cells or using an in vitro transcription system. Strands may be allowed to hybridize (anneal) in an appropriate liquid composition (sometimes termed an "annealing buffer").
- An NAi vector may be produced using standard recombinant nucleic acid techniques.
- sample may be any biological specimen that contains cells, tissue, or cellular material (e.g., material derived from cells, such as a cell lysate or fraction thereof).
- a sample may be obtained from (i.e., originates from, was initiaiiyremoved from) a subject.
- Methods of obtaining samples include, e.g., tissue biopsy, such as excisional biopsy, incisional biopy, or core biopsy; fine needle aspiration biopsy; brushings; lavage; or collecting body fluids that may contain cells, such as blood, sputum, lymph, mucus, saliva, or urine.
- tissue biopsy such as excisional biopsy, incisional biopy, or core biopsy
- fine needle aspiration biopsy such as fine needle aspiration biopsy
- brushings lavage
- body fluids that may contain cells, such as blood, sputum, lymph, mucus, saliva, or urine.
- a sample contains at least some intact cells at the time it is removed from a subject.
- a sample retains at least some of the microarchitecture of a tissue from which it was removed.
- a sample may be subjected to one or more processing steps after having been obtained from a subject and/or may be split into one or more portions.
- the term "sample” encompasses processed samples, portions of samples, etc., and such samples are considered to have been obtained from the subject from whom the initial sample was removed.
- a sample may be obtained from an individual who has been diagnosed with or is suspected of having a tumor, e.g., a brain tumor.
- a tumor sample is a sample obtained from or comprising tumor cells or a tumor.
- a tumor sample may have been obtained from a tumor prior to or after removal of the tumor from a subject.
- a sample e.g., a sample used in a method or composition disclosed herein, may have been procured directly from a subject, or indirectly, e.g., by receiving the sample from one or more persons who procured the sample directly from the subject, e.g., by performing a biopsy, surgery, or other procedure on the subject.
- small molecule is an organic molecule that is less than about 2 kilodaltons (kDa) in mass. In some embodiments, the small molecule is less than about 1.5 kDa, or less than about 1 kDa. In some embodiments, the small molecule is less than about 800 daltons (Da), 600 Da, 500 Da, 400 Da, 300 Da, 200 Da, or 100 Da. Often, a small molecule has a mass of at least 50 Da. In some embodiments, a small molecule is non- polymeric. In some embodiments, a small molecule is not an amino acid. In some embodiments, a small molecule is not a nucleotide.
- a small molecule is not a saccharide.
- a small molecule contains multiple carbon-carbon bonds and can comprise one or more heteroatoms and/ or one or more functional groups important for structural interaction with proteins (e.g., hydrogen bonding), e.g.. an amine, carbonyl, hydroxyl, or carboxyl group, and in some embodiments at least two functional groups.
- proteins e.g., hydrogen bonding
- Small molecules often comprise one or more cyclic carbon or heterocyclic structures and/or aromatic or polyaromatic structures, optionally substituted with one or more of the above functional groups.
- a "subject” may be any vertebrate organism in various embodiments.
- a subject may be individual to whom an agent is administered, e.g., for experimental, diagnostic, and/or therapeutic purposes or from whom a sample is obtained or on whom a procedure is performed.
- a subject is a mammal, e.g. a human, non-human primate, rodent (e.g., mouse, rat, rabbit), ungulate (e.g., ovine, bovine, equine, caprine species), canine, or feline.
- a subject is an adult. For purposes hereof a human at least 18 years of age is considered an adult.
- Treatment refers to providing medical and/or surgical management of a subject.
- Treatment may include, but is not limited to, administering an agent or composition (e.g.. a pharmaceutical composition) to a subject.
- Treatment is typically undertaken in an effort to alter the course of a disease (which term is used to indicate any disease, disorder, or undesirable condition warranting therapy ) in a manner beneficial to the subject.
- the effect of treatment may include reversing, alleviating, reducing severity of, delaying the onset of. curing, inhibiting the progression of, and/or reducing the likelihood of occurrence or recurrence of the disease or one or more symptoms or manifestations of the disease.
- a therapeutic agent may be administered to a subject who has a disease or is at increased risk of developing a disease relative to a member of the general population.
- a therapeutic agent may be administered to a subject who has had a disease but no longer shows ev idence of the disease.
- the agent may be administered e.g.. to reduce the likelihood of recurrence of evident disease.
- a therapeutic agent may be administered prophylactically, i.e.. before development of any symptom or manifestation of a disease.
- prophylactic treatment refers to providing medical and/or surgical management to a subject who has not developed a disease or does not show eveidence of a disease in order, e.g., to reduce the likelihood that the disease will occur or to reduce the severity of the disease should it occur.
- the subject may have been identified as being at risk of developing the disease (e.g., at increased risk relative to the general population or as having a risk factor that increases the likelihood of developing the disease.
- a "variant" of a particular polypeptide or polynucleotide has one or more alterations (e.g., additions, substitutions, and/or deletions, which may be referred to collectively as “mutations") with respect to the polypeptide or polynucleotide, which may be referred to as the "original polypeptide” or “original polynucleotide", respectively.
- An addition may be an insertion or may be at either terminus.
- a variant may be shorter or longer than the original polypeptide or polynucleotide.
- the term “variant” encompasses "fragments".
- a “fragment” is a continuous portion of a polypeptide or polynucleotide that is shorter than the original polypeptide.
- a variant comprises or consists of a fragment. In some embodiments a fragment or variant is at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or more as long as the original polypeptide or polynucleotide.
- a fragment may be an N-terminal, C-terminal, or internal fragment.
- a variant polypeptide comprises or consists of at least one domain of an original polypeptide.
- a variant polynucleotide hybridizes to an original polynucleotide under stringent conditions, e.g., high stringency conditions, for sequences of the length of the original polypeptide.
- a variant polypeptide or polynucleotide comprises or consists of a polypeptide or polynucleotide that is at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or more identical in sequence to the original polypeptide or polynucleotide over at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the original polypeptide or polynucleotide.
- a variant polypeptide comprises or consists of a polypeptide that is at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or more identical in sequence to the original polypeptide over at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the original polypeptide, with the proviso that, for purposes of computing percent identity, a conservative amino acid substitution is considered identical to the amino acid it replaces.
- a variant polypeptide comprises or consists of a polypeptide that is at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or more identical to the original polypeptide over at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the original polypeptide, with the proviso that any one or more amino acid substitutions (up to the total number of such substitutions) may be restricted to conservative substitutions.
- a percent identity is measured over at least 100; 200; 300; 400; 500; 600; 700; 800; 900; 1,000; 1,200; 1,500; 2,000; 2,500; 3,000; 3,500; 4,000; 4,500; or 5,000 amino acids.
- the sequence of a variant polypeptide comprises or consists of a sequence that has N amino acid differences with respect to an original sequence, wherein N is any integer between 1 and 10 or between 1 and 20 or any integer up to 1%, 2%, 5%, or 10% of the number of amino acids in the original polypeptide, where an "amino acid difference" refers to a substitution, insertion, or deletion of an amino acid. In some embodiments a difference is a conservative substitution.
- Conservative substitutions may be made, e.g., on the basis of similarity in side chain size, polarity, charge, solubility, hydrophobicity, hydrophilicity and/or the amphipathic nature of the residues involved.
- conservative substitutions may be made according to Table A, wherein amino acids in the same block in the second column and in the same line in the third column may be substituted for one another other in a conservative substitution.
- Certain conservative substitutions are substituting an amino acid in one row of the third column corresponding to a block in the second column with an amino acid from another row of the third column within the same block in the second column.
- proline (P) is considered to be in an individual group.
- cysteine (C) is considered to be in an individual group.
- proline (P) and cysteine (C) are each considered to be in an individual group.
- a variant is a functional variant, i.e., the variant at least in part retains at least one activity of the original polypeptide or polynucleotide. In some embodiments a variant at least in part retains more than one or substantially all known
- an activity may be, e.g., a catalytic activity, binding activity, ability to perform or participate in a biological function or process, etc.
- an activity of a variant may be at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more, of the activity of the original polypeptide or polynucleotide, up to approximately 100%, approximately 125%), or approximately 150% of the activity of the original polypeptide or polynucleotide, in various embodiments.
- a variant e.g., a functional variant, comprises or consists of a polypeptide at ieast 95%, 96%, 97%, 98%, 99%. 99.5% or 100% identical to an original polypeptide or polynucleotide over at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or 100% of the original polypeptide or polynucleotide.
- an alteration e.g., a substitution or deletion, e.g., in a functional variant, does not alter or delete an amino acid or nucleotide that is known or predicted to be important for an activity, e.g., a known or predicted catalytic residue or residue involved in binding a substrate or cofactor.
- nucleotide(s), amino acid(s), or region(s) exhibiting lower degrees of conservation across species as compared with other amino acids or regions may be selected for alteration.
- variants can be created by introducing one or more nucleotide alterations, e.g., one or more substitution(s), addition(s_ and/or deletion(s) into a nucleotide sequence encoding a polypeptide, such that one or more amino acid alterations, e.g., substitution(s), addition(s) and/or deletion(s) are introduced into the encoded polypeptide.
- Alterations can be introduced by standard techniques, such as site- directed mutagenesis, PCR-mediated mutagenesis, etc. Variants may be tested in one or more suitable assays to assess activity.
- a "vector" may be any of a number of nucleic acid molecules or viruses or portions thereof that are capable of mediating entry of, e.g., transferring, transporting, etc., a nucleic acid of interest between different genetic environments or into a cell.
- the nucleic acid of interest may be linked to, e.g., inserted into, the vector using, e.g., restriction and ligation.
- Vectors include, for example, DNA or RNA plasmids, cosmids, naturally occurring or modified viral genomes or portions thereof, nucleic acids that can be packaged into viral capsids, mini-chromosomes, artificial chromosomes, etc.
- Plasmid vectors typically include an origin of replication (e.g., for replication in prokaryotic cells).
- a plasmid may include part or all of a viral genome (e.g., a viral promoter, enhancer, processing or packaging signals, and/or sequences sufficient to give rise to a nucleic acid that can be integrated into the host cell genome and/or to give rise to infectious virus).
- Viruses or portions thereof that can be used to introduce nucleic acids into cells may be referred to as viral vectors.
- Viral vectors include, e.g., adenoviruses, adeno-associated viruses, retroviruses (e.g., lentiviruses), vaccinia virus and other poxviruses, herpesviruses (e.g., herpes simplex virus), and others.
- Viral vectors may or may not contain sufficient viral genetic information for production of infectious virus when introduced into host cells, i.e., viral vectors may be replication- competent or replication-defective. In some embodiments, e.g., where sufficient information for production of infectious virus is lacking, it may be supplied by a host cell or by another vector introduced into the cell, e.g., if production of virus is desired.
- a nucleic acid to be transferred may be incorporated into a naturally occurring or modified viral genome or a portion thereof or may be present within a viral capsid as a separate nucleic acid molecule.
- a vector may contain one or more nucleic acids encoding a marker suitable for identifying and/or selecting cells that have taken up the vector.
- Markers include, for example, various proteins that increase or decrease either resistance or sensitivity to antibiotics or other agents (e.g., a protein that confers resistance to an antibiotic such as puromycin, hygromycin or blasticidin), enzymes whose activities are detectable by assays known in the art (e.g., ⁇ - galactosidase or alkaline phosphatase), and proteins or RNAs that detectably affect the phenotype o cells that express them (e.g., fluorescent proteins).
- Vectors often include one or more appropriately positioned sites for restriction enzymes, which may be used to facilitate insertion into the vector of a nucleic acid, e.g., a nuc leic acid to be expressed.
- An expression vector is a vector into which a desired nucleic acid has been inserted or may be inserted such that it is operably linked to regulatory elements (also termed “regulatory sequences", “expression control elements”, or “expression control sequences”) and may be expressed as an RNA transcript (e.g., an mRNA that can be translated into protein or a noncoding RNA such as an shRNA or mi RNA precursor).
- regulatory elements also termed “regulatory sequences", “expression control elements”, or “expression control sequences”
- RNA transcript e.g., an mRNA that can be translated into protein or a noncoding RNA such as an shRNA or mi RNA precursor.
- Expression vectors include regulatory sequence(s), e.g., expression control sequences, sufficient to direct transcription of an operably linked nucleic acid under at least some conditions; other elements required or helpful for expression may be supplied by, e.g., the host cell or by an in vitro expression system.
- regulatory sequences typically include a promoter and may include enhancer sequences or upstream activator sequences.
- a vector may include sequences that encode a 5' untranslated region and/or a 3' untranslated region, which may comprise a cleavage and/or polyadenylation signal.
- regulatory elements may be contained in a vector prior to insertion of a nucleic acid whose expression is desired or may be contained in an inserted nucleic acid or may be inserted into a vector following insertion of a nucleic acid whose expression is desired.
- a nucleic acid and regulatory element(s) are said to be "operably linked” when they are covalently linked so as to place the expression or transcription of the nucleic acid under the influence or control of the regulatory element(s).
- a promoter region would be operably linked to a nucleic acid if the promoter region were capable of effecting transcription of that nucleic acid.
- One of ordinary skill in the art will be aware that the precise nature of the regulatory sequences useful for gene expression may vary between species or ceil types, but may in general include, as appropriate, sequences involved with the initiation of transcription, RNA processing, or initiation of translation. The choice and design of an appropriate vector and regulatory element(s) is within the ability and discretion of one of ordinary skill in the art.
- a vector may contain a promoter capable of directing expression in mammalian cells, such as a suitable viral promoter, e.g., from a cytomegalovirus (CMV), retrovirus, simian virus (e.g., SV40), papilloma virus, herpes virus or other virus that infects mammalian cells, or a mammalian promoter from, e.g., a gene such as EF1 alpha, ubiquitin (e.g., ubiquitin B or C), globin, actin, phosphoglycerate kinase (PGK), etc., or a composite promoter such as a CAG promoter (combination of the CMV early enhancer element and chicken beta-actin promoter).
- a suitable viral promoter e.g., from a cytomegalovirus (CMV), retrovirus, simian virus (e.g., SV40), papilloma virus, herpes virus
- a human promoter may be used.
- a promoter that ordinarily directs transcription by a eukaryotic RNA polymerase I (a "pol I promoter"), e.g., (a U6, HI, 7SK or tRNA promoter or a functional variant thereof) may be used.
- a promoter that ordinarily directs transcription by a eukaryotic RNA polymerase II (a "pol II promoter") or a functional variant thereof is used.
- a promoter that ordinarily directs transcription by a eukaryotic RNA polymerase III e.g., a promoter for transcription of ribosomal RNA (other than 5S rRNA) or a functional variant thereof is used.
- a poly III promoter e.g., a promoter for transcription of ribosomal RNA (other than 5S rRNA) or a functional variant thereof.
- expression vectors that may be used in mammalian cells include, e.g., the pcDNA vector series, pSV2 vector series, pCMV vector series, pRSV vector series, pEFl vector series, Gateway® vectors, etc.
- virus vectors examples include, e.g., adenoviruses, adeno-associated viruses, poxviruses such as vaccinia viruses and attenuated poxviruses, retroviruses (e.g., lentiviruses), Semliki Forest virus, Sindbis virus, etc.
- regulatable (e.g., inducible or repressible) expression control element(s) e.g., a regulatable promoter
- expression can be regulated, e.g., turned on or increased or turned off or decreased.
- the tetracycline-regulatable gene expression system Gossen & Bujard, Proc.
- expression control elements that can be regulated by small molecules such as artificial or naturally occurring hormone receptor ligands (e.g., steroid receptor ligands such as naturally occurring or synthetic estrogen receptor or glucocorticoid receptor ligands), tetracycline or analogs thereof, metal-regulated systems (e.g., metallothionein promoter) may be used in certain embodiments.
- hormone receptor ligands e.g., steroid receptor ligands such as naturally occurring or synthetic estrogen receptor or glucocorticoid receptor ligands
- metal-regulated systems e.g., metallothionein promoter
- tissue-specific or cell type specific regulatory element(s) may be used, e.g., in order to direct expression in one or more selected tissues or cell types.
- a vector may comprise a polynucleotide sequence that encodes a polypeptide, wherein the polynucleotide sequence is positioned in frame with a nucleic acid inserted into the vector so that an N- or C-terminal fusion is created.
- the polypeptide encoded by the polynucleotide sequence may be a targeting peptide.
- a targeting peptide may comprise a signal sequence (which directs secretion of a protein) or a sequence that directs the expressed protein to a specific organelle or location in the cell such as the nucleus or mitochondria.
- the polypeptide comprises a tag. A tag may be useful to facilitate detection and/or purification of a protein that contains it.
- tags include polyhistidine-tag (e.g., 6X-His tag), glutathione- S-transferase, maltose binding protein, NUS tag, SNUT tag, Strep tag, epitope tags such as V5, HA, Myc, or FLAG.
- a protease cleavage site is located in the region between the protein encoded by the inserted nucleic acid and the polypeptide, allowing the polypeptide to be removed by exposure to the protease.
- glyc ine cleavage system As an antitumor target.
- methods of inhibiting tumor cell survival or proliferation are provided, the methods comprising inhibiting the GCS of a tumor cell.
- a method of inhibiting tumor cell survival or proliferation comprises contacting a tumor cell with an inhibitor of the GCS.
- methods of killing a tumor cell are provided, the methods comprising the step of contacting the tumor cell with a GCS inhibitor.
- a tumor cell overexpresses serine hydroxymethyltransferase 2
- tumor encompasses abnormal growths comprising aberrantly proliferating cells.
- a tumor is typically characterized by excessive cell proliferation that is not appropriately regulated (e.g., that does not respond normally to physiological influences and signals that would ordinarily constrain proliferation) and may exhibit one or more of the following properties: dysplasia (e.g., lack of normal cell differentiation, resulting in an increased number or proportion of immature cells); anapiasia (e.g., greater loss of differentiation, more loss of structural organization, cellular
- a tumor is a malignant tumor, also referred to herein as a "cancer".
- Malignant tumors have a tendency for sustained growth and an ability to spread, e.g., to invade locally and/or metastasize regionally and/or todistant locations, whereas benign tumors often remain localized at the site of origin and are often self limiting in terms of growth.
- tumor includes malignant solid tumors (e.g., carcinomas, sarcomas) and malignant growths in which there may be no detectable solid tumor mass (e.g., certain hematologic malignancies).
- cancer is generally used interchangeably with “tumor” herein and/or to refer to a disease characterized by one or more tumors, e.g., one or more malignant or potentially malignant tumors.
- Cancer includes, but is not limited to: breast cancer; biliary tract cancer; bladder cancer; brain cancer (e.g., glioblastomas, medulloblastomas); cervical cancer; choriocarcinoma; colon cancer;
- endometrial cancer esophageal cancer
- gastric cancer hematological neoplasms including acute lymphocytic leukemia and acute myelogenous leukemia; T-cell acute lymphoblastic leukemia/1 ymphoma; hairy cell leukemia; chronic lymphocytic leukemia, chronic myelogenous leukemia, multiple myeloma; adult T-cell leukemia/lymphoma; intraepithelial neoplasms including Bowen's disease and Paget's disease; liver cancer; lung cancer;
- lymphomas including Hodgkin's disease and lymphocytic lymphomas; neuroblastoma;
- melanoma oral cancer including squamous cell carcinoma; ovarian cancer including ovarian cancer arising from epithelial cells, stromal cells, germ cells and mesenchymal cells;
- neuroblastoma pancreatic cancer
- prostate cancer rectal cancer
- sarcomas including angiosarcoma, gastrointestinal stromal tumors, leiomyosarcoma, rhabdomyosarcoma, liposarcoma, fibrosarcoma, and osteosarcoma
- renal cancer including renal cell carcinoma ana w nms tumor
- skin cancer including basal cell carcinoma and squamous cell cancer
- testicular cancer including germinal tumors such as seminoma, non-seminoma (teratomas, choriocarcinomas), stromal tumors, and germ cell tumors
- thyroid cancer including thyroid adenocarcinoma and medullary carcinoma.
- a tumor may be of a type has a relatively low likelihood of invasion or metastasis.
- a tumor may be associated with neurofibromatosis (e.g., type 1, 2, 3, 4, or 5), tuberous sclerosis, Sturge-Weber syndrome or von Hippel-Lindau disease.
- a tumor is not detectabiy invasive, e.g., a carcinoma in situ. It will be appreciated that a variety of different tumor types can arise in certain organs, which may differ with regard to, e.g., clinical and/or pathological features and/or molecular markers.
- Tumors arising in a variety of different organs are discussed, e.g., in DeVita, supra or in the WHO Classification of Tumours series, 4 th ed, or 3 rd ed (Pathology and Genetics of Tumours series), by the International Agency for Research on Cancer (IARC), WHO Press, Geneva, Switzerland, all volumes of which are incorporated herein by reference.
- IARC International Agency for Research on Cancer
- a tumor cell is a brain tumor cell, e.g., a glioblastoma cell.
- a tumor cell is a bladder tumor cell, breast tumor cell, cervical tumor cell, colorectal tumor cell, embryonal tumor cell, gastric tumor cell, germ cell tumor cell, head and neck tumor cell, hematologic tumor cell, kidney tumor cell, melanoma cell, mesothelial tumor cell, ovarian tumor cell, yolk sac tumor cell, or sarcoma cell.
- a breast tumor cell is a triple negative breast tumor cell.
- a "triple negative" breast tumor is a breast tumor that does not express estrogen receptor (ER), progesterone receptor (PR), or or Her2/neu.
- triple negative breast tumors typically have a worse prognosis than breast tumor that are not triple negative.
- a tumor cell is a tumor initiating cell.
- a tumor initiating cell is a glioblastoma stem cell (GBM-SC).
- GBM-SC glioblastoma stem cell
- a tumor cell is not a lung tumor cell.
- a tumor cell is not a non-small cell lung cancer cell.
- a tumor is not a colon cancer.
- a tumor is not a lung tumor.
- a cancer is not non-small cell lung cancer.
- a tumor is not a colon cancer.
- methods of inhibiting a tumor comprising inhibiting the GCS in at least some tumor cells of the tumor.
- a method of inhibiting a tumor comprises contacting the tumor with an inhibitor of the GCS.
- a method of inhibiting a tumor comprises contacting the tumor with an inhibitor of a GCS component.
- inhibiting a tumor comprises inhibiting survival or proliferation of at least some tumor cells of the tumor.
- inhibiting a tumor comprises killing at least some cells of the tumor.
- inhibiting a tumor comprises inhibiting survival or proliferation of at least some tumor initiating cells.
- inhibiting a tumor comprises inhibiting tumor progression, e.g., inhibiting local invasion or metastasis.
- a tumor comprises tumor cells that overexpress SHMT2.
- a tumor is of a type that has a tendency to overexpress SHMT2.
- a tumor is a brain tumor e.g., a glioblastoma.
- a tumor is a bladder tumor, breast tumor, cervical tumor, colorectal tumor , embryonal tumor, gastric tumor, germ cell tumor, head and neck tumor, hematologic tumor, kidney tumor, melanoma , mesothelial tumor, ovarian tumor, yolk sac tumor or sarcoma .
- a breast tumor is a triple negative breast tumor.
- GCS inhibitor or “inhibitor of the GCS” refers to an agent that inhibits expression of a GCS component, inhibits one or more activit(ies) of a GCS component, or inhibits the glycine catabolism pathway catalyzed by the GCS (or the reverse reaction). Any of a variety of different agents may be used as a GCS inhibitor in various embodiments. Certain GCS inhibitors and methods of identifying GCS inhibitors are discussed further below.
- a method comprises (a) contacting one or more cells with a GCS inhibitor; and (b) assessing the survival and/or proliferation of the one or more cells.
- the one or more cells comprise tumor cells.
- the one or more cells comprise tumor initiating cells.
- the one or more cells comprise tumor cells that overexpress SHMT2. For example, in some embodiments at least, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more , e.g., all or essentially all of the tumor cells overexpress SHMT2.
- detecting the level of inhibition of the survival and/or proliferation of the one or more tumor cells comprises determining the capacity of the one or more tumor cells to form colonies in suspension culture. In some embodiments detecting the level of inhibition of the survival or proliferation of the one or more tumor cells comprises determining the capacity of the one or more tumor cells to form colonies in a semi-solid medium. In some embodiments detecting the level of inhibition of the survival and/or proliferation of the one or more tumor cells comprises determine the capacity of the one or more tumor cells to form tumor spheres in culture, in some embodiments detecting the level of inhibition of the survival and/or proliferation of the one or more tumor cells comprises determine the capacity of the one or more tumor cells to form tumors in vivo.
- a GCS inhibitor is contacted with cells, e.g., tumor cells, in combination with a second anti-tumor agent.
- a method comprises comparing the effect of a GCS inhibitor in combination with a second agent with the effect of the GCS inhibitor when used as a single agent in an ex vivo or in vivo tumor model.
- a tumor cell, tumor cell line, or tumor comprises one or more oncogenes or has reduced or absent expression of one or more tumor suppressor genes (TSGs) or reduced or absent activity of one or more TSG gene products, e.g., as a result of a mutation in the TSG.
- TSGs tumor suppressor genes
- oncogene encompasses nucleic acids that, when expressed, can increase the likelihood of or contribute to cancer initiation or progression. Normal cellular sequences (“proto-oncogenes”) can be activated to become oncogenes (sometimes termed "activated oncogenes”) by mutation and/or aberrant expression.
- an oncogene can comprise a complete coding sequence for a gene product or a portion that maintains at least in part the oncogenic potential of the complete sequence or a sequence that encodes a fusion protein.
- Oncogenic mutations can result, e.g., in altered (e.g., increased) protein activity, loss of proper regulation, or an alteration (e.g., an increase) in RNA or protein level.
- Aberrant expression may occur, e.g., due to chromosomal rearrangement resulting in juxtaposition to regulatory elements such as enhancers, epigenetic mechanisms, or due to amplification, and may result in an increased amount of proto- oncogene product or production in an inappropriate cell type.
- proto- oncogenes often encode proteins that control or participate in cell proliferation,
- Oncogenes also include a variety of viral proteins, e.g., from viruses such as polyomaviruses (e.g., SV40 large T antigen) and papillomaviruses (e.g., human papilloma virus E6 and E7).
- viruses such as polyomaviruses (e.g., SV40 large T antigen) and papillomaviruses (e.g., human papilloma virus E6 and E7).
- a TSG may be any gene wherein a loss or reduction in function of an expression product of the gene can increase the likelihood of or contribute to cancer initiation or progression. Loss or reduction in function can occur, e.g., due to mutation or epigenetic mechanisms.
- TSGs encode proteins that normally function to restrain or negatively regulate cell proliferation and/or to promote apoptosis.
- an oncogene or TSG encodes a mi RNA.
- exemplary oncogenes include, e.g., MYC, SRC, FOS, J UN, M Y B. RAS, RAF, ABL, ALK, AKT, TRK, BCL2, WNT, HER2/NEU, EGFR, MAPK, ERK, MDM2, CDK4, GLI1, GLI2, IGF2, TP53, etc.
- Exemplary TSGs include, e.g., RB, TP53, A PC, NF1, BRCA 1 , BRCA2, PTEN, CDK inhibitory proteins (e.g., pi 6. p21), PTCH, WT1, etc. It will be understood that a number of these oncogene and TSG names encompass multiple family members and that many other TSGs are known.
- TIC tumor initating cell
- methods of inhibiting a tumor initating cell comprising contacting a tumor initiating cell with a GCS inhibitor.
- tumor initiating ceil is used interchangeably herein with the term “cancer stem cell” (CSC).
- CSCs are cells within or originating from a tumor that exhibit properties of extensive self-renewal, capacity for multi-lineage differentiation or multipotency, and capacity for continued proliferation, e.g., under appropriate culture conditions. CSCs can be defined functionally as those cells within a tumor mass that have the capacity to seed and generate secondary tumors.
- CSCs may be defined by their ability to seed tumors at high dilutions (i.e., using very low numbers of cells) in animal models (e.g., immunocompromised mice). Tumors generated by CSCs may resemble the tumor from which they originate, e.g., in terms of morphological and immunohistochemical phenotype.
- a CSC may exhibit increased likelihood of (i) initiating a tumor; (ii) growing in suspension culture; (iii) forming a colony in soft agar; (iv) forming a tumor sphere; and/or (v) exhibiting resistance to various commonly used chemotherapy drugs and/or radiation.
- CSCs may be responsible for phenomena such as metastatic dissemination, the primary cause of cancer mortality in many tumor types, and/or for tumor recurrence after removal or ablation of the bulk of the tumor by, e.g., surgery, radiation, chemotherapy, or radiofrequency ablation.
- CSCs have been identified from a wide variety of tumor types, including brain tumors, breast tumors, colorectal tumors, and others (see, e.g., Singh, C.
- glioblastoma tumor initiating cell lines also termed glioblastoma stem cells (GMB-SCs) are listed in the Examples.
- a GBM-SC may be a cell obtained from a GBM, or a descendant thereof (e.g., a member of a cell line derived from a GBM).
- GBM-SCs can be propagated in vitro and, when cultured in suitable medium, can form neurospheres resembling those formed by normal neural stem cells.
- a suitable medium is a neurobasal medium supplemented with appropriate growth factors such as epidermal growth factor and basic tibro blast growth factor.
- GBM-SCs can be induced to differentiate in vitro into multiple different neural or glial cell types, such as cells that exhibit cellular marker profiles and morphological characteristics of astrocytes, oligodendrocytes and neurons. In some embodiments, such differentiation can be induced by addition of serum and/or withdrawal of the culture conditions suitable for neurosphere propagation.
- CSCs may be identified or isolated ina variety of ways, if desired. CSCs isolated from various tumor types have been reported to exhibit altered expression (e.g., increased or decreased expression) of various cellular markers, e.g., ceil surface markers, as compared with normal cells of the same tissue type or as compared with other cells from the same tumor. In some embodiments CSCs have increased or decreased expression of one or more cellular marker(s), which expression pattern may be used to identify or isolate them. See, e.g., PCT/US2009/002254 and references therein, which are incorporated herein by reference. In certain embodiments, the one or more cellular markers are selected from:
- CSCs are CD44+, CD24- (CD44 Mgh , CD24 low ).
- CSCs e.g., GBM-SCs, express at least one cell surface marker selected from CD133, CD15, alpha 6 integrin, and LICAM.
- GBM-SCs are A2B5+.
- A2B5 is a monoclonal antibody that recognizes GT3 gangliosides.
- CSCs e.g., GBM-SCs
- ALDH+ cells can be identified, for example, using a functional assay that uses the reagent ALDEFLUOR
- CSCs e.g., GBM-SCs
- CSCs e.g., GBM-SCs
- CSCs express at least one transcription factor selected from OCT4, SOX2, NANOG, c-MYC, and NOTCH.
- CSCs may exhibit distinct physical characteristics that may be used to identify or isolate them independent of expression of particular cellular markers.
- CSCs e.g., GBM-SCs
- a method of reducing the number of TICs in a tumor comprises contacting the tumor with a GCS inhibitor, whereby the number of TICs in the tumor is reduced.
- a method of inhibiting treatment resistance or inhibiting emergence of treatment resistance in a tumor comprises contacting the tumor with a GCS inhibitor, whereby resistance or the emergence of treatment resistance is inhibited.
- a method of inhibiting tumor metastasis comprises contacting a tumor with a GCS inhibitor, whereby tumor metastasis is inhibited.
- a method of inhibiting tumor recurrence comprises treating a subject in need thereof with a GCS inhibitor, whereby the likelihood of tumor recurrence is inhibited.
- methods of treating a subject in need of treatment for a tumor comprising inhibiting the GCS in at least some tumor cells in the subject.
- a method of treating a subject in need of treatment for a tumor comprises administering an inhibitor of the GCS to the subject.
- at least some of the tumor cells overexpress SHMT2.
- the tumor is of a tumor type that has a tendency to overexpress SHMT2.
- the tumor is a brain tumor e.g., a glioblastoma.
- the tumor is a bladder tumor, breast tumor, cervical tumor, colorectal tumor, embryonal tumor, gastric tumor, germ cell tumor, head and neck tumor, hematologic tumor, kidney tumor, melanoma , mesothelial tumor, ovarian tumor, yolk sac tumor or sarcoma.
- a method further comprises assessing the response of the tumor to administration of the GCS inhibitor. In some embodiments assessing a response comprises assessing size, growth rate, local progression, or metastasis of the tumor. In some embodiments a method further comprises assessing the subject for presence or severity of one or more symptoms or signs of the tumor. In some embodiments a GCS inhibitor is administered in combination with use of a second anti-tumor agent, e.g., an agent approved for use in treating at least one tumor type.
- a second anti-tumor agent e.g., an agent approved for use in treating at least one tumor type.
- compositions useful for inhibiting a tumor cell or tumor or for treating a subject in need of treatment for a tumor comprising an inhibitor of the GCS.
- a composition further comprises an additional anti-tumor agent.
- the GCS comprises a multienzyme system present in a wide range of organisms and is the major pathway for the catabolism of glycine in humans (7).
- GCS components include g lycine dehydrogenase (GLDC; also called glycine decarboxylase), glycine cleavage system protein H (GCSH), aminomethyltransferase (AMT), and dihydrolipoamide dehydrogenase (DLD).
- GLDC glycine dehydrogenase
- GCSH glycine cleavage system protein H
- AMT aminomethyltransferase
- DLD dihydrolipoamide dehydrogenase
- NKH non-ketotic hyperglycinemia
- glycine encephalopathy is characterized by accumulation of glycine in tissues and body fluids (e.g., plasma and cerebrospinal fluid) and results in a range of neurodevelopmental defects. It is inherited as an autosomal recessive trait. NKH is discussed in Hamosh A, et aL "Glycine Encephalopathy" in Pagon RA, et al., (eds.) Gene Reviews [Internet].
- Applicants surveyed a set of genes involved in amino acid catabolism to assess the potential requirement for expression of these genes in survival and/or proliferation of glioblastoma (GBM) cells.
- the genes were selected based at least in part on the following criteria: (1) loss-of-function mutations in the gene are a known cause of an inherited metabolic disorder in humans; and (2) expression of the gene was determined to be positively associated with GBM, GBM tumor initiating cells, and sternness. The effect of inhibiting expression of the selected genes was tested using short hairpin RNA (shRNA)-mediated knockdown.
- shRNA short hairpin RNA
- GLDC GCS component glycine dehydrogenase
- GLDC-knockdown-sensitive Those cell lines that exhibited markedly reduced viability (e.g., at least 10%, 20%, 25%, or more reduction in viability) were considered “GLDC-knockdown-sensitive” while those cell lines that did not exhibit markedly reduced viability (e.g., less than a 6% reduction in viability) were considered “GLDC-knockdown- insensitive” for these experiments.
- shRNA-mediated inhibition of a different GCS component glycine cleavage system protein H (GCSH), or treatment with cysteamine, a small molecule that is a known inhibitor of the GCS (9), markedly impaired viability of cell lines in the GLDC-knockdown-sensitive group.
- assessing the expression of SHMT2 is of use to identify tumor cells and/or tumors that have increased likelihood of being sensitive ("responding") to administration of a GCS inhibitor. In some aspects, assessing the expression of SHMT2 is of use to identify subjects in need of treatment for cancer, who have increased likelihood of benefiting from
- the GCS catalyzes the reversible oxidation of glycine, yielding carbon dioxide, ammonia, N5, 1 O-methylenetetrahydrofolate (5,10-CH2-H4 folate), and reduced pyridine nucleotide (NADH), according to the following overall reaction scheme:
- GLDC also termed P protein
- GCSH also termed H protein
- AMT also termed T protein
- T protein is a tetrahydrofolate-requiring enzyme
- DLD also termed L protein or E3
- E3 is a lipoamide dehydrogenase
- glycine catabolism reaction catalyzed by the GCS is believed to occur in three reactions (sometimes termed partial reactions), as follows:
- Lip, H4folate, and 5,10-CH2-H4folate represent lipoyl moiety, tetrahydrofolate, and N5,N10-methylene-H4 folate, respectively (7).
- P protein catalyzes the decarboxylation of glycine concomitantly with the transfer of the residual aminomethyl group to a sulfur atom on the lipoyl group of the oxidized H-protein, generating aminomethylated H-protein.
- T-protein catalyzes the transfer of a methylene group from aminomethylated H-protein to tetrahydrofolate (THF), resulting in the release of NH 3 and the generation of reduced H-protein.
- the dihydrolipoyl group of reduced H-protein is reoxidized by L-protein (7).
- L-protein (7) Under appropriate conditions, e.g., in anaerobic conditions such as those that exist in anaerobic bacteria, these reactions can function in reverse, resulting in synthesis of glycine.
- GCS components from a number of different eukaryotes and prokaryotes have been purified and characterized (see, e.g., references cited in (7), which are incorporated herein by reference).
- GCS components have been purified from tissue of several vertebrates, including human, rat, chicken, and bovine; from plants (e.g., pea), and from various bacterial species.
- Glycine cleavage activity has been detected in liver, kidney, and brain in various verterbrate species.
- cDNAs encoding GLDC, GCSH, AMT, and DLD of a number of species, including humans, other vertebrates, and various bacteria and plants, have been cloned and sequences are known in the art. Sequences are available, e.g., in various publicly available databases such as the National Center for Biotechnology
- NCBI Protein Data Bank
- Table B lists Gene IDs (from the NCBI Gene Database) and mRNA and protein accession numbers from the NCBI Reference Sequence (RefSeq) database for human GCS components.
- the GLDC, GCSH, AMT, and DLD proteins are naturally produced as "pre-proteins" that include a mitochondrial targeting sequence (MTS) at their N-terminus, which sequence is typically removed when the pre- protein is processed into a mature form in, e.g., a mammalian cell.
- MTS mitochondrial targeting sequence
- a normal DNA, RNA, or polypeptide sequence is a sequence found in at least some healthy individuals and not known to contribute to or result in a disease.
- a normal DNA, RNA, or polypeptide sequence may be, e.g., (i) the most common sequence present in a population; (ii) a reference sequence (e.g., an NCBI RefSeq sequence or UniProt reference sequence); (iii) a sequence in which the nucleotide present at each position of the sequence is tne most common nucleotide present at that position in a population; or (iv) a sequence in which all difference(s) relative to at least one of the foregoing sequences have a frequency of at least about 1 % in a population.
- Table B GCS Components (with human Gene IDs and accession numbers)
- GCS components have been expressed in various host cells using recombinant DNA technology and purified in active (or activatable) form.
- active (or activatable) form For example, tagged human H protein has been produced and purified (Zay, A., et al., Glycine cleavage enzyme complex: Molecular cloning and expression of the H-protein cDNA from cultured human skin fibroblastsBiochem. Cell Biol. 89(3):299-307 (2011)).
- E. coli lipoate protein ligase (LPL) has been expressed and purified and shown to lipoylate (attach the lipoate prosthetic group to) the apo-H-protein, converting it to the functional holo-H-protein.
- Tagged human T protein has been produced and purified (Okamura-Ikeda, K., et al. Crystal Structure of Human T-protein of Glycine Cleavage System at 2.0 A° Resolution and its Implication for Understanding Nonketotic Hyperglycinemia. J Mol. Biol. 351, 1 146-1159 (2005)).
- Human L protein (tagged or untagged) has been produced and purified (Kim, H., et al., Expression of cDNA sequences encoding mature and precursor forms of human dihydrolipoamide dehydrogenase in
- Mutant GCS components have been isolated from various species or generated using recombinant DNA techniques and assessed for activity.
- Various amino acid residues important for activity have been identified using, e.g., sequence conservation, structural information, and/or assays of activity of naturally occurring GCS proteins (e.g., mutant proteins occurring in NHK) or recombinantly produced GCS proteins containing amino acid alterations (see, e.g., Brautigam et al, 2005; Liu et al, 1995; Nakai, T. et al, Structure of P- piGiciii ui uic gl cine icav gc 3 ⁇ 4 3 ⁇ 4Lcin. impiu iuiuiis lur nuiuvciuiii iiypeigi iiiciiua. r.ivmi
- Tth P protein Thermus thermophilus
- Crystal structures of Tth P protein have been determined for the apoenzyme, the holoenzyme, and the holoenzyme in complex with an inhibitor ((aminooxy) acetate) and used to generate a model of the structure of human P protein (Nakai et al., 2005). Sequence conservation and structural information were used to identify the active site and certain functionally important residues of human P protein.
- H-protein is a monomeric protein of molecular weight ⁇ 14 kDa that plays acentral role in glycine cleavage.
- the lipoic acid prosthetic group covalently bound to a specific lysine residue of the H-protein interacts with sites on the P-, T- and L-proteins. Structures of H-protein from pea leaves, with a reduced lipoic acid, an oxidized lipoic acid, and aminomethyllipoic acid have been determined (Pares et al., 1994; Pares et al, 1995).
- a crystal structure of bovine H protein has been reported (Higashiura A, et al., High-resolution X-ray crystal structure of bovine H-protein at 0.88 A resolution. Acta Crystallogr D Biol Crystallogr. 66(Pt 6):698-708 (2010).
- L protein catalyzes the last step of the glycine cleavage reaction scheme shown above, which involves the oxidation of dihydrolipoamide (Lip-(SH) 2 ), forming lipoamide (Lip-S 2 ).
- An FAD cofactor is an intermediary in the electron transfer from Lip-(SH) 2 to NAD* .
- L protein functions as a homodimer with two intramolecular disulfide bridges between cysteine residues that are proximal to the FAD cofactors. Crystal structures of human L protein in the presence of NAD+ or NADH have been determined (Brautigam 2005, supra). NKH-causing mutations were found to occur at the dimer interface, the active site, or the FAD and NAD (+)-binding sites.
- methods useful for identifying tumor cells, tumor cell lines, or tumors that are sensitive to GCS inhibition are provided herein.
- methods useful for identifying agents to which tumor cells, tumor cell lines, or tumors are sensitive are provided herein.
- atumor, tumor cell, or tumor cell line is considered "sensitive" to an agent (e.g., a GCS inhibitor) or intervention if exposure to the agent or intervention has at least one anti-tumor effect on the tumor, tumor cell, or tumor cell line.
- an "anti-tumor effect" is, e.g., inhibition of tumor cell survival (viability), proliferation, tumor initiating capacity, and/or metastasis, or a decrease in tumor size, growth rate, or likelihood of progression or recurrence.
- a tumor, tumor cell, or tumor cell line is considered sensitive to a GCS inhibitor if the GCS inhibitor inhibits tumor cell viability or proliferation, e.g., if the tumor, tumor cell, or tumor cell line exhibits a decrease in cell viability and/or cell proliferation following exposure to the GCS inhibitor as compared with a suitable reference value.
- a suitable reference value may be, e.g., the level of viability or proliferation that existed prior to exposure to the GCS inhibitor or the level of viability and/or proliferation that would be expected in the absence of the GCS inhibitor.
- a tumor is considered sensitive to a GCS inhibitor if exposure to the GCS inhibitor results in a reduction in tumor size, growth rate, or likelihood of metastasis or recurrence, e.g., if the tumor exhibits a decrease in size, growth rate, or likelihood of metastasis or recurrence following exposure to a GCS inhibitor as compared with a suitable reference value.
- a suitable reference value may be, e.g., the size, growth rate, or likelihood of metastasis or recurrence that that existed prior to exposure to the GCS inhibitor or that would be expected in the absence of the GCS inhibitor.
- a level that would be expected in the absence of the GCS inhibitor is determined by performing a control assay in which comparable tumor or tumor cell(s), e.g., tumor cells of the same tumor ceil line or a tumor derived from the same tumor cell line, is not exposed to the GCS inhibitor.
- a level that would be expected in the absence of the GCS inhibitor is determined using a control group of subjects not treated with a GCS inhibitor.
- sensitivity of a tumor ceil, tumor cell line, or tumor to GCS inhibition or sensitivity to an agent, e.g., a GCS inhibitor, or combination of agents is assessed using tumor cells in culture.
- Numerous tumor cell lines and non-tumorigenic cell lines are know in the art. Cell lines can be obtained, e.g., from depositories or cell banks such as the American Type Culture Collection (ATCC), Coriell Cell Repositories, Deutsche Sammlung von Mikroorganismen und Zellkulturen (German Collection of Microorganisms and Cell Cultures; DSMZ), European Collection of Cell Cultures (ECACC), Japanese Collection of Research Bioresources (JCRB), RIKEN, Cell Bank Australia, etc.
- tumor cells e.g., a tumor cell line
- tumor cells e.g., a tumor cell line
- originates from a tumor of a non-human animal e.g., a tumor that was not produced by introduction of tumor cells into the non-human animal.
- tumor cells originate from a naturally arising tumor (i.e., a tumor that was not intentionally induced or generated for, e.g., experimental purposes).
- Tumor cells can be produced by genetically modifying a non-tumor cell, e.g., a non-tumor somatic cell, e.g., by expressing or activating an oncogene in the non-tumor cell and/or inactivating or inhibiting expression of one or more tumor suppressor genes (TSG) or inhibiting activity of a gene product of a TSG.
- TSG tumor suppressor genes
- Certain experimentally produced tumor cells and exemplary methods of producing tumor cells are described in PCT/US2000/015008 (WO/2000/073420) and/or in USSN 10/ USSN 10/767,018.
- a non-tumor cell is immortalized by causing the cell to express telomerase catalytic subunit (e.g., human telomerase catalytic subunit; hTERT).
- a tumor cell is produced from a non-tumor cell by introducing one or more expression construct(s) or expression vector(s) comprising an oncogene into the cell or modifying an endogenous gene (proto-oncogene) by a targeted insertion into or near the gene or by deletion or replacement of a portion of the gene.
- a TSG is knocked out or functionally inactivated using gene targeting. For example, a portion of a TSG may be deleted or the TSG may be disrupted by an insertion.
- a TSG is inhibited by introducing into a cell one or more expression construct(s) or expression vector(s) encoding an inhibitory molecule (e.g., an RNAi agent such as a shRNA or a dominant negative or a negative regulator) that is capable of inhibiting the expression or activity of an expression product of a TSG.
- an inhibitory molecule e.g., an RNAi agent such as a shRNA or a dominant negative or a negative regulator
- Oncogenes and/or TSG inhibitory molecules may be expressed under control of suitable regulatory elements, which may be constitutive or regulatable (e.g., inducible).
- tumor cells may be produced by expressing or activating multiple oncogenes and/or inhibiting or inactivating multiple TSGs, e.g., 1 , 2, 3, 4, or more oncogenes and/or 1, 2, 3, 4, or more TSGs.
- multiple oncogenes and/or TGSs whose expression/activation or
- inhibition/inactivation can be used to induce tumors are known in the art.
- Tumor cells may be maintained in a culture system comprising a culture medium to which an agent (e.g., a GCS inhibitor) is or has been added.
- an agent e.g., a GCS inhibitor
- the effect of the agent on tumor cell viability, proliferation, tumor-initiating capacity, or any other tumor cell property may be assessed.
- any suitable method known in the art may be used for assessing tumor cell viability or proliferation or tumor-initiating capacity in various embodiments.
- survival and/or proliferation of a cell or cell population may be determined by: a cell counting assay (e.g., using visual inspection, automated image analysis, flow cytometer, etc.), a replication assay, a cell membrane integrity assay, a cellular ATP-based assay, a mitochondrial reductase activity assay, a BrdU, EdU, or H3- Thymidine incorporation assay, a DNA content assay using a nucleic acid dye, such as Hoechst Dye, DAPI, Actinomycin D, 7-aminoactinomycin D or propidium iodide, a cellular metabolism assay such as resazurin (sometimes known as AlamarBlue or by various other names), MTV, XTT, and CellTitre Glo, etc., a protein content assay such as SRB
- a cell counting assay e.g., using visual inspection, automated image analysis, flow cytometer, etc.
- a replication assay e
- inhibition of cell proliferation or survival by a GCS inhibitor may, or may not, be complete.
- cell proliferation may, or may not, be decreased to a state of complete arrest for an effect to be considered one of inhibition or reduction of cell proliferation.
- "inhibition" may comprise inhibiting proliferation of a cell that is in a non-proliferating state (e.g., a cell that is in the GO state, also referred to as "quiescent") and/or inhibiting proliferation of a proliferating cell (e.g., a cell that is not quiescent).
- inhibition of cell survival may refer to killing of a cell, or cells, such as by causing or contributing to necrosis or apoptosis, and/or the process of rendering a cell susceptible to death.
- the inhibition may be at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% of a reference level (e.g., a control level).
- a GCS inhibitor is used, e.g., contacted with tumor cells, e.g., tumor cells that overexpress SHMT2, in an amount (e.g...
- a concentration that inhibits tumor cell proliferation or survival by a selected amount, e.g., by at least aboutl0%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% of a reference level (e.g., a control level).
- a reference level e.g., a control level
- an anti-tumor effect is inhibition of the capacity of tumor cells to form colonies in suspension culture. In some embodiments an anti-tumor effect is inhibition of capacity of the one or more tumor cells to form colonies in a semi-solid medium such as soft agar or methylcellulose. In some embodiments an anti-tumor effect is inhibition of capacity of the one or more tumor cells to form tumor spheres in culture. In some embodiments an anti-tumor effect is inhibition of the capac ity of the one or more tumor cells to form tumors in vivo.
- sensitivity of a tumor cell, tumor cell line, or tumor to GCS inhibition or sensitivity to an agent, e.g., a GCS inhibitor, or combination of agents is assessed using an in vivo tumor model.
- An "in vivo"tumor model involves the use of one or more living non-human animals ("test animals").
- test animals may involve administration of an agent (e.g., a GCS inhibitor) and/or introduction of tumor cells to one or more test animals.
- a test animal is a mouse, rat, or dog.
- Numerous in vivo tumor models are known in the art. By way of example, certain in vivo tumor models are described in U.S. Pat. Nos. 4,736,866; USSN 10/ 990993;
- tumor cells may be used in an in vivo tumor model in various embodiments.
- Tumor cells may be from a tumor cell line or tumor sample.
- tumor cells nrim ' nate from a naturally arising tumor (i.e., a tumor that was not intentionally induced or generated for. e.g.. experimental purposes).
- experimentally produced tumor cells may be used.
- the number of tumor cells introduced may range, e.g., from 1 to about 10, 10 2 , 10 3 , 10 4 , 1 () ⁇ 10 6 , 10 7 , 10 8 , 10 9 , or more.
- the tumor cells overexpress SHMT2, e.g., the tumor cells are from a tumor cell line or tumor that overexpresses SHMT2.
- the tumor cells are of the same species or inbred strain as the test animal.
- tumor cells may originate from the test animal.
- the tumor cells are of a different species than the test animal.
- the tumor cells may be human cells.
- a test animal is immunocompromised, e.g., in certain embodiments in which the tumor cells are from a different species to the test animal or originate from an immunologically incompatible strain of the same species as the test animal.
- a test animal may be selected or genetically engineered to have a functionally deficient immune system or may be treated (e.g., with radiation or an immunosuppressive agent or surgery such as removal of the thymus) so as to reduce immune system function.
- Atest animal is a SCID mouse, NOD mouse, NOD/SCI D mouse, nude mouse, and/or Ragl and/or Rag2 knockout mouse, or a rat having similar immune system dysfunction.
- Tumor cells may be introduced at an orthotopic or non-orthotopic location. In some embodiments tumor cells are introduced subcutaneously, under the renal capsule, or into the bloodstream.
- Non-tumor cells e.g., fibroblasts, bone marrow derived cells
- an extracellular matrix component or hydrogel e.g., collagen or Matrigel®
- an agent that promotes tumor development or growth may be administered to the test animal prior to, together with, or separately from the tumor cells.
- Tumor cells may be contacted with an agent (e.g., a GCS inhibitor) prior to grafting and/or following grafting (by administering the agent to the test animal).
- an agent e.g., a GCS inhibitor
- the number, size, growth rate, metastasis, or other properties may be assessed at one or more time points following grafting.
- a tumor in an in vivo tumor model arises due to neoplastic transformation that occurs in vivo, e.g., at least in part as a result of one or more mutations existing or occurring in a cell in vivo.
- a test animal is a tumor-prone animal.
- the animal may, for example, be of a species or strain that naturally has a predisposition to develop tumors and/or may be a genetically engineered animal.
- the animal is a genetically engineered animal at least some of whose cells comprise, as a result of genetic modification , at least one activated oncogene and/or in which at least one TSG has been functionally inactivated.
- Standard methods of generating genetically modified animals e.g., transgenic animals that comprises exogenous genes or animals that have an alteration to an endogenous gene, e.g., an insertion or an at least partial deletion or replacement (sometimes referred to as "knockout" or "knock-in” animal) can be used.
- Tumor number, size, growth rate, or metastasis may, for example, be assessed using various imaging modalities, e.g., X-ray, magnetic resonance imaging, functional imaging, e.g., of metabolism (e.g., using PET scan), etc.
- tumor(s) may be removed from the body (e.g., at necropsy) and assessed (e.g., tumors may be counted, weighed, and/or size (e.g., dimensions) measured).
- the size and/or number of tumors may be determined non-invasively.
- tumor cells that are fluorescently labeled can be monitored by various tumor-imaging techniques or instruments, e.g., noninvasive fluorescence methods such as two-photon microscopy.
- noninvasive fluorescence methods such as two-photon microscopy.
- the size of a tumor implanted subcutaneously can be monitored and measured underneath the skin.
- treatment effect or sensitivity of a tumor in a human subject may be evaluated at least in part using objective criteria known in the art.
- objective criteria known in the art.
- RECIST may be used to determine if a cancer patient improves ("responds"), remains about the same (“stable disease”), or worsens ("progressive disease”) based on anatomical tumor burden.
- a tumor may be considered '"sensitive' " if the subject experiences a response (complete or partial response) or stable disease or a slowing of tumor progression for at least a period of time, e.g.. a period of time that would be considered iini « ii meaningful.
- Tumor progression may comprise, e.g., progression to a more advanced stage or grade; local, regional, or distant spread (e.g., metastasis).
- a decrease in viability, proliferation, size, growth rate, or likelihood of progression or recurrence is statistically significant.
- a period of time may be at least 4, 6, 8, 12 weeks, or more.
- criteria mentioned herein for assessing tumor sensitivity in human subjects are merely exemplary. Modified versions or other reasonable criteria may be used.
- criteria based on anatomic tumor burden should reasonably correlate with a clinically meaningful benefit such as increased survival (e.g, increased progression-free survival, increased cancer-specific survival, or increased overall survival) or at least improved quality of life, such as reduction in one or more symptoms.
- treatment effect or sensitivity of a tumor may beassessed by evaluating an outcome.
- overall survival may be assessed.
- disease-specific survival i.e., survival considering only mortality due to cancer
- progression-free survival is assessed.
- An outcome may be assessed over a given time period, e.g., 1, 2, 5, 10, 15, or 20 years from, e.g., the date of diagnosis or a date of initiating treatment.
- Methods and criteria for evaluating progression, response to treatment, existence of metastases, and other outcomes are known in the art and may include objective measurements (e.g., anatomical tumor burden) and criteria, clinical evaluation of symptoms), or combinations thereof.
- imaging e.g., using X-ray, CT scan, or MRI scan, etc.
- functional imaging may be used to detect or assess lesions (local or metastatic), e.g., to measure anatomical tumor burden, detect new lesions, etc.
- Applicants discovered that (i) expression of mitochondrial serine hydroxymethyltransferase 2 (SHMT2) is elevated in a number of tumor types; and (ii) the level of SHMT2 expression correlates with tumor cell sensitivity to GCS inhibition.
- SHMT2 mitochondrial serine hydroxymethyltransferase 2
- analysis of the expression levels of multiple genes involved in glycine metabolism revealed that expression of mitochondrial SHMT2, an enzyme involved in the conversion of serine to glycine in the mitochondria, was tightly correlated with sensitivity to GLDC knockdown.
- Tumor cell lines that were sensitive to GLDC knockdown i.e., tumor cells lines whose survival or proliferation was inhibited by GLDC knockdown
- Tumor cell lines that overexpressed SHMT? relative to. e.g., normal tissue controls were sensitive to GCS inhibition by a small molecule (cysteamine), whereas tumor cell lines that displayed low or absent expression of SHMT2 were insensitive to GCS inhibition.
- expression level of SHMT2 is correlated with tumor cell sensitivity to GCS inhibition.
- shRNA-mediated knockdown of SHMT2 in tumor cells that were sensitive to GCS inhibition protected these cells against GLDC shRNAs. Without wishing to be bound by any theory, this result suggests that the relationship between SHMT2 levels and sensitivity to GCS inhibition is not simply correlative but may also be functionally relevant.
- Human SHMT2 has been assigned Gene ID 6472.
- SHMT2 genes (homologs of the human gene) have been identified in a wide range of other species (e.g., other vertebrates, insects, fungi). Multiple isoforms of human SHMT2 polypeptide have been identified, and multiple transcript variants are known.
- Table C lists RefSeq accession numbers of exemplary sequences of human SHMT2 protein isoforms and mRNA transcript variants.
- SHMT2 mRNA levels were significantly elevated in a large number of cancers, relative to normal tissue controls.
- microarray-based meta-analyses revealed that SHMT2 expression is increased in a number of cancers, including a variety of brain tumors, bladder tumors, breast tumors, cervical tumors, colorectal tumors, embryonal tumors, gastric tumors, germ cell tumors, head and neck tumors, hematologic tumors, kidney tumors, melanomas, mesothelial tumors, ovarian tumors, yolk sac tumors, and sarcomas.
- SHMT2 was within the top 1% of overexpressed genes in that particular cancer (see Table 1 in Examples).
- a method of classifying a tumor cell, tumor cell line, or tumor comprises: (a) assessing SHMT2 expression in the tumor cell, tumor cell line, or tumor; and (b) classifying the tumor cell, tumor cell line, or tumor based on results of step (a).
- a tumor cell, tumor cell line, or tumor is classified into one of at least two groups based on expression of SHMT2. For example, in some embodiments a tumor cell, tumor cell line, or tumor is classified as exhibiting overexpression of SHMT2 or as not exhibiting overexpression of SHMT2.
- expression levels of SHMT2 are of use to distinguish between tumor cells that are likely to sensitive or less likely to be sensitive to GCS inhibition.
- the level of SHMT2 expression is used to predict sensitivity of a tumor cell, tumor cell line, or tumor to GCS inhibition.
- a tumor cell, tumor cell line, or tumor that overexpresses SHMT2 is classified as having an increased likelihood of being sensitive to inhibition of the GCS.
- a subject in need of treatment for a tumor that overexpresses SHMT2 is classified as having an increased likelihood of being a suitable candidate for treatment with an inhibitor of the GCS, e.g., the subject is classified as having an increased likelihood of benefiting from treatment with a GCS inhibitor.
- a method of classifying a tumor comprises: (a) determining whether the tumor is of a type that has a tendency to overexpress SHMT2; and (b) classifying the tumor based on results of step (a).
- a tumor type that has a tendency to overexpress SHMT2 is a brain tumor, bladder tumor, breast tumor, cervical tumor, colorectal tumor, embryonal tumor, gastric tumor, germ cell tumor, head and neck tumor, hematologic tumor, kidney tumor, melanoma, mesothelial tumor, ovarian tumor, yolk sac tumor, or sarcoma.
- a breast tumor is a triple negative breast tumor.
- the method further comprises assessing SHMT2 expression in the tumor.
- any cell, cell line, or tumor from which a suitable sample is available may be assessed for SHMT2 expression or activity (and/or used one or more purposes described herein).
- Numerous tumor cell lines and non-tumorigenic cell lines are known in the art. Cell lines may be obtained, e.g., from depositories or cell banks such as those listed above. Exemplary tumor cell lines and tumors that overexpress SHMT2 or that do not overexpress SHMT2 are described in the Examples.
- overexpression or “overexpressed” are used interchangeably to refer to a level of expression (e.g., an amount of a gene product, such as mRNA or protein, produced or present) that is greater than, e.g., at least about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10-fold or more higher than, a reference level or control level. However, in some embodiments, overexpression may refer to a level between 1.1 and 1.5 -fold higher than a reference or control level. In some embodiments a control level is a level in normal (non-tumor) cells or non-tumor tissue. In some embodiments non-tumor tissue is tissue adjacent to a tumor.
- a control level is a level in normal (non-tumor) cells or non-tumor tissue.
- non-tumor tissue is tissue adjacent to a tumor.
- non-tumor tissue is tissue of the same tissue type as that from which a tumor arose.
- non-tumor cells are cells present in non-tumor tissue, e.g., non-tumor tissue adjacent to a tumor.
- a gene is overexpressed in a tumor cell, tumor cell line, or tumor, if expression is detectably greater than background in the tumor cell, tumor cell line, or tumor, and is not detectably greater than background in control cells.
- overexpression of SHMT2 refers to an expression level at least about 50%, 60%, 70%, 80%, 90%, or 100% as high as that present in cells of the U- 251, BT145, 0308, A2058, ACHN, or LN229 cell line (or an average expression level of these cell lines), where, for those cell lines that can be induced to differentiate by culturing under particular conditions, the expression of SHMT2 is measured in cells cultured under non-differentiation-inducing conditions.
- overexpression of SHMT2 refers to an expression level at least about 50%, 60%, 70%, 80%, 90%, or 100% as high as that present in any one or more of the cancers listed in Table 1.
- a level of SHMT2 expression at or below the level of expression exhibited by MCF7, HMC-1- 8, U87, PC3, DoTc2-4510, or exhibited by BT145 or 0308 when induced to differentiate represents a lack of overexpression of SHMT2.
- assessing the level of SHMT2 expression comprises determining whether at least some tumor cells overexpress SHMT2 or assessing the percentage of tumor cells that overexpress SHMT2.
- a tumor may be considered to overexpress SHMT2 if at least about 10%, 20%, 30%, 40%, 50%, or more of the tumor cells analyzed overexpress SHMT2.
- at least about 50%, 60%, 70%, 80%, 90%, or more of tumor cells exhibit intense staining for SHMT2.
- Figure 6 shows representative examples of brain tumor (GBM) sections exhibiting overexpression of SHMT2 and normal brain tissue (representative of tissue that does not overexpress SHMT2).
- a cell overexpresses SHMT2 sufficiently ctrrm r t i v c UC h that individual punctae are not easily distinguished by IHC performed using conditions in which such punctae would be readily distinguished in non-cancer control cells that express SHMT2.
- a method comprises assessing the level of SHMT2 expression by determining the level of an SHMT2 gene product in a sample, e.g., a tumor sample.
- methods for classifying a tumor sample according to the level of an SHMT2 gene product in the sample are provided.
- a method of classifying a tumor sample comprises steps of: (a) providing a tumor sample; and (b) assessing SHMT2 expression in the tumor sample, wherein the level of SHMT2 expression is correlated with sensitivity to GCS inhibitor, thereby classifying the tumor sample with respect to sensitivity to a GCS inhibitor.
- a method of classifying a tumor comprises: (a) determining the level of SHMT2 expression in a sample obtained from the tumor; (b) comparing the level of SHMT2 expression with a control level of SHMT2 expression; and (c) classifying the tumor with respect to the likelihood that the tumor is sensitive to a GCS inhibitor based on the result of step (b), wherein a greater (increased) level of SHMT2 gene expression in the sample as compared with the control level of SHMT2 expression is indicative of an increased likelihood that the tumor is sensitive to a GCS inhibitor.
- a method for tumor diagnosis, prognosis, prediction, or treatment selection comprises assessing the level of SHMT2 expression in the tumor.
- a method for tumor diagnosis, prognosis, prediction, or treatment selection comprises: (a) assessing the level of SHMT2 expression in a tumor; and (b) providing diagnostic, prognostic, predictive, or treatment selection information based at least in part on step (a).
- a method for tumor diagnosis, prognosis, prediction, or treatment selection comprises: (a) providing a tumor sample obtained from a subject; (b) assessing the level of SHMT2 expression in the sample; and (c) providing diagnostic, prognostic, predictive, or treatment selection information based at least in part on step (a).
- a method may further comprise scoring the sample or tumor based on the level of SHMT2 expression.
- the score may be used to provide diagnostic, prognostic, predictive, or treatment selection information.
- diagnostic information comprises diagnosing the presence of a tumor. For example, the presence of cells that express or overexpress SHMT2 in a location or sample that would not normally (in the absence of a tumor) be expected to contain such cells a ""dicative of a tumor, or the presence of an increased number of cells that overexpress SHMT2 as compared with the number of such cells that would be expected normally (in the absence of a tumor) may be indicative of a tumor.
- the presence or level of SHMT2 expression may correlate with prognosis, e.g., outcome, independent of a particular treatment.
- prognosis e.g., outcome
- tumors that overexpress SHMT2 may, in general, be more aggressive, be more likely to result in a poor outcome when treated using standard therapy, and/or be more likely to recur after treatment using standard therapy than tumors that do not overexpress SHMT2.
- Outcome may be assessed, e.g., by disease-free survival, overall survival (e.g., 1, 2, 5, or 10 year survival post-diagnosis).
- Such a correlation may be established by analysis of SHMT2 expression in tumor samples from a cohort of patients for whom outcome data are available.
- Subjects may be classified into groups based on SHMT2 expression in tumor samples from the subjects and appropriate analysis, e.g., appropriate statistical analysis, may be performed to detect a difference between groups. For example, Kaplan-Meier analysis may be used.
- predictive information comprises predicting the likelihood that a tumor will be sensitive to a GCS inhibitor (will respond to a GCS inhibitor), wherein increased SHMT2 expression indicates an increased likelihood that the tumor will be sensitive to a GCS inhibitor.
- methods of predicting the likelihood that a tumor cellor tumor is sensitive to a GCS inhibitor are provided, the methods comprising determining whether the tumor cell or tumor overexpresses SHMT2, wherein if the tumor cell or tumor overexpresses SHMT2, the tumor cell or tumor has increased likelihood of being sensitive to a GCS inhibitor than if the tumor cell or tumor does not overexpress SHMT2.
- methods of use to identify a subject who is a suitable candidate for therapy with a GCS inhibitor comprising assessing the level of SHMT2 expression in a tumor sample obtained from a subject having cancer, wherein an increased level of SHMT2 expression indicates that the subject is a suitable candidate for treatment with a GCS inhibitor.
- a method of selecting a treatment for a subject in need of treatment for cancer comprises (a) assessing the level of SHMT2 expression in a tumor sample obtained from a subject having cancer; and (b) selecting a therapeutic agent for the subject based at least in part on the result of step (a).
- a method of selecting a treatment for a subject in need of treatment for cancer comprises (a) assessing the level of SHMT2 expression in a tumor sample obtained from the ,, ⁇ ; ⁇ *. "id (b) selecting a GCS inhibitor as a therapeutic agent for a subject if the tumor overexpresses SHMT2. In some embodiments the method further comprises treating the subject with a GCS inhibitor. In some embodiments a method of treating a subject comprises: (a) providing a subject in need of treatment for a tumor that has been determined to overexpress SHMT2; and (b) treating the subject with a GCS inhibitor.
- a method comprises: (a) determining that a subject is in need of treatment for a tumor that overexpresses SHMT2; and (b) treating the subject with a GCS inhibitor.
- a method comprises: (a) determining that a subject with cancer is a suitable candidate for treatment with a GCS inhibitor, based at least in part on the level of SHMT2 expression in the cancer; and (b) treating the subject with a GCS inhibitor.
- a method of assessing efficacy of treatment of cancer comprising: (a) assessing the level of SHMT2 expression or SHMT2 activity in a sample obtained from a subject who has been treated for cancer, wherein absence of increased SHMT2 expression or absence of increased SI IMT2 activity in the sample indicates effective treatment.
- step (a) is repeated at one or more time points following treatment of the subject for cancer, wherein continued absence of increased SHMT2 expression or increased SHMT2 activity of over time indicates effective treatment.
- the sample may be obtained, for example, from or close to the site of a tumor that was treated (e.g., from or near a site from which a tumor was removed).
- the tumor may have originally been determined to overexpress SHMT2.
- a method of assessing efficacy of treatment of cancer comprising: (a) assessing the level of SHMT2 expression or SHMT2 activity in a sample obtained from a subject having cancer, and (b) repeating step (a) at one or more time points during treatment of the subject, wherein decreased SHMT2 expression or decreased SHMT2 activity of over time or maintained reduct ion in SHMT2 expression or activity over time indicates effective treatment.
- the sample may be obtained, for example, from or close to the site of a cancer being treated.
- the tumor may have originally been determined to comprise at least some cells that overexpress SHMT2.
- a method of monitoring a subject for tumor recurrence comprising: (a) assessing the level of SHMT2 expression or SHMT2 activity in a sample obtained from a subject that has been treated for a tumor, wherein
- step (a) is repeated at one or more time points following treatment.
- the sample may be obtained, for example, from or near the site of a tumor (e.g., from or near a site from which a tumor was removed).
- the level of SHMT2 expression may be assessed by assessing the level of an SHMT2 gene product, e.g., RNA or protein. Any suitable method known in the art useful for assessing gene products, e.g., RNA or proteins, may be used in various embodiments.
- RNA is measured based at least in part on hybridization , amplification , and/or sequencing.
- RNA e.g., mRNA
- in situ hybridization e.g., Northern blots
- microarray hybridization e.g., using cDNA or oligonucleotide microarrays
- reverse transcription PCR e.g., real-time reverse transcription PCR; quantitative RT-PCR
- reverse transcription followed by sequencing nanostring technology (Geiss, G., et al., Nature Biotechnology (2008), 26. 317 - 325), flow cytometry, etc.
- the TaqMan® assay and the SYBR® Green PCR assay are commonly used real-time PCR techniques.
- a number of these methods include a step of contacting a sample with one or more nucleic acid probe(s) or primer(s) comprising a sequence (e.g., at least 10 nucleotides in length, e.g., at least 12, 15, 20, or 25 nucleotides in length) substantially or perfectly complementary to a target RNA whose level is to be measured.
- a probe or primer may be labeled, e.g., with a fluorescent dye.
- a probe or primer comprises a sequence that is sufficiently complementary to an mRNA of interest to allow the probe or primer to distinguish between such mRNA and most or essentially all (e.g., at least 99%, or more) transcripts from other genes in a mammalian cell, e.g., a human cell, under the conditions of an assay.
- Primers may be designed using methods and software programs known in the art. For example, PrimerBlast , a program available at the NCBI website that makes use of the algorithm Primer3 (Rozen, S and Skaletsky, HJ (2000) PrimerS on the WWW for general users and for biologist programmers.
- a probe or primer may be attached to a support or may be in solution in various embodiments.
- a support may be a substantially planar support, e.g., a slide or chip, or a particulate support, e.g., an approximately spherical support such as a microparticle (also referred to as a "bead").
- a sequencing-based approach such as serial analysis of gene expression co .
- a rn ⁇ /' including variants thereof) or RNA-Seq may be used.
- RNA-Seq refers to the use of any of a variety of high throughput sequencing techniques to quantify RNA transcripts (see, e.g., Wang, Z., et al. Nature Reviews Genetics (2009), 10, 57-63).
- Other methods of use for detecting RNA include, e.g., electrochemical detection or fluorescence-correlation spectroscopy. It will be understood that certain methods that detect mRNA may, in some instances, also detect at least some pre-mRNA transcript(s), transcript processing
- increased copy number of a chromosomal region containing at least a portion of the SHMT2 gene may be used as an indicator of overexpression.
- copy number of a region is considered increased if more than 2 copies of the region per cell are present in at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more of tumor cells in a tumor or tumor cell line.
- copy number may be at least 3, 4, 5, 8, 10, or 15.
- copy number of a region is considered decreased if less than 2 copies of the region per cell are present in at least 10%, 20%, 30%, 40%, 50%>, or more of tumor cells in a tumor or tumor cell line.
- Methods useful for assessing copy number include, e.g., fluorescence in situ hybridization (FISH), multiplex ligation-dependent probe amplification, quantitative multiplex PCR of short fluorescent fragments (QMPSF), comparative genomic hybridization, array comparative genomic hybridization, SNP array technologies. DNA sequencing, etc.
- FISH fluorescence in situ hybridization
- QMPSF quantitative multiplex PCR of short fluorescent fragments
- any method suitable for detecting and/or measuring proteins may be used to assess the level of SHMT2 polypeptide in various embodiments.
- an immunological method or other affinity-based method may be used.
- Immunological detection methods generally involve detecting specific antibody-antigen interactions, e.g., in a sample.
- An antibody may be monoclonal or polyclonal.
- An antibody preparation may comprise multiple monoclonal antibodies, which may have been generated using the same or different portions of a polypeptide of interest as immunogens or binding targets.
- an antibody is an anti-peptide antibody.
- an antibody e.g., an antibody that binds to an antigen (primary antibody) or a secondary antibody that binds to the primary antibody, has been tagged or conjugated with a label.
- a label also referred to as a "detectable label” may be any moiety that facilitates detection and, optionally, quantification, of an entity that comprises it or to which it is attached.
- Labels that may be used in various embodiments include, e.g., organic materials (including small molecule dye fluorophores, quenchers, polymers, fluorescent proteins); inorganic materials "'" ⁇ TMetal chelates, colloidal metal, metal and semiconductor nanocrystals (e.g., quantum dots); compounds that exhibit luminescensce upon enzymatic catalysis such as naturally occurring or synthetic luciferins (e.g., firefly or Ren ilia luciferin, coelenterazine), haptens, radioactive atoms, isotopes, or enzymes.
- organic materials including small molecule dye fluorophores, quenchers, polymers, fluorescent proteins
- inorganic materials "'" ⁇ TMetal chelates, colloidal metal, metal and semiconductor nanocrystals e.g., quantum dots
- compounds that exhibit luminescensce upon enzymatic catalysis such as naturally occurring or synthetic luciferins (e.g., firefly or Ren
- Fluorescent dyes include, e.g., acridine dyes; Alexa dyes; BODIPY, coumain, cyanine dyes; fluorescein dyes, rhodamine dyes, xanthene dyes, and derivatives of any of the foregoing. See, e.g., The Handbook— A Guide to Fluorescent Probes and Labeling Technologies, 10th edition (Invitrogen Corp.), which describes numerous fluorescent and otherwise detectable molecules and methods for their use and modification. Enzymes include, e.g., luciferase, beta-galactosidase, horseradish peroxidase, alkaline phosphatase.
- a label may be directly detectable or indirectly detectable in various embodiments. For example, a fluorescent dye would be directly detectable, whereas an enzyme may be indirectly detectable, e.g., the enzyme reacts with a substrate to generate a directly detectable signal. In some embodiments a label-free detection method may be used.
- Exemplary immunological detection methods include, e.g.,
- immunohistochemistry which term generally refers to the immunologically based detect ion of a tissue or cellular constituent in a tissue or cell sample; enzyme-linked immunosorbent assay (ELISA), bead-based assays such as the Luminex® assay platform (Invitrogen), protein microarrays, surface plasmon resonance assays (e.g., using BiaCore® technology), microcanti levers, immunoprecipitation, Western blot, flow cytometry.
- ELISA enzyme-linked immunosorbent assay
- bead-based assays such as the Luminex® assay platform (Invitrogen)
- protein microarrays e.g., protein microarrays
- surface plasmon resonance assays e.g., using BiaCore® technology
- microcanti levers e.g., using BiaCore® technology
- ELISA assays typically involve use of primary or secondary antibodies that are linked to an enzyme, which acts on a substrate to produce a detectable signal (e.g., production of a colored product) to indicate the presence of antigen or other analyte.
- ELISA also encompasses use of non-enzymatic reporters such as fluorogenic, electrochemiluminescent, or real-time PGR reporters that generate quantifiable signals. It will be appreciated that the term “ELISA” encompasses a number of variations such as “indirect”, “sandwich”, “competitive”, and “reverse” ELISA.
- IHC is considered to encompass immunocytochemistry (ICC), which term generally refers to the immunological detection of a cellular constituent in isolated cells that essentially lack extracellular matrix components and tissue microarchitecture that would typically be present in a tissue sample.
- ICC immunocytochemistry
- a sample is in the form of a tissue section, which may be a fixed or a fresh (e.g., fresh frozen) tissue section or cell smear in various embodiments.
- a sample e.g., a tissue section, may be embedded, e.g., in paraffin or a synthetic resin or combination thereof.
- a sample e.g., a t; '"-" v —'ion, may be fixed using a suitable fixative such as a formalin-based fixative.
- a section may be a paraffin-embedded, formalin-fixed tissue section.
- a section may be deparaffmized (a process in which paraffin or other substance in which the tissue section has been embedded is removed at least sufficiently to allow staining of a portion of the tissue section).
- a variety of antigen retrieval procedures (sometimes called antigen recovery), may be used, e.g., in IHC.
- Such methods may include, for example, applying heat (optionally with pressure) and/or treating with various proteolytic enzymes.
- Methods can include microwave oven irradiation, combined microwave oven irradiation and proteolytic enzyme digestion, pressure cooker heating, autoclave heating, water bath heating, steamer heating, high temperature incubator, etc.
- a buffer that blocks the reactive sites to which the primary or secondary antibodies may otherwise bind.
- Common blocking buffers include, e.g., normal serum, nonfat dry milk, bovine serum albumin (BSA), or gelatin, and various commercial blocking buffers.
- a second stain may be applied, e.g., to provide contrast that helps the primary stain stand out.
- a stain may be referred to as a
- counterstain Such stains may show specificity for discrete cellular compartments or antigens or stain the whole cell. Examples of commonly used counterstains include, e.g., hematoxylin, Hoechst stain, or DAPI.
- an affinity-based method may use a non-antibody ligand of other specific binding agent as a detection reagent, e.g., in place of an antibody.
- cell imaging optionally computer-aided, may be used to detect and, optionally, measure, SHMT2 mRNA or polypeptide.
- CellProfiler is an exemplary cell image analysis program.
- a method comprises assessing at least one SHMT2 isoform or at least one transcript encoding an SHMT2 isoform.
- at least SHMT2 mitochondrial isoform 1 , SHMT2 mitochondrial isoform 1 precursor or a transcript encoding SHMT2 mitochondrial isoform 1 precursor is assessed.
- at least SHMT2 mitochondrial isoform 2, SHMT2 mitochondrial isoform 2 precursor, or a transcript encoding SHMT2 mitochondrial isoform 2 precursor is assessed.
- at least SHMT2 mitochondrial isoform 3, SHMT2 mitochondrial isoform 3, or a transcript encoding SHMT2 mitochondrial isoform 3 is assessed.
- Suitable reagents e.g., probes, primers, antibodies, capable of detecting specific isoforms or transcripts or multiple ; r . compassionf sweep-, makeup ruling or transcripts may be used.
- a binding agent e.g., an antibody that binds to one, more than one, or all isoforms is used.
- a probe or primer that binds to one, more than one, or all transcript variants is used.
- Various antibodies that specifically bind to SHMT2 e.g., human SHMT2 are commercially available, e.g., from Sigma-Aldrich (3050 Spruce St., St.
- an antibody (or other affinity reagent) or procedure for use to detect SHMT2 may be validated, if desired, by showing that a classification, e.g., a classification of tumors, obtained using the antibody or procedure correlates with a characteristic of interest such as tumor sensitivity to a GCS inhibitor in an appropriate set of samples.
- a classification e.g., a classification of tumors
- an antibody may be validated for use in IHC for detection of SHMT2 and classification of samples and subjects into different categories correlated with sensitivity to a GCS inhibitor.
- an antibody or antibody preparation or a protocol or procedure for performing IHC may be validated by establishing that its use provides similar results to those obtained using an antibody or procedure described in the Examples on an appropriate set of test samples.
- an antibody or antibody preparation or a procedure may be validated by establishing that its use results in the same classification (concordant classification) of at least 80%, 85%, 90%, 95% or more of samples in an appropriate set of test samples as is obtained using an antibody described in the Examples. Once a particular antibody or procedure is validated, it can be used to validate additional antibodies or procedures.
- a probe, primer, microarray, or other reagent(s) or procedure(s) to detect SHMT2 RNA may be validated, if desired, by showing that a classification obtained using the reagent or procedure correlates with a characteristic of interest, such as sensitivity to a GCS inhibitor, in an appropriate set of samples.
- SHMT2 mRNA or protein level may be used together with levels of one or more other (e.g., up to 10) other mRNAs or proteins that are selected for their utility for classification for diagnostic, prognostic, predictive, or treatment selection purposes in one or more types of cancer.
- SHMT2 expression e.g., the level of SHMT2 mRNA or protein, is not measured or analyzed merely as a contributor to a cluster dendrogram, or heatmap based on gene expression profiling in which expression at least 20; 50; 100; 500; 1,000, or more genes is assessed.
- the level of SHMT2 mRNA or protein is used to classify samples or tumors (e.g., for diagnostic, prognostic, predictive, or treatment selection purposes) in a manner that is distinct from the manner in which the expression of many or most other genes in the gene expression profile are used.
- the level of SHMT2 mRNA or polypeptide may be used
- measuring the level of SHMT2 protein may comprise measuring SHMT2 activity.
- SHMT2 activity in converting serine to glycine can be assessed (see, e.g., reference 8).
- glycine level and/or glycine production by tumor cells or by a tumor may be assessed.
- glycine level is measured in one or more sample(s) obtained from a subject.
- a sample may be a fluid sample, such as blood, cerebrospinal fluid (CSF), urine, sputum, bronchialveolar lavage, aspirate fine needle biopsy aspirate or, in some embodiments, a tissue sample, e.g., biopsy sample or surgical sample.
- CSF cerebrospinal fluid
- urine sputum
- bronchialveolar lavage aspirate fine needle biopsy aspirate
- tissue sample e.g., biopsy sample or surgical sample.
- an elevated glycine level (as compared with normal glycine levels) may indicate that a subject has a tumor that is sensitive to GCS inhibition.
- an in vivo method maybe used to measure SHMT2 activity.
- magnetic resonance spectroscopy may be used to detect glycine, e.g.. elevated glycine in vivo (e.g., in the region of a tumor) or ex vivo (e.g., in a sample obtamed from a subject).
- Suitable controls and normalization procedures maybe used to accurately quantify SHMT2 expression or activity, where appropriate.
- measured values may be normalized based on the expression of one or more RNAs or polypeptides whose expression is not expected to vary significantly between tumors.
- expression is normalized based on expression of a housekeeping gene.
- a housekeeping gene is a structural gene such as actin, e.g., beta-actin.
- a measured value may be normalized to account for the fact that different samples may contain different proportions of a cell type of interest, e.g.. cancer cells, versus non-cancer cells.
- the percentage of various cell types (which may be tumor or non-tumor cells) can be assessed by detecting expression of one or more cellular markers characteristically expressed by such cells.
- stromal cells e.g.,
- FA— u i may be assessed by detecting expression of a stromal cell-specific cellular marker. Results may be adjusted to more accurately reflect mRNA or polypeptide or activity level specifically in tumor cells or in particular cellular locations. If a sample such as a tissue section contains distinguishable (e.g., based on standard histopathological criteria), areas of neoplastic and non-neoplastic tissue, such as at the margin of a tumor, the level of expression, copy number, or activity may be assessed specifically in the area of neoplastic tissue, e.g., for purposes of comparison with a control level, which may optionally be the level measured in the non-neoplastic tissue.
- a sample such as a tissue section contains distinguishable (e.g., based on standard histopathological criteria)
- areas of neoplastic and non-neoplastic tissue such as at the margin of a tumor
- the level of expression, copy number, or activity may be assessed specifically in the area of neoplastic tissue, e
- the level of an SHMT2 gene product or the level of SHMT2 activity is determined to be "increased” or “not increased” by comparison with a suitable control level or reference level.
- a suitable control level may be a level that represents a normal level of SHMT2 gene product or SHMT2 activity, e.g., a level of SHMT2 gene product or SHMT2 activity in non-diseased cells or tissue.
- Any method that includes a step of (a) assessing the level of SHMT2 expression or activity may comprise a step of (b) comparing the level of SHMT2 expression or activity with a control level of SHMT2 expression or activity, wherein if the level determined in (a) is greater than the control level, then the level determined in (a) is considered to be "increased” (or, if the level determined in (a) is not greater than the control level, then the level determined in (a) is considered to be "not increased “ .
- a tumor has an increased level of SHMT2 expression or activity as compared to a control level
- the tumor is classified as having an increased likelihood of being sensitive to a GCS inhibitor
- the tumor does not have a significantly increased level of SHMT2 relative to a control level
- the tumor is classified as having a decreased likelihood of being sensitive to a GCS inhibitor.
- a control level may be determined in a variety of ways.
- a control level is an absolute level.
- a control level is a relative level, such as the percentage of tumor cells exhibiting SHMT2 staining or the percentage of tumor cells exhibiting intense staining for SHMT2.
- a comparison may be performed in various ways.
- one or more samples are obtained from a tumor, and one or more samples are obtained from nearby normal (non-tumor) tissue composed of similar cell types from the same patient.
- the relative level of SHMT2 gene product or SHMT2 activity in the tumor sample(s) versus the non-tumor sample(s) is determined.
- the relative level (ratio) of SHMT2 gene product in the tumor samples versus the non-tumor sample(s) is greater than a predetermined value (indicating that cells of the tumor have— ' " ⁇ — SHMT2), the tumor is classified as likely to be sensitive to a GCS inhibitor.
- the predetermined value may be, e.g., at least 1.5, 2, 2.5, 3, 5, 10, 20, or more.
- a control level may be a historical measurement. It will be understood that in at least some embodiments a value may be semi-quantitative, qualitative or approximate. For example, visual inspection (e.g., using light microscopy) of a stained IHC sample can provide an assessment of the level of SHMT2 expression or activity without necessarily counting cells or precisely quantifying the intensity of staining. Certain methods are stated herein mainly in terms of conclusions or predictions that may be drawn or made if SHMT2 expression is increased (overexpressed). Methods could be stated in terms of conclusions or predictions that may be drawn or made if SHMT2 expression is not increased. For example, if SHMT2 expression is absent the tumor may be classified as not having an increased likelihood of being sensitive to a GCS inhibitor.
- acontrol or reference level represents normal levels of SHMT2 expression or activity present in non-cancer cells and tissues.
- a level of SHMT2 expression or SHMT2 activity characteristic of a GCS inhibitor-sensitive cancer may be used as a reference or control level in some embodiments.
- the presence of SHMT2 expression or SHMT2 activity at a level comparable to. e.g., approximately the same, as or greater than the control level would be indicative of the presence of a cancer that is likely to be sensitive to a GCS inhibitor, while a decreased level of SHMT2 expression or SHMT2 activity as compared with the control level would be predictive, e.g., of less likelihood that a tumor will be sensitive to a GCS inhibitor.
- Any of the methods may. in certain embodiments, comprise assigning a score to a sample (or to a tumor from which a sample was obtained) based on the level of SHMT2 expression or SHMT2 activity measured in the sample, e.g., based on the level of an SHMT2 gene product or the level of SHMT2 activity or a combination thereof.
- two or more scores may be assigned.
- scoring may comprise assigning a first score based on percentage of cells that express or overexpress SHMT2 and assigning a second score based on the level of expression.
- a composite score may be generated from two or more scores.
- a range of scores may be divided into multiple smaller ranges (subranges), and samples or tumors may be assigned differing likelihoods of being sensitive to GCS inhibition based on the subrange into which their score falls. For example, a higher score may indicate increased likelihood that a tumor will be sensitive to GCS inhibition.
- the number of categories in a useful scoring or classi fication system may * ;tween 2 and 10, e.g., 2, 3, or 4. although the number of categories may be greater than 10 in some embodiments.
- a score may be assigned using a scale of 0 to X, where 0 indicates that the sample is "negative" for SHMT2 (e.g.. no detectable SHMT2 polypeptide), and X is a number that represents strong (high intensity) staining in the majority of cells.
- a score is assigned using a scale of 0, 1, or 2, where 0 indicates that the sample is negative for SHMT2 (no detectable SHMT2 protein), 1 is low level staining and 2 is strong (high intensity) staining in the majority of cells.
- a higher score indicates increased likelihood that a tumor will be sensitive to GCS inhibition.
- a score may be represented using numbers or using any suitable set of symbols or words instead of, or in combination with numbers. For example, scores can be represented as 0, 1, 2; negative, positive; negative, low, high; - , +, ++, +++; etc.
- the number of categories may be, e.g., 2, 3, 4, or more.
- a score may be obtained by evaluating one field or multiple fields in a cell sample or tissue sample. Multiple samples from a tumor may be evaluated in some embodiments. It will be understood that "no detectable SHMT2" may mean that the level detected, if any, is not noticeably or not significantly different to background levels. In some embodiments, at least 10, 20, 50, 100, 200, 300, 400, 500, 1000 cells, or more (e.g., tumor cells) are assessed to evaluate SHMT2 expression or activity in a sample or tumor, e.g., to assign a score to a sample or tumor.
- Various methods described herein e.g., methods of classification, diagnosis, prognosis, prediction, or treatment selection may be described in terms of samples, tumors, or subjects. Such descriptions maybe considered equivalent and freely interchangeable.
- a method of classifying a sample such method may be expressed as a method of classifying a tumor from which the sample was obtained.
- assessing the level of SHMT2 in a sample such method may be expressed as a method of assessing the level of SHMT2 expression in a tumor from which the sample was obtained.
- predicting typically refer to forecast of an increased or a decreased probability that a result, outcome, event, etc., of interest exists or will occur, e.g., when particular criteria or conditions are met, as compared with the probability that such result, outcome, or event, etc., exists or will occur when such criteria or — are not met
- Predicting "predicting the likelihood”, and like terms do not imply or require the ability to predict with 100% accuracy and do not imply or require the ability to provide a numerical value for a likelihood (although such value may be provided in some embodiments).
- a method for predicting the likelihood of tumor sensitivity may be used together with one or more other methods.
- a method of predicting likelihood can be a method useful to assist in predicting likelihood in combination with one or more other methods, e.g., as part of an overall method.
- SHMT2 expression correlates with sensitivity to GCS inhibition
- tumors or tumor types that are sensitive to GCS inhibition even though they do not overexpress SHMT2 may exist.
- Such tumors may usefully be treated with GCS inhibitors
- Such tumors or tumor types may be identified by testing larger panels of tumors or tumor cell lines than have been examined to date.
- administration of a GCS inhibitor may inhibit emergence of tumor subclones that overexpress SHMT2. If SHMT2 overexpression confers a survival or proliferation advantage on tumor cells, suppressing emergence of such subclones may be therapeutically useful. It is reasonable to expect that SHMT2 activity may be elevated in some tumors by mechanisms that do not involve increased SHMT2 expression.
- SHMT2 may be activated by certain mutations. It is also reasonable to expect that alternate approaches to identifying tumors or tumor cell lines that are sensitive to GCS inhibition based, e.g., on expression of selected RNA or proteins other than SHMT2, may be discovered.
- a tumor that contains only a small number of SHMT2 positive cellsor may lack evidence of SHMT2 positive cells may be usefully treated with a GCS inhibitor.
- tumor initiating cells may have an increased likelihood of being SHMT2 positive (e.g., overexpressing SHMT2).
- a GCS inhibitor may be useful in eliminating tumor initiating cells or inhibiting proliferation of tumor initiating cells or inhibiting emergence of additional tumor initiating cells.
- Tumor initiating cells may constitute only a small fraction of a tumor in vivo.
- a GCS inhibitor may be used to specifically inhibit this subpopulation of tumor cells, optionally in combination with an agent that inhibits the bulk tumor cell population.
- treatment with a GCS inhibitor may inhibit tumor recurrence, e.g., by inhibiting survival or proliferation or emergence of tumor initiating cells.
- treatment with a GCS inhibitor may begin or continue after a tumor has been apparently eradicated, e.g., by surgery, radiation, and/or pharmacological therapy.
- a method of monitoring a subject in need of treatment for a tumor comprises: (a) providing a subject in need of monitoring for a tumor, the subject having been administered a GCS inhibitor; and (b) monitoring the subject at one or more time points after administration.
- a method of monitoring a subject in need of treatment for a tumor comprises: (a) providing a subject in need of monitoring for a tumor, the subject having been administered a GCS inhibitor; and (b) monitoring the subject at one or more time points after administration.
- the tumor overexpresses SHMT2.
- the tumor has been determined to overexpress SHMT2.
- monitoring the subject comprises monitoring for the presence of a tumor, tumor size, metastasis, or one or more symptoms, e.g., one or more symptoms associated with a tumor.
- Monitoring may comprise, e.g., any standard means of monitoring subjects with cancer or who have been treated for cancer, e.g., symptom assessment, physical examination, imaging, etc. Monitoring may be useful, e.g., to assess tumor sensitivity, assess tolerability of the GCS inhibitor to the subject, or select a dose level.
- the disclosure provides methods of modulating tumor cell or tumor sensitivity to GCS inhibition, the methods comprising modulating SHMT2 expression or activity in the tumor.
- sensivity of a tumor cell or tumor e.g.. a tumor cell or tumor that expresses or overexpresses SHMT2 to GCS inhibition may be decreased by inhibiting SHMT2 expression or activity in the tumor cell or tumor.
- SHMT2 expression may be inhibited using an SI IMT2 inhibitor which may be. e.g.. an RNAi agent targeted to SHMT2, a small molecule, antisense agent, etc. In some embodiments such inhibition may be useful, e.g., for research or testing purposes.
- sensivity of a tumor cell or tumor may be increased by causing a tumor cell or tumor to overexpress SHMT2 or a functional variant thereof or by otherwise causing a tumor cell or tumor to have increased levels of SI IMT2 or increased SHMT2 activity.
- causing a tumor cell or tumor to have increased SUM 1 2 or increased SHMT2 activity comprises delivering a nucleic acid encoding SHMT2 or a functional variant thereof to the tumor cell or tumor, e.g., by contacting the tumor cell or tumor with the nucleic acid.
- the nucleic acid is in a vector.
- causing a tumor cell or tumor to have increased SHMT2 or increased SHMT2 activity comprises delivering a polypeptide comprising SHMT2 or a functional variant to the tumor cell or tumor, e.g., by contacting the tumor cell or tumor with a polypeptide
- the polypeptide comprises a protein transduction domain or mitochondrial targeting sequence.
- contacting the tumor cell or tumor comprises administering to a subject.
- an agent that causes a tumor cell or tumor to have increased SHMT2 or increased SHMT2 activity may be targeted to, expressed in, or applied directly to or in the vicinity of tumor cells or a tumor.
- a GCS inhibitor comprises a small molecule, nucleic acid, or polypeptide.
- a GCS inhibitor comprises an RNAi agent, an antisense oligonucleotide, or an aptamer.
- a GCS inhibitor is a direct GCS inhibitor, i.e., the GCS inhibitor acts at least in part by physically interacting with, e.g., binding to, a GCS component.
- a GCS inhibitor may bind to an active site of a GCS protein.
- binding of a GCS inhibitor to a GCS protein inhibits binding of the natural substrate or cofactor, e.g., by sterically blocking access of the substrate or cofactor.
- a GCS inhibitor may be an indirect GCS inhibitor, i.e., the GCS inhibitor may act by a mechanism that does not require physical interaction of the inhibitor with a GCS component.
- an indirect GCS inhibitor may modulate a protein that is involved in post-translational modification or localization of a GCS protein.
- a GCS inhibitor acts at least in part in the cytoplasm.
- a GCS inhibitor induces degradation or translational repression of cytoplasmic mRNA that encodes a GCS protein.
- a GCS inhibitor may interact with, e.g.. bind to. a GCS protein in the cytoplasm.
- the inhibitor may, for example, inhibit entry of the GCS protein into mitochondria or may remain associated with and inhibit a GCS protein that enters mitochondria.
- a GCS inhibitor acts at least in part in mitochondria, e.g., the GCS inhibitor inhibits a GCS protein located in mitochondria.
- a GCS inhibitor inhibits expression of a gene that encodes a GCS protein, so that a decreased amount o the protein is produced.
- expression of a gene encoding a GCS component is inhibited by RNAi or using an antisense oligonucleotide.
- a cell may be contacted with an RNAi agent targeted to mRNA that encodes GLDC, GCSH, AM I " , or DLD.
- an RNAi agent comprises a first portion and a second portion, wherein the first portion and the second portion form a duplex between 1 5-30 nucleotides in length and the first portion comprises a
- the first portion comprises a sequence that is 100%
- RNAi agent is an siRNA.
- RNAi agent is an RNAi vector.
- the RNAi agent is a shRNA or a miRNA precursor, which may be expressed intracellularly, e.g., by cells that have taken up an RNAi vector.
- an RNAi agent is targeted to RNA that encodes a target selected from GLDC, GCSH, and AMT.
- an RNAi agent is targeted to RNA that encodes a target selected from GLDC and GCSH.
- exemplary target sequences for RNAi agents that inhibit human GLDC or GCSH expression are provided in the Examples.
- shRNA denoted Gl, G4, and G5 effectively inhibited GLDC expression and were toxic to tumor cells.
- shRNA denoted GS1, GS2, GS3, and GS4 effectively inhibited GCSH expression and were toxic to tumor cells.
- an RNAi agent comprises a first sequence that is perfectly complementary to 18, 19, 20, or 21 continuous nucleotides of target sequence of Gl, G4, G5, GS1, GS2, GS3, or GS4 and a second sequence that is perfectly complementary to the first sequence.
- Sequences of additional targets within mRNA encoding a GCS component and sequences of RNAi agents useful for inhibiting expression of a GCS component can be selected using, e.g., any of various known approaches useful for design of RNAi agents. In some embodiments one or more sequences may be selected to minimize "off-target" effects.
- a sequence that has less than about 70%, 75%, 80%, 85%, 90%, or 95% complementarity to known or predicted mRNAs (other than the target GCS mRNA) of a species of interest may be selected as a guide strand and/or a sequence that has less than about 70%, 75%, 80%, 85%, 90%, or 95% complementarity to known or predicted mRNAs of a species of interest may be selected as a passenger strand.
- an RNAi agent is designed so as to promote use of the strand that is complementary to (anti-sense to) RNA that encodes a GCS component as a guide strand.
- an RNAi agent may be designed so that the duplex portion of the RNAi agent has lower thermodynamic stability at the 5' end of the guide strand than at the3' end (see, e.g., hvorova, A., et al, (2003) Cell, 1 15(2): 209-216).
- position-specific chemical modification may be used tn reduce potential off-target effects.
- at least two different RNAi agents may be used in combination. Different RNAi agents may be targeted to the same gene or may be targeted to genes encoding different GCS components in various embodiments. In some embodiments two or more different RNAi agents targeted to GLDC are used.
- RNAi agents targeted to GCSH are used.
- one or more RNAi agents targeted to GLDC and one or more RNAi agents targeted to GCSH are used.
- RNAi agents targeted to GLDC, GCSH, and AMT are used in combination.
- up to 5, 10, or more different RNAi agents are used.
- RNAi agents may be used in different amounts or concentrations or in about the same amounts or concentrations in various embodiments.
- an RNAi agent may be selected at least in part empirically, e.g., to achieve a high degree of inhibition of its target and/or a high specificity. For example, multiple RNAi agents may be tested in cell culture or administered to test animals to identify one or more RNAi agents that exhibit a selected degree of silencing and/or a selected specificity for their intended target.
- RNA e.g., mRNA
- a protein whose inhibition is desired e.g., a GCS protein
- a single-stranded oligonucleotide complementary to RNA e.g., mRNA
- cells e.g., in a culture medium or by administration to a subject.
- oligonucleotide enters cells and hybridizes to a RNA target. Such hybridization may result in, e.g., degradation of mRNA by RNase H or blockage of translation.
- the oligonucleotide sequence may be about 90%, 95%, 99%, or 100% complementarity to a RNA target over at least 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, or 30 nt may be selected.
- the oligonucleotide sequence may be selected to minimize off-target effects.
- a sequence that has less than about 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% complementarity to known or predicted mRNAs (other than a GCS mRNA) of a species to which the antisense agent is to be administered over at least 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, or 30 nt may be selected.
- An antisense agent may inhibit GLDC, GCSH, AMT, or DLD. Multiple antisense agents may be contacted with cells in combination. The antisense agents may be designed to inhibit the same GCS component or different GCS components.
- a GCS inhibitor inhibits at least one activity of a GCS component.
- Activity typically refers to the ability of an entity of interest, e.g., a GCS component, to produce an effect, e.g., on a biomolecule or on a biological system such as a rr ) ⁇ >r nanism.
- Various activities of GCS proteins e.g., catalytic activities, are described above.
- An alteration in activity e.g., a reduction in activity (inhibition) may be measured, e.g., on a per molecule basis, per mole basis, or per weight basis of protein.
- a catalytic activity of a GCS protein is inhibited.
- an agent is a direct inhibitor of a GCS protein.
- a direct inhibitor may bind to GLDC, GCSH, or AMT and interfere with the enzyme's ability to catalyze a reaction and/or may prevent a substrate from entering the active site.
- a direct inhibitor is a structural analog of a substrate, a structural analog of a transition state, or a structural analog of a cofactor of an enzyme, wherein the analog is sufficiently similar in structure to a normal substrate, transition state, or cofactor to be capable of physically interacting with the enzyme but cannot, for example, be productively acted on or used by the enzyme.
- a substrate analog, transition state analog, or cofactor analog competes with a normal substrate or cofactor for binding to an enzyme.
- a GCS inhibitor comprises a structural analog of glycine (glycine analog).
- a glycine analog may act as a substrate analog to inhibit P protein.
- a structural analog of glycine is a molecule that comprises a primary amine group and a group that substitutes for the carboxylic function of glycine.
- a group that substitutes for the carboxylic function comprises a ⁇ -electron system.
- a glycine analog is a molecule in which the amino group of glycine or the amino group of a glycine analog that comprises an amino group is replaced by an aminooxy (ONH 2 ) group.
- carboxymethoxylamine aminooxy acetatic acid
- P protein glycine
- a GCS inhibitor comprises cysteamine (2-aminoethanethiol; chemical formula HSCH 2 CH 2 NH 2 ), a cysteamine salt, or a cysteamine derivative.
- Cysteamine is a known inhibitor of the GCS (Hayasaka K, Tada K. Effects of the metabolites of the branched-chain amino acids and cysteamine on the glycinecleavage system. Biochem Int 6:225-230 (1983)). Without wishing to be bound by any theory, cysteamine may act at «t in ojt by inhibiting P protein.
- a GCS inhibitor comprises cysteamine bitartrate (also known as mercaptamine bitartrate). Cysteamine bitartrate is used clinically in the treatment of disorders of cystine excretion (cystinosis) and is available in the form of oral capsules under the trade name CystagonTM.
- a GCS inhibitor comprises a cysteamine prodrug.
- a cysteamine prodrug comprises an agent that is capable of releasing multiple molecules of cysteamine upon cleavage of disulfide and/or amide bonds.
- a GCS inhibitor comprises cystamine (2,2'-dithiobis(ethylamine)). The disulfide bond in cystamine may be readily cleaved, e.g., in vivo, to yield two molecules of cysteamine.
- a GCS inhibitor comprises a compound of formula I:
- a GCS inhibitor comprises a compound having the following structure:
- n in Formulas I and II can independently range, e.g., from 1 to 20, in various embodiments.
- Compounds of Formula I or II may act as cysteamine prodrugs.
- Nephropathic cystinosis an autosomal recessive disease characterised by raised lysosomal levels of cystine in the cells of most organs, can be treated by regular
- cysteamine Various prodrugs and derivatives of cysteamine or cystamine have been designed (and in at least some cases evaluated) as potential treatments for nephropathic cystinosis, including, but not limited to, certain of the compounds described above. See, e.g., McCaughan B, et al., Bioorg Med Chem Lett., 1 8(5): 1 716-9 (2008); Omran, /... et al., Bioorg Med Chem Lett., 21(8):2502-4 (201 1 ); Omran. Z, et al.. Bioorg Med Chem. 19(l l):3492-6 (2011); Omran, Z. ; et al., Bioorg Med Chem Lett.
- a GCS inhibitor is a prodrug or derivative of cysteamine or cystamine designed and/or evaluated as a potential treatment for nephropathic cystinosis.
- a GCS inhibitor has the ability to decrease intracellular cystine in cystinotic cells, e.g., in cell culture or in animals.
- a GCS inhibitor comprises valproic acid (CAS No. 99-66- 1 , also referred to as dipropylacetic acid or 2-propylpentanoic acid, among other names).
- a GCS inhibitor comprises valproate or a valproate salt.
- the valproate salt is sodium valproate.
- a GCS inhibitor is valproate semisodium, also termed divalproex sodium.
- Valproate semisodium is a coordination compound comprised of sodium valproate and valproic acid in a 1 : 1 molar relationship and is also known as sodium hydrogen bis(2-propylpentanoate).
- Valproate semisodium dissociates to valproate ion in the gastrointestinal tract. It is as available in an enteric coated tablet form as Depakote®.
- a method of inhibiting survival or proliferation of tumor cells comprises contacting tumor cells with valproic acid, valproate, a valproate salt, or a prodrug, analog, or derivative of valproic acid or valproate.
- a method comprises administering valproic acid, valproate, a valproate salt, or a prodrug, analog, or derivative of valproic acid or valproate, to a subject in need treatment for a tumor.
- a GCS inhibitor does not comprise valproic acid, valproate, a valproate salt, or a prodrug of valproic acid or valproate, or. in some embodiments, an analog of valproate.
- a GCS inhibitor comprises co-enyzme A (CoA) or a CoA derivative such as tiglyl CoA, isobutyryl CoA, succinyl CoA. methylmalonyl CoA, isovaleryl CoA, or propionyl CoA (Hayasaka and Tada 1983, supra).
- CoA co-enyzme A
- a CoA derivative such as tiglyl CoA, isobutyryl CoA, succinyl CoA. methylmalonyl CoA, isovaleryl CoA, or propionyl CoA (Hayasaka and Tada 1983, supra).
- a GCS inhibitor is a structural analog of folic acid or folate.
- a folic acid or folate analog may act a substrate analog to inhibit T protein.
- T protein For example, as noted above.
- 5-methyltetrahydro folate (5-CH3-H4folate) is a folate analog that inhibits T protein.
- Other folate analogs include methotrexate, pemetrexed.
- a folate analog is an inhibitor of an enzyme involved in folate metabolism, such as dihydrofolate reductase, ⁇ -glycinamide ribonucleotide transformylase, 5'-amino-4'-imidazolecarboxamide ribonucleotide transformylase, or thymidylate synthetase. See, e.g., Gangjee A, et al.
- a GCS inhibitor does not comprise an analog of folic acid or folate.
- a GCS inhibitor is an aptamer, antibody, or non-antibody polypeptide that binds to a GCS component, e.g., GLDC, GCSH, AMT, or OLD in various embodiments.
- a GCS inhibitor comprises a single chain antibody or nanobody.
- Antibodies that bind to GCS proteins are known in the art and a number of such antibodies are commercially available. Additional antibodies may be produced using routine methods.
- a single chain antibody or other antibody fragment maybe generated from afull size antibody.
- a humanized antibody or antibody fragment may be used, e.g., for therapeutic purposes.
- one or more non-antibody peptides or polypeptides that bind to targets with affinity and specificity comparable to that of antibodies may be used as GCS inhibitors.
- Peptides that bind to a target of interest e.g., GLDC. GCSH. AMT, or DLD
- a target of interest e.g., GLDC. GCSH. AMT, or DLD
- two hybrid assays e.g.. in yeast or mammalian cells
- display technologies such as phage display, yeast display, ribosome display, bacterial display, or mRNA display technologies, etc.
- a peptide may be selected from a peptide library, which may be. e.g.. a display- library or a chemically synthesized library.
- One or more rounds of selection e.g., panning
- a peptide may be inserted into a supporting protein scaffold that may. e.g.,
- a scaffold may be any of a variety of suitable proteins that have reasonable solubility.
- Useful scaffolds known in the art include, e.g., those based on folds from protein Z (affi bodies), fibronectin (adnexitis), ankyrin repeat proteins (DARPins); cysteine-knot miniproteins (knottins) or Armadillo repeat proteins or based on full-length proteins such as lipocalins (anticalins).
- a scaffold may comprise one or more alterations relative to a naturally occurring protein. For example. site(s) that potentially react with human proteins may be altered. See, e.g.. or
- peptide aptamer is sometimes used to refer to such peptides or to polypeptides comprising them. See, e.g.. Colas, P., et al.. Nature, 380:548-50, 1996; Bickle, MB., et al. Nat. Protoc. 1, 1066-1091 , 2006; Colas. P., J Biol. 7( 1 ):2. 2008.
- a polypeptide comprises a dominant negative version of a GCS component, e.g., a dominant negative version of GLDC, GCSH, AMT, or DLD.
- a dominant negative version of a protein is a variant that lacks activity or has substantially reduced functional activity relative to normal and antagonizes or interferes with function of the normal version of the protein expressed by a cell.
- adominant negative variant is a fragment of a normal protein or has an alteration in one or more amino acids (e.g., a catalytic residue) that reduces or eliminates functional activity.
- a dominant negative variant lacsk at least some amino acid(s) or domain(s) required for normal activity but retains ability to physically interact with (e.g., bind to) a substrate, cofactor, regulator, or binding partner of the normal protein.
- a dominant negative variant may, for example, compete with a normal version of a protein for interaction with a substrate, cofactor, regulator, or binding partner.
- a dominant negative variant may be capable of binding a substrate but have reduced ability to catalyze a reaction involving the substrate, as compared with the normal version of the protein.
- a dominant negative variant may be capable of forming a complex with a normal version of the protein, but the resulting complex lacks activity or has reduced activity relative to a complex formed that comprises the normal protein and not the dominant negative variant.
- a GCS inhibitor inhibits homodimerization of a GCS
- ⁇ * ⁇ * ,t_ e.g., P protein or L protein. Exemplary methods of identifying such agents are described below.
- binding of a GCS inhibitor to its target is non-covalent. In some embodiments it is contemplated that binding of a GCS inhibitor to its target is covalent. Inhibition of a GCS component by a GCS inhibitor may be reversible or may be essentially irreversible in various embodiments. An essentially irreversible inhibitor may be characterized in that recovery of activity of the inhibited GCS component in a system would not be detected following removal of unbound GCS inhibitor (unless additional molecules of the GCS component are synthesized or added to the system, in which case activity of such molecules may be detected). In some embodiments a GCS inhibitor that binds non- covalently may be modified to comprise a functional group capable of reacting with a GCS protein to form a covalent bond.
- a GCS inhibitor comprises an ester, solvate, salt, or hydrate of a GCS inhibitor described above or identified as described herein.
- a GCS inhibitor is altered, e.g.. in order to modify or try to modify one or moreof its properties.
- any of the methods may further comprise producing an altered GCS inhibitor and, optionally, testing the altered GCS inhibitor for activity as a GCS inhibitor or anti-tumor agent.
- Exemplary, properties that may be altered, and exemplary methods of alteration are described further above. Any such methods may be applied to GCS inhibitors described herein or identified as described herein.
- methods of making altered GCS inhibitors e.g.. structural analogs. GCS inhibitors attached to a second moiety
- expression or activity of one or more GCS components or the overall activity of the glycine catabolism pathway catalyzed by the GCS may be assessed (e.g.. detected and. optionally, measured). Such assessment may be used for any of a variety of purposes. For example, as described further below, such assessment may be used to identify, characterize, or test an agent (e.g.. a GCS inhibitor).
- expression or activity o one or more GCS components or the overall activity of the glycine catabolism pathway may be used to classify a tumor cell, tumor cell line, or tumor.
- a tumor cell, tumor cell line, or tumor may be classified as having increased or decreased expression or activity of a GCS component or of the GCS as compared to a reference, e.g., normal cells, or may be compared * ⁇ "imor cells, tumor cell lines, or tumors of the same or different tumor types.
- expression of GCS components canbe assessed using any suitable method known in the art that is useful for assessing gene expression, e.g., for detecting or measuring specific RNAs or proteins of interest, e.g., microarrays. RNA-Seq. immunological methods. See, e.g., discussion above and Examples.
- expression of a GCS component is assessed after contacting cells with an agent known to inhibit expression of the GCS component or an agent being evaluated for, e.g., ability to modulate (e.g., inhibit) the GCS or ability to modulate (e.g., inhibit) expression of the GCS component.
- the agent is an RNAi agent.
- the amount of RNA or protein may be measured and may be optionally normalized and/or compared with a control value, e.g., a value expected in the absence of the agent. If the amount measured after contacting cells with the agent is less than the control value, the agent may be confirmed or identified as a GCS inhibitor or, specifically, as an inhibitor of the expression of the GCS component.
- a control value e.g., a value expected in the absence of the agent.
- Activity of a GCS component or overall activity of the GCS may be assessed using any of variety of approaches.
- a number ofmethods that can be used to assess (e.g., detect, measure, etc.) activity of individual GCS components or combinations of two or more GCS components are known in the art. See, e.g.. Sato, T., et al.. Glycine metabolism by rat liver mitochondria. III. The glycine cleavage and the exchange of carboxyl carbon of glycine with bicarbonate. J. Biochem. (Tokyo). 65: 77-83 (1969); Motokawa, Y., and G. Kikuchi. Glycine metabolism by rat liver mitochondria. II.
- performing an assay for activity of the GCS or a GCS " ' ⁇ " * ' : '" >m rises (a) providing a composition comprising a GCS protein and a substrate for a reaction catalyzed by the GCS component; and (b) assessing at least one indicator of the reaction.
- a suitable assay, and assay details e.g., suitable substrate(s), suitable reaction conditions, detection methods, etc.. are selected as appropriate for the GCS component(s) and reaction.
- Assessing at least one indicator of the reaction may comprise detecting and, in some embodiments measuring, the indicator or a change in the indicator.
- the composition may contain one or more other ingredients such as a buffer, a salt, an antioxidant such as beta-mercaptoethanol or dithiothreitol, etc.
- the composition may comprise one or more co- factors or other ingredients that promote or are necessary for a reaction.
- the composition may comprise any one or more GCS protein(s) in various embodiments.
- a substrate is labeled.
- the ingredients and amounts thereof in the composition are typically selected so as to be sufficient for a reaction to occur to a detectable extent, at least in the absence of a GCS inhibitor.
- the composition may be provided in any suitable vessel, such as a tube, well, dish, etc.
- the assay utilizes isolated GCS protein(s), e.g., one or more at least partially purified GCS protein(s).
- the GCS protein(s) are recombinantly produced and, optionally, at least partially purified.
- human GCS component(s) are used.
- a reaction is, e.g., a glycine cleavage reaction, a glycine synthesis reaction, or any of the individual reactions described above that comprise the overall glycine cleavage reaction or glycine synthesis reaction.
- a substrate, product, or intermediate of the reaction serves as an indicator of the reaction.
- an increased amount of a product, or a decreased amount of a substrate is indicative of a reaction.
- a cell-based assay is used, in which the reaction occurs in living cells, and an indicator of the reaction is then assessed.
- an indicator of the reaction is assessed in cells.
- an indicator of the reaction is assessed after lysing the cells.
- activity of the GCS or of a GCS protein may be expressed in terms of amount of product formed or amount of substrate consumed in a given period of time per milligram (mg) of protein.
- activity may be expressed as ⁇ of product formed/min/mg.
- any suitable method and/or instrument that can detect the indicator or a change in the indicator can be used.
- detection and/or measurement may be performed using spectroscopic, colorimetric, electrochemical (e.g., amperometrie or
- chromatographic e.g., gas or liquid chromatography
- optical calorimetric
- thermometric thermometric
- photometric piezoelectric
- radiometric and/or magnetic approaches in various embodiments.
- radiation is detected using scintillation counting.
- absorbance and/or emission of light is detected, e.g., using a spectrometer.
- a substrate or product is directly detected, thereby serving as a direct indicator of the reaction.
- a detection reagent is used as an indicator of a reaction.
- a detection reagent is converted into a compound that is amenable (or more amenable) to colorimetric, fluorimetric, or chemi luminescent detection.
- a detection reagent that can be readily detected without interference from one or more ingredients of an assay composition is selected.
- a coupled assay is used.
- the product of a reaction catalyzed by the GCS is used as a substrate of another reaction (coupled reaction), e.g., a more readily detectable or more conveniently detectable reaction.
- the coupled reaction is catalyzed by an enzyme, in which case the assay may be referred to as a coupled enzyme assay.
- one or more reactions catalyzed by the GCS is coupled to a reaction that results in a detectable change in a detection reagent.
- a product of a reaction catalyzed by the GCS serves as a substrate for a coupled reaction.
- the coupled reaction is catalyzed by a suitable enzyme.
- a first coupled reaction is coupled to one or more additional reactions, that may, for example, amplify a signal from the first coupled reaction, or result in a detectable change in a detection reagent.
- the detectable product is detected using a suitable detection approach and apparatus, which will generally depend at least in part on the particular product. For example, absorbance of a colored product or emission of light by a fluorescent product can be detected using a microplate reader such as the Victor2
- a reaction in some embodiments is visually detectable, e.g., by a change in color. It will be understood that a fluorescent product is typically excited at an appropriate wavelength to cause it to emit light. In various embodiments the amount of a detectable product formed (e.g., within a specified time period) or the rate of production of a detectable product (e.g., at a specified time after starting the reaction) provides an indicator of the reaction. In various embodiments a reaction ismonitored continuously or at one or more time points. In some , .
- GCS activity is assessed using a glycine cleavage assay in which GCS components (P, H, T, and L proteins) and cofactors are provided, and glycine is provided as a substrate.
- glycine cleavage may be assessed by measuring the amount of C0 2 that is produced when the GCS components are incubated in the presence of glycine.
- the glycine may be labeled, e.g., by incorporating a carbon or oxygen isotope (e.g., C 14 , O 18 ) in the carboxyl group.
- Production of radiolabeled C0 2 can be detected, e.g., using a scintillation counter.
- C0 2 is absorbed by a suitable substance (such as hyamine) or treated with one or more reactants so as to generate a liquid or solid, which may facilitate such measurements. See, e.g., Sato, et al. (1969).
- a solid state carbon dioxide sensor is used.
- glycine consumption is measured using, e.g., high performance liquid chromatography (HPLC) or Raman spectroscopy to detect glycine.
- HPLC high performance liquid chromatography
- Raman spectroscopy to detect glycine.
- GCS activity is assessed by measuring glycine-dependent NADH formation (e.g., spectrophotometrically at 340 nm or fluorimetrically by excitation at 340 nm and emission at 450 nm) or disappearance of H4 folate (see, e.g., Bourguignon, J., et al., Resolution and characterization of the glycine-cleavage reaction in pea leaf mitochondria: Properties of the forward reaction catalysed by glycine decarboxylase and serine
- NADH is detected and. in some embodiments measured, using a coupled assay in which NADH is oxidized to NAD+, concomitantly with the transfer of a hydride to a compound that serves as a detection reagent, followed by detection of the resulting reduced compound.
- reduction of the detection reagent results in a detectable change, e.g., a change in a directly detectable property of the reagent.
- the detection reagent when reduced, becomes colored (or changes or loses color if it was initially colored) or becomes fluorescent (or changes its fluorescent properties (e.g., changes its emission frequency or is quenched) if it was initially fluorescent).
- the detection reagent comprises a tetrazolium salt (e.g., MTT, X IT, INT, XTS, WTS (water-soluble tetrazolium salt)), which can be reduced to yield p ro i uc t ( a formazan).
- the detection reagent comprises resazurin, which can be reduced to a fluorescent product (resofurin).
- oxidation of NADH in the coupled reaction is accomplished by a suitable NAD+
- the amount of detectable product formed provides an indicator of the amount of NADH produced and thus the activity of the GCS.
- the rate of formation of a detectable product formed provides an indicator of the rate of production of NADH and thus the activity of the GCS.
- a glycine exchange reaction is used, e.g., to assess activity of P and/or H proteins and/or to identify agents that inhibit activity of P and/or H protein.
- the glycine exchange reaction measures exchange of the glycine carboxyl carbon with the carbon atom in C0 2 or bicarbonate (HCCV). For example, the amount of [ 14 C] bicarbonate fixed in the carbonyl carbon of glycine can be measured. The reaction does not require T protein.
- the glycine exchange reaction can be used to specifically measure P-protein activity when excess purified 1 1 -protein is added to the reaction.
- H-protein activity can be assayed using the glycine exchange reaction in a manner similar to the assay for P-protein except that the reaction mixture is supplemented with an excess of P-protein.
- an agent that inhibits the glycine exchange reaction may be classified as an inhibitor of P protein or an inhibitor of H protein by perfoming the reaction in the presence of varying amounts of P protein and/or H protein.
- the inhibitor does not inhibit P protein and, instead, inhibits H protein.
- altering the amount of P protein does not significantly affect the reaction and/or if altering the amount of H protein does significantly affect the reaction, it may be concluded that the inhibitor does not inhibit P protein and, instead, inhibits P protein.
- an agent that inhibits the glycine cleavage reaction may be classified as an inhibitor of a particular GCS component by performing the reaction in the presence of the agent and varying amounts of each component, comparing the results with those obtained when the reactions are performed in the absence of the agent, and determining which set of reactions is affected by the presence of the agent.
- an agent that inhibits the glycine cleavage reaction may be classified as an inhibitor of a particular GCS component by testing the ability of the inhibitor to block C02 production, or by testing its ability to inhibit the activity of DLD or AMT in isolation, e.g., as described below.
- an agent that inhibits the glycine cleavage reaction may be classified as an inhibitor of a particular GCS component by testing the ability of the inhibitor (e.g., a small molecule) to bind to one of the GCS components.
- H protein activity may be assessed by following the reaction of H protein with 5,5'-dithiobis(2-nitrobenzoic acid) (Nbs) (Neuburger M, et al, Biochem J. 1991 Sep 15;278 ( Pt 3):765-9 (1991)).
- Nbs 5,5'-dithiobis(2-nitrobenzoic acid)
- lipoamide dehydrogenase catalyses the conversion of the disulfide bond of the lipoamide into two SH groups.
- a large excess of Nbs rapidly catalyses conversion of the SH groups into the disulfide bond with the formation of two molecules of 2-nitro-5-thiobenzoate (Nbs).
- the reaction is followed spectrophotometrically at 412 nm and H protein activity expressed as pmol Nbs formed.
- T protein activity can be assessed using a variety of approaches.
- the ability of T protein to catalzye the reverse of the reaction that it catalyzes in the glycine cleavage pathway is measured.
- T protein catalyzes the synthesis of the H-protein-bound intermediate from methylenetetrahydrofolate, ammonia, and 1 I-protein having a reduced lipoyl prosthetic group.
- T protein activity in the reverse reaction can be measured as described in Okamura-lkeda , et al., Mechanism of the glycine cleavage reaction. Properties of the reverse reaction catalyzed by T-protein. J Biol Chem.
- T protein activity can be assayed by measuring the synthesis of glycine from methylenetetrahydrofolate, NH4C I and [ 14C] bicarbonate in the presence of excess P-protein and I I- protein, e.g., according to the method described by Motokawa, Y., and G. Kikuchi, supra ( ⁇ 969) or Hiraga, et al., supra (1981).
- ammonia (NH3) produced in the reaction catalyzed by T protein, serves as an indicator.
- ammonia is detected using a Berthelot reaction.
- ammonia is detected using a coupled assay, using, e.g., a glutamate dehydrogenase (GLDH) to catalyze a reaction in which NADH is oxidized to NAD+, thereby making possible the indirect monitoring of ammonia by. e.g., measuring the consumption of NADH.
- GLDH glutamate dehydrogenase
- ammonia is detected directly, e.g., using an enzyme that catalyzed by T protein.
- NADH can be monitored at a wavelength of 340 nm or NADH can be detected using a coupled assay, e.g.. as described below.
- L protein utilizes dihydrolipoic acid (in H protein as a prosthetic group N-linked to a lysine residue or in the free form with diminished activity) as a hydrogen donor to catalyze the reduction of NAD + to NADH.
- a dihydolipoamide dehydrogenase/ Tris(2-carboxyethyl)phosphine (TCEP) assay in which TCEP is used as a reductant for lipoic acid can be used to measure the activity of L protein and/or H protein. This reduction can be measured, e.g., spectrophotometrically at 340 nm (see, e.g., Gueguen, V., et al.
- activity of a GCS component may be measured after contacting the GCS component with an agent known to inhibit activity of the GCS component or an agent being evaluated, e.g., for ability to modulate (e.g., inhibit) the GCS or ability to modulate (e.g., inhibit) activity of the GCS component.
- the agent is or comprises a small molecule.
- the activity measured may be compared with a control value, e.g., a value expected or obtained in the absence of the agent. If the activity measured after contacting cells with the agent is less than the control value, the agent may be confirmed or identified as a GCS inhibitor or, specifically, as an inhibitor of the activity of the GCS component.
- aGCS inhibitor may be used at a concentration that reduces GCS activ ity or reduces activity of a particular GCS component to a selected amount or level or to within a selected range as assessed, e.g., using one or more of the above-mentioned assays.
- the reduction isat least about 5%, 10%, 15%, 20%, 25%. 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% of a reference level (e.g., a control level), or any intervening range, using a suitable assay.
- the reduction is at least 5%, 10%, 15%, 20%. 25%.
- a reference level e.g., a control level.
- a reference level is a level that exists in ce of the GCS inhibitor.
- 100% inhibition refers to reduction to a background level.
- a method of identifying a candidate agent for treatment of cancer comprises (a) performing a screen or assay to identify an inhibitor of the GCS. In some embodiments the method further comprises testing an inhibitor identified in step (a) in a tumor model.
- a cell-free assay comprises contacting one or more GCS component(s) and an agent (e.g., a test agent) in a composition outside of a living cell.
- an agent e.g., a test agent
- the composition comprises a cell lysate or one or more GCS component(s) that is/are at least partially purified or synthesized outside living cells.
- the GCS component(s) may be purified to a selected degree of purity.
- a composition may comprise a cytoplasmic lysate or organelle-specific lysate.
- a lysate is prepared from cells that naturally express or are engineered to express a GCS component.
- a composition may comprise membranes or membrane constituents (e.g., lipids). Such membranes or constituents may be naturally occurring (e.g., components present in mitochondria or mitochondrial membranes), artificial, or a combination thereof in various embodiments.
- a composition may comprise a subcellular organelle, e.g., mitochondria.
- the composition comprises one or more GCS protein(s) or an RNA encoding a GCS protein.
- the RNA or protein has been synthesized using recombinant nucleic acid techniques.
- a GCS protein can be expressed in appropriate prokaryotic or eukaryotic host cells and purified.
- an RNA or protein has a sequence that consists of or comprises a naturally occurring sequence, e.g.. a normal sequence.
- the sequence of a GCS component comprises the sequence of a naturally occurring GCS
- a GCS component that is a variant, e.g., a functional variant, of a naturally occurring normal GCS component is used.
- a polypeptide comprising a sequence at least 80%, 90%, 95%, 96%, 97%, 98%, 99% identical, or 100% identical, to a mammalian, e.g., human.
- GLDC, GCSH, AMT, or DLD or at least 80%, 90%, 95%, 96%, 97%, 98%, 99% identical, or 100% identical, to a Junctional port ion of a mammalian, e.g.. human, GLDC, GCSH, AM I ' , or DLD is used.
- a polypeptide comprising a sequence at least 80%, 90%, 95%, 96%, 97%, 98%, 99% identical, or 100% identical, to at least a catalytic domain of a mammalian, e.g., human GLDC, GCSH, or AMT is used.
- a GCS component comprising a tag is used.
- information obtained from sequence comparison, mutational analysis, analysis of naturally occurring mutants, structural analysis may be used to generate a functional variant.
- a protein that at least in part lacks a mitochondrial targeting sequence, which sequence is found in a naturally occurring precursor protein (pre-protein) is used.
- pre-protein naturally occurring precursor protein
- a fragment is used.
- a fragment comprises at least a catalytic domain.
- a cell-based assay is an assay performed at least in part using living cells.
- a cell-based assay comprises contacting living cells that express a GCS component with a test agent) and assessing the effect of the test agent on expression or activity of the GCS component.
- the GCS component may be assessed in the cellular environment or may first be isolated from the cells and then assessed.
- test agent may be used to refer to an agent that is to be assessed, is being assessed, or has been assessed, e.g., for one or more activit(ies) or for suitability for one or more purposes, but is not to be construed as implying any limitation on the agent or its use.
- performing an assay to identify a GCS inhibitor comprises:
- step (a) providing a composition comprising a test agent and at least one GCS component or RNA encoding a GCS component; and (b) assessing the effect of the test agent on the GCS or on the GCS component or RNA encoding the GCS component, e.g., determining whether the test agent inhibits the GCS or inhibits the GCS component. If the test agent inhibits the GCS or GCS component the test agent is identified as a GCS inhibitor. In some embodiments, step
- step (b) comprises assessing expression of a GCS component.
- step (b) comprises assessing activity of a GCS component or assessing activity of the GCS.
- a method comprises: (a) identifying a GCS inhibitor; and (b) testing the GCS inhibitor identified in step (a) in at least one tumor model.
- a method ing a candidate anti-tumor agent comprises steps of (a) performing an assay to identify a GCS inhibitor; and (b) testing the GCS inhibitor identified in step (a) in at least one tumor model.
- a method of assessing a candidate anti-tumor agent comprises: (a) providing a GCS inhibitor; and (b) testing the GCS inhibitor in at least one tumor model.
- testing comprises determining whether the GCS inhibitor exhibits at least one anti-tumor effect.
- step (b) comprises (i) contacting one or more tumor cells with the GCS inhibitor; and (ii) assessing survival (viability) or proliferation of the one or more tumor cells, wherein the GCS inhibitor is confirmed as a candidate anti-cancer agent if the survival or proliferation of the one or more tumor cells is inhibited.
- a method further comprises determining whether the survival or proliferation of the one or more tumor cells is inhibited, e.g., as compared with survival or proliferation of one or more suitable control cells.
- a suitable control cell may be.
- tumor cells are contacted with the test agent in a culture system. In some embodiments at least some of the tumor cells overexpress SI IMT2.
- a method of identifying an agent that modulates expression of a gene that encodes a GCS protein comprises (a) contacting a gene that encodes a GCS protein and a test agent; and (b) assessing the effect of the test agent on expression of the gene.
- step (b) of method of identifying an agent that modulates expression of a gene comprises assessing the level of an expression product of the gene (e.g.. mRNA or protein). The level may be compared with a suitable reference level, e.g.. the level that would be expected in the absence of the test agent, e.g., in the absence of an agent, or in the presence of an agent known or believed to be inactive in the system.
- the test agent is identified as a modulator of expression of the gene. For example, if the level measured in step (b) is increased or decreased as compared with the reference level, the test agent enhances or inhibits expression of the gene, respectively.
- a measured level is normalized, based, e.g., on expression of one or more suitable genes. In some embodiments expression is normalized based on expression of a gene whose expression level is not expected to be specifically affected by a test agent. In some embodiments a measured level is normalized based on expression of a structural gene.
- the method comprises contacting cells with the test agent sing the effect of the test agent on expression of the gene by the cells.
- the step of contacting cells with a test agent may occur in culture or in vivo in various embodiments.
- the cells or composition may be maintained for a suitable time period after being contacted with the test agent and prior to assessing the effect of the test agent.
- a suitable time period may be a time period sufficient for at least some of the gene product existing at the time of contacting to be degraded.
- the time period may be, e.g., at least 1, 4, 8, 12, 24, or 48 hours up to about 7 days, e.g., between 12 and 24 hours, between 24 and 48 hours, between 48 and 72 hours, etc.
- cells are exposed to the test agent during only part of such time period. In some embodiments cells are exposed to the test agent throughout time period. Additional test agent may be added during the time period. In some embodiments cells that naturally express the target gene may be used. In some embodiments cells that have been engineered to express a target gene or a portion thereof of that have been engineered to express a reporter gene may be used. In some embodiments an agent may be assessed for ability to inhibit expression of a target gene by RNAi. In some embodiments an RNAi agent is contacted with cells, e.g.. by adding the agent to medium containing the cells, and the effect on level of the target RNA or a translation product thereof is assessed. For example, degradation of the target RNA may be detected. In some embodiments an RNAi agent is expressed intracellularly, and the effect on expression of a target gene is assessed.
- a reporter gene comprises a nucleic acid in which one or more expression control elements (e.g., at least a promoter) of a target gene are operably linked to a sequence that encodes a reporter molecule ("reporter").
- reporter e.g., at least a promoter
- a GCS reporter gene comprises a nucleic acid in which one or more expression control elements (e.g., at least a promoter) of the GLDC, GCSH, AMT. or OLD gene are operably linked to a sequence that encodes a reporter. The level of the reporter is detected and serves as a readout that reflects transcriptional activity from the expression control element(s).
- Reporters may be detectable molecules, such as proteins that produce a fluorescent, luminescent, or colorimetric signal or are capable of absorbing light of a particular wavelength.
- a reporter molecule comprises an enzyme that substrate to produce a fluorescent, luminescent, or colorimetric signal.
- reporter molecules include, e.g., green, blue, sapphire, yellow, red, orange, and cyan fluorescent proteins and derivatives thereof; monomeric red fluorescent protein and derivatives such as those known as "mFruits", e.g., mCherry. m Strawberry, m Tomato: enzymes such as luciferase; beta-galactosidase; horseradish peroxidase; alkaline phosphatase; etc.
- a reporter is a secreted protein.
- Agents that modulate, e.g., inhibit, activity of a GCS protein may be identified using a variety of different cell-free or cell-based assays.
- a test agent is contacted with one or more GCS protein(s), e.g., by preparing a composition comprising the test agent and the GCS protein(s).
- the composition may be incubated for a suitable period of time under suitable conditions to allow, e.g., binding or reaction to occur.
- One or more parameters are measured, e.g., binding of the test agent to the GCS protein, activity (e.g., enzymatic activity) of the GCS protein, etc.
- the composition may comprise other component(s) necessary or helpful for a reaction or for detecting binding or enzymatic activity or identifying a compound of interest.
- an assay comprises determining whether a test agent binds to a GCS protein and/or quantifying one or more binding characteristics. Numerous binding assay formats are known in the art.
- a label-free assay may be used, while in other embodiments the target or test agent may be labeled.
- A. binding assay may include a solid phase or fluid phase binding event. The test agent, the GCS protein, an indicator of either, or an indicator of the binding event may be detected.
- a GCS protein or a test agent is attached to a support.
- a support is an article having a rigid or semi-rigid surface. In some embodiments at least one surface is substantially flat. In some embodiments a support is approximately spherical.
- a support may be composed of an inorganic or organic material or combination thereof. In some embodiment, a support is composed at least in part of a metal, ceramic, glass, plastic, gel, or other matrix.
- Such articles may, for example, take the form of plates (e.g., multiwell plates), slides, particles (e.g., "beads " , e.g., magnetic beads), pellets, bars, rods, pins, disks, chips, filters, or other suitable forms.
- a support comprises a sensor, e.g., a sensor capable of detecting binding or a change in binding.
- the sensor may detect a change in weight or a signal such as fluorescence.
- the support comprises an electrode.
- test agents may be arranged as a small molecule microarray. Test agents may be present in multiple locations on a surface, in individual wells or vessels, etc. See, e.g.. Vegas A J. et al.. Chem
- a GCS protein or a test agent is noncovalently or covalently attached to the support.
- multiple test agents are immobilized in multiple locations (e.g., in an array format).
- a GCS protein is added and the composition is maintained for a suitable time period to allow binding to occur.
- unbound material is removed by washing, and the GCS protein is detected.
- a washing step may be omitted.
- binding may be detected by measuring a change in fluorescence polarization, fluorescence resonance energy transfer, or electrochemiluminescence.
- a GCS protein is immobilized, test agents are added, and binding is measured using similar approaches.
- a method for screening one or more test agents to identify those that bind to a GCS component comprises steps of: (a) introducing into each of one or more reaction vessels: one or more GCS components and one or more test agents whose binding to a GCS component is to be evaluated; (b) incubating the vessels under suitable conditions and for a time sufficient to allow binding to occur; and (c) assaying for binding, thereby determining whether one or more of the test agents binds to a GCS component.
- Reaction vessels may be, e.g., wells of a multiwell plate.
- a screen may be performed using a single GCS component or multiple GCS components in a given vessel.
- a screen may be performed using a single test agent or multiple test agents in a given reaction vessel.
- surface plasmon resonance may be used to measure kinetics (on and/or off rates) and/or detect or measure binding strength (affinity) between a test agent and a GCS protein.
- SPR surface plasmon resonance
- a test agent capable of binding to the protein can be selected on the basis of the binding and dissociation rate and/or binding level.
- Other useful methods for detecting and/or quantifying binding include use of a quartz crystal microbalance, optical cantilever, microchannel resonator, dual polarisation interferometer, coupled waveguide plasmon resonance, immunoprecipitation or other antibody-based detection methods, isothermal titration and differential scanning calorimetry, capillary electrophoresis, resonance energy transfer, electrochemi luminesce, fluorescence anisotropy or fluorescence polarization, and fluorescent correlation analysis.
- an agent that is known to bind to a GCS protein is used as a tool for screening test agents (e.g., small molecules) for ability to bind to and/or inhibit activity of the target GCS protein.
- the agent that is known to bind to a target may be labeled.
- the label may comprise, e.g., a radioactive, fluorescent, or other detectable moiety.
- the ability of a test agent to compete with the labeled agent can be detected and serves as an indicator of the binding of the test agent to the target protein.
- a scintillation proximity assay may be used.
- the target protein is attached to beads containing a scintillant material.
- the beads are typically located in wells or other vessels.
- a target protein is attached to scintillant material embedded directly into wells.
- a test agent and a radiolabeled compound capable of binding to the target protein are added to the well. Binding of the radiolabeled compound to the target protein results in a signal. The signal is reduced in the presence of a test agent that competes with the radiolabeled compound for binding. See, e.g.. J. Fraser Glickman, et al.. Scintillation Proximity Assays in High-Throughput Screening. Assay and Drug Development
- a test agent that binds to a GCS protein, with a Kd equal to or less than approximately 1 miVl, 500 ⁇ , 100 ⁇ , 50 ⁇ , 10 ⁇ , 5 ⁇ , or 1 ⁇ is identified or selected.
- a test agent that binds to a GCS protein with a Kd equal to or less than approximately 500 nM, 100 nM. 50 nM. or 10 nM is identified or selected.
- a test agent that binds to a GCS protein with a Kd between 0.1 - 10 nM is identified or selected.
- Test agents that bind to a GCS protein may be further tested, e.g., in one or more cell-free or cell-based assays, to determine the extent to which they modulate, e.g., inhibit, activity of the target protein and/or to determine the extent to which they modulate, e.g., inhibit, overall activity of the GCS.
- test agents that bind to a GCS protein may be further tested, e.g., in one or more cell-free or cell-based assays, to determine the extent to which they modulate, e.g., inhibit, activity of the protein and/or overall activity of the GCS.
- the ability of a test agent to inhibit dimerization of a GCS component may be assessed. Methods of assessing protein-protein interactions, such as protein-fragment complementation assays (PCA), or FRET or BRET- based assays, SPA assays, etc.
- performing an assay to identify a GCS inhibitor comprises: (a) providing a composition comprising a test agent, a substrate, and one or more GCS ' • "'""""'”itf s); and (b) assessing the effect of the test agent on a reaction catalyzed by the one or more GCS component(s).
- the ability of a test agent to inhibit catalysis of a chemical reaction by a GCS protein is assessed. If the test agent inhibits the reaction, the test agent is identified as a GCS inhibitor.
- the reaction is any of the reactions of the GCS described above. In various embodiments the reaction is assessed using any of the methods described herein.
- a method of identifying a modulator of a GCS protein comprises (a) providing a composition comprising a GCS protein, a substrate for a reaction catalyzed by the GCSprotein. and a test agent; and (b) detecting at least one indicator of the reaction. In some embodiments the method further comprises (c) comparing the result of step (b) with a reference value and (d) identifying the test agent as a GCS modulator if the result of step (b) indicates that the test agent increased or inhibited the reaction.
- a method of identifying a GCS inhibitor comprises: (a) providing a composition comprising a test agent, a substrate, and one or more GCS protein(s); (b) measuring an indicator of a reaction catalyzed by the one or more GCS protein(s); (c) comparing the result of step (b) with a reference value; and (d) identifying the test agent as a GCS inhibitor if the result of step (c) indicates that the test agent inhibited the reaction.
- the composition comprises any one, more than one, or all of the GCS proteins.
- the GCS protein(s), substrate, and test agent may be provided in a suitable liquid medium.
- the liquid medium is an aqueous medium that comprises at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or more water (v/v).
- a liquid medium may comprise an organic solvent such as DM SO, e.g.. in an amount that does not significantly affect the activity of the target protein as compared with activity in the absence of the organic solvent.
- Other ingredients may be present in the composition, such as co-factors, buffer substances, etc.
- Buffer substances include, e.g., Tris-HCl. sodium borate. HEPES, MOPS, etc.
- the concentration of the substrate. GCS protein(s), other ingredients, and conditions such as pl l and temperature may vary.
- the composition is maintained for a suitable time period under conditions that would (in the absence of a test agent that is a potential inhibitor) be appropriate for the GCS protein to catalyze a reaction in which the substrate(s) is/are converted to one or more product(s) at a detectable level.
- the reaction may be stopped after a selected time period by, e.g., adding an agent that stops the reaction.
- An indicator of the reaction is detected. In some embodiments the amount of " " ⁇ "' "educed and/or the rate of product formation is determined.
- test agent The effect of the test agent on the amount of product produced and/or the rate at which the product is produced is assessed, e.g., by comparison with a suitable reference value. If the amount of product or rate of product production is decreased in the presence of the test agent as compared with a suitable reference value, the test agent is considered to inhibit the ability of the GCS protein to catalyze the reaction, i.e., the test agent is considered an inhibitor of the GCS protein. In some embodiments the rate of substrate consumption or the amount of substrate consumed is determined or the amount of substrate remaining is determined.
- the test agent is considered to inhibit the ability of the protein to catalyze the reaction, i.e., the test agent is considered an inhibitor of the protein.
- the composition comprises a detection reagent.
- at least one reaction of the GCS is coupled to a reaction in which a detection reagent undergoes a detectable change, and the change is detected as an indicator of the reaction.
- the detection reagent is converted to a detectable compound, which compound is detected as an indicator of the reaction.
- a detection reagent is added after the reaction has been stopped or is combined with a sample removed from the vessel in which the reaction occurred.
- a composition comprises one or more enzymes, electron transfer agents, or other ingredients suitable for performing a coupled assay.
- a reference value in any of these assays may be, e.g., a value measured under similar, substantially identical, or identical assay conditions in the absence of the test agent
- a reference value may be a previously obtained, contemporaneously obtained, subsequently obtained, or historical value.
- Various substrates and products that can be detected and measured are described above. For example, in some embodiments production of ammonia is measured. In some embodiments consumption of NAD+ or production of NADH is measured. In some embodiments production of carbon dioxide is measured. In some embodiments
- a substrate comprises a moiety that facilitates detection of a product of a reaction catalyzed by a target protein.
- the substrate may comprise one or more labels (e.g.. radioactive atoms, fluorescent labels, and/or fluorescence quenchers).
- the substrate comprises a moiety that " " ; gnal upon reaction of the substrate.
- the substrate comprises a moiety that can be readily detected upon release from the substrate.
- the moiety may react with another compound to produce a colorimetric, fluorescent, or luminescent signal.
- an assay readout may be based on resonance energy transfer (RET), e.g., fluorescence resonance energy transfer (FRET), luminescence resonance energy transfer (LRET), or bioluminescence resonance energy transfer (BRET).
- RET resonance energy transfer
- FRET fluorescence resonance energy transfer
- LRET luminescence resonance energy transfer
- BRET bioluminescence resonance energy transfer
- RET-based assays make use of a distance-dependent interaction involving energy transfer between two moieties (sometimes termed a donor and acceptor). If both moieties are present as part of a substrate and positioned so that cleavage of the substrate releases one of the moieties, a signal (e.g., an increase or decrease in a signal) may be detected.
- one or more of the assay components is attached to or otherwise physically associated with a support.
- an enzyme is immobilized to a support or matrix such as a gel.
- a support comprises a sensor, e.g., a sensor capable of detecting an indicator of
- an appropriate assay may be selected for a target of interest depending at least in part on the particular activit(ies) characteristic of the target. For example, various assays that may be used for assessing activity of GCS proteins or overall activity of the GCS are described above.
- a glycine cleavage assay may be used.
- a glycine exchange reaction may be used, e.g., to assess activity of P and/or H proteins and/or to identify agents that inhibit activity of P and/or H protein.
- H protein activity may be measured by following the reaction of H protein with Nbs.
- the ability of T protein to catalzye the reverse of the reaction that it catalyzes in the glycine cleavage pathway is measured.
- a dihydolipoamide dehydrogenase/ Tris(2-carboxyethyl)phosphine (TCEP) assay in which TCEP is used as a reductant for lipoic acid may be used to measure the activity of L protein and/or H protein.
- Embodiments are directed towards each of the assays described herein, e.g., to identify or characterize GCS inhibitors.
- a method for screening one or more test agents to identify those that exert an effect on the GCS or a GCS component comprises steps of: (a) introducing into each of one or more reaction vessels: one or more GCS components; one or more substrates; and one or more test agents whose effect on the GCS or on a GCS component is to be evaluated; (b) incubating the vessels under suitable conditions and for a time sufficient to —action to occur; and (c) assaying for the occurrence of the reaction, thereby revealing the effect of the test agent on the GCS or on a GCS component.
- the method comprises comparing the result of step (c) with a reference value, e.g., a value obtained or expected under otherwise similar conditions in the absence of the test agent. In some embodiments the method further comprises identifying a test agent as an inhibitor of the GCS or a GCS component if the extent of the reaction as assessed in step (c) is reduced as compared with the reference value.
- a screen may be performed using a single GCS component or multiple GCS components in a given vessel. In various embodiments a screen may be performed using a single substrate or multiple substrates in a given vessel. In various embodiments a screen may be performed using a single test agent or multiple test agents in a given reaction vessel.
- the method further comprises testing at least some of the test agents individually to determine which one(s) exert an effet on the GCS or a GCS component.
- the number of reaction vessels and/or test agents is at least 10; 100; 1000; 10,000; 100,000, or more.
- the reaction vessels are wells of a multiwcll plate.
- a test agent identified as a GCS modulator e.g., a GCS inhibitor
- an initial ("primary") assay or screen may be considered a "candidate modulator”.
- One or more "confirmatory” or “secondary” assays or screens may be performed to confirm that a test agent modulates a GCS protein or GCS activity or to measure the extent or specifity of modulation or to assess specificity. Such confirmatory testing may utilize the same assay or a different assay as that used to identify the test agent.
- a secondary assay comprises determining whether a test agent functions as a specific inhibitor of the GCS or a GCS component or as a non-specific inhibitor, e.g., of transcription , translation, or protein activity.
- a test agent that exhibits a reasonable degree of specificity for the GCS or a GCS component is identified or selected, e.g., for further testing or development or use.
- a wide variety of cells may be used for one or more purposes described herein, e.g., in one or more assays or screens described herein.
- the cells express or contain a target, e.g., a GCS gene product, either naturally or as a result of genetic modification.
- cells that do not express a target may be useful, e.g., for control purposes.
- a cell may originate from any organism of interest, e.g., a vertebrate, e.g., a mammal.
- a cell is a primate cell, e.g., a human cell.
- a cell may be " cell, immortalized cell, normal cell, abnormal cell, non-tumor cell, tumor cell, etc., in various embodiments.
- a cell may originate from a particular tissue or organ of interest or may be of a particular cell type.
- a cell is a member of a population of cells, e.g.. a non-immortalized or immortalized cell line.
- a "cell line" refers to a population of cells that has been maintained in culture for at least 10 passages or at least 10 population doublings.
- a cell line is derived from a single cell.
- a cell line is derived from multiple cells.
- a cell line is derived from a sample of cells obtained from a particular individual.
- the cells of a cell line are descended from a cell or cells originating from a single sample (e.g., a sample obtained from a tumor) or individual.
- a cell may be a member of a cell line that is capable of prolonged proliferation in culture (e.g., for longer than about 3 months or longer than about 25 population doublings).
- a cell line is capable of indefinite proliferation in culture (immortalized cells).
- An immortalized cell line has acquired an essentially infinite life span, i.e., the cell line is capable of proliferating essentially indefinitely.
- a cell line that has undergone or is capable of undergoing at least 100 population doublings in culture may be considered immortal.
- a non- immortalized cell line may, for example, be capable of undergoing between about 20-80 population doublings in culture before senescence.
- cells are maintained in culture and may be passaged or allowed to double once or more following their isolation from an individual (e.g., between 2-5, 5- 10, 10-20, 20-50. 50- 100 times, or more) prior to their use in a method disclosed herein.
- cells have been passaged or permitted to double no more than 1 , 2. 5. 10, 20. or 50 times following their isolation from an individual prior to their use in a method disclosed herein.
- cells may be tested to confirm whether they are derived from a single individual or a particular cell line by any of a variety of methods known in the art such as DNA fingerprinting (e.g.. short tandem repeat (STR) analysis) or single nucleotide polymorphism (SNP) analysis (which may be performed using, e.g.. SNP arrays (e.g., SNP chips) or sequencing).
- DNA fingerprinting e.g.. short tandem repeat (STR) analysis
- SNP single nucleotide polymorphism
- a high throughput screen is performed.
- a high throughput screen may utilize one or more cell-free or cell-based assays.
- High throughput screens often involve testing large numbers of test agents with high efficiency, e.g.. in parallel. For example, tens or hundreds of thousands of agents may be routinely screened in short periods of time, e.g., hours to days. Such screening is often performed in multiwell plates (sometimes referred to as microwell or microliter plates or microplates) containing,
- wells or more wells or other vessels in which multiple physically separated depressions, wells, cavities, or areas (collectively "wells") are present in or on a substrate.
- Different test agent(s) may be present in or added to the different wells. It will be understood that some wells may be empty, may comprise replicates, or may contain control agents or vehicle.
- High throughput screens may involve use of automation, e.g., for liquid handling, imaging, and/or data acquisition or processing, etc.
- an integrated robot system comprising one or more robots transports assay-microplates from station to station for, e.g., addition, mixing, and/or incubation of assay constituents (e.g., test agent, target, substrate) and, in some embodiments, readout or detection.
- a HTS system may prepare, incubate, and analyze many plates simultaneously. Certain general principles and techniques that may be applied in embodiments of a HTS are described in Macarrcm R & Hertzberg RP. Design and implementation of high-throughput screening assays. Methods Mol Biol, 565: 1-32, 2009 and/or An WF & Tolliday NJ., Introduction: cell-based assays for high-throughput screening. Methods Mol Biol.
- Test agent(s) showing an activity of interest may be retested and/or, optionally (e.g.. depending at least in part on results of restesting) selected for further testing, development, or use.
- Positive and/or negative controls may be used in any of the assays.
- An appropriate positive or negative control can be selected based at least in part on the assay.
- an agent known to modulate a GCS protein may be used as a positive control.
- a known GCS inhibitor may be used as a positive control in a screen to identify additional GCS inhibitors.
- a negative control may be to perform the assay in the absence of a test agent.
- one or more test agents that exhibit a selected degree of activity e.g., inhibitory activity on a GCS protein
- one or more test agents that exhibit at least 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 200%, or more, of the activity of a positive control may be identified and, optionally, selected for further testing, development, or use.
- a first screen is performed to identify agents that bind to a target protein, e.g.. a GCS protein, and a second screen is performed to identify those agents * u "' : " : u it the target protein and/or have a selected potency.
- one or more assays or screens is/are performed to identify test agents that bind to and/or inhibit a GCS protein, and the ability of identified test agents to inhibit survival or proliferation of tumor cells, e.g., tumor cells that overexpress SI 1MT2, is then assessed.
- the effect of a test agent may be assessed using one or more tumor cell lines, e.g., tumor cell lines that overexpress SHMT2.
- efficacy may be assessed in 2, 5, 10, or more tumor cell lines.
- efficacy may be assessed using a tumor cell line comprising CSCs.
- GCS proteins or RNA encoding them or cells may be contacted with one or more test agent(s) for various periods of time.
- An appropriate duration may be selected based, e.g., on any of a variety of considerations, e.g., the indicator to be detected, the reaction being assessed, the amount or rate of synthesis or degradation or activity of a target, the concentration or amount of test agent, etc.
- target RNA(s), protein(s), or cells are contacted with test agent(s) for between 5 minutes and 20 days, e.g., for between 5 and 60 minutes, between 1 hours (h) and 6.
- Cells may be contacted with a test agent during all or part of a culture period.
- a test agent may be replenished once or more during a culture period, e.g., between media changes or at the time of media changes.
- a test agent may be removed prior to assessing expression or activity.
- cells are contacted in vivo by administering a test agent to a subject, e.g., a test animal.
- a test agent may be administered once or more than once (multiple doses).
- the effect of the test agent on a tumor or subject may be assessed at one or more time points following administration.
- the effect of a test agent on a tumor or subject may be assessed at one or more time points between 12 h and 52 weeks after initial administration.
- the effect may be assessed between 1 week and 4 weeks following administration, between 4 weeks and 12 weeks following administration, between 12 weeks and 24 weeks following administration, between 24 weeks and 48 weeks following administration, or any intervening range or particular value, e.g., about 1, 2, 4, 6, 8, 12, 16, 20, 24, or more weeks following initial administration.
- a method comprises (a) contacting one or more test cells with a GCS inhibitor; and (b) assessing the survival and/or proliferation of the one or more - > . »i i ⁇ - jn some embodiments, the method further comprises contacting one or more control cells with the GCS inhibitor; and assessing the survival and/or proliferation of the one or more control cells by the GCS inhibitor. In some embodiments a method comprises (a) contacting one or more test cells with a GCS inhibitor; and (b) detecting the level of inhibition of the survival and/or proliferation of the one or more test cells by the GCS inhibitor.
- the method further comprises contacting one or more control cells with the GCS inhibitor; and detecting the level of inhibition of the survival and/or proliferation of the one or more control cells by the GCS inhibitor.
- the one or more test cells comprise tumor cells.
- the one or more test cells comprise tumor initiating cells.
- the one or more test cells comprise tumor cells, and the one or more control cells comprise non-tumor cells.
- the one or more test cells comprise tumor cells that overexpress SHMT2.
- the one or more test cells and the one or more control cells originate from the same individual or cell line.
- the one or more test cells and the one or more control cells originate from the same tissue type or organ type.
- a GCS inhibitor is contacted with cells in combination with a second antitumor agent.
- test cells and control cells are maintained in separate vessels (e.g., separate wells of a microwell plate) under substantially identical conditions when contacted with an agent.
- activity of an agent e.g., a lead compound
- Co-cultures permit evaluation of the selective survival and/or proliferation properties of two or more populations of cells (e.g., test and control cells) in contact with an agent in a common culture vessel.
- each population of cells in a co-culture will have an identifying characteristic that is detectable and distinct from an identifying characteristic of the other population(s) of cells in the co-culture.
- the identifying characteristic comprises a level of expression of GFP or other reporter protein and/or a tumor cell marker.
- identifying characteristics known in the art may be suitable, provided that the identifying characteristic enables measurement of the level of survival and/or proliferation of each of two or more populations of cells in the co-culture.
- a co-culture may comprise, e.g., between 1% and 99% test cells in some embodiments.
- the percentage of test cells is between 10% and 90%, between 20% and 80%,between 30% and 70%, between 40% and 60%, e.g., about 50%.
- a GCS component is contacted with multiple different doses (e.g., different concentrations or amounts) of a test agent and/or a GCS component is contacted with a test agent for multiple different durations.
- cells are contacted with multiple different doses (e.g., different concentrations or amounts) of a test agent and/or cells are contacted with a test agent for multiple different durations.
- any of the methods may include obtaining or analyzing a dose response curve for an agent.
- a dose response curve indicates the level of inhibition of activity of a target by an agent at a plurality of doses.
- a control dose response curve may be obtained or analyzed, wherein the control dose response curve indicates the level of inhibition of a target by vehicle or an inactive agent at a plurality of doses.
- a method comprises assessing the potency of an agent, e.g., using a dose response assay.
- analyzing comprises determining an IC50 or EC50 value for an agent.
- potency is characterized as a half maximal inhibitor concentration (IC50) of an agent, which is used herein to refer to the concentration of an agent that inhibits a given biological process or component, etc., by 50% (half).
- potency is characterized as a half maximal effective concentration (EC50) of an agent, which is used herein to refer to the concentration of an agent at which 50% of the maximal response induced by the agent (e.g., inhibition, activation) is observed.
- the biological process is a metabolic pathway, e.g., the reaction catalyzed by the GCS.
- the component is a component of a metabolic pathway, e.g., an enzyme.
- the biological process is cell proliferation or viability.
- a method comprises determining a GI50 for an agent, which term refers to the concentration of an agent required to inhibit cell proliferation by 50%.
- a dose response curve, IC50, EC50, or GI50 may be determined using an agent in one or more different compositions or in combination with one or more different agents.
- a dose response curve, IC50, EC50, or GI50 may be determined for exposure to an agent for a selected time period, e.g., any of the time periods mentioned herein.
- any of the methods may include obtaining or analyzing a dose response curve using test cells and/or control cells.
- a test dose response curve indicates the level of inhibition of test cell survival or proliferation by an agent at a plurality of doses; and a control dose response curve indicates the level of inhibition of control cell survival or proliferation by the agent at a plurality of doses.
- Test ' ⁇ "" * """ be, e.g., tumor cells that express a target of an agent.
- Control cells may be, e.g., non-tumor cells, or tumor cells that do not express a target of the agent.
- control cells are non-tumor cells that originate from the same tissue, organ, or cell type as test cells.
- a test dose response curve indicates the level of inhibition of test cell survival or proliferation by an agent at a plurality of doses; and a control dose response curve indicates the level of inhibition of control cell survival or proliferation by vehicle or an inactive agent at a plurality of doses.
- analyzing comprises determining an IC50 value for an agent on test cells and/or control cells.
- the IC50 value for the agent on test cells differs from the IC50 value for the agent on control cells in a statistically significant manner.
- the IC50 value for the agent on tumor cells is statistically significantly lower than the IC50 value for the agent on non-tumor cells.
- the IC50 of a GCS inhibitor may be between about 2 and about 1000-fold lower, e.g., about 2, 5, 10, 20, 50, 100, 250, 500, or 1000-fold lower, for test cells versus control cells.
- the IC50 of an agent may be between about 2 and about 1000-fold lower, e.g., about 2, 5, 10, 20, 50, 100, 250, 500, or 1000-fold lower, for tumor cells than for normal (non-tumor) cells.
- test agents e.g., candidate anti-tumor agents
- cells e.g., tumor cells, tumor cell lines, identified, obtained, or generated using any suitable method
- any suitable assay may be used to assess the effect of a candidate anti-tumor agent on a tumor cell or tumor.
- any of a variety of assays for cell viability and/or proli feration may be used in various embodiments; any of a variety of assays for tumor size, growth rate, progression may be used in various embodiments.
- an agent is first identi fied or characterized in one or more cell-free and/or cell- based assays or screens and then tested in subjects (e.g., test animals), e.g., to assess its effect on tumors in vivo.
- a test agent e.g., a candidate anti-tumor agent
- a candidate anti-tumor agent may be adm inistered to a subject using any suitable route of administration and may be formulated appropriately (e.g., with one or more carriers) for the selected route of administration.
- a candidate anti-tumor agent described or identified as described herein may be tested in combination with a second anti-tumor agent.
- one or more test agents e.g., a compound library
- a test agent is tested in combination with a known GCS inhibitor and the effect of the combination is compared with the effect of the GCS inhibitor in the absence of the test agent.
- a test agent identified as a modulator (e.g., inhibitor) of GCS activity is tested in a secondary assay to measure its effect on one or more individual GCS components.
- a test agent identified may be tested to determine whether it specifically inhibits GLDC, GCSH, or AMT.
- test agents may be used in various embodiments.
- a test agent may be a small molecule, polypeptide, peptide, nucleic acid, oligonucleotide, lipid, carbohydrate, or hybrid molecule.
- Agents can be obtained from natural sources or produced synthetically. Agents may be at least partially pure or may be present in extracts or other types of mixtures. Extracts or fractions thereof can be produced from, e.g., plants, animals, microorganisms, marine organisms, fermentation broths (e.g., soil, bacterial or fungal fermentation broths), etc.
- a compound collection (“library") is tested.
- the library may comprise, e.g., between 100 and 500,000 compounds, or more.
- Compounds are often arrayed in multwell plates. They may be dissolved in a solvent (e.g., DM SO) or provided in dry form, e.g., as a powder or solid. Collections of synthetic, semi -synthetic, and/or naturally occurring compounds may be tested.
- Compound libraries can comprise structurally related, structurally diverse, or structurally unrelated compounds. Compounds may be artificial (having a structure invented by man and not found in nature) or naturally occurring.
- a library comprises at least some compounds that have been identified as "hits" or "leads" in a drug discovery program and/or analogs thereof.
- a compound library may comprise natural products and/or compounds generated using non- directed or directed synthetic organic chemistry.
- Acompound library may be a small molecule library.
- Other libraries of interest include peptide or peptoid libraries, cDNA libraries, and oligonucleotide libraries.
- a library may be focused (e.g., composed primarily of compounds having the same core structure, derived from the same precursor, or having at least one biochemical activity in common).
- Compound libraries are available from a number of commercial vendors such as Tocris Bioscience, Nanosyn, BioFocus, and from government entities.
- MLSMR Molecular Libraries Small Molecule Repository
- NIH National Institutes of Health
- NCC C ollection
- a test agent may be, e.g., an antineoplastic, antibacterial, antiviral, antifungal, antiprotozoal, antiparasitic, antidepressant, antipsychotic, anesthetic, antianginal, antihypertensive, antiarrhythmic, antiinflammatory, analgesic, antithrombotic, antiemetic, immunomodulator, antidiabetic, lipid- or cholesterol- lowering (e.g., statin), anticonvulsant, anticoagulant, antianxiety, hypnotic (sleep-inducing), hormonal, or anti-hormonal drug. etc.
- an agent has undergone at least some preclinical or clinical development or has been determined or predicted to have "druglike" properties.
- an agent may have completed a Phase I trial or at least a preclinical study in non-human animals and shown evidence of safety and tolerability.
- an agent is not an agent that is found in a cell culture medium known or used in the art. e.g.. for culturing vertebrate, e.g.. mammalian cells , e.g.. an agent provided for purposes of culturing the cells, or, if the agent is found in a cell culture medium known or used in the art, the agent may be used at a different, e.g., higher, concentration when used in a method or composition described herein.
- an agent is not an agent known in the art as being useful for treating tumors (e.g., for inhibiting tumor cell survival or proliferation or for inhibiting tumor maintenance, growth, or progression) or for treating side effects associated with chemotherapy.
- GCS modulators e.g., GCS inhibitor(s).
- a structure e.g.. a two-dimensional or three-dimensional structure
- a target e.g., a GCS protein
- a structure obtained with a ligand (e.g.. an inhibitor) bound to the target may be used.
- a computer-aided computational approach sometimes referred to as "virtual screening" is used in the
- candidate modulators e.g., candidate GCS inhibitors.
- Structures of compounds may be screened for ability to bind to an enzyme, e.g.. to a region (e.g., a "pocket") accessible to the compound.
- the region may be a known or potential active site or any region accessible to the compound, e.g., a concave region on the surface or a cleft.
- a variety of docking and pharmacophore-based algorithms are known in the art, and computer programs implementing such algorithms are available. Commonly used programs include Gold, Dock, Glide, FlexX, Fred, and LigandFit (including the most recent releases thereof).
- a virtual screening algorithm may involve two major phases: searching (also called “docking") and scoring.
- searching also called "docking”
- scoring assigns scores to the candidate complexes and selects a structure that displays favorable interactions based at least in part on the energy.
- this process may be repeated with a large number of test compounds to identify those that, for example, display the most favorable interactions with the target.
- low-energy binding modes of a small molecule within an active site or possible active site are identified.
- Variations may include the use of rigid or flexible docking algorithms and/or including the potential binding of water molecules.
- the three-dimensional structure of an enzyme's active site may be used to identify potential inhibitors. Agent(s) that have the potential to bind in or near an active site may be identified. These predictions may then be tested using the actual compound. A new inhibitor thus identified may then be used to obtain a structure of the enzyme in an inhibitor/enzyme complex to show how the molecule is binding to the active site. Further changes may be made to the inhibitor, e.g., to try to improve binding. This cycle may be repeated until an inhibitor of sufficient predicted or actual potency (e.g., a desired potency for therapeutic purposes) is identified. Numerous small molecule structures are available and can be used for virtual screening.
- a collection of compound structures may sometimes referred to as a "virtual library".
- ZINC is a publicly available database containing structures of millions of commercially available compounds that can be used for virtual screening (http://zinc.docking.org/; Shoichet, J. Chem. Inf. Model, 45( 1 ): 177-82. 2005).
- a database containing about 250.000 small m i f vn io structures is available on the National Cancer Institute (U.S.) website (at http://129.43.27.140/ncidb2/).
- multiple small molecules may be screened, e.g., up to 50,000; 100,000; 250,000; 500,000, or up to 1 million, 2 million, 5 million. 10 million, or more.
- Compounds can be scored and, optionally, ranked by their potential to bind to a target.
- Compounds identified in virtual screens can be tested in cell-free or cell-based assays or in animal models to confirm their ability to inhibit activity of a target, e.g., the GCS or a GCS component, and/or to assess their effect on tumor cell survival or proliferation or tumor maintenance or progression.
- Computational approaches may be used to predict one or more physico-chemical, pharmacokinetic and/or pharmacodynamic properties of compounds identified in a physical or virtual screen. Such information may be used, e.g., to select one or more hits for, e.g., further testing, development, or use. For example, small molecules having characteristics typical of "drug-like" molecules may be selected and/or small molecules having one or more undesired characteristics may be avoided.
- one or more agents may be selected for, e.g., further testing, development, or use.
- a selected hit may be referred to as a "lead” or "lead agent".
- a lead may be an agent that is determined or predicted to have higher potency, greater selectivity for a target, one or more drug-like properties, potential for useful modification, or any other propert(ies) of interest, e.g., as compared with one or more other hits, e.g., as compared with the majority of other hits.
- Further testing may comprise, e.g., resynthesis of a hit, retesting of a hit in the same or a different assay, etc.
- Development of an agent may comprise producing an altered agent, e.g., an altered lead agent.
- structures of hit compounds may be examined to identify a pharmacophore, which may be used to design additional compounds (e.g., structural analogs).
- any of the methods may comprise producing an altered agent, e.g., an altered lead agent.
- a method comprises modifying an agent to achieve or seek to achieve an alteration in one or more properties, e.g., (1) increased affinity for a target of interest; (2) decreased affinity for a non-target molecule, (3) increased solubility (e.g., increased aqueous solubility); (4) increased stability (e.g., in vivo); (5) increased potency: (6) increased selectivity, e.g., for a target molecule or for tumor cells, e.g..
- a higher selectivity e.g., higher cytotoxicity
- a decrease in one or more side effects e.g., decreased adverse side effects, e.g., decreased toxicity
- one or modified pharmacokinetic properties e.g., absorption, distribution, metabolism and/or excretion
- modified onset of therapeutic action or duration of effect (1 1) modified, e.g..
- modified, oral bioavailability (12) modified, e.g., increased, tissue or tumor penetration; (13) modified, e.g., increased, cell permeability; (14) modified, e.g., increased, delivery to a selected subcellular organelle; (15) modified, e.g., increased, increased ability to cross the blood-brain barrier (increased ability to cross the blood-brain barrier may be desirable in some embodiments if the agent is to be used to treat central nervous system tumors, e.g., brain tumors; decreased ability to cross the blood-brain barrier may be desirable in some embodiments if the agent has adverse effects on the CNS ); ( 16) altered immunogenicity; (17) altered plasma protein binding.
- any of the methods further comprises determining an in vitro activity or in vivo activity or toxicology profile of an altered agent, e.g., an altered lead agent.
- One or more additional alterations may be performed, e.g., based at least in part on such analysis. Multiple cycles of alteration and testing may be performed, thereby generating additional altered agents.
- any of the methods may further comprise performing a quantitative structure activity relationship analysis of multiple hit. lead, or altered agents. Alteration may be accomplished through at least partly random or non- predetermined modification, predetermined modification, and/or using computational approaches in various embodiments.
- alteration may make use of established principles or techniques of medicinal chemistry, e.g., to predictably alter one or more properties.
- a first library of test agents is screened using any of the methods described herein, one or more test agents that are “hits” or “leads” is identified, and at least one such hit or lead is subjected to systematic structural alteration to create a second library of compounds structurally related to the hit or lead.
- the second library is then screened using methods described herein or other methods.
- an agent identified as described herein may have an unknown structure and/or may be part of a mixture comprising multiple potentially active agents.
- a variety of techniques useful for determining the structures of agents are known and may be used to determine the structure, if desired, such as NMR, infrared (IR) spectroscopy, ultraviolet-visible (UV-Vis) spectroscopy, mass spectrometry, X-ray crystallography, etc.
- a variety of techniques useful for separating agents are known and may be used to separate agents present in a mixture.
- one or more known modulators or one or more identified ;*" " or altered agents that act on the same target or on different targets, e.g., the same GCS component or different GCS components, may be linked to each other directly or via one or more linkers or a scaffold.
- any of the methods may comprise producing an altered agent, e.g., an altered lead agent, by modifying an agent to incorporate or be attached to a label, which may optionally be used to detect or measure the agent or a metabolite of the agent, e.g., in a pharmacokinetic study.
- any of the methods may comprise producing an altered agent, e.g., an altered lead agent, by modifying an agent to incorporate or be attached to a second moiety (or more than two moieties).
- a second (or additional) moiety comprises a linker, tag, or targeting moiety.
- a second (or additional) moiety may modify one or more properties (1) - (17) listed above.
- a modification may increase delivery of the agent to, or or accumulation of the agent at, a site of desired activity in the body of a subject.
- a site may be, e.g., a tumor, organ, tissue, cellular compartment (e.g., cytoplasm, organelle), etc.
- a moiety that enhances cell permeability may comprise a protein transduction domain (PTD).
- PTD protein transduction domain
- Cell permeability is used interchangeably with “cell uptake” herein arid is not intended to imply any particular mechanism. Uptake may comprise traversal of the plasma membrane into the cytoplasm.
- a PTD is a peptide or peptoid that can enhance uptake by cells, e.g., mammalian cells, of an entitythat comprises it or to which it is attached .
- Many PTDs are known in the art.
- Hxemplary PTDs include various sequences rich in amino acids having positively charged side chains (e.g., guanidino-, amidino-and amino-containing side chains (e.g., U.
- S. Patent No. 6,593,292 such as arginine-rich peptides, sequences from HIV Tat protein (e.g., U. S. Patent No. 6,316,003); penetratin (sequence derived from the homeodomain of Antennapedia); sequences from a phage display library (e.g., U.S. 20030104622); MTS peptide (sequence derived from the Kaposi fibroblast growth factor signal peptide), etc.
- Organel le-spec i fic PTDs provide a means to target specific subcellular sites. See, e.g., Jain M, et al. Cancer Res. 65:7840-7846, 2005; Torchilin VP.
- a PTD may be used to
- GCS component or a microparticle or nanoparticle that incorporates a GCS inhibitor.
- a GCS inhibitor comprises or is physically associated with a moiety that increases mitochondrial localization of the agent, e.g., that increases entry of the agent into the mitochondria.
- a GCS inhibitor is modified to comprise or be physically associated with such a moiety.
- Mitochondrial targeting moieties in certain embodiments can include a variety of peptides, peptide mimetics, and non-peptide species.
- such a moiety is conjugated to a GCS inhibitor or expressed as a fusion protein with a GCS inhibitor in order to target the agent to mitochondria.
- a mitochondrial targeting moiety comprises or is a functional variant of a naturally occurring mitochondrial targeting signal (MTS).
- MTSs are often N-terminal, or less frequently C-terminal, cleavable amino acid sequences of, e.g., about 15-40 residues in length, which are often positively charged with relatively few negatively charged residues. They may, e.g., comprise multiple basic (e.g., arginine), hydrophobic (e.g., alanine, leucine), and polar residues (e.g., serine).
- the targeting signal is generally proteolytically removed by mitochondria processing peptidase during import or inside the mitochondrial matrix. Some mitochondrial proteins are targeted to mitochondria by similar internal sequences that do not undergo cleavage.
- MTSs are believed to form amphipathic a-helices, which may be important for their recognition by the translocation machineries in the mitochondrial outer (TOM complex) and inner (TIM complex) membranes.
- TOM complex mitochondrial outer
- TIM complex inner
- a sequence having amphiphilicity in combination with localized positive charges from basic residues may direct successful mitochondrial import.
- Exemplary peptides that may be used to enhance mitochondrial import include, e.g., SS peptides or XJB peptide mimetics or a series of cationic, lipophilic cell-permeable mitochondrial penetrating peptides at least 4-8 amino acids in length comprising lysine (K) and arginine (R) or d-arginine (r) (selected to provide positive charge), and phenylalanine (F) and cyclohexylalanine (FX) residues (toimpart lipophilicity) (Horton, KH, et al., Chemistry & Biology 15: 375-382 (2008).
- SS peptides or XJB peptide mimetics or a series of cationic, lipophilic cell-permeable mitochondrial penetrating peptides at least 4-8 amino acids in length comprising lysine (K) and arginine (R) or d-arginine (r) (selected
- Non-peptide mitochondrial targeting species include various lipophilic cationic compounds such as triphenylphosphonium (TPP) or a derivative thereof, e.g., a lower alkyl derivative thereof (e.g., a CI -6 alkyl, e.g., methyl derivative), (2-oxo-ethyl)-triphenyl-phosphonium, or stearyltriphenyl phosphonium.
- TPP triphenylphosphonium
- a derivative thereof e.g., a lower alkyl derivative thereof (e.g., a CI -6 alkyl, e.g., methyl derivative)
- 2-oxo-ethyl)-triphenyl-phosphonium e.g., Hoye, AT. et al., Accounts of Chemical Research.
- a GCS inhibitor comprises or is modified to comprise or be physically associated with a moiety that increases passage across the blood brain barrier (BBB).
- BBB blood brain barrier
- a GCS inhibitor is modified to increase its lipophilicity by, e.g., conjugating a lipophilic moiety thereto.
- an agent e.g., a GCS inhibitor
- a moiety such as polyethylene glycol (PEG) or a derivative thereof, or another biocompatible organic polymer (either naturally occurring or artificial), resulting in an agent of increased size that has an increased circulation time in the body (e.g., after intravenous administration).
- the moiety may have a molecular weight, or average molecular weight, of, e.g., between 10 kD and 200 kD in various embodiments.
- PEGylation (the process of covalent attachment of polyethylene glycol polymer chains to another molecule) may be achieved by incubation of a reactive derivative of PEG with the target molecule.
- the covalent attachment of PEG to an agent may "mask" the agent from the immune system (reducing immunogenic ity and antigenicity), and increase the hydrodynamic size of the agent, which prolongs its circulatory time by reducing renal clearance.
- PEGylation may provide enhanced water solubility to hydrophobic agents.
- a GCS inhibitor comprises or is linked to a targeting moiety.
- a targeting moiety binds to a tumor cell surface marker.
- a targeting moiety comprises an antibody that binds to a cell surface marker, e.g., a tumor cell surface marker.
- a targeting moiety comprises a ligand that binds to a cell surface marker.
- a small molecule ligand, aptamer, or polypeptide maybe used in some embodiments.
- folate may be used as a targeting moiety to direct a GCS inhibitor to tumors that express the folate receptor.
- altered GCS inhibitors and methods of making an altered GCS inhibitor are provided.
- an altered GCS inhibitor may be produced as a fusion protein.
- an altered GCS inhibitor may be produced at least in part by covalently attaching asecond moiety to the agent.
- the GCS inhibitor and moiety are linked using a linker.
- linkers, reactive functional groups useful for covalent attachment, and methods of linking various molecules or other entities are known in the art and may be used in various embodiments. Nonlimiting examples are found in Hermanson, G., Bioconjugate Techniques, 2 nd ed., Academic Press (2008). One of ordinary skill in the art will be able to select appropriate linkers and methods.
- Any « " ;t -' w « i; nker and/or method can be used to link an agent that inhibits the GCS to a targeting moiety in order to generate a targeted GCS inhibitor.
- a Afunctional linker may ⁇ be used.
- a linker comprises a cleavage site for an intracellular enzyme, so that the GCS inhibitor may be released from the targeting moiety inside cells that contain the enzyme.
- any of the methods may comprise producing a composition by formulating an agent, e.g., a lead agent or altered agent, e.g., an altered lead agent, with a pharmaceutically acceptable carrier.
- any of the methods may comprise testing a lead or altered agent in vivo, by administering one or more doses of the composition to a subject, optionally a subject harboring a tumor cell or tumor, and evaluating one or more pharmacokinetic parameters, evaluating the effect of the agent on the subject (e.g., monitoring for adverse effects) and/or evaluating the effect of the agent on the growth and/or survival of the cancer cell in the subject.
- any of the methods may comprise testing a lead or altered agent in a tumor model in vivo, by administering one or more doses of the composition to a non-human animal that serves as a tumor model and evaluating the effect of the agent on the tumor in the subject. For example, tumor size, number, growth rate, or metastasis may be assessed, e.g., as discussed above.
- samples or data may be acquired at multiple time points, e.g., during or after a dose or series of doses.
- a suitable computer program may be used for data analysis, e.g., to calculate one or more pharmacokinetic parameters.
- the subject is a mouse, rat, rabbit, dog, cat, sheep, pig, non-human primate, or human.
- an altered agent e.g., an altered lead agent
- an agent or an intermediate obtained in the course of synthesis of the agent may be used as a starting material for alteration.
- an altered agent may be synthesized using any suitable materials and/or synthesis route.
- one or more agents that inhibit the GCS or a GCS component may be identified, designed, or produced based on a known GCS inhibitor or based one or more hits identified in a screen for GCS inhibitors.
- a known GCS inhibitor or an agent identified as a GCS inhibitor in an assay or screen may be altered, e.g., to produce an altered agent having one or more altered properties, e.g., as described above.
- a computer-readable medium stores at least some results of a screen to identify agents that inhibit the GCS or a GCS component.
- the results may be stored in a database and may include one or more screening protocols, results obtained from a screen, predicted properties of hits, leads, or altered leads, or results of additional testing of hits, leads, or altered leads.
- an agent capable of causing a decrease in level or activity of a target e.g., the GCS or a GCS component, of at least 50% when used in a cell-free or cell-based assay at a concentration equal to or less than approximately 1 mM, 500 ⁇ , 100 ⁇ , 0 uM, 10 ⁇ , 5 ⁇ , or 1 ⁇ , may be screened for. identified, selected, designed, provided, or used.
- an agent capable of causing a decrease in level or activity of a target e.g., the GCS or a GCS component, of at least 50% (i.e., a decrease to 50% or less of the activity that would be expected in the absence of the compound) when used in a cell-free or cell-based assay at lower concentrations, e.g., equal to or less than approximately 500 nM, 100 nM, 50 nM, or 10 nM or less, may be identified, selected, designed, or used.
- an agent capable of causing a decrease in level or activity of a target e.g., the GCS or a GCS component, of at least 50% when used at a concentration between 0.1 - 10 nM, may be screened for, identified, selected, designed, provided, or used.
- an agent e.g., a GCS inhibitor
- a GCS inhibitor that is capable of causing a decrease of at least 50% in tumor cell survival or proliferation (i.e., a decrease to 50% or less of the number of viable cells that would be expected in the absence of the agent) when used in a suitable cell culture system at a concentration equal to or less than approximately 1 mM, 500 ⁇ , 100 ⁇ , 50 ⁇ . 10 ⁇ , 5 ⁇ , or 1 ⁇ may be screened for, identified, selected, designed, produced, provided, or used.
- an agent e.g., a GCS inhibitor
- concentrations e.g., equal to or less than approximately 500 nM, 100 nM, 50 nM, or 10 nM or less
- an agent, e.g., a GCS inhibitor that is capable of causing a decrease of at least 50% in tumor cell survival or proliferation when used in a suitable cell culture system when used at a concentration between 0.1-10 nM may be screened for, identified, selected, designed, produced, provided, or used.
- at least 50% is between 50% and 75%, between 75% and 90%, between 90% and 95%, between 95% and 100%.
- a decrease of 100% may be a reduction to background levels or essentially no viable cells or no cell proliferation.
- a test agent may be contacted with tumor cells (e.g., tumor cells that overexpress SHMT2) ex vivo, and the tumor cells are then introduced into a test animal that serves as a tumor model. The ability of the test agent to inhibit tumor development, tumor size, or tumor growth is assessed.
- tumor cells e.g., tumor cells that overexpress SHMT2
- a test agent is administered to a test animal that serves as a tumor model.
- a test agent may be administered by any route or regimen in various embodiments.
- the test agent can be administered prior to, concomitant with, and/or following the administration of tumor cells or development of a tumor.
- a test agent may be administered once or more during the course of the testing period, for example, one, two, three, four, or more times a day, weekly, bi-weekly, or monthly, beginning before or after tumor cells have been administered.
- the test agent is
- doses are 0.01-200 mg/kg (e.g., 0.1-20 mg/kg or 1 -10 mg/kg).
- an agent is administered to a non-human subject, e.g., a non-human mammal, e.g., a rodent such as a mouse, rat, hamster, rabbit, or guinea pig; a dog, a cat, a bovine or ovine, a non-human primate (e.g., a monkey such as a cynomolgus or rhesus monkey).
- the non-human animal may be used to assess effect of the agent or a combination of agents on tumor formation, growth, progression (e.g., local invasion, regional or distant metastasis), etc.
- a non-human animal is used to assess efficacy and/or toxic ity of an agent or combination of agents. Methods known in the art can be used for such assessment.
- a candidate anti-tumor agent that has been assessed in an ex vivo or in vivo tumor model and shown to inhibit tumor cell survival or proliferation or to inhibit tumor maintenance, growth, invasion, metastasis, resistance to chemotherapy, recurrence, or otherwise shown a useful anti-tumor effect may be considered an anti-tumor agent.
- An antitumor agent may be tested in a clinical trial in a population of subjects in need of treatment for cancer to confirm its therapeutic utility or further define subject characteristics or tumor characteristics that correlate with (e.g. are predictive of) efficacy or to identify particularly effective agents, combinations, doses, etc.
- a composition comprises a GCS inhibitor and a tumor cell that overexpresses SHMT2.
- the composition may further include a cell culture medium.
- the composition may further comprise an agent. e.g., a test agent.
- An agent may be combined with one or more substances, which may be physiologically acceptable substances or combinations thereof.
- a physiologically acceptable substance can be contacted with vertebrate cells, e.g., mammalian cells, e.g., human cells, of many types without causing undue cytotoxicity in the amount used.
- a difference between two or more values (e.g., measurements) or groups, or a relationship between two or more variables, may be statistically significant.
- a level of inhibition or reduction of expression, activity, cell proliferation, cell survival, or tumor size e.g., as compared with a reference or control level, may be statistically significant.
- “statistically significant" may refer to a p-value of less than 0.05 using an appropriate statistical test.
- One of ordinary skill in the art will be aware of appropriate statistical tests and models for assessing statistical significance, e.g., of differences in measurements, relationships between variables, etc., in a given context.
- Exemplary tests and models include, e.g., t-test, ANOVA, chi-square test, Wilcoxon rank sum test, log-rank test, Cox proportional hazards model, etc.
- multiple regression analysis may be used.
- a p-value may be less than 0. 025.
- a p-value may be less than 0.01.
- a two-sided statistical test is used.
- a result or outcome or difference between two or more values is "statistically significant" if it has less than a 5%, less than a 2.5%, or less than a 1% probability of occurring by chance.
- a difference between two or more values or a relationship between two or more variables may be statistically significant with a p-value of less than 0.05. less than 0.025. or less than 0.01 .
- values may be average values obtained from a set of measurements obtained from different individuals, different samples, or different replicates of an experiment.
- Software packages such as SAS, GraphPad, etc., may be used for performing statistical analysis.
- a method of identifying an agent that modulates sensitivity to GCS inhibition comprises (a) performing a screen or assay to identify an agent that modulates, e.g., increases, expression or activity of SHMT2.
- a method of identifying a candidate agent for treatment of cancer comprises (a) performing a screen or " "- ⁇ * ⁇ entify an agent that modulates, e.g., increases, expression or activity of SHMT2.
- a method further comprises (b) testing an agent identified in step (a) in a tumor model, e.g., in combination with a GCS inhibitor.
- binding assays, activity assays, computer-aided screens, and/or methods of generating altered agents described herein may be used to identify agents that modulate SHMT2 expression or activity.
- a method of treating a subject in need of treatment for a tumor comprises inhibiting the GCS in the tumor.
- a method comprises administering a GCS inhibitor to the subject.
- any of the methods may comprise predicting the likelihood that a tumor will be sensitive to a GCS inhibitor.
- a method comprises determining whether the tumor overexpresses SHMT2, wherein if the tumor overexpresses SHMT2, the tumor has increased likelihood of being sensitive to a GCS inhibitor.
- the method comprises determining whether the tumor is of a tumor type that has a tendency to overexpress SI IMT2.
- a method comprises (a) determining that a subject is in need of treatment for a tumor; and (b) administering a GCS inhibitor to the subject. In some embodiments a method comprises (a) determining that a subject is in need of treatment for an SHMT2-overexpressing tumor; and (b) administering a GCS inhibitor to the subject. In some embodiments a method comprises (a) diagnosing a subject as having a tumor; and (b) administering a GCS inhibitor to the subject.
- a method comprises (a) diagnosing a subject as having an SHMT2-overexpressing tumor: and (b) administering a GCS inhibitor to the subject.
- a GCS inhibitor may be any GCS inhibitor described herein, known in the art, or identified or produced as described herein.
- a subject may be in need of treatment of a tumor of any type in various embodiments.
- providing a subject in need of treatment for a tumor comprises diagnosing the subject as having a tumor.
- a subject may be diagnosed as having cancer or may have been diagnosed as having cancer using any method of diagnosis known in the art. Methods may include, e.g., physical examination, imaging (e.g., CT scan. MRI), histopathological examination and/or molecular analysis of biopsy or surgical specimens, or :- ⁇ * ions thereof. See, e.g., DeVita, supra.
- the subject has a solid tumor.
- the subject has a carcinoma.
- the subject has a sarcoma.
- a subject is in need of treatment for a tumor of a type that has a tendency to overexpress SHMT2.
- a subject is in need of treatment for a brain tumor, bladder tumor, breast cancer, cervical tumor, colorectal tumor, embryonal tumor, gastric tumor, germ cell tumor, head and neck tumor, hematologic tumor, kidney tumor, melanoma, mesothelial tumor, ovarian tumor, yolk sac tumor, or sarcoma.
- a tumor is a central nervous system (CNS) tumor.
- CNS central nervous system
- the CNS tumor is a brain tumor. In some embodiments, the CNS tumor is a glioma. In some embodiments, the glioma is an astrocytic glioma, e.g., an anaplastic astrocytoma (World Health Organization grade III) or glioblastoma (World Health
- a subject is at risk of cancer or at risk of cancer recurrence.
- a subject at risk of cancer may be, e.g.. a subject who has not been diagnosed with cancer but has an increased risk of developing cancer.
- a subject at increased risk of cancer may be, e.g., a subject who has not been diagnosed with cancer but has an increased risk of developing cancer as compared with a control, who may be matched with regard to one or more demographic characteristics such as age, gender, etc.
- the subject may have a risk at least 1.2, 1.5, 2, 3, 5, 10 or more times that of an age-matched control (e.g., of the same gender), in various embodiments.
- age-matched can refer to the same number of years of age as the subject or within the same age range as the subject (e.g., a range of 5 or 10 years). For example, a control may be up to 5 years older or younger than the subject. Determining whether a subject is considered “at increased risk" of cancer is within the skill of the ordinarily skilled medical practitioner. Any suitable test(s) and/or criteria can be used.
- a subject may be considered "at increased risk of developing cancer if any one or more of the following apply: (i) the subject has an inherited mutation or genetic polymorphism that is associated with increased risk of developing or having cancer relative to other members of the general population not having such mutation p 0 iy mor hism (e.g., inherited mutations in certain TSGs are known to be associated with increased risk of cancer); (ii) the subject has a gene or protein expression profile, and/or presence of particular substance(s) in a sample obtained from the subject (e.g., blood), that is/are associated with increased risk of developing or having cancer relative to the general population; (iii) the subject has one or more risk factors such as a family history of cancer, exposure to a tumor-promoting agent or carcinogen (e.g., a physical carcinogen, such as ultraviolet or ionizing radiation; a chemical carcinogen such as asbestos, tobacco or smoke components, afiatoxin, arsenic; a biological carcinogen such as
- a subject suspected of having cancer may be a subject who has one or more symptoms of cancer or who has had a diagnostic procedure performed that suggested or was consistent with the possible existence of cancer.
- a subject at risk of cancer recurrence may be a subject who has been treated for cancer and appears to be free of cancer, e.g., as assessed by an appropriate method.
- compositions e.g., pharmaceutical compositions.
- active agent(s) e.g., an anti-tumor agent
- pharmaceutical compositions typically comprise one or more pharmaceutically acceptable carriers.
- compositions comprising a GCS inhibitor and a pharmaceutically acceptable carrier are provided.
- a GCS inhibitor can be any of the GCS inhibitors described above or identified as described above.
- pharmaceutical compositions comprising aGCS inhibitor and any
- compositions comprising two or more GCS inhibitors and any pharmaceutically acceptable carrier(s).
- a composition comprises first and second GCS inhibitors, wherein the first and second GCS inhibitors inhibit different GCS components. Certain embodiments are directed to compositions comprising each combination of two or more GCS inhibitors described above or identified as described herein, together with any
- At least one of the GCS inhibitors inhibits GLDC. I n some embodiments, at least one of the GCS inhibitors inhibits GCSH. In some embodiments, at least one of the GCS inhibitors comprises cysteamine or acysteamine salt or prodrug.
- a pharmaceutically acceptable carrier encompasses vehicles, diluents, solvents, fillers, dispersion media, excipients, encapsulating substances, ⁇ " ' " ⁇ ⁇ and other substances that are compatible with pharmaceutical administration to a human or non-human animal.
- a pharmaceutically-acceptable carrier is a non-toxic material (at least in the amounts used and in typical subjects) that does not significantly interfere with the biological activity of the active ingredients of a composition.
- ком ⁇ онент in the context of a pharmaceutical composition, means that the ingredients of the pharmaceutical compositions are capable of being comingled with an active agent, and with each other, in a manner such that there is no interaction that would substantially reduce the efficacy of the pharmaceutical composition or render it unsuitable for administration, e.g., under conditions of ordinary use.
- Supplementary active agents may be incorporated into the compositions in various embodiments.
- a supplementary active agent is an anti-tumor agent (e.g., as described above).
- a supplementary active agent enhances the effectiveness of a GCS inhibitor or reduces toxicity or treats a side effect of the GCS inhibitor with which it is administered.
- compositions may depend for example, at least in part on the nature of the active agent, e.g., properties such as solubility or stability; compatibility (meaning that substances can be present together in a composition without interacting in a manner that would substantially reduce the efficacy of the pharmaceutical composition under ordinar use situations); dosage format (e.g., tablet, liquid for injection, etc.); and/or route of administration of the composition.
- properties such as solubility or stability
- compatibility meaning that substances can be present together in a composition without interacting in a manner that would substantially reduce the efficacy of the pharmaceutical composition under ordinar use situations
- dosage format e.g., tablet, liquid for injection, etc.
- route of administration of the composition e.g., route of administration of the composition.
- a pharmaceutical composition may be formulated to be suitable for its intended route of administration.
- routes of administration include, e.g., intravenous, intraarterial, intraosseus, respiratory (e.g., by inhalation), intrathecal, intracisternal, intranasal, intraperitoneal, oral or other means of introduction into the gastrointestinal tract (e.g., stomach or small intestine), sublingual, buccal, subcutaneous, intramuscular, intradermal, intraocular, intrasynovial, intravesical, transdermal, cutaneous (onto the skin) (also termed "topical”), vaginal, or rectal administration.
- a pharmaceutical composition may, for example, be in the form of a liquid, gel, lotion, tablet, pill, capsule, spray, aerosol, ointment, transdermal patch, suppository, implant, etc., in various embodiments.
- the agent can be formulated with pharmaceutically acceptable carriers as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, etc.
- Pharmaceutically acceptable carriers suitable for injection or other parenteral administration methods can include, for example, aqueous solutions such as water ' ⁇ ' :r for injection).
- a pharmaceutical composition e.g., a pharmaceutical composition intended for parenteral use, e.g., injection, is sterile.
- a pharmaceutically acceptable carrier or composition is sterile.
- Sterile solutions may be prepared, for example, by incorporating the active agent(s) in the required amount in an appropriate solvent, optionally with one or a combination of ingredients discussed above, followed by filter sterilization.
- dispersions may be prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above.
- methods of preparation may include vacuum drying or freeze-drying (lyophilization) which yields a powder of the active ingredient plus any additional desired ingredient(s) from a previously sterile-filtered solution thereof.
- a pharmaceutical composition may comprise, in addition to an active agent, one or more physiologically acceptable agents that act, for example, as bulking agents, fillers, solubilizers, stabilizers, surfactants, osmotic agents, preservatives, anti-microbial agents, chelating agents, buffers, disintegrants, absorption enhancers, flowability enhancers, etc.
- physiologically acceptable agents that act, for example, as bulking agents, fillers, solubilizers, stabilizers, surfactants, osmotic agents, preservatives, anti-microbial agents, chelating agents, buffers, disintegrants, absorption enhancers, flowability enhancers, etc.
- Physiologically acceptable compounds compatible with pharmaceutical administration include, for example, carbohydrates, such as glucose, sucrose, lactose; dextrans; polyols such as mannitol; antioxidants, such as ascorbic acid or glutathione. Numerous pharmaceutically acceptable carriers and methods of preparing dosage forms are known in the art.
- a method of making a pharmaceutical composition comprising a GCS inhibitor may include, e.g.,
- a GCS inhibitor with one or more pharmaceutically acceptable carriers and preparing a dosage form suitable for administration to a subject.
- a preparation of an active agent e.g.. a GCS inhibitor, is at least 90% pure, e.g.. at least 95%. 96%, 97%), 98%, 99%, or more pure when used in a pharmaceutical composition.
- apharmaceutical composition may be manufactured consistent with good manufacturing practices (GMP).
- GMP good manufacturing practices
- at least some, most, or all pharmaceutically acceptable carriers and other ingredients in a pharmaceutical composition are, if applicable, pharmaceutical grade (USP).
- a dose of an agent may be expressed using any appropriate units, e.g., as a total amount (e.g., in milligrams (mg)), amount/body weight (e.g., mg/kg), amount/surface area (e.g., mg/m 2 ), etc.
- Doses of agents described herein may range, e.g., from about 0.1 ⁇ g to 10,000 mg, e.g., from about 1 ⁇ g to 5,000 mg, e.g., from about 10 ⁇ g to 1000 mg once or more per day, week, month, or other time interval, in various embodiments.
- doses in certain embodiments may range from about 0.0001 mg to about 100 mg of agent per kg of body weight per day, e.g., from 0.001 mg to 50 mg of agent per kg of body weight, e.g., from 0.01 mg to 10 mg of agent per kg of body weight.
- lower or higher doses may be used.
- doses are expressed in terms of surface area, e.g., between about 1 mg/m to about 5,000 mg/m .
- One of ordinary skill in the art may choose from among the various active agents and may consider factors such as potency, bioavailability, mode of administration, the activity of the agent(s), the route of administration, the time of administration, the rate of excretion or metabolism of the agent being employed, the duration of treatment, severity of typical or expected adverse side-effects (if any), other agents and/or materials used in combination with the agent, the age, sex, weight, physical condition, general health and prior medical history of the patient being treated, and like factors well known in the medical arts, with a goal of selecting an effective prophylactic or therapeutic treatment regimen while avoiding substantial or unacceptable toxicity.
- factors such as potency, bioavailability, mode of administration, the activity of the agent(s), the route of administration, the time of administration, the rate of excretion or metabolism of the agent being employed, the duration of treatment, severity of typical or expected adverse side-effects (if any), other agents and/or materials used in combination with the agent, the age, sex, weight, physical condition, general health and prior medical history
- a GCS inhibitor may be used at the maximum tolerated dose or a sub-therapeutic dose or any dose there between, e.g., the lowest dose effective to achieve a therapeutic effect.
- Maximum tolerated dose refers to the highest dose of a pharmacological or radiological treatment that can be administered without unacceptable toxicity, that is, the highest dose that has an acceptable risk/benefit ratio, according to sound medical judgment. In general, the ordinarily skilled practitioner can select a dose that has a i- i g risk/benefit ratio according to sound medical judgment.
- a MTD may, for example, be established in a population of subjects in a clinical trial.
- an agent is administered in an amount that is lower than the MTD, e.g., the agent is administered in an amount that is about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the MTD.
- an agent or pharmaceutical composition is provided to a subject for an extended period of time, such as repeated administrations for one or more months, between a month and a year, one or more years, or longer.
- treatment involves administering an agent or pharmaceutical composition repeatedly over the life of the subject.
- treatment involves regular administrations, for example one or more times a day, one or more times a week, or one or more times a month.
- an effective daily dose may be administered as two, three, four, five, six, or more sub-doses administered separately at appropriate intervals throughout the day, optionally, in unit dosage forms. Exemplary doses may be selected using in vitro studies, tested in animal models, and/or clinical trials as standard in the art.
- a particular agent e.g., a GCS inhibitor
- a GCS inhibitor or pharmaceutical composition comprising a GCS inhibitor may be used in combination therapies, that is, a GCS inhibitor or pharmaceutical composition comprising a GCS inhibitor may be administered concurrently with, prior to, or subsequent to, one or more other desired therapeutics or procedures.
- the particular combination of therapies (therapeutics or procedures) to employ in a combination regimen will generally take into account compatibility of the desired therapeutics and/or procedures and the desired therapeutic effect to be achieved. It will also be appreciated that the therapies employed may achieve a desired effect for the same disorder (for example, a GCS inhibitor may be administered concurrently with another anticancer agent), or they may achieve different effects (e.g., control of any adverse effects).
- therapies or anticancer agents that may be used in combination with a GCS inhibitor or pharmaceutical composition comprising a GCS inhibitor include, e.g., other anti-cancer agents, e.g., chemotherapeutic drugs, surgery, radiotherapy (e.g., ⁇ -radiation, neutron beam radiotherapy, electron beam radiotherapy, proton therapy, brachytherapy, and systemic radioactive isotopes), endocrine therapy, biologic response modifiers (e.g., interferons, interleukins),
- other anti-cancer agents e.g., chemotherapeutic drugs, surgery, radiotherapy (e.g., ⁇ -radiation, neutron beam radiotherapy, electron beam radiotherapy, proton therapy, brachytherapy, and systemic radioactive isotopes), endocrine therapy, biologic response modifiers (e.g., interferons, interleukins),
- radiotherapy e.g., ⁇ -radiation, neutron beam radiotherapy, electron beam radiotherapy, proton therapy,
- agents to attenuate any adverse effects, or combinations thereof, useful for treating a subject in need of treatment for a tumor may be administered in the same composition or separately in various embodiments. When they are administered separately, two or more agents may be given simultaneously or sequentially (in anyorder). If administered separately, the time interval between
- administration of the agents can vary.
- administration of first and second agents is performed such that (i) a dose of the second agent is administered before more than 90% of the most recently administered dose of the first agent has been metabolized to an inactive form or excreted from the body; or (ii) doses of the first and second agents are administered at least once within 8 weeks of each other (e.g., within 1. 2. 4, or 7 days, or within 2, 3, 4, 5, 6, 7, or 8 weeks of each other); (iii) the therapies are administered during overlapping time periods (e.g., by continuous or intermittent infusion); or (iv) any combination of the foregoing.
- agents may be administered individually at substantially the same time (e.g., within less than 1, 2, 5, or 10 minutes of one another).
- agents may be administered individually within less than 3 hours, e.g., less than 1 hour.
- agents may be administered by the same route of administration.
- agents may be administered by different routes of administration.
- a "regimen '" or “treatment protocol” refers to a selection of one or more agent(s), dose level(s), and optionally other aspects(s) that describe the manner in which therapy is administered to a subject, such as dosing interval, route of administration, rate and duration of a bolus administration or infusion, appropriate parameters for administering radiation, etc.
- Many cancer chemotherapy regimens include combinations of drugs that have different cytotoxic or cytostatic mechanisms and/or that typically result in different dose-limiting adverse effects.
- an agent that acts on DNA e.g., alkylating agent
- an anti- microtubule agent are a common combination found in many chemotherapy regimens.
- a regimen that has been tested in a clinical trial e.g., a regimen that has been shown to be acceptable in terms of safety and, in some embodiments, showing at least some evidence of efficacy
- a standard regimen an agent used in such a regimen may be referred to as a "standard chemotherapy agent”.
- a standard regimen or standard chemotherapy agent is a regimen or chemotherapy agent that is used in clinical practice in oncology.
- pharmaceutical agents used in a standard regimen are all approved drugs. See, e.g., DeVita, . ⁇ -. , _ e x anl pi es 0 f standard regimens.
- a GCS inhibitor is added to a standard regimen or substituted for one or more of the agents typically used in a standard regimen.
- Such combination therapies are provided herein.
- cancer chemotherapeutic agents include, e.g., alkylating and alkylating-like agents such as nitrogen mustards (e.g., chlorambucil, chlormethine, cyclophosphamide, ifosfamide, and melphalan), nitrosoureas (e.g., carmustine, fotemustine, lomustine, streptozocin);
- platinum agents e.g., alkylating-like agents such as carboplatin, cisplatin, oxaliplatin, BBR3464, satraplatin
- busulfan dacarbazine, procarbazine, temozolomide, thioTEPA, trcosulfan.
- uramustine antimetabolites such as folic acids (e.g., aminopterin.
- methotrexate pemetrexed, raltitrexed
- purines such as cladribine, clofarabine, fludarabine, mercaptopurine, pentostatin, thioguanine
- pyrimidines such as capecitabine, cytarabine, fluorouracil, floxuridine, gemcitabine
- spindle poisons/mitotic inhibitors such as taxanes (e.g., docetaxel, paclitaxel), vincas (e.g., vinblastine, vincristine, vindesine, and vinorelbine), epothilones
- cytotoxic/anti-tumor antibiotics such anthracyclines (e.g., daunorubicin, doxorubicin, epirubicin, idarubicin.
- mitoxantrone pixantrone. and valrubicin
- Streptomyces e.g., actinomycin, bleomycin, mitomycin, plicamycin
- topoisomerase inhibitors such as camptotheca (e.g., camptothecin, topotecan, irinotecan) and podophyllum ⁇ (e.g., etoposide, teniposide)
- monoclonal antibodies for cancer therapy such as anti-receptor tyrosine kinases (e.g...).
- cetuximab panitumumab, trastuzumab), anti-CD20 (e.g., rituximab and tositumomab), and others for example alemtuzumab, aevacizumab, gemtuzumab; photosensitizers such as aminolevulinic acid, methyl aminolevulinate, porfimer sodium, and verteporfln; tyrosine and/or serine/threonine kinase inhibitors, e.g., inhibitors of Abl, Kit, insulin receptor family member(s), VEGF receptor family member(s), EGF receptor family member(s), PDGF receptor family member(s), FGF receptor family member(s), mTOR.
- anti-CD20 e.g., rituximab and tositumomab
- others for example alemtuzumab, aevacizumab, gemtuzumab
- Raf kinase family phosphatidyl inositol (PI) kinases such as PI3 kinase, PI kinase-like kinase family members, cyclin dependent kinase (CDK) family members, Aurora kinase family members (e.g., kinase inhibitors that are on the market or have shown efficacy in at least one phase III trial in tumors, such as cediranib. crizotinib, dasatinib, erlotinib. gefitinib, imatinib. lapatinib.
- PI phosphatidyl inositol
- CDK cyclin dependent kinase
- Aurora kinase family members e.g., kinase inhibitors that are on the market or have shown efficacy in at least one phase III trial in tumors, such as cediranib. crizotinib, dasatinib,
- nilotinib nilotinib, sorafenib, sunitinib, vandetanib
- growth factor receptor antagonists and others such as retinoids (e.g., alitretinoin and tretinoin), altretamine, amsacrine. anagrelide, arsenic trioxide, asparaginase (e.g., pegasparagase), bexarotene, bortezomib, denileukin diftitox, "'ine, ixabepilone, masoprocol, mitotane, and testolactone, Hsp90 inhibitors.
- retinoids e.g., alitretinoin and tretinoin
- altretamine amsacrine. anagrelide
- arsenic trioxide e.g., asparaginase (e.g., pegasparagase), bexarot
- proteasome inhibitors e.g.. bortezomib
- angiogenesis inhibitors e.g., anti- vascular endothelial growth factor agents such as bevacizumab (Avastin) or VEGF receptor antagonists, matrix metalloproteinase inhibitors, various pro-apoptotic agents (e.g., apoptosis inducers), Ras inhibitors, anti-inflammatory agents, cancer vaccines, or other
- immunomodulating therapies etc. It will be understood that the preceding classification is non-limiting. A number of anti-tumor agents have multiple activities or mechanisms of action and could be classified in multiple categories or classes or have additional mechanisms of action or targets.
- a GCS inhibitor may be administered in combination with an agent that acts on or in the mitochondria.
- a GCS inhibitor may be administered to a subject in need of treatment for a tumor that has demonstrated resistance to one or more standard chemotherapy agents or regimens.
- a GCS inhibitor may be administered in combination with an agent that increases SHMT2 expression or activity.
- a GCS inhibitor is administered to a subject in need of treatment for a brain tumor, e.g., GBM, in combination with one or more compounds approved or accepted in the art as useful for treatment of brain tumors.
- a GCS inhibitor is administered to a subject in need of treatment for a brain tumor in combination with a compound selected from the group consisting of: temozolomide, cannabinoids, antiangiogenic agents (e.g., VEGFR inhibitors such as cediranib or bevacizumab), perillyl alcohol (POH) (a Ras inhibitor), and Hedgehog-Gli signaling inhibitors, e.g., Hedgehog inhibitors such as GDC-0449.
- temozolomide cannabinoids
- antiangiogenic agents e.g., VEGFR inhibitors such as cediranib or bevacizumab
- POH perillyl alcohol
- Hedgehog-Gli signaling inhibitors e.g., Hedgehog inhibitors such as G
- a sub-therapeutic dosage of any two or more agents, or a sub-therapeutic dosage of each may be used in the treatment of a subject having, or at risk of developing, cancer, in some embodiments.
- a "sub-therapeutic dose” as used herein refers to a dosage which is less than that dosage which would produce or is ordinarily considered sufficient to produce a therapeutic result in the subject if administered in the absence of at least one other agent.
- administering a GCS inhibitor in combination with a standard or experimental chemotherapy agent or regimen may result in enhanced efficacy in one or more tumor types relative to the standard or experimental chemotherapy agent or
- a GCS inhibitor, or combination of agents is formulated in unit dosage form, e.g., for ease of administration and uniformity of dosage.
- unit dosage form refers to a physically discrete unit of agent(s) appropriate for the subject to be treated.
- a unit dosage form may be a pill, tablet, or other discrete dosage form for oral administration, or a pre 1 1 led syringe or an ampoule or other vessel containing an amount of a liquid composition appropriate for a single administration, etc.
- pharmaceutically acceptable carrier(s) employed in a pharmaceutical composition comprising a GCS inhibitor and, optionally, one or more other active agents, is/are typically used at a concentration sufficient to provide a practical size to dosage relationship.
- the pharmaceutically acceptable carrier(s), in total may comprise, for example, from about 50% to about 99.99999% by weight of the pharmaceutical compositions, e.g., from about 80% to about 99.99%, e.g., from about 90% to about 99.95%, from about 95% to about 99.9%, or from about 98% to about 99%, in certain embodiments.
- a GCS inhibitor may be administered locally to a tissue or organ in which cancer cells are or may be present or that is at increased risk of developing a tumor.
- local administration is accomplished by, e.g., direct injection into or in close proximity to the tissue or organ or into a blood vessel that directly supplies or traverses the tissue or organ or by implanting a sustained release implant within or in close proximity to the tissue or organ or by using a pump or other drug delivery device to deliver a composition into or in close proximity to a tissue or organ.
- regional perfusion in which the portion of the systemic circulation containing a tumor is temporarily isolated from the rest of the circulation, may be used.
- an agent is administered into a body cavity or space from which a tumor has been removed or that is in fluid communication with asite from which a tumor has been removed.
- a body cavity or space can be, for example, the peritoneal cavity, intrathecal space, or bladder.
- an agent is administered directly into or in close proximity to a tumor.
- an agent is locally administered during surgery, e.g., to a tissue or organ or body cavity or space containing a tumor or from which a tumor has been removed.
- "in close proximity" typically refers to within 25 cm or less. e.g.. within 20 cm or less, e.g., within 10 cm or less, e.g., within 5 cm or less.
- administration may be self-administration or directing administration.
- a GCS inhibitor is administered using a virus vector.
- a virus vector suitable for administration to a subject may be used.
- the vector has tropism for tumor cells.
- a sustained release implant may be implanted at any suitable site.
- a sustained release implant may be used to treat a subject at risk of developing a recurrence of cancer.
- a sustained release implant may deliver therapeutically useful levels of an active agent for at least 14 days, e.g., at least 30 days, e.g., at least 60 days, e.g., up to 3 months, 6 months, or more.
- inhaled compositions may be of use to achieve local delivery to the lung in, for example, lung cancer patients.
- metered dose inhalers are regularly used for administration by inhalation. These types of devices include metered dose inhalers (MDI), breath-actuated MDI, dry powder inhaler (DPI), spacer/holding chambers in combination with MDI, and nebulizers.
- MDI metered dose inhalers
- DPI dry powder inhaler
- spacer/holding chambers in combination with MDI spacer/holding chambers in combination with MDI
- nebulizers nebulizers.
- an inhaled composition may be used for systemic delivery, wherein an agent is absorbed across the respiratory epithelium, enters the circulatory system, and is transported in the blood so as to reach one or more sites in the body, e.g., one or more sites that harbors or may harbor a tumor or tumor cells.
- intranasal compositions may be used, e.g., for treatment of intranasal tumors.
- intranasal compositions may be used for local delivery to the central nervous system (e.g., the brain), for example to treat a subject in need of treatment for a brain tumor.
- intranasal compositions may be used for systemic delivery, wherein anagent is absorbed across the nasal mucosa, enters the circulatory system and is transported in the blood so as to reach one or more sites in the body, e.g., one or more sites that harbors or may harbor a tumor or tumor cells.
- osmotic blood brain barrier (BBB) disruption may be used to enhance delivery of a therapeutic agent to the brain for treatment of a brain tumor or a metastasis to the brain.
- Osmotic BBB disruption typically involves placement of an intraarterial catheter and infusion of a hyperosmolar solution such as 25% mannitol into an artery that supplies the brain, followed by infusion of the therapeutic agent.
- An internal (implantable) or external (extracorporeal) pump may be used for adminstration in some embodiments.
- Such pumps typically include a drug reservoir from which continuous or intermittent release occurs into the target tissue or in the vicinity thereof via a catheter.
- ' 1 end coupled to the pump and having a discharge portion for infusing therapeutic dosages of an agent into a selected infusion site in an organ or tissue or space within the body such as the spinal canal is used.
- the pump may be programmed to release predetermined amounts of the agent at predetemined time intervals.
- a catheter attached to the pump may be implanted so that the discharge portion lies in the brain parenchyma.
- U.S. Pat. No. 6,263,237 describes exemplary pump and catheter systems and methods for implanting them into the body of a subject and directing the administration of an agent to a desired location in the brain.
- convection-enhanced delivery is used to deliver an agent to a selected location, e.g., in the brain.
- CED utilizes an applied external pressure gradient to induce fluid convection into target tissue such as the brain or a tumor.
- a controlled pressure source in stream with a fluid reservoir ensures operation at constant pressure.
- Fluid is typically administered via a small catheter using a pump, e.g., at pressures up to about 70 mm I I g to drive convective flow.
- Micro fabricated silicon probes having an outlet along an axis perpendicular to the insertion direction can be used to improve delivery. See, e.g., Sawyer, AJ, New methods for direct delivery of chemotherapy for treating brain tumors, Yale J Biol Med. (2006) 79(3-4): 141-52, and references therein.
- U.S. Pat. Pub. No. 20040215173 describes exemplary apparatus that may be used to administer agents into tissues and/or tumors by convection enhanced delivery.
- an agent is delivered to one or more of the CSF-containing chambers of the central nervous system, e.g., any one or more of the ventricles or the cisterna magna.
- the catheter may be implanted so that the discharge portion lies in the ventricle or the cistern magna, respectively.
- the agent typically at least in part diffuses out of the ventricle or cisterna magna.
- delivery to these locations can thus allow delivery of the agent to a relatively wide area of the brain rather than localizing it more closely to a specific site although of course such methods can be used for tumors of the ventricles or cistern magna (e.g., ependymal tumors).
- delivery to a CSF-containing space is accomplished by surgically implanting a catheter through the skull so that the tip has access to the space. The other end of the catheter is then connected to a reservoir (e.g.. an Ommaya reservoir), which is placed beneath the scalp (subcutaneously).
- a reservoir e.g. an Ommaya reservoir
- a GCS inhibitor is administered directly to the brain in an implant.
- a GCS inhibitor may be incorporated into an implantable,
- the GLIADEL® Wafer which is used to administer carmustine is an example of such an implant, in which the polyanhydride copolymer polifeprosan 20, consisting of poly[bis(p-carboxyphenoxy) propane: sebacic acid in a 20:80 W
- a substantially non-biodegradable polymer such as polyethylene-co-vinyl acetate (EVAc) can be used to produce an implant that may be removed once release of the therapeutic agent falls below a selected level (e.g., a
- an active agent e.g., a GCS inhibitor
- a salt should be pharmaceutically acceptable, but non- pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically- acceptable salts thereof and are not excluded.
- Pharmaceutically-acceptable salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, maleic, acetic, salicylic, citric, formic, malonic, succinic, and the like.
- pharmaceutically-acceptable salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts.
- agents can be provided as a pharmaceutically acceptable pro-drug.
- an active metabolite can be used.
- agents may be modified, e.g., with targeting ligands, moieties that increase their uptake, moieties that increase their biological half-life (e.g., pegylation), e.g., as described above.
- a GCS inhibitor is administered in a preparation that provides sustained and/or delayed release in the gastrointestinal tract.
- a coated oral dosage form may be used to provide sustained and/or delayed release, wherein the coating at least in part surrounds acore that contains an active agent and controls the location in the digestive system where the active agent is released.
- an oral dosage form comprising an enteric coating is used, wherein the enteric coating remains substantially intact in the stomach but dissolves and releases the drug once the small intestine is reached. See. e.g., PCT/US2007/O02325 (Enterically coated cystamine, cysteamine and derivatives thereof, published as WO/2007/089670), for non-limiting example of enteric coatings.
- a dosage form comprising an enteric coating may be used, e.g., to administer cysteamine. a cysteamine salt, a cysteamine derivative, or other GCS inhibitor.
- an enteric coating may protect the active agent from the gastric environment, promote conversion of a prodrug to an active agent, or promote
- an agent e.g.. a GCS inhibitor
- a particle comprises a microparticle or nanoparticle or a liposome.
- microparticle may be used interchangeably with microcapsule, microsphere, microcarrier, and like terms.
- nanoparticle may be used
- an agent is physically associated with a medical device such as a stent, shunt, or catheter.
- a medical device such as a stent, shunt, or catheter.
- an agent may be associated with a coating of such a device.
- an agent is physically associated with a gel which, in some
- a hydrogel may be a hydrogel.
- an agent is physically associated with a film.
- a physical association is a noncovalent association.
- an agent may be incorporated into or encapsulated by a matrix.
- a physical association comprises a covalent bond.
- an agent may be covalently attached to a particle or a coating of a medical device.
- an active agent may be released at least in part as a result of diffusion out of a matrix or breakdown of at least a portion of the matrix.
- a matrix may be at least somewhat permeable to the agent. Breakdown may occur due to physical forces, chemical degradation (e.g., spontaneous hydrolysis, enzymatic cleavage), etc.
- the matrix may disintegrate or dissolve over time or may become less dense.
- a particle, gel, film, or coating comprises a biocompatible polymer.
- a biocompatible polymer is biodegradable.
- a number of artificial (non-naturally occurring) or naturally occurring biocompatible polymers are known in the art of drug delivery and may be used in various embodiments.
- a polymer is an organic polymer. Examples of organic polymers include polylactides, polyglycolides, polylactide-co-glycolides, polycaprolactones, polyethylenes. polyethylene glycols, polycarbonates, polyanhydrides (e.g.
- celluloses starches, polysaccharides), polypeptides.
- a polysaccharide comprises a chitosan, alginate, dextran, or cyclodextrin.
- a polypeptide comprises a collagen or albumin.
- a polymer is a derivative or variant lolymer.
- derivatives of a first polymer include polymers having substitutions, additions o chemical groups, or other modifications known to those of ordinary skill in the art.
- a polymer derivative comprises a modification of a pendant group or side chain of a first polymer.
- a polymer derivative comprises the same backbone chain as a first polymer but differs with regard to at least some pendant groups or side chains.
- a derivative may be synthesized at least in part by modifying a first polymer.
- a derivative may be synthesized at least in part by polymerization of appropriate monomers.
- a polymer comprises a hydrophilic polymer
- a polymer may be a homopolymer or a copolymer comprising two or more different monomers.
- a copolymer may be a random polymer, block polymer, or may comprise a combination of random and block sequences in various embodiments.
- a polymer may be linear or branched in various embodiments.
- a polymer may be crosslinked.
- a polymer may be a graft polymer.
- a polymer may be a comb or brush polymer, star polymer, or dendrimer in various embodiments.
- a polymer may comprise a blend of two or more polymers.
- a wide variety of methods for obtaining polymers (e.g., by synthesis or obtaining from natural sources) and for forming matrices therefrom are known in the art and may be used in various embodiments.
- Methods for making microparticles and nanoparticles are known in the art. Exemplary methods include, e.g., spray drying, phase separation, single and double emulsion, solvent evaporation, solvent extraction, and simple and complex coacervation.
- Particulate polymeric compositions may, for example, be made using techniques such as milling, granulation, extrusion, spheronization, or precipitation. See, e.g., U.S. Patent Publication Nos. 20040092470; 20050181059 and references in any of the foregoing for examples of various techniques and materials that may be of use to produce particles comprising an active agent.
- a preformed implant may be made by introducing a liquid
- polymerization, cross-linking, or gelation occurs to form a semi-solid or solid structure.
- appropriate ' ' ' '' " include the presence of a suitable concentration of an ion, salt, cross-linking agent, or polymerization initiator, which may be added either prior to or following the introduction of the liquid into the mold.
- appropriate conditions include applying heat or pressure.
- an implant may be formed at least in part by compressing dry or solid particles, optionally while exposing them to heat.
- an implant may be formed at least in part by evaporation or sublimation of a solvent from a composition.
- a mold may be, e.g., any article that contains a cavity, well, space, or depression of suitable shape and dimensions into which a liquid can be introduced.
- a liquid composition used for forming an implant comprises an active agent.
- the active agent may, for example, become entrapped during formation of the implant.
- an implant may be produced and subsequently impregnated or at least in part coated with an active agent.
- a drug delivery system that provides a selected rate or amount of release of an active agent may be empirically determined at least in part by formulating multiple compositions, for example, with varying sizes or proportions of active agent and other component(s). and performing suitable tests of dissolution or release.
- a particle may be substantially uniform in composition or may be heterogenous in composition.
- a particle comprises a core and one or more outer layers (which may be termed shell(s)), wherein the core and outer layer(s) may differ in
- the agent is substantially contained in a core. In some embodiments, the agent is substantially contained outside the core.
- an active agent may be at least in part encapsulated in a particle (e.g., contained within a hollow, liquid, semi-solid, or solid core) or may be dispersed substantially throughout a matri or may be present within or attached to a coating layer.
- a liquid core may comprise an aqueous carrier such as water, an organic solvent, or a lipid, in various embodiments.
- a film or coating may comprise a single layer or may comprise multiple layers. The layers of a multi-layer film or coating may differ in composition.
- an active agent is contained substantially in one or more layers at least prior to use for delivering the active agent, e.g., prior to administration to a subject.
- a particle may be modified, e.g., by covalent or noncovalent attachment of. or
- a particle is modi ied by attachment of a polymer thereto, such as polyethylene glycol (PEG) or a derivative thereof.
- a particle may have a targeting moiety attached thereto or incorporated therein. A targeting moiety may already be exposed at the surface of the particle at the time the particle is administered to a subject or may become exposed following administration.
- a targeting moiety may, e.g., enhance localization of the particle at a particular location in the body (e.g., a site at which a tumor exists or is suspected to exist or is prone to metastasize) or a site from which a tumor has been removed, enhance localization of the particle to particular cells (e.g., tumor cells), enhance cell uptake, etc.
- a targeting moiety may be covalently attached to a material from which the particle is at least in part comprised, may be admixed with a material during formation of the particle, may be applied to the particle in or as part of a coating layer, etc.
- a microparticle has a diameter or longest dimension of 500 microns ( ⁇ ) or less, e.g., between 50 ⁇ and 500 ⁇ , between 20 ⁇ and 50 ⁇ , between 1 ⁇ ⁇ ⁇ and 20 ⁇ ⁇ ⁇ . e.g., between 1 ⁇ and 10 ⁇ .
- a nanoparticle has a diameter or longest dimension of 1 ⁇ (1000 nm) or less, e.g., between 1 nm and 100 nm, between 100 nn and 200 nm, between 200 nm and 500 nm, or between 500 nm and 1000 nm.
- a film or coating has a thickness of 500 microns ( ⁇ ) or less, e.g.. between 50 ⁇ and 500 ⁇ , between 20 ⁇ and 50 ⁇ . between 1 ⁇ and 20 ⁇ , e.g., between 1 ⁇ and 10 ⁇ .
- a particle may be composed at least in part of one or more lipids.
- Liposomes for example, which may comprise phospholipids or other lipids, are nontoxic, physiologically acceptable carriers that may be used in some embodiments.
- Liposomes can be prepared according to methods known to those skilled in the art. In some embodiments, for example, liposomes may be prepared as described in U.S. Pat. No.
- Liposomes including targeted liposomes, pegylated liposomes, and polymerized liposomes, are known in the art (see, e.g., Hansen C B, et al, Biochim Biophys Acta.
- a lipid-containing lay be prepared as described in any of the following PCT application publications, or references therein: WO/201 1 /127255; WO/2010, 080724: WO/2010/021865;
- a component of a delivery system has been approved for use in humans by a government agency responsible for regulating the manufacture, marketing, sale, and/or use of therapeutic agents (e.g., pharmaceutical agents), such as the U.S. Food & Drug Administration (FDA), European Medicines Agency (EMA), or similar agency in another country or jurisdiction.
- therapeutic agents e.g., pharmaceutical agents
- FDA U.S. Food & Drug Administration
- EMA European Medicines Agency
- a component of a delivery system has been approved for use in veterinary medicine.
- a component of a delivery system is generally recognized as safe (GRAS) by the U.S. FDA.
- a pharmaceutical pack or kit containing a GCS inhibitor or composition comprising a GCS inhibitor is provided.
- the GCS inhibitor is in a powdered or other solid form.
- the GCS inhibitor or composition which may be in powdered or solid form, may be mixed with a pharmaceutically acceptable carrier prior to administration.
- the pack or kit further contains a separately packaged pharmaceutically acceptable carrier or composition for mixing prior to
- a pharmaceutical pack or kit contains one or more GCS inhibitors and one or more additional agents for treatment of cancer.
- the agents may be packaged separately or together.
- the kit may include instructions for use of the medication.
- the kit includes multiple doses of each agent.
- the kit may include sufficient quantities of each agent to treat a subject for, e.g.. a week, two weeks, three weeks, four weeks, or multiple months, e.g.. 2-6 months.
- the kit may include a full cycle of chemotherapy. In certain embodiments, the kit includes multiple cycles of chemotherapy.
- An agent or pharmaceutical composition may be provided in a container having a label affixed thereto, wherein the label has been approved by a government agency responsible for regulating the manufacture, marketing, sale, and/or use of pharmaceutical agents and/or a pharmaceutical composition may be packaged with a package insert approved by such an agency that contains information relevant to the pharmaceutical composition, such as a description of its contents, description of its use in a method of the invention, etc.
- information comprises instructions for use of the composition to treat a
- a label, package insert, or instructions may recommend or specify that a GCS inhibitor or pharmaceutical composition comprising a GCS inhibitor should be used in conjunction with an appropriate diagnostic test, which may be referred to as a "companion diagnostic", to determine, e.g., whether a patient is a suitable candidate for treatment with the GCS inhibitor or pharmaceutical composition comprising the GCS inhibitor.
- a companion diagnostic test provides an assessment of the expression or activity of SHMT2.
- a reagent or kit for performing the diagnostic test may be packaged or otherwise supplied with a GCS inhibitor or
- a GCS inhibitor or pharmaceutical composition comprising a GCS inhibitor may be approved by a government regulatory agency (such as the US FDA, the European Medicines Agency (EMA), or government agencies having similar authority over the approval of therapeutic agents in other jurisdictions) e.g., allowed to be marketed, promoted, distributed, sold or otherwise provided commercially, for treatment of humans or for veterinary purposes, with the recommendation or requirement that the subject is determined to be a suitable candidate for treatment with the GCS inhibitor based at least in part on assessing the level of SHMT2 expression or SHMT2 activity in a tumor of the subject to be treated or in a tumor sample obtained from the subject.
- a government regulatory agency such as the US FDA, the European Medicines Agency (EMA), or government agencies having similar authority over the approval of therapeutic agents in other jurisdictions
- EMA European Medicines Agency
- the approval may be for an "indication" that includes a requirement that a subject or tumor or tumor sample be classified as having high levels or increased levels of SHMT2 expression or SHMT2 activity.
- a requirement or recommendation may be included in, e.g., a package insert or label provided with the GCS inhibitor or pharmaceutical composition.
- a particular method for detection or measurerement of an SHMT2 gene product or of SHMT2 activity or a specific test reagent (e.g., an antibody that binds to SHMT2 polypeptide or a probe that hybridizes to SHMT2 mRNA) or kit may be specified.
- test reagent, or kit may have been used in a clinical trial the results of which at least in part formed the basis for approval of the GCS inhibitor or pharmaceutical composition. In some embodiments the method, test reagent, or kit may have been validated as providing results that correlate with outcome of treatment with a GCS inhibitor or pharmaceutical composition comprising a GCS inhibitor.
- a GCS inhibitor is an agent that has previously (i.e.. prior to the present invention) been administered to a subject (e.g., a human) in need of " ⁇ ⁇ " for cancer for a purpose other than treating cancer ("other purpose"), e.g..
- a subject in need of treatment for cancer may be one to whom the agent would normally be administered for such other purpose; or (ii) the GCS inhibitor may be administered to treat cancer in a composition or combination distinct from that known in the art to be useful for such other purpose or using a dose or route of administration or targeting approach distinct from that known in the art to be useful for such other purpose ; and/or (iii) the GCS inhibitor may be administered based at least in part on results of a test that determines whether the tumor is or is likely to be sensitive to GCS inhibition, e.g., an SHMT2-based assay.
- An SHM ' 1 2-based assay may comprise any assay of the expression or activity of SHMT2.
- any of the methods of treatment with a GCS inhibitor may further comprise treatment with an agent that is useful for treating NKH.
- Treatment of NKH may include (i) reduction of plasma concentration of glycine through treatment with sodium benzoate and/or (ii) blocking of glycinergic receptors, most commonly at the N-methyl D- aspartate (NMDA) receptor site.
- NMDA N-methyl D- aspartate
- Benzoate is used by the liver to conjugate glycine for excretion, and its administration results in decreased plasma glycine levels.
- determining the level of SHMT2 gene expression or SHMT2 gene copy number in a sample obtained from the tumor comprises providing a tumor sample to a testing facility.
- a method comprises: providing to a testing facility (a) a sample (e.g., a tumor sample) obtained from a subject; and (b) instructions to perform an SI IMT2-based assay.
- the method further comprises receiving a result of the assay and, optionally, treating a subject or selecting a treatment for a subject based at least in part on the result.
- a method comprises: (a) providing to a testing facility a sample, e.g., a tumor sample, obtained from a subject; and (b) receiving results of an SHMT2 -based assay.
- a method comprises: (a) providing to a testing facility a sample, e.g., a tumor sample, obtained from a subject; and (b) receiving results of an assay for sensitivity to a GCS inhibitor.
- "providing " to a testing facility encompasses directly providing, arranging for or directing or authorizing another individual or entity to provide, etc.
- providing encompasses entering an order for an assay into an electronic ordering system, e.g., of a health care facility.
- a method comprises providing, e.g.. electronically, a result of an SH T2-based assay or other assay for sensitivity to a GCS inhibitor.
- the assay may be performed at a ' ⁇ ' ⁇ "' ⁇ ' " ⁇ ⁇ ⁇ ;ility that is remote from (e.g.. at least 1 kilometer away from) the site where the sample is obtained from a subject.
- an SHMT2 -based assay or other assay for sensitivity to a GCS inhibitor is performed at one or more central testing facilities, which may be qualified or accredited (e.g., by a national or international organization which, in some embodiments, is a government organization or a professional organization) to perform the assay and, optionally, provide a result, e.g., a report comprising a result.
- a result may comprise one or more scores and/or a narrative description.
- a sample may be sent to the laboratory, and a report comprising a result of the assay, optionally together with an interpretation, is provided to a requesting individual or entity.
- a result is provided in an electronic format; optionally a paper copy is provided instead of or in addition to an electronic format.
- a result is provided at least in part by entering the result into a computer, e.g., into a database, electronic medical record, etc., wherein it may be accessed by or under direction of a requestor.
- a result is provided at least in part over a network, e.g., the Internet. It is contemplated that samples and/or results may be transmitted through one or more different entities or individuals, which may carry out one or more steps of a method or assay or may transmit or receive results thereof. All such activities and intermediate steps thereof and methods of implementation are individually and in combination within the scope of the present disclosure.
- kits comprise at least one reagent useful for identifying a tumor cell or tumor that is sensitive to GCS inhibition and/or useful for assessing the likelihood that a tumor cell or tumor is sensitive to GCS inhibition.
- a kit may be referred to herein for convenience as a "diagnostic kit”.
- the kit contains an agent that useful for classifying a tumor or tumor cell based on expression of SHMT2 or based on SI 1 M l 2 gene copy number. F or example, the agent is of use to detect an SHMT2 gene or an SHMT2 gene product, e.g.. SI IMT2 mRNA or polypeptide.
- the agent is a nucleic acid, e.g., a probe or primer, that specifically hybridizes to SHMT2 DNA or mRNA or its complement.
- the agent is an antibody (primary antibody) or other agent that specifically binds to SHMT2 polypeptide.
- a kit further comprises: (a) a detection reagent such as a secondary antibody that binds to a primary antibody, or a substrate, for use in an assay to detet an SHMT2 gene product; (b) one or more control agents (e.g., a probe or primer that does not !
- kits comprises liquid composition (or components thereof) useful for performing cell lysis, antigen retrieval, staining, or for performing or stopping an enzymatic reaction or washing a sample.
- the liquid composition may contain, for example, a buffer substance, a monvalent or divalent cation (e.g., as a salt), water, etc.
- a kit is of use to perform IHC.
- the kit is ELISA assay kit.
- a diagnostic kit comprises a label or package insert indicating that the kit has been cleared or approved by a government agency responsible for or having jurisdiction over regulation of diagnostic tests, devices, health care products, or the like, for use in a method described herein.
- a government agency is the US Food & Drug Administration (FDA) or a national or regional regulatory agency in a region or country other than the US that has similar responsibilities or authority with regard to regulating diagnostic tests, devices, health care products, or the like.
- FDA US Food & Drug Administration
- a system is adapted or programmed to carry out an assay for measuring expression or activity of SHMT2.
- the system may include one or more instruments (e.g., a PCR machine), an automated cell or tissue staining apparatus, a device that produces, records, or stores images, and/or one or more computer processors.
- the system may be programmed with parameters that have been selected for detection and/or quantification of an SHMT2 gene product, e.g., in tumor samples.
- the system may be adapted to perform the assay on multiple samples in parallel and/or may have appropriate software to provide an interpretation of the result.
- the system may comprise appropriate input and output devices, e.g., a keyboard, display, printer, etc.
- a kit may comprise instructions for use.
- instructions comprise written or illustrative material, e.g., in a paper or electronic format (e.g., on a computer-readable medium).
- Instructions may comprise directions for performing an assay and/or for interpreting results, e.g., in regard to tumor classification or treatment selection or GCS inhibition.
- a kit may contain an image of stained cells or tissue sections illustrating examples that are useful for interpreting the results obtained using an antibody to predict sensitivity to GCS inhibition or identify a sensitive tumor. For example, the images may show cells or tissues that would be considered "positive” or "negative” for n of the target of SHMT2 or that would be assigned a numerical score indicative of a level of expression of SHMT2.
- kits may comprise an article that can serve as a reference standard or control.
- a kit may comprise an antibody that does not bind to SHMT2 to serve as a negative control.
- a kit comprises ingredients for an assay of use to identify an inhibitor of the GCS.
- the kit comprises any one or more GCS components or expression vectors suitable for producing one or more GCS components.
- a kit comprises a detection reagent, a control reagent, or at least one additional reagent suitable for performing an assay.
- Articles in a kit may be individually packaged or contained in individual containers, which may be provided together in a larger container such as a cardboard or styrofoam box.
- one or more reagents or a kit may meet specified manufacturing and/or quality control criteria, e.g., consistency with good manufacturing practices.
- Example 1 shRNA-mediated knockdown of GLDC is toxic to GBM stem cells
- Cancer cells frequently display changes in various metabolic activities which play a role in supporting their transformed state. For example, many types of cancer cells employ increased glycolysis through altered pyruvate kinase isoform expression, which may allow glucose metabolites to be preferentially incorporated towards biomass in a manner conducive to rapid growth (1, 2).
- isocitrate dehydrogenase ID! 1 1
- L-2-hydroxyglutarate dehydrogenase may predispose to GBM or medulloblastoma (5, 6).
- Example 2 shRNA-mediated knockdown of GLDC is toxic to GBM stem cells
- GBM-SC GBM stem cell line BT145.
- BT145 cells were either infected with a lentivirus expressing hairpins targeting GLDC (Gl to G5) or a control hairpin targeting GFP.
- GBM-SC GBM stem cell
- BT145 cells were either infected with a lentivirus expressing hairpins targeting GLDC (Gl to G5) or a control hairpin targeting GFP.
- FIG. 1A Western blotting for GLDC demonstrates strong suppression of GLDC expression for hairpins Gl, G4, and G5 but not for G2 or G3.
- lentivirus-delivered expression of three shRNAs directed against GLDC - Gl, G4, and G5- were each toxic to the GBM-SC line BT145, and each
- shRNAs G2 lly minimally lowered GLDC expression and were not toxic to ⁇ 45 cells.
- Gl CGAGCC l ACTTAAACCAGAAA (SEQ ID NO: I )
- G2 CCTGCCAACATCCGTTTGAAA (SEQ ID NO: 2)
- G3 CCACGGAAACTGCGATATTAA (SEQ ID NO: 3)
- G4 GCCACTGGGAAAGAAGTGTAT (SEQ ID NO: 4)
- G5 GAAGTTTATGAGTCTCCATTT (SEQ ID NO: 5)
- Example 3 Different tumor cell lines are either sensitive or resistant
- Example 5 Inhibition of glycine cleavage system protein H (GCSH) impairs the viability of cell lines in the GLDC-knockdown-sensitive group
- GCSH glycine cleavage system protein H
- GS 1 CGTTGGGAGATGTTGTTTATT (SEQ ID NO: 6)
- GS2 GTGCGTAAATTCACAGAGAAA (SEQ ID NO: 7)
- GS3 GTGAACTCTATTCTCCTTTAT (SEQ ID NO: 8)
- GS4 GATGAACTTATGAGTGAAGAA (SEQ ID NO: 9)
- knockdown/inhibition sensitive cells expressed high levels of SHMT2, while insensitive cells had low levels.
- Example 7 Knockdown of SHMT2 greatly reduces sensitivity to GLDC knockdown.
- Figure 5D shows cell viability of BT145 cells stably infected with SHMT2 or GFP shRNAs (labeled on X axis), then secondarily infected with Gl shRNA.
- Dotted line indicates the level of cell viability of cells initially expressing GFP shRNAs then infected with Gl for 7 days. Viability is expressed as a % of the viability when each stable line was secondarily infected with GFP shRNAs, which was set at 100%. Similar rescue was obtained for SHMT2 shRNA-expressing cells secondarily infected with G4 or G5 hairpin (data not shown). Similar results were obtained for BT1 12 GBM-SC line and LN229 and U25 1 GBM-derived cell lines (data not shown).
- Figure 5E shows representative light micrographs of neurospheres initially expressing either GFP or S3 shRNAs then secondarily infected with Gl, G4, or G5 shRNAs.
- Gl, G4, or G5 infection of shGFP-expressing cells results in small, disintegrating neurospheres indicative of cell death, while cells expressing S3 are protected. Similar results were observed for initial infection of S I . S2, or S5.
- S2 CGGAGAGTTGTGGAC rn ATA (SEQ ID NO: 1 1 )
- Example 8 SHMT2 mRNA expression is significantly elevated in many different cancer types [00307]
- SHMT2 mRNA levels are significantly elevated in a large number of cancers, relative to normal tissue controls, and in most cases SHMT2 was within the top 1% of overexpressed genes in that particular cancer (Table 1).
- Table 1 SIIMT2 transcripts are significantly elevated in a number of cancers, as analyzed with Oncomine (www.oncomine.com).
- 'PMID' indicates the PubMed reference ID number for the study in which the microarray data is published.
- 'Fold' indicates fold change over corresponding normal tissue.
- 'Rank %' indicates the percentile in which SHMT2 placed among cancer-upregulated genes in that particular comparison.
- Example 9 SHMT2 protein expression is elevated in GBM.
- SHMT2 appeared to be highly expressed in most, if not all, tumor cells, at a level per cell that was dramatically higher than seen in the astrocytes.
- mitochondrial methylenetetrahydrofolate dehydrogenase-cyclohydrolase supports a role in rapid cell growth. Biochim Biophys Acta 1674, 78-84 (2004).
- Embodiments or aspects herein may be directed to any agent, composition, article, kit, and/or method described herein. It is contemplated that any one or more embodiments or Docket No. WIBR-127-W01
- any method of treatment may comprise a step of providing a subject in need of such treatment.
- Any method of treatment may comprise a step of providing a subject having a disease for which such treatment is warranted.
- Any method of treatment may comprise a step of diagnosing a subject as being in need of such treatment.
- Any method of treatment may comprise a step of diagnosing a subject as having a disease for which such treatment is warranted.
- “About” in reference to a numerical value generally refers to a range of values that fall within ⁇ 10%, in some embodiments ⁇ 5%, in some embodiments ⁇ 1%, in some embodiments ⁇ 0.5% of the value unless otherwise stated or otherwise evident from the context. In any embodiment in which a numerical value is prefaced by “about”, an embodiment in which the exact value is recited is provided. Where an embodiment in which a numerical value is not prefaced by “about” is provided, an embodiment in which the value is prefaced by “about” is also provided. Where a range is preceded by "about " ,
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Pathology (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Pharmacology & Pharmacy (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Epidemiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Physics & Mathematics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Cell Biology (AREA)
- Food Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Engineering & Computer Science (AREA)
- Radiology & Medical Imaging (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Toxicology (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
Priority Applications (9)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2013216703A AU2013216703A1 (en) | 2012-02-10 | 2013-02-11 | Inhibition of the glycine cleavage system for treatment of cancer |
| EP13746071.3A EP2811991A4 (en) | 2012-02-10 | 2013-02-11 | INHIBITION OF THE GLYCIN CLEAVAGE SYSTEM FOR THE TREATMENT OF CANCER |
| CA2864161A CA2864161A1 (en) | 2012-02-10 | 2013-02-11 | Inhibition of the glycine cleavage system for treatment of cancer |
| JP2014556787A JP2015509489A (ja) | 2012-02-10 | 2013-02-11 | がんの処置のためのグリシン開裂系の阻害 |
| NZ630026A NZ630026A (en) | 2012-02-10 | 2013-02-11 | Inhibition of the glycine cleavage system for treatment of cancer |
| US14/377,470 US9493775B2 (en) | 2012-02-10 | 2013-02-11 | Inhibition of the glycine cleavage system for treatment of cancer |
| SG11201404779TA SG11201404779TA (en) | 2012-02-10 | 2013-02-11 | Inhibition of the glycine cleavage system for treatment of cancer |
| IL234046A IL234046A0 (en) | 2012-02-10 | 2014-08-10 | Inhibition of the glycine cleavage system for treatment of cancer |
| ZA2014/06124A ZA201406124B (en) | 2012-02-10 | 2014-08-20 | Inhibition of glycine cleavage system for treatment of cancer |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201261597550P | 2012-02-10 | 2012-02-10 | |
| US61/597,550 | 2012-02-10 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2013120086A1 true WO2013120086A1 (en) | 2013-08-15 |
Family
ID=48948101
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2013/025601 Ceased WO2013120086A1 (en) | 2012-02-10 | 2013-02-11 | Inhibition of the glycine cleavage system for treatment of cancer |
Country Status (10)
| Country | Link |
|---|---|
| US (1) | US9493775B2 (https=) |
| EP (1) | EP2811991A4 (https=) |
| JP (1) | JP2015509489A (https=) |
| AU (1) | AU2013216703A1 (https=) |
| CA (1) | CA2864161A1 (https=) |
| IL (1) | IL234046A0 (https=) |
| NZ (1) | NZ630026A (https=) |
| SG (1) | SG11201404779TA (https=) |
| WO (1) | WO2013120086A1 (https=) |
| ZA (1) | ZA201406124B (https=) |
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016085990A1 (en) * | 2014-11-24 | 2016-06-02 | The Regents Of The University Of Michigan | Compositions and methods relating to inhibiting serine hyrdoxymethyltransferase 2 activity |
| JP2017502686A (ja) * | 2013-11-06 | 2017-01-26 | アメリカ合衆国 | 発現プロファイリングによりリンパ腫のタイプをサブタイピングするための方法 |
| WO2017212249A1 (en) * | 2016-06-07 | 2017-12-14 | Novabiotics Limited | Microparticles comprising a sulphur-containing compound |
| WO2018080393A1 (en) * | 2016-10-28 | 2018-05-03 | Agency For Science, Technology And Research | Antisense oligonucleotides |
| WO2019057995A1 (en) * | 2017-09-25 | 2019-03-28 | INSERM (Institut National de la Santé et de la Recherche Médicale) | USE OF VNN1 AS A BIOMARKER AND THERAPEUTIC TARGET IN SARCOMES |
| US10287331B2 (en) | 2013-04-15 | 2019-05-14 | Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. | Mitochondrial proteins constructs and uses thereof |
| US10905660B2 (en) | 2016-06-07 | 2021-02-02 | Novabiotics Limited | Microparticles |
| RU2780397C2 (ru) * | 2016-06-07 | 2022-09-22 | НоваБиотикс Лимитед | Микрочастицы, содержащие серосодержащие соединения |
| CN115590945A (zh) * | 2022-08-19 | 2023-01-13 | 北京市肿瘤防治研究所(Cn) | 一种用于治疗肿瘤的多肽及其应用 |
| IL263540B1 (en) * | 2016-06-07 | 2023-03-01 | Novabiotics Ltd | Microparticles that include a sulfur-containing compound |
| US12576050B2 (en) | 2018-10-17 | 2026-03-17 | Novabiotics Limited | Dosage regime |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8741591B2 (en) | 2009-10-09 | 2014-06-03 | The Research Foundation For The State University Of New York | pH-insensitive glucose indicator protein |
| WO2012064286A1 (en) * | 2010-11-11 | 2012-05-18 | Agency For Science, Technology And Research | Targeting metabolic enzymes in human cancer |
| US10733023B1 (en) * | 2015-08-06 | 2020-08-04 | D2Iq, Inc. | Oversubscription scheduling |
| WO2017156362A1 (en) | 2016-03-11 | 2017-09-14 | President And Fellows Of Harvard College | Modulating t cell survival by targeting the one-carbon metabolic pathway |
| US11576871B2 (en) | 2016-11-16 | 2023-02-14 | The Regents Of The University Of California | Formulations of cysteamine and cystamine |
| EP3691630A4 (en) * | 2017-10-06 | 2021-10-27 | Rush University Medical Center | USE OF A COMPOSITION CONTAINING BENZOATE TO TREAT GLYCINE ENCEPHALOPATHY |
| US12478684B2 (en) | 2019-04-11 | 2025-11-25 | Northeastern University | Oligonucleotide-polymer miktoarm conjugates and methods of use |
| US11162102B2 (en) | 2019-05-13 | 2021-11-02 | Dna Twopointo Inc. | Modifications of mammalian cells using artificial micro-RNA to alter their properties and the compositions of their products |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000066110A1 (en) * | 1999-04-29 | 2000-11-09 | Merck Patent Gmbh | Glycine cleavage system inhibitors as potential antipsychotics |
| WO2004024129A1 (en) * | 2002-09-10 | 2004-03-25 | Samir Chachoua | Induced remission therapy |
| WO2008133292A1 (ja) * | 2007-04-25 | 2008-11-06 | Japan Health Sciences Foundation | スキルス型がんの疾患関連たんぱく質 |
| CN101797242A (zh) * | 2010-04-07 | 2010-08-11 | 中国科学技术大学 | 半胱胺在制备治疗癌症的药物中的应用 |
| WO2011031308A1 (en) * | 2009-09-09 | 2011-03-17 | Cytokinetics, Incorporated | Novel combinations |
-
2013
- 2013-02-11 CA CA2864161A patent/CA2864161A1/en not_active Abandoned
- 2013-02-11 SG SG11201404779TA patent/SG11201404779TA/en unknown
- 2013-02-11 AU AU2013216703A patent/AU2013216703A1/en not_active Abandoned
- 2013-02-11 WO PCT/US2013/025601 patent/WO2013120086A1/en not_active Ceased
- 2013-02-11 JP JP2014556787A patent/JP2015509489A/ja active Pending
- 2013-02-11 US US14/377,470 patent/US9493775B2/en active Active
- 2013-02-11 NZ NZ630026A patent/NZ630026A/en not_active IP Right Cessation
- 2013-02-11 EP EP13746071.3A patent/EP2811991A4/en not_active Withdrawn
-
2014
- 2014-08-10 IL IL234046A patent/IL234046A0/en unknown
- 2014-08-20 ZA ZA2014/06124A patent/ZA201406124B/en unknown
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000066110A1 (en) * | 1999-04-29 | 2000-11-09 | Merck Patent Gmbh | Glycine cleavage system inhibitors as potential antipsychotics |
| WO2004024129A1 (en) * | 2002-09-10 | 2004-03-25 | Samir Chachoua | Induced remission therapy |
| WO2008133292A1 (ja) * | 2007-04-25 | 2008-11-06 | Japan Health Sciences Foundation | スキルス型がんの疾患関連たんぱく質 |
| WO2011031308A1 (en) * | 2009-09-09 | 2011-03-17 | Cytokinetics, Incorporated | Novel combinations |
| CN101797242A (zh) * | 2010-04-07 | 2010-08-11 | 中国科学技术大学 | 半胱胺在制备治疗癌症的药物中的应用 |
Non-Patent Citations (11)
| Title |
|---|
| DATABASE PUBMED XP055082677, accession no. 6341059 * |
| DATABASE PUBMED XP055082678, accession no. 616813 * |
| DATABASE PUBMED XP055082802, retrieved from PubMed accession no. 679320 * |
| DATABASE PUBMED XP055082810, accession no. 1512034 * |
| HAYASAKA K. ET AL.: "Effects of the metabolites of the branched-chain amino acids and cysteamine on the glycine cleavage system", BIOCHEM. INT., vol. 6, no. 2, 1983, pages 225 - 230, XP008174608 * |
| JEITNER T.M. ET AL.: "Inhibition of the proliferation of human neural neoplastic cell lines by cysteamine", CANCER LETT., vol. 103, no. 1, 1996, pages 85 - 90, XP009051880 * |
| LEIVONEN S.K. ET AL.: "Identification of miR-193b Targets in Breast Cancer cells and Systems Biological Analysis of Their Functional Impact", MOLECULAR & CELLULAR PROTEOMICS, vol. 10, no. 7, 2011, XP055080936 * |
| PAI SI. ET AL.: "Prospects of RNA interference therapy for cancer", GENE THERAPY, vol. 13, no. 6, 2006, pages 464 - 477, XP002397956 * |
| See also references of EP2811991A4 * |
| XIAO-MEI WAN ET AL.: "Autophagy-mediated chemosensitization by cysteamine in cancer cells.", INTERNATIONAL JOURNAL OF CANCER, vol. 129, no. ISSUE, 2011, pages 1087 - 1095, XP055080933 * |
| ZHANG WC. ET AL.: "Glycine Decarboxylase Activity Drives Non-Small Cell Lung cancer Tumor-Initiating Cells and Tumorigenesis.", CELL., vol. 148, 20 January 2012 (2012-01-20), pages 259 - 272, XP055080934 * |
Cited By (20)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10287331B2 (en) | 2013-04-15 | 2019-05-14 | Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. | Mitochondrial proteins constructs and uses thereof |
| US10607717B2 (en) | 2013-11-06 | 2020-03-31 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Method for subtyping lymphoma types by means of expression profiling |
| JP2017502686A (ja) * | 2013-11-06 | 2017-01-26 | アメリカ合衆国 | 発現プロファイリングによりリンパ腫のタイプをサブタイピングするための方法 |
| JP7016129B2 (ja) | 2013-11-06 | 2022-02-04 | アメリカ合衆国 | 発現プロファイリングによりリンパ腫のタイプをサブタイピングするための方法 |
| US11574704B2 (en) | 2013-11-06 | 2023-02-07 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Method for subtyping lymphoma types by means of expression profiling |
| JP2020078323A (ja) * | 2013-11-06 | 2020-05-28 | アメリカ合衆国 | 発現プロファイリングによりリンパ腫のタイプをサブタイピングするための方法 |
| WO2016085990A1 (en) * | 2014-11-24 | 2016-06-02 | The Regents Of The University Of Michigan | Compositions and methods relating to inhibiting serine hyrdoxymethyltransferase 2 activity |
| IL263540B2 (en) * | 2016-06-07 | 2023-07-01 | Novabiotics Ltd | Microparticles that include a sulfur-containing compound |
| IL263540B1 (en) * | 2016-06-07 | 2023-03-01 | Novabiotics Ltd | Microparticles that include a sulfur-containing compound |
| US10905660B2 (en) | 2016-06-07 | 2021-02-02 | Novabiotics Limited | Microparticles |
| CN109310654A (zh) * | 2016-06-07 | 2019-02-05 | 诺瓦生命科学有限公司 | 包含含硫化合物的微粒 |
| WO2017212249A1 (en) * | 2016-06-07 | 2017-12-14 | Novabiotics Limited | Microparticles comprising a sulphur-containing compound |
| US11369568B2 (en) | 2016-06-07 | 2022-06-28 | Novabiotics Limited | Microparticles comprising a sulphur-containing compound |
| RU2780397C2 (ru) * | 2016-06-07 | 2022-09-22 | НоваБиотикс Лимитед | Микрочастицы, содержащие серосодержащие соединения |
| US11072795B2 (en) | 2016-10-28 | 2021-07-27 | Agency For Science, Technology And Research | Antisense oligonucleotides |
| WO2018080393A1 (en) * | 2016-10-28 | 2018-05-03 | Agency For Science, Technology And Research | Antisense oligonucleotides |
| US11579147B2 (en) | 2017-09-25 | 2023-02-14 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Use of VNN1 as a biomarker and a therapeutic target in sarcomas |
| WO2019057995A1 (en) * | 2017-09-25 | 2019-03-28 | INSERM (Institut National de la Santé et de la Recherche Médicale) | USE OF VNN1 AS A BIOMARKER AND THERAPEUTIC TARGET IN SARCOMES |
| US12576050B2 (en) | 2018-10-17 | 2026-03-17 | Novabiotics Limited | Dosage regime |
| CN115590945A (zh) * | 2022-08-19 | 2023-01-13 | 北京市肿瘤防治研究所(Cn) | 一种用于治疗肿瘤的多肽及其应用 |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2013216703A1 (en) | 2014-09-25 |
| EP2811991A4 (en) | 2016-03-16 |
| JP2015509489A (ja) | 2015-03-30 |
| SG11201404779TA (en) | 2014-09-26 |
| ZA201406124B (en) | 2015-05-27 |
| IL234046A0 (en) | 2014-09-30 |
| US9493775B2 (en) | 2016-11-15 |
| US20150011611A1 (en) | 2015-01-08 |
| NZ630026A (en) | 2016-06-24 |
| EP2811991A1 (en) | 2014-12-17 |
| CA2864161A1 (en) | 2013-08-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9493775B2 (en) | Inhibition of the glycine cleavage system for treatment of cancer | |
| JP6898848B2 (ja) | 脳転移を治療するための方法 | |
| US20140087970A1 (en) | Serine biosynthesis pathway inhibition for treatment of cancer | |
| US20210069218A1 (en) | Methods of controlling tumor bioenergetics networks | |
| Ma et al. | NNMT/1‐MNA promote cell‐cycle progression of breast cancer by targeting UBC12/Cullin‐1‐mediated degradation of P27 proteins | |
| Ni et al. | MiR-221-3p-mediated downregulation of MDM2 reverses the paclitaxel resistance of non-small cell lung cancer in vitro and in vivo | |
| US20140348749A1 (en) | Identification and treatment of tumors sensitive to glucose limitation | |
| Li et al. | Suppressing recurrence in Sonic Hedgehog subgroup medulloblastoma using the OLIG2 inhibitor CT-179 | |
| Yin et al. | Mitochondrial‐Derived Peptide MOTS‐c Suppresses Ovarian Cancer Progression by Attenuating USP7‐Mediated LARS1 Deubiquitination | |
| Tang et al. | EIF4A3‐mediated biogenesis of CircFADS1 promotes the progression of hepatocellular carcinoma via Wnt/β‐catenin pathway | |
| US20140142180A1 (en) | Methods of treating tumors having elevated mct1 expression | |
| Ye et al. | PICH activates cyclin A1 transcription to drive S-phase progression and chemoresistance in gastric cancer | |
| Wan et al. | Identification of a Novel Substrate for eEF2K and the AURKA‐SOX8 as the Related Pathway in TNBC | |
| WO2017064159A1 (en) | Trpv2 as a biomarker and as a therapeutic target for melanoma | |
| EP3369819B1 (en) | Dna aptamer binding to cancer cell | |
| Wang et al. | FTO‐mediated m6A demethylation regulates IGFBP3 expression and AKT activation through IMP3‐dependent P‐body re‐localisation in lung cancer | |
| US12404332B2 (en) | Methods for diagnosing and treating cancers | |
| Liu et al. | Acquired resistance to HSP90 inhibitor 17-AAG and increased metastatic potential are associated with MUC1 expression in colon carcinoma cells | |
| Xiao et al. | The deubiquitinase OTUB2 promotes cervical cancer growth through stabilizing FOXM1 | |
| US20130310406A1 (en) | Mir-193a-3p and associated genes predict tumorigenesis and chemotherapy outcomes | |
| CN116855608B (zh) | Cited1在肺癌诊断、治疗及预后预测中的应用 | |
| US20240125768A1 (en) | Methods for modulating a src-1 condensate | |
| Zhou et al. | Circular RNA hsa_circ_103089 modulates metabolic glycolysis and influences migration, invasion, and cisplatin sensitivity in non-small cell lung cancer cells via the miR-876-5p/EGFR axis | |
| CN118792406B (zh) | 用于治疗AKT/mTOR信号通路相关疾病的基因 | |
| CN119082310B (zh) | Aml诊断和预后预测相关的生物标志物及其应用 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13746071 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14377470 Country of ref document: US |
|
| ENP | Entry into the national phase |
Ref document number: 2014556787 Country of ref document: JP Kind code of ref document: A Ref document number: 2864161 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 234046 Country of ref document: IL |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REEP | Request for entry into the european phase |
Ref document number: 2013746071 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2013746071 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2013216703 Country of ref document: AU Date of ref document: 20130211 Kind code of ref document: A |