WO2013114405A1 - Primer for amplifying geranyl pyrophosphate synthase from mango - Google Patents
Primer for amplifying geranyl pyrophosphate synthase from mango Download PDFInfo
- Publication number
- WO2013114405A1 WO2013114405A1 PCT/IN2013/000070 IN2013000070W WO2013114405A1 WO 2013114405 A1 WO2013114405 A1 WO 2013114405A1 IN 2013000070 W IN2013000070 W IN 2013000070W WO 2013114405 A1 WO2013114405 A1 WO 2013114405A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- gpps
- mango
- gpps2
- geranyl pyrophosphate
- ggpps
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1085—Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y205/00—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5)
- C12Y205/01—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5) transferring alkyl or aryl groups, other than methyl groups (2.5.1)
- C12Y205/01001—Dimethylallyltranstransferase (2.5.1.1)
Definitions
- the present invention relates to primer sequence for amplifying geranyl pyrophosphate synthase from mango species.
- the invention further relates to a nucleotide sequence encoding said amplified geranyl pyrophosphate synthase (GPPS) for enzyme production in an artificial system thus generating the desired flavor in food products.
- GPPS amplified geranyl pyrophosphate synthase
- Mango (Mangifera indica L.) represents one of the most popular tropical fruits not only in India, the country dominating global mango trade, but all over the world.
- Alphonso is the most popular, mainly because of its highly attractive flavor and long shelf life.
- cultivation of Alphonso is troublesome to farmers because of various factors such as cultivation locality dependent variation in the fruit quality, especially in terms of flavor, occurrence of the physiological diseases such as spongy, alternate bearing of the fruits, etc.
- Alphonso fruits are highly rich in monoterpenes which contribute above 90% to the volatile blend of the ripe fruits (Pandit et al., 2009a; Pandit et al., 2009b). Further studies on the geographic variation in the mango flavor revealed that there is a variation in the levels of terpenes between cultivation localities. /
- Monoterpenes form one of the major classes of flavor volatiles in 'Alphonso' mango. Monoterpenes play a vital ecological role by acting as attractant of the pollinators and the seed dispersal agents, as the repellent of the herbivores and the pathogens and as an attractant of the predators of herbivores (Chen et al., 2003; Dudareva et al., 2004; Kessler and Baldwin, 2001 ; Pichersky and Gershenzon, 2002; Ramsewak et al., 2003). Many monoterpenes are also known to exert beneficial effects on human health by acting as antioxidant and antitumor agents (Loreto et al., 2004; Wagner and Elmadfa, 2003).
- Monoterpenes also play an important role as flavor compounds of many fruits including mango giving a characteristic identity to the fruit. Being rich in the terpene flavorants, mango forms an appropriate system to study biosynthesis and regulation of monoterpenes. Studies were conducted to understand the technical composition of mango flavor indicating the dominance of monoterpenes in mango fruits.
- Geranyl pyrophosphate synthases find utility in the flavor industry.
- the nucleotide sequences can be used for enzyme production in an artificial system and later this artificially synthesized enzyme can be mixed appropriately with the mango pulp, thus generating the desired flavor.
- These nucleotide sequences can also be used for semi-biosynthesis of flavors via various approaches such as enzyme immobilization, single cell culture, etc., as well as to improve other varieties of mango.
- nucleotide sequences encoding Geranyl Pyrophosphate Synthases (GPPS) which play an important role in the biosynthesis of terpenes in mango is not known hitherto and there is a long standing need in the prior art for such sequences.
- the Inventors have attempted in this research to provide artificial sequences which may be used to impart color, flavor and smell as in natural Alphonso mangoes.
- the invention provides primer sequences to amplify geranyl pyrophosphate synthases derived from mango ha ving sequence selected from the group consisting of Seq ID. Nos. 2 - 13.
- the present invention provides forward and reverse degenerate primers for the two geranyl pyrophosphate synthase enzymes isolated from mango.
- the present invention provides forward and reverse gene specific primers for the two geranyl pyrophosphate synthases isolated from mango.
- Yet another aspect of the current invention discloses primers corresponding to the terminal regions of the mRNA which are designed for the two geranyl pyrophosphate synthases isolated from mango. These terminal primers are used for the PCR amplification with mango cDNA as a template.
- the present invention provides an isolated novel nucleotide sequence encoding geranyl pyrophosphate synthase from mango comprising sequence of sequence ID nos.14 and 15.
- the invention provides a process of isolating gene sequences encoding two functional geranyl pyrophosphate synthases from mango.
- the invention provides biochemical characterization of the isolated nucleotide sequences encoding two geranyl pyrophosphate synthases.
- Figure 1(a) Complete open reading frame encoding geranyl pyrophosphate synthase 1 ( z ' GPPS l) isolated from mango.
- Figure 1(b) Comple te open reading frame encoding geranyl pyrophosphate synthase 2 (MGPPS2) isolated from mango.
- Figure 2 Alignment of M ' GPPS l and /GPPS2 with the most similar sequences characterized from other plants.
- Five regions which are conserved among the prenyltransferases (I-V) are indicated by purple, coral, yellow, green and blue colour, respectively.
- Aspartate residues of FARM (region II) and SARM (region V) are indicated by black filled circles.
- the truncation site for M ' GPPS l is indicated by an arrow; whereas that of GPPS2 is shown by the arrow with two heads.
- Figure 3 Neighbour-Joining tree constructed using mango prenyltransferases (indicated by star symbol) and numerous other functionally characterized short-chain prenyltransferases. The numbers at the branche nodes indicate the bootstrap scores obtained using 1000 trials. Two italicized letters following the protein name indicate initials of the systematic name of the organism.
- Figure 4 LC-MS/MS chromatogram of the standards of GPP, FPP and GGPP (a) and of the in vitro assays products formed from DMAPP and IPP with the protein expressed from M ' GPPS l (b), MGPPS2 (c) and the empty vector (d).
- Figure 5 Complementation assay for the confirmation of absence of GGPP synthase activity with M GPPS2. Functionally characterized GGPPS from Picea abies was used as a positive control.
- Figure 6 Optimum temperature, pH and MgCl 2 concentration requirement of recombinant M ' GPPSl (a) and M GPPS2 (b). For each enzyme and each parameter, peak area of GPP in the assay showing maximum activity was set to 1. Letters over each point indicate the significance of ANOVA (p ⁇ 0.05) carried out by Fisher's LSD test independently for each of the two parameters; the values having different letters are significantly different from each other.
- Figure 7 Homology model of MGPPS2 generated using Mint GPPS (PDB ID: 3KRF) as a template.
- Figure 8 Abundance of / ' GPPS l and GPPS2 transcripts relative to EFl a during ripening of mango fruits from three cultivation localities, Dapoli, Deogad and Vengurle, in India (DAH: days after harvest). Values presented are averages of four independent biological replicates each of which was represented by at least two technical replicates. Letters indicate the significance of ANOVA (p ⁇ 0.01) for the comparison between the ripening stages for the levels of monoterpenes (a, b, etc.) and the relative transcript abundance of GPPS1 (m, n, etc.) and GPPS2 (x, y, etc.); the values having different letters are significantly different from each other. Letters are indicated only at the stages where the difference between the stages is significant.
- 'Geranyl pyrophosphate synthase' refers to an enzyme that catalyzes formation of geranyl pyrophosphate.
- GPPS1 and /GPPS2 refer to geranyl pyrophosphate synthase derived from mangifera indica (Mango) particularly.
- the suffix 1 & 2 are the two individual enzymes named consecutively to show they are closely related. This nomenclature is in conformance with the International protocols.
- Mature raw fruits of mango used in the present invention are collected from Dapoli, Deogad and Vengurle regions of Maharashtra. Biosynthesis of monoterpenes is thought to be localized in the plastids and it starts when the two five-carbon building blocks, Isopentenyl Pyrophosphate (IPP) and Dimethylallyl Pyrophosphate (DMAPP) are condensed into an immediate precursor of monoterpenes, geranyl pyrophosphate (GPP), by the action of GPP synthase (GPPS) (Dudareva et al., 2004). The conversion of GPP into actual monoterpenes is catalyzed by the monoterpene synthases.
- IPP Isopentenyl Pyrophosphate
- DMAPP Dimethylallyl Pyrophosphate
- GPP geranyl pyrophosphate
- GPPS GPP synthase
- GPP is an important branch-point step in the biosynthesis of monoterpenes; since DMAPP and IPP are the precursors for all the terpenes.
- the extent of GPPS activity decides the DMAPP and IPP pool diverted towards the biosynthesis of monoterpenes which contribute above 90% to the volatile blend of the ripe mango fruit.
- GPPS geranyl pyrophosphate synthase
- the present invention relates to novel nucleotide sequences encoding two geranyl pyrophosphate synthase derived from mango.
- the nucleotide sequences encoding the two geranyl pyrophosphate synthases are useful for enzyme production in artificial system.
- the artificially synthesized enzyme can be mixed appropriately with the food product thus generating the desired flavor.
- the nucleotide sequence is also useful in the flavor industry for semi-biosynthesis of flavors via various approaches such as enzyme immobilization, single cell culture, etc., as well as for improving varieties of desired fruits and food products.
- the complete open reading frames encoding the two geranyl pyrophosphate synthases derived from mango are as shown in Figure la and lb.
- GPPS geranyl pyrophosphate synthase
- Biosynthesis of monoterpenes is thought to be localized in the plastids and it starts when the two five-carbon building blocks, isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP) are condensed into an immediate precursor of monoterpenes, geranyl pyrophosphate (GPP), by the action of GPP synthase (GPPS) (Dudareva et al., 2004).
- GPP GPP synthase
- GPP GPP synthase
- GPP GPP synthase
- GPP GPP synthase
- Formation of GPP is an important branch-point step in the biosynthesis of monoterpenes; since DMAPP and IPP are the precursors for all the terpenes.
- the extent of GPPS activity decides the DMAPP and IPP pool diverted towards the biosynthesis of monoterpenes which contribute above 90% to the volatile blend of the ripe mango fruit.
- the present invention disclose primer sequences to amplify geranyl pyrophosphate synthases derived from mango ha ving sequence selected from the group consisting of Seq Id. Nos. 2 - 13.
- the present inventions provides forward and reverse degenerate primers for two geranyl pyrophosphate synthases useful for amplification of the cDNA prepared from ripe fruits of mango.
- the degenerate primers designed for geranyl pyrophosphate synthase 1 are:
- the degenerate primers designed for geranyl pyrophosphate synthase 2 are:
- the present invention provides forward and reverse gene specific primers for two geranyl pyrophosphate synthases useful for amplification of the ends of cDNA by rapid amplification of cDNA ends (RACE).
- GPPS1 geranyl pyrophosphate synthase 1
- GPPS2 geranyl pyrophosphate synthase 2
- the current invention provides primers corresponding to the terminal regions of the mRNA which are designed for two geranyl pyrophosphate synthases useful for the PCR amplification with mango cDNA as a template.
- the terminal primers designed for geranyl pyrophosphate synthase 1 are:
- the terminal primers designed for geranyl pyrophosphate synthase 2 are:
- the present invention discloses the process of isolating two full-length nucleotide sequences encoding geranyl pyrophosphate synthases from ripe mangoes designated as M/GPPS l and GPPS2 respectively.
- the process comprises the following steps:
- step (iv) designing gene specific primers for GPPS and GGPPS based on the sequence of the fragments obtained in step (iv);
- viii amplifying mango cDNA using primers obtained in step (vii) by PCR (polymerase chain reaction).
- primers are designed and used to amplify an interdomain fragment of these genes from Aiphonso mango. The fragments obtained show high similarity to the respective genes reported from the other plants.
- gene specific primers are designed so as to have an overlapping region of 327 and 183 base pairs between 5' and 3' RACE fragments for GPPS 1 and GPPS2, respectively.
- the fragments are eluted from the agarose gel, ligated in a pGEM-T Easy vector and transformed in E.coli cells. Positive colonies are identified by colony PCR and the presence of desired insert is confirmed by sequencing. Sequences are aligned and analysed for the presence of uninterrupted reading frame in the MEGA 4.1 software. The full-length open reading frames are finally obtained using terminal primers based on the sequences of the RACE fragments. The fragments obtained at the end of all of the above steps encode an amino acid sequence without a stop codon.
- the degenerate primers designed in step (iii) of the process of isolating two full-length nucleotide sequences encoding geranyl pyrophosphate synthases from ripe mangoes are;
- step (v) of the process of isolating two full-length nucleotide sequences encoding geranyl pyrophosphate synthases from ripe mangoes are;
- the terminal primers designed in step (vii) of the process of isolating two full-length nucleotide sequences encoding geranyl pyrophosphate synthases from ripe mangoes are;
- the complete open reading frame (ORF) of MiGPPSI (Seq ID No. 14) thus obtained is 1266 base pair (bp) long, flanked by 1 12 base pair untranslated region (UTR) at the 5' end and 242 base pair UTR at the 3' end, encoded a protein of 421 amino acids with the predicted molecular weight of 46.2 kD and the isoelectric pH of 6.19.
- the complete open reading frame (ORF) of MiGPPS2 (Seq ID No.
- the present invention studies the similarity of the in silico translated amino acid sequences of GPPS 1 and GPPS2 with enzymes from other plants.
- the in silico translated GPPS 1 shows the highest sequence similarity with the GPPS from Quercus robur (80% identity), Arabidopsis (71% identity) and Picea abies (66% identity).
- the putative protein sequence of GPPS2 on the other hand showed the highest sequence similarity to the GGPPS from Corylus avellana (84% identity) and Lupinus albus (79% identity), the Large Subunit (LSU) of the heterodimeric G(G)PPS from Humulus lupulus (81%) identity) and the LSU of heterodimeric GPPS from snapdragon (78% identity).
- the sequence identity of the putative amino acid sequences of GPPS1 and MiGPPS2 with each other was 20% ( Figure 2).
- the present invention provides a phylogenetic analysis of the deduced amino acid sequences of GPPS1, GPPS2 and a few functionally characterized prenyl transferases from the other organisms to understand the evolutionary relationships of M/GPPSl and M/GPPS2 with the short chain prenyltransferases from the other plants.
- a neighbor joining tree is constructed using amino acid sequences of the genes obtained from the NCBI database.
- NCBI accession numbers of the sequences used are: GPPS: Arabidopsis thaliana, CAC 16849; Abies grandis, AAN01 134; Quercus robur, CAC20852; Picea abies (GPPS2), ACA21458; Picea abies (GPPS3), ACA21459; Solarium lycopersicum, ABB88703; Phalaenopsis bellina, ABV71395; Mentha x piperita (LSU), AAF08793; Antirrhinum majus (LSU), AAS82860; Humulus lupulus (LSU), ACQ90682; Mentha x piperita (SSU), AF 182827; Antirrhinum majus (SSU), AAS82859; Humulus lupulus (SSU), ACQ90681 ; Aphid (G/FPPS), AAY33491 ; Chlamydomonas reinhardtii, XP
- GGPPS geranylgeranyl pyrophosphate synthase
- FPPS Farnesyl pyrophosphate synthase
- GPPSs are scattered in four different clades and are accompanied by GGPPS in clade 1 (formed by gymnosperm GPPS and GGPPS) and clade 2 (formed by angiosperm GGPPS, GPPS-LSU and MiGPPS2).
- Clade 3 contains the angiosperm and gymnosperm GPPS including M/GPPSl .
- Clade 4 on the other hand had the small subunit of GPPS which along with the Large Subunit (LSU) of clade 2 forms a functional heterodimeric GPPS in angiosperms.
- LSU Large Subunit
- the enzymes of clade 1 , 2 and 4 are shown to be involved in the biosynthesis of respective isopentenyl diphosphates and/or terpenes.
- Expression of GPPS-SSU of clade 4 is highly correlated with the volatiles and the expression of monoterpene synthase in hop and in the other plants (Wang and Dixon, 2009).
- the enzymes belonging to clade 1 are also shown to be involved in the terpene production induced upon methyl jasmonate treatment (Hefner et al., 1998; Schmidt and Gershenzon, 2007, 2008; Schmidt et al., 2010).
- the present invention provides in vitro assay to get functional insights into the recombinant proteins of GPPS 1 and GPPS2. Accordingly, the recombinant proteins are incubated with substrates isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP) and the products are analysed by LC-MS/MS. None of the isopentenyl diphosphate products are detected in the assays with the soluble fraction of the full-length and truncated version of MGPPS 1 and GPPS2.
- IPP isopentenyl pyrophosphate
- DMAPP dimethylallyl pyrophosphate
- the soluble fraction of the truncated version showed the formation of GPP along with about 7-12% (of the total) FPP at the optimum conditions.
- the same medium was used for truncated version of /GPPS2 and surprisingly, instead of GGPP, the purified protein formed is-GPP as a main product with about 8-16% ⁇ , ⁇ -FPF, at the optimum conditions. None of the isopentenyl diphosphate products were detected with the full-length versions of GPPS 1 and GPPS2 carrying the 5' segment corresponding to the putative signal peptides.
- the present invention provides a complementation assay for GPPS2 to confirm the absence of geranylgeranyl pyrophosphate (GGPP) synthase activity with GPPS2.
- GGPP geranylgeranyl pyrophosphate
- the plasmid pACCARAcrtE is constructed by cloning the Erwinia uredovora genes of caratogenesis (crt) cluster except GGPPS (Sandmann et al., 1993).
- crt caratogenesis
- GGPPS Sandmann et al., 1993.
- pACCATAcrtE is complemented by the functional GGPPS, yellow colored zeaxanthin diglucoside pigment is formed.
- the putative GGPPS coding sequence from mango analyzed in this manner does not produce yellow-coloured colonies confirming the absence of GGPP synthase activity with the putative GGPPS from mango. This finding along with the GPP synthase activity detected in in vitro assays results in nomenclature of the putative GGPPS as MiGPPS2.
- the present invention provides enzymatic assays to determine the optimum biochemical requirements of GPPS 1 and GPPS2.
- the activity of GPPS1 and GPPS2 is measured at varying temperature, MgCl 2 concentration and pH.
- biochemical properties of these two enzymes are much similar.
- the relatively higher optimum temperature (40 °C) of GPPS 1 and GPPS2 can be attributed to the higher temperature observed in the ripening fruits of mangoes.
- the present invention provides a homology based model of GPPS2 using the large sub unit (LSU) of mint GPPS as template.
- LSU of mint shows 78% ⁇ sequence identity with /GPPS2.
- the chain-length determination mechanism of GPPS thus appears to be different than that of FPPS and GGPPS.
- the unawareness about the product chain-length determining mechanism is further aggravated by the fact that the catalytic large sub unit (LSU) shares very high sequence homology with the GGPPS.
- the residues in the chain-length determining (CLD) region of GGPPS are also conserved among the GPPS-LSU and still there is a difference of CI O between the products of these two enzymes (Burke et al, 1999).
- GPPS-LSU Such high sequence similarity of GPPS-LSU with GGPPS is imparted by the interactions between LSU and SSU, which results in the remodeling of the reaction cavity and restriction of the product length to GPP (Burke and Croteau, 2002; Chang et al., 2010; Orlova et al., 2009).
- GPPS2 is also highly similar to GGPPS and GPPS-LSU, nonetheless, it does not produce GGPP but synthesizes GPP and small amounts of FPP in the absence of any regulatory small sub unit (SSU).
- the present invention profiles the transcripts of GPPS 1 and GPPS2 through the ripening stages of mango from three cultivation localities in Maharashtra; Dapoli, Deogad and Vengurle.
- the maximum expression of MiGPPSl and MiGPPS2 is observed to be at 10 days after harvest (DAH), while the concentration of monoterpenes is observed to be the highest at 15 DAH (Pandit et al., 2009b) indicating the preparative role of MiGPPSl and MiGPPS2 for the highest production of monoterpenes at 15 DAH.
- Monoterpenes are the most important components of the terpene class of the represent flavor and fragrance chemicals.
- the coding sequences of the enzyme, geranyl diphosphate synthase, characterized in this study can be used for biotechnological production of the recombinant enzyme which can be further used for the production of monoterpenes.
- the degenerate primers described here have been designed by homology-based approach based on the putative gene sequences reported from the other plants. These primers can thus be used for isolating similar genes from the other plants also. Similar work is being attempted by the Inventors in case of Alphonso mango as well as other economically important fruits and crops.
- nucleotide sequences encoding the two geranyl pyrophosphate synthases of the present invention are useful for enzyme production in artificial system.
- This artificially synthesized enzyme can be mixed appropriately with the food product including mango pulp, thus generating the desired flavor.
- the nucleotide sequence is also useful in the flavor industry for semi-biosynthesis of flavors via various approaches such as enzyme immobilization, single cell culture, etc., as well as for improving other varieties of mango.
- Mature raw fruits of mango were collected from the orchards of Konkan Krishi Vidyapeeth at Dapoli ( 17°45' ⁇ 73° 1 ⁇ ) and Deogad ( ⁇ 16°3 ⁇ ⁇ 73°20') and from a private orchard at Vengurle ( ⁇ 15°5 ⁇ ⁇ 73°39').
- fruits were collected from four plants. After harvesting, fruits were put in the hay, carried to the laboratory and allowed to ripe at ambient temperature. At the interval of every five days, fruits were peeled, pulp was immediately frozen in the liquid nitrogen and stored at -80 °C until use.
- the experimental tissues of four ripening stages 0, 5, 10 and 15 DAH (days after harvest) were obtained from each of the three localities.
- degenerate primers were designed for GPPS (fori : 5'- TCTTGTTACNGGTG A AACC ATG-3 ' and rev: 5 ' -T YA YTTTKTTCTTGTRATG ACGC - 3') and GGPPS (for: 5 ' -TSG ARATG ATHC AC AC Y ATGTC -3', rev l : 5 '-GPPS (fori : 5'- TCTTGTTACNGGTG A AACC ATG-3 ' and rev: 5 ' -T YA YTTTKTTCTTGTRATG ACGC - 3') and GGPPS (for: 5 ' -TSG ARATG ATHC AC AC Y ATGTC -3', rev l : 5 '-GPPS (fori : 5'- TCTTGTTACNGGTG A AACC ATG-3 ' and rev: 5 ' -T YA YTTTKTTCTTGTRATG ACGC - 3') and GGPPS (for:
- These primers were used for amplification of the cDNA prepared from the ripe fruits of mango.
- the gene specific primers for GPPS for5'- AGATGACGTTCTTGATTTCACGGGC-3 ',rev5'- CTTTGAGTTAG ATCTAAAAGTGCCCG-3 '
- GGPPS for 5 ' - ACG ACCTTCGTCGGGG AAAACCG-3 ' , rev 5'-
- RACE amplification of cDNA ends
- SMARTTM RACE cDNA Amplification Kit (Clontech, Palo Alto, CA, USA).
- primers corresponding to the terminal regions of the mRNA were designed for GPPS (for 5 '- ATGTTATTTTCTTATGGCCTTTCTCG-3 ',rev5 '- TTTATTTCTTGTGATGACTCTTTGAG -3') and GGPPS (for 5'-
- GPPSs were scattered in four different clades and were accompanied by GGPPS in clade 1 (formed by gymnosperm GPPS and GGPPS) and clade 2 (formed by angiosperm GGPPS, GPPS-LSU and MiGGPPS (MiGPPS2)).
- Clade 3 contained the angiosperm and gymnosperm GPPS including MiGPPS (MiGPPS l ).
- Clade 4 on the other hand had the small subunit of GPPS which along with the LSU of clade 2 forms a functional heterodimeric GPPS in angiosperms (Fig. 3).
- the recombinant plasmids of MGPPS l and MGPPS2 were transformed in the BL21(DE3)pLysS Rosetta ( ovagen, Madison, WI, USA) and BL21(DE3) Star (Invitrogen) cells, respectively.
- LB media containing 1M sorbitol and 2.5mM betaine was used for the expression of the recombinant proteins.
- 5ml of starter culture grown at 18 °C for 48 hrs was used as inoculum for the expression in 100ml media with the Overnight Express Autoinduction System 1 (Novagen, Madison, WI, USA).
- In vitro assay for determining the activity of MGPPS l and M/GPPS2 were carried out in the final volume of 200 ⁇ containing appropriate amount of enzyme, 25 mM Mopso (pH 7.0), 2 mM DTT, 10 mM MgCl 2 , 10% (v/v) glycerol and 67 ⁇ of each DMAPP and IPP.
- the assays were performed in 25 mM MOPSO (pH 6 and 6.5), 25 mM HEPES (pH 7 and 7.5) or 25 mM tris (pH 8-9) containing the other required components as mentioned above.
- the assays carried out for determining the optimum Mg 2+ concentration contained varied concentration MgCl 2 along with the other required components as mentioned above. After overnight incubation, the assay reactions were washed with equal volume of chloroform for removing the proteins and the aqueous phase was directly used for LC-MS/MS analysis.
- Both the enzymes required the temperature of 40 °C for the optimum activity and more than 60% of the optimum activity was retained at 30 and 35 °C. The activity sharply reduced above the temperature of 40 °C.
- the MgCl 2 concentration of 6mM was required for both of the enzymes for exhibiting the maximum activity.
- M/GPPSl showed more than 80% of the optimum activity at the MgCl 2 concentration of 3-15mM; similar extent of activity was exhibited by M GPPS2 between 6 and 15mM MgCl 2 . None of these enzymes showed any activity in the absence of Mg 2+ or in the presence of other divalent metal ions such as Mn 2+ , Zn 2+ or Ca 2+ . Both M/GPPSl and GPPS2 were optimally active between pH 7 and 8 (Fig. 6).
- MGPPS2 showed the higher sequence similarity with the GGPPS than GPPS reported from the other plants but no GGPP was detected in the in vitro assays.
- complementation assay was carried out by co- transforming GPPS2 with pACCARAcrtE.
- PalOS5 from Picea abies which has been shown to be a functional GGPPS, was used as a positive control. Plasmids in the combination of PalOS5+ pACCARAcrtE, GPPS2 + pACCARAcrtE, and pACCARAcrtE alone, were transformed in BL21(DE3)Star cells (Invitrogen). The transformants were selected on LB agar media containing 100 ⁇ g/ ml carbanecillin and 50 ⁇ g/ ml chloramphenicol and were allowed to grow at 28 °C for 2 days.
- Quantitative PCR was performed with Brilliant SYBR Green QPCR Master Mix (Stratagene) with elongation factor la (EF l ) as an internal control.
- Primers used for amplifying a fragment of GPPS1 were: for 5'-AGGCTGCGCTCCATGGTAGTCA- 3' and rev 5'- ACCGTGGGACGAAACCTCTTTCC-3 ' ; whereas, those for GPPS2 were: for 5'- GACTGCTGGCAAAGATTTGGTGGCT- 3' and rev 5'-
- the fruits of 10 days after harvest (10 DAH) showed the highest expression (Fig. 8).
- the transcript levels were about 3.4 (Vengurle) to 17 (Deogad) fold higher in 10 DAH stage than the raw (0 DAH) stage.
- the expression was higher in the ripe (15 DAH) stage as compared to the raw stages, there was a slight reduction in the expression during the transition from 10 DAH to 15 DAH stage. No uniform difference between the localities through the ripening stages could be seen for the expression levels of MiGPPSl.
- Deogad fruits had the higher expression levels in 5 DAH and 10 DAH stage and the lower expression levels in the 0 DAH and 15 DAH stage as compared to Dapoli and Vengurle; however, this difference was only 1.2 to 3 folds.
- Expression of MiGPPSl was also assessed in the raw and ripe exocarp of the fruits from Deogad; ripe skin had about 5 fold higher transcripts as compared to the raw skin. The transcript levels were 3.9 and 4.4 folds higher in the exocarp as compared to the mesocarp for the raw and ripe stages, respectively.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Medicinal Chemistry (AREA)
- Nutrition Science (AREA)
- Enzymes And Modification Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- General Preparation And Processing Of Foods (AREA)
- Preparation Of Fruits And Vegetables (AREA)
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP13708533.8A EP2809776B1 (en) | 2012-02-03 | 2013-02-01 | Primer for amplifying geranyl pyrophosphate synthase from mango |
| US14/376,403 US20150184136A1 (en) | 2012-02-03 | 2013-02-01 | Primer for amplifying geranyl pyrophosphate synthase from mango |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| IN302/DEL/2012 | 2012-02-03 | ||
| IN302DE2012 IN2012DE00302A (https=) | 2012-02-03 | 2013-02-01 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2013114405A1 true WO2013114405A1 (en) | 2013-08-08 |
Family
ID=47844418
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IN2013/000070 Ceased WO2013114405A1 (en) | 2012-02-03 | 2013-02-01 | Primer for amplifying geranyl pyrophosphate synthase from mango |
Country Status (4)
| Country | Link |
|---|---|
| US (1) | US20150184136A1 (https=) |
| EP (1) | EP2809776B1 (https=) |
| IN (1) | IN2012DE00302A (https=) |
| WO (1) | WO2013114405A1 (https=) |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0854916A4 (en) * | 1995-09-20 | 2002-07-24 | Univ Queensland | NEW ACC SYNTHASE GENES |
-
2013
- 2013-02-01 US US14/376,403 patent/US20150184136A1/en not_active Abandoned
- 2013-02-01 IN IN302DE2012 patent/IN2012DE00302A/en unknown
- 2013-02-01 WO PCT/IN2013/000070 patent/WO2013114405A1/en not_active Ceased
- 2013-02-01 EP EP13708533.8A patent/EP2809776B1/en not_active Not-in-force
Non-Patent Citations (14)
Also Published As
| Publication number | Publication date |
|---|---|
| IN2012DE00302A (https=) | 2015-04-10 |
| US20150184136A1 (en) | 2015-07-02 |
| EP2809776A1 (en) | 2014-12-10 |
| EP2809776B1 (en) | 2016-04-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hsiao et al. | A novel homodimeric geranyl diphosphate synthase from the orchid Phalaenopsis bellina lacking a DD (X) 2–4D motif | |
| Tholl et al. | Terpene specialized metabolism in Arabidopsis thaliana | |
| Tholl | Biosynthesis and biological functions of terpenoids in plants | |
| Abbas et al. | Functional characterization and expression analysis of two terpene synthases involved in floral scent formation in Lilium ‘Siberia’ | |
| Matsuba et al. | Evolution of a complex locus for terpene biosynthesis in Solanum | |
| Brückner et al. | Characterization of two genes for the biosynthesis of abietane-type diterpenes in rosemary (Rosmarinus officinalis) glandular trichomes | |
| Beck et al. | Characterization of the GGPP synthase gene family in Arabidopsis thaliana | |
| Sallaud et al. | Characterization of two genes for the biosynthesis of the labdane diterpene Z‐abienol in tobacco (Nicotiana tabacum) glandular trichomes | |
| Matsushima et al. | The single cellular green microalga Botryococcus braunii, race B possesses three distinct 1-deoxy-D-xylulose 5-phosphate synthases | |
| Kulkarni et al. | Characterization of three novel isoprenyl diphosphate synthases from the terpenoid rich mango fruit | |
| Misra et al. | Involvement of an ent-copalyl diphosphate synthase in tissue-specific accumulation of specialized diterpenes in Andrographis paniculata | |
| Hao et al. | Cloning, molecular characterization and functional analysis of 1-hydroxy-2-methyl-2-(E)-butenyl-4-diphosphate reductase (HDR) gene for diterpenoid tanshinone biosynthesis in Salvia miltiorrhiza Bge. f. alba | |
| Xiang et al. | Molecular cloning and expression of Chimonanthus praecox farnesyl pyrophosphate synthase gene and its possible involvement in the biosynthesis of floral volatile sesquiterpenoids | |
| US20170247713A1 (en) | Trichome-specific transcription factor modulating terpene biosynthesis | |
| Lan et al. | Molecular cloning and expression of Hedychium coronarium farnesyl pyrophosphate synthase gene and its possible involvement in the biosynthesis of floral and wounding/herbivory induced leaf volatile sesquiterpenoids | |
| Dong et al. | Overexpression of geranyl diphosphate synthase 1 (NnGGPPS1) from Nelumbo nucifera enhances carotenoid and chlorophyll content and biomass | |
| Dhandapani et al. | Production of multiple terpenes of different chain lengths by subcellular targeting of multi-substrate terpene synthase in plants | |
| Wei et al. | Molecular cloning and characterization of farnesyl diphosphate synthase from Rosa rugosa Thunb associated with salinity stress | |
| Lee et al. | Induction, cloning and functional expression of a sesquiterpene biosynthetic enzyme, δ-guaiene synthase, of Aquilaria microcarpa cell cultures | |
| WO2013051925A1 (en) | A method for regulating the biosynthesis, conversion and utilization of prenyl-pyrophosphates in hevea brasiliensis | |
| Sharma et al. | Functional characterization of 1-deoxy-D-xylulose-5-phosphate synthase (DXS) genes from Monarda citriodora establishes the key role of McDXS2 in specialized terpenoid biosynthesis | |
| Li et al. | Methyl jasmonate activated regulatory module Ma14-3-3e-MbHLH130-MbACO13/MbACS7 promoting ethylene biosynthesis and fruit ripening in banana | |
| Lin et al. | Molecular cloning and functional analysis of the gene encoding geranylgeranyl diphosphate synthase from Jatropha curcas | |
| EP2809776B1 (en) | Primer for amplifying geranyl pyrophosphate synthase from mango | |
| US9650683B2 (en) | Primer for amplifying farnesyl pyrophosphate synthase from mango |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13708533 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14376403 Country of ref document: US |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2013708533 Country of ref document: EP |