WO2013110121A1 - Assay for a biomarker of a central nervous system disorder - Google Patents

Assay for a biomarker of a central nervous system disorder Download PDF

Info

Publication number
WO2013110121A1
WO2013110121A1 PCT/AU2013/000046 AU2013000046W WO2013110121A1 WO 2013110121 A1 WO2013110121 A1 WO 2013110121A1 AU 2013000046 W AU2013000046 W AU 2013000046W WO 2013110121 A1 WO2013110121 A1 WO 2013110121A1
Authority
WO
WIPO (PCT)
Prior art keywords
antibody
subject
fragment
dopamine receptor
binding
Prior art date
Application number
PCT/AU2013/000046
Other languages
French (fr)
Inventor
Fabienne BRILOT
Russell C. DALE
Original Assignee
The University Of Sydney
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from AU2012900261A external-priority patent/AU2012900261A0/en
Application filed by The University Of Sydney filed Critical The University Of Sydney
Publication of WO2013110121A1 publication Critical patent/WO2013110121A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/14—Blood; Artificial blood
    • A61K35/16—Blood plasma; Blood serum
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/66—Phosphorus compounds
    • A61K31/675—Phosphorus compounds having nitrogen as a ring hetero atom, e.g. pyridoxal phosphate
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6854—Immunoglobulins
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • G01N33/6896—Neurological disorders, e.g. Alzheimer's disease
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2869—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against hormone receptors
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value
    • G01N2500/02—Screening involving studying the effect of compounds C on the interaction between interacting molecules A and B (e.g. A = enzyme and B = substrate for A, or A = receptor and B = ligand for the receptor)
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/50—Determining the risk of developing a disease

Definitions

  • the present invention relates to a method of diagnosing or characterising a central nervous system disorder (CNS).
  • the invention may also be useful in predicting the risk of developing a CNS disorder.
  • the invention also relates to the identification of a biomarker of a CNS disorder. More specifically, the present invention contemplates the identification of an autoantibody in a subject as a biomarker of a CNS disorder.
  • the invention also relates to the treatment of a CNS disorder. Specifically, the invention contemplates the treatment of an autoimmune CNS disorder.
  • CNS disorders are currently categorised on the basis of particular symptoms or a set of symptoms without necessarily identification of the mechanisms which cause such symptoms. This means that certain CNS disorders actually encompass a spectrum of more specific disease states, each of which may result from distinct mechanisms of action.
  • CNS diseases can be characterised by a wide range of symptoms which may include movement disorders, mood disorders, memory loss, mental confusion, psychiatric disorders, and cognitive dysfunction. Previous studies of CNS disorders have identified possible autoimmune involvement in these disorders.
  • Epitopes are present within the dopamine receptors to which autoantibodies are capable of binding.
  • the present invention provides a method of diagnosing a central nervous system disorder, said method comprising the step of identifying in a subject an antibody capable of binding to a dopamine receptor or fragment thereof.
  • the invention provides a method of diagnosing a central nervous system disorder in a subject said method comprising the step of detecting in a sample of said subject the presence of an antibody capable of binding to a dopamine receptor or fragment thereof wherein the presence of said antibody is indicative of said central nervous system disorder in said subject.
  • the present invention provides a method of characterising a central nervous system disorder in a subject said method comprising the step of identifying in a sample of said subject an antibody capable of binding to a dopamine receptor or fragment thereof.
  • the present invention provides a method of determining a causative effect of a central nervous system disorder in a subject said method comprising the step of identifying in a sample of said subject an antibody capable of binding to a dopamine receptor or fragment thereof.
  • the present invention provides a method of identifying a biomarker of a central nervous system disorder said method comprising the step of identifying in a sample of said subject an antibody capable of binding to a dopamine receptor or fragment thereof wherein said antibody is the biomarker of a central nervous system disorder.
  • the invention provides a method of diagnosing a CNS disorder, characterising a CNS disorder, determining the causative effect of a CNS disorder, or identifying a biomarker of a CNS disorder wherein an increase in the level of an antibody which binds to a dopamine receptor or fragment thereof relative to a predetermined control level is indicative of a CNS disorder.
  • the present invention provides a method according to the invention wherein said dopamine receptor is a D2-class receptor.
  • the invention relates to a method of diagnosing a CNS disorder, characterising a CNS disorder, determining the causative effect of a CNS disorder, or identifying a biomarker of a CNS disorder said method comprising the step of identifying in a sample from a subject an antibody capable of binding to a dopamine D2-class receptor or fragment thereof.
  • dopamine D2-class receptors include D2R.
  • the present invention provides a method according to the invention wherein said dopamine receptor is D2R.
  • the invention provides a method of diagnosing a CNS disorder, characterising a CNS disorder, determining the causative effect of a CNS disorder, or identifying a biomarker of a CNS disorder said method comprising the step of identifying in a sample from a subject an antibody capable of binding to a dopamine receptor D2R or fragment thereof.
  • the invention provides a method of diagnosing a CNS disorder, characterising a CNS disorder, determining the causative effect of a CNS disorder, or identifying a biomarker of a CNS disorder wherein an increase in the level of an antibody which is capable of binding to a dopamine receptor D2R or fragment thereof relative to a
  • predetermined control level is indicative of a CNS disorder.
  • the CNS disorder includes encephalitis, basal ganglia encephalitis, a range of autoimmune movement disorders, for example Sydenham chorea, paediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS), Tourette syndrome, obsessive compulsive disorder (OCD) and other emotional disorders including depression and anxiety, opsoclonus myoclonus, cerebellar ataxia or psychosis.
  • encephalitis for example Sydenham chorea, paediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS), Tourette syndrome, obsessive compulsive disorder (OCD) and other emotional disorders including depression and anxiety, opsoclonus myoclonus, cerebellar ataxia or psychosis.
  • PANDAS paediatric autoimmune neuropsychiatric disorders associated with streptococcal infections
  • OCD obsessive compulsive disorder
  • other emotional disorders including depression and anxiety, opso
  • dopamine receptors or fragments thereof represent an autoantigen(s) that can be used for diagnosing, characterising, determining the causative effect of, or identifying a biomarker of encephalitis, for example basal ganglia encephalitis, a range of autoimmune movement disorders, for example Sydenham chorea, paediatric neuropsychiatric disorders associated with streptococcal infections (PANDAS), Tourette syndrome, obsessive compulsive disorder (OCD) and other emotional disorders including depression and anxiety, opsoclonus myoclonus, cerebellar ataxia or psychosis.
  • a biomarker of encephalitis for example basal ganglia encephalitis
  • a range of autoimmune movement disorders for example Sydenham chorea, paediatric neuropsychiatric disorders associated with streptococcal infections (PANDAS), Tourette syndrome, obsessive compulsive disorder (OCD) and other emotional disorders including depression and anxiety, opsoclonus myo
  • the invention relates to a method of diagnosing, characterising, determining the causative effect of, or identifying a biomarker of a central nervous system disorder selected from the group consisting of encephalitis, of basal ganglia encephalitis, a range of autoimmune movement disorders, for example Sydenham chorea, paediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS), Tourette syndrome, obsessive compulsive disorder (OCD) and other emotional disorders including depression and anxiety, opsoclonus myoclonus, cerebellar ataxia or psychosis said method comprising the step of identifying in a subject an antibody capable of binding to a dopamine D2-class receptor or fragment thereof.
  • a central nervous system disorder selected from the group consisting of encephalitis, of basal ganglia encephalitis, a range of autoimmune movement disorders, for example Sydenham chorea, paediatric autoimmune neuropsychiatric disorders associated with streptococcal
  • the invention provides a method of diagnosing, characterising, determining the causative effect of, or identifying a biomarker of a central nervous system disorder selected from the group consisting of encephalitis, for example basal ganglia encephalitis, a range of autoimmune movement disorders, for example Sydenham chorea, paediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS), Tourette syndrome, obsessive compulsive disorder (OCD) and other emotional disorders including depression and anxiety, opsoclonus myoclonus, cerebellar ataxia or psychosis wherein an increase in the level of an antibody in subject, which binds to a dopamine D2-class receptor or fragment thereof relative to a predetermined control level is indicative of encephalitis, for example basal ganglia encephalitis, a range of autoimmune movement disorders, for example Sydenham chorea, paediatric autoimmune neuropsychiatric disorders associated with streptococ
  • encephalitis for
  • the invention provides a method of diagnosing, characterising, determining the causative effect of, or identifying a biomarker of a central nervous system disorder selected from the group consisting of encephalitis, for example basal ganglia encephalitis, a range of autoimmune movement disorders, for example Sydenham chorea, paediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS), Tourette syndrome, obsessive compulsive disorder (OCD) and other emotional disorders including depression and anxiety, opsoclonus myoclonus, cerebellar ataxia or psychosis said method comprising the step of identifying in a subject an antibody capable of binding to a dopamine receptor, D2R or fragment thereof.
  • encephalitis for example basal ganglia encephalitis
  • a range of autoimmune movement disorders for example Sydenham chorea
  • the invention provides a method of diagnosing, characterising, determining the causative effect of, or identifying a biomarker of a central nervous system disorder selected from the group consisting of encephalitis, for example basal ganglia encephalitis, a range of autoimmune movement disorders, for example Sydenham chorea, paediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS), Tourette syndrome, obsessive compulsive disorder (OCD) and other emotional disorders including depression and anxiety, opsoclonus myoclonus, cerebellar ataxia or psychosis wherein an increase in the level of an antibody which binds to a dopamine D2R or fragment thereof relative to a predetermined control level is indicative of encephalitis, for example basal ganglia encephalitis, a range of autoimmune movement disorders, for example Sydenham chorea, paediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS), Tourette syndrome,
  • the invention provides a method of diagnosing, characterising, determining the causative effect of, or identifying a biomarker of basal ganglia encephalitis said method comprising the step of identifying in a sample from a subject an antibody capable of binding to a dopamine receptor, D2R or fragment thereof.
  • the invention provides a method of diagnosing, characterising, determining the causative effect of, or identifying a biomarker of basal ganglia encephalitis wherein an increase in the level of an antibody capable of binding to a dopamine D2R or fragment thereof relative to a predetermined control level is indicative of basal ganglia encephalitis.
  • the invention provides a method of diagnosing, characterising, determining the causative effect of, or identifying a biomarker of Sydenham chorea said method comprising the step of identifying in a sample from a subject an antibody capable of binding to a dopamine receptor, D2R or fragment thereof.
  • the invention provides a method of diagnosing, characterising, determining the causative effect of, or identifying a biomarker of Sydenham chorea wherein an increase in the level of an antibody capable of binding to a dopamine D2R or fragment thereof relative to a predetermined control level is indicative of Sydenham chorea.
  • the invention provides a method of diagnosing, characterising, determining the causative effect of, or identifying a biomarker of Tourette syndrome said method comprising the step of identifying in a sample from a subject an antibody capable of binding to a dopamine receptor, D2R or fragment thereof.
  • the invention provides a method of diagnosing, characterising, determining the causative effect of, or identifying a biomarker of Tourette syndrome wherein an increase in the level of an antibody capable of binding to a dopamine D2R or fragment thereof relative to a predetermined control level is indicative of Tourette syndrome.
  • the invention provides a method of identifying a biomarker of a central nervous system disorder in a subject wherein said subject is suspected of having or susceptible to a central nervous system disorder said method comprising the step of detecting in a sample from said subject the presence of an antibody capable of binding to a dopamine receptor or fragment thereof wherein the presence of said antibody is the biomarker of the central nervous system disorder.
  • the method of the invention may be used on a subject who is suspected of being susceptible to development of a central nervous system disorder.
  • the invention also provides a method of predicting the risk of a subject developing a central nervous system disorder in particular encephalitis, basal ganglia encephalitis, a range of autoimmune movement disorders, for example Sydenham chorea, paediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS), Tourette syndrome, obsessive compulsive disorder (OCD) and other emotional disorders including depression and anxiety, opsoclonus myoclonus, cerebellar ataxia or psychosis), the method comprising the step of testing for: (a) the presence of an antibody capable of binding to a dopamine receptor in the subject, wherein the presence of the antibody in the subject is indicative of an increased risk of developing the central nervous system disorder relative to a control group; or
  • the subject of the method of the invention is a child. In another embodiment, the subject of the method of the invention is an adult.
  • CNS disorders are categorised on the basis of particular symptoms without necessarily the identification of the mechanisms which cause such symptoms. It would also be clear that symptoms of certain CNS disorders may result from a number of distinct mechanisms of action, which frequently are unknown. Thus for certain CNS disorders, current available methods of treatment are limited to correcting the symptoms of a syndrome of disorders, without addressing the cause of the symptoms of a specific CNS disease state.
  • the present invention relates to a method of diagnosing, characterising, determining the causative effect of, or identifying a biomarker of a CNS disease
  • the invention may be used advantageously to define a specific CNS disease state within a broader spectrum of CNS disorders.
  • the method of the present invention permits the identification of a specific disease state from a syndrome of CNS disorders.
  • Such treatment may include immunotherapy such as administration of corticosteroids, administration of immunoglobulin, plasmapheresis or plasma exchange.
  • the present invention provides a method of treating a central nervous system disorder wherein said central nervous system disorder is identified by the method of the invention said method of treating comprising the step of administering to a subject in need thereof an immune suppressive drug, immunoglobulin, rituximab, cyclophosphamide, a compound capable of inhibiting the binding of an antibody to a dopamine receptor or fragment thereof, plasmapheresis or plasma exchange or a combination thereof.
  • the invention relates to the treatment of encephalitis, for example basal ganglia encephalitis, a range of autoimmune movement disorders, for example Sydenham chorea, paediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS), Tourette syndrome, obsessive compulsive disorder (OCD) and other emotional disorders including depression and anxiety, opsoclonus myoclonus, cerebellar ataxia or psychosis by administering to a subject in need thereof immune suppressive drug, immunoglobulin, rituximab, cyclophosphamide, a compound capable of inhibiting the binding of an antibody to a dopamine receptor or fragment thereof, plasmapheresis or plasma exchange or a combination thereof.
  • encephalitis for example basal ganglia encephalitis
  • a range of autoimmune movement disorders for example Sydenham chorea, paediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS), Tour
  • the treatment options for disease states identified by the method of the present invention would include administering to a subject in need thereof a compound capable of, for example, reducing antibody availability or decreasing antibody production.
  • the compound may be an immune suppressive drug such as a steroid, intravenous immunoglobulin (IVIG), rituximab or cyclophosphamide or a combination thereof.
  • the invention relates to the treatment of encephalitis, for example basal ganglia encephalitis, a range of autoimmune movement disorders, for example Sydenham chorea, paediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS), Tourette syndrome, obsessive compulsive disorder (OCD) and other emotional disorders including depression and anxiety, opsoclonus myoclonus, cerebellar ataxia or psychosis by administering to a subject in need thereof a compound capable of, for example, reducing antibody availability or decreasing antibody production.
  • the compound may be an immune suppressive drug such as steroid, IVIG, rituximab or cyclophosphamide or a combination thereof.
  • the method of the invention allows for the identification of treatments which specifically inhibit the binding of autoantibodies to specific relevant autoantigens.
  • treatments may include the administration of a compound to a subject in need thereof which is capable of inhibiting the binding of an antibody to a dopamine receptor or fragment thereof.
  • the method of the invention allows for the identification of treatments which specifically inhibit the binding of autoantibodies to relevant autoantigens.
  • treatments may include administering to a subject in need thereof a compound which is capable of inhibiting the binding of an antibody to a dopamine D2-class receptor, such as D2R or fragment thereof.
  • the invention in certain embodiments relates to a method of treating a CNS disorder with a compound capable of reducing or abrogating antibody/antigen interaction.
  • This includes for example treating a CNS disorder by administration of a compound capable of inhibiting the binding of an antibody to a dopamine receptor or fragment thereof.
  • the dopamine receptor is a D2-class receptor, such as D2R.
  • the invention relates to a method of treating encephalitis, for example basal ganglia encephalitis, a range of autoimmune movement disorders, for example
  • Sydenham chorea paediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS), Tourette syndrome, obsessive compulsive disorder (OCD) and other emotional disorders including depression and anxiety, opsoclonus myoclonus, cerebellar ataxia or psychosis said method comprising the step of administering to a subject in need thereof a compound capable of inhibiting the binding of an antibody to a dopamine receptor or fragment thereof.
  • the dopamine receptor is a D2-class receptor, such as D2R or fragment thereof.
  • the invention relates to a method of treating basal ganglia encephalitis said method comprising the step of administering to a subject in need thereof immunotherapy such as administration of corticosteroids, administration of
  • the invention relates to a method of treating basal ganglia encephalitis said method comprising the step of administering to a subject in need thereof an immune suppressive drug, an immunoglobulin, rituximab, cyclophosphamide, a compound capable of inhibiting the binding of an antibody to a dopamine receptor or fragment thereof, plasmapheresis or plasma exchange or a combination thereof.
  • the invention relates to a method of treating basal ganglia encephalitis said method comprising the step of administering to a subject in need thereof: a compound capable of inhibiting the binding of an antibody to a dopamine receptor or fragment thereof.
  • the dopamine receptor is a D2-class receptor or fragment thereof, such as D2R or fragment thereof.
  • the invention relates to a method of treating basal ganglia encephalitis said method comprising the step of administering to a subject in need thereof a compound capable of inhibiting the binding of an antibody to the dopamine receptor D2R or fragment thereof.
  • the invention relates to a method of treating Sydenham chorea said method comprising the step of administering to a subject in need thereof a compound capable of inhibiting the binding of an antibody to the dopamine receptor D2R or fragment thereof.
  • the invention relates to a method of treating Tourette syndrome said method comprising the step of administering to a subject in need thereof a compound capable of inhibiting the binding of an antibody to the dopamine receptor D2R or fragment thereof.
  • the compound which inhibits the binding of an antibody to a dopamine receptor or fragment thereof would be understood to include any compound or molecule capable of inhibiting the binding of an antibody to a dopamine receptor or fragment thereof, for example, an antibody or fragment thereof capable of inhibiting the binding of an antibody to a dopamine receptor or fragment thereof.
  • the invention relates to a method of treating encephalitis, for example basal ganglia encephalitis, a range of autoimmune movement disorders, for example Sydenham chorea, paediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS), Tourette syndrome, obsessive compulsive disorder (OCD) and other emotional disorders including depression and anxiety, opsoclonus myoclonus, cerebellar ataxia or psychosis said method comprising the step of administering to a subject in need thereof an antibody or fragment thereof capable of inhibiting the binding of an antibody to a dopamine receptor or fragment thereof.
  • encephalitis for example basal ganglia encephalitis
  • a range of autoimmune movement disorders for example Sydenham chorea, paediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS), Tourette syndrome, obsessive compulsive disorder (OCD) and other emotional disorders including depression and anxiety, opsoclonus
  • the invention also relates to a method of treating a CNS disorder said method comprising the step of administering to a subject in need thereof a compound capable of competing for binding with an antibody to a dopamine receptor or fragment thereof wherein the dopamine receptor or fragment thereof is, for example, a dopamine D2-class receptor, such as D2R or fragment thereof.
  • the invention relates to treating encephalitis, for example basal ganglia encephalitis, a range of autoimmune movement disorders, for example
  • Sydenham chorea paediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS), Tourette syndrome, obsessive compulsive disorder (OCD) and other emotional disorders including depression and anxiety, opsoclonus myoclonus, cerebellar ataxia or psychosis said method comprising the step of administering to a subject in need thereof a compound capable of competing for binding with an antibody capable of binding a dopamine receptor or fragment thereof wherein the dopamine receptor is, for example, a dopamine D2-class receptor, such as D2R or fragment thereof.
  • a dopamine D2-class receptor such as D2R or fragment thereof.
  • the compound capable of competing for binding with an antibody to a dopamine receptor or fragment thereof may include any compound which is capable of competing for binding with an antibody to a dopamine receptor - for example, a soluble dopamine receptor or fragment thereof wherein the soluble dopamine receptor or fragment thereof includes a soluble dopamine D2-class receptor, such as D2R or fragment thereof.
  • the present invention provides a method according to the invention wherein said subject is suspected of being susceptible to development of a CNS disorder. Consequently, it will be clear to the skilled addressee that the methods of "treatment" of the invention may also be used to prevent or slow the onset of the CNS disorder.
  • the present invention provides a method according to the invention wherein said antibody that is capable of binding to a dopamine receptor or fragment thereof is detected in a sample obtained from a subject, for example an ex vivo sample obtained from the subject.
  • said sample obtained from said subject is blood, a blood-derived sample, cerebrospinal fluid or a cerebrospinal fluid-derived sample or CNS tissue.
  • the method of the invention may be carried out using an ex vivo sample of blood, an ex vivo blood-derived sample, ex vivo cerebrospinal fluid, an ex vivo cerebrospinal fluid-derived sample or ex vivo CNS tissue.
  • the method of the invention is carried out using ex vivo blood serum.
  • the present invention provides, a method of identifying an antibody capable of binding to a dopamine receptor or fragment thereof said method comprising the steps of: expressing a dopamine receptor or fragment thereof on the surface of a cell; exposing said surface of the cell to a sample obtained from a subject; and detecting an antibody from said sample obtained from said subject capable of binding to said dopamine receptor or fragment thereof.
  • the invention relates to a method of diagnosing a CNS disorder, characterising a CNS disorder, determining the causative effect of a CNS disorder, or identifying a biomarker of a CNS disorder in a subject comprising the step of detecting in a sample from the subject the presence of an antibody capable of binding to a dopamine receptor or fragment thereof wherein said antibody capable of binding to a dopamine receptor or fragment thereof is detected by a method comprising the steps of:
  • expressing a dopamine receptor or fragment thereof on the surface of a cell exposing said surface of the cell to a sample obtained from the subject; and detecting an antibody capable of binding to said dopamine receptor or fragment thereof from said sample obtained from said subject wherein the presence of said antibody is indicative of said central nervous system disorder in said subject.
  • the method provides for the identification of an increase in the level of an antibody capable of binding to a dopamine receptor or fragment thereof relative to a predetermined control level.
  • the dopamine receptor is a D2-class receptor or fragment thereof, such as D2R or fragment thereof.
  • the phrase "dopamine receptor or fragment thereof” may encompass all of or any part of a dopamine receptor.
  • the dopamine receptor or fragment thereof is a D2-class receptor, such as D2R or fragment thereof.
  • the dopamine receptor or fragment thereof comprises at least one extracellular portion of a dopamine receptor such as D2R.
  • said cell is a eukaryotic cell and more preferably said cell is a mammalian cell.
  • any mammalian cell suitable for the expression of a recombinant proteins for example a CHO cell, could be used in the method of the invention described in paragraphs [0065] to [0069].
  • the cell used in the method described in paragraphs [0065] to [0069] is a human cell and in a particularly preferred embodiment the cell used in the method described in paragraphs [0065] to [0069] is a HEK 293 cell.
  • the invention relates to the method of the invention wherein said antibody capable of binding to a dopamine receptor or fragment thereof is detected by a method comprising the steps of: expressing a dopamine receptor or fragment thereof on the surface of a HEK 293 cell; exposing said surface of the HEK 293 cell to a sample obtained from a subject; and detecting an antibody from said sample obtained from said subject capable of binding to the dopamine receptor or fragment thereof, wherein the presence of said antibody is indicative of a central nervous system disorder in said subject.
  • the method provides for the identification of an increase in the level of an antibody capable of binding to a dopamine receptor or fragment thereof relative to a predetermined control level.
  • the dopamine receptor is a D2-class receptor or fragment thereof, such as D2R or fragment thereof
  • said antibody capable of binding to a dopamine receptor or fragment thereof can be detected by flow cytometry such as fluorescence-activated cell sorting or alternatively by microscopy.
  • the present invention provides a method according to the invention wherein the antibody capable of binding to a dopamine receptor or fragment thereof is detected using a method comprising the steps of: expressing a dopamine receptor or fragment thereof on the surface of a cell; exposing said surface of the cell to a sample obtained from a subject; and detecting by microscopy an antibody from said sample obtained from said subject capable of binding to the dopamine receptor or fragment thereof wherein the presence of said antibody is indicative of a central nervous system disorder in said subject
  • the present invention provides a method according to the invention wherein the antibody capable of binding to a dopamine receptor or fragment thereof is detected using a method comprising the steps of: expressing a dopamine receptor or fragment thereof on the surface of a cell; exposing said surface of the cell to a sample obtained from a subject; and detecting by flow cytometry an antibody from said sample obtained from said subject capable of binding to the dopamine receptor or part thereof wherein the presence of said antibody is indicative of a central nervous system disorder in said subject.
  • said sample obtained from said subject is blood, a blood-derived sample, cerebrospinal fluid or a cerebrospinal fluid- derived sample or CNS tissue.
  • blood-derived sample includes any sample which may be obtained from blood, for example serum, plasma or any blood-derived products which may be isolated from blood including blood-borne proteins such as
  • immunoglobulin for example IgM, IgG, IgE, IgA or IgD.
  • cerebrospinal fluid-derived sample includes any sample which may be obtained from cerebrospinal fluid including, for example, any products which may be isolated from cerebrospinal fluid including cerebrospinal fluid borne proteins such as immunoglobulin for example IgM, IgG, IgE, IgA or IgD.
  • cerebrospinal fluid borne proteins such as immunoglobulin for example IgM, IgG, IgE, IgA or IgD.
  • the present invention also contemplates use of the method of the invention as a means of screening or identifying a compound capable of inhibiting the binding of an antibody to a dopamine receptor or fragment thereof.
  • the present invention further contemplates the use of the method of the invention as a means of screening or identifying a compound capable of competing for binding with an antibody to a dopamine receptor or fragment thereof.
  • the present invention provides a method of identifying a compound capable of inhibiting the binding of an antibody to a dopamine receptor or fragment thereof said method comprising the steps of: expressing a dopamine receptor or fragment thereof on the surface of a cell; exposing said surface of said cell to an antibody capable of binding to said dopamine receptor or fragment thereof; and exposing the surface of said cell to a compound to be tested for inhibiting the binding of said antibody to said dopamine receptor or fragment thereof.
  • the present invention provides a method of identifying a compound capable of competing for binding with an antibody to a dopamine receptor or fragment thereof said method comprising the steps of: expressing a dopamine receptor or fragment thereof on the surface of a cell; exposing said surface of said cell to an antibody capable of binding to said dopamine receptor or fragment thereof; and exposing the surface of said cell to a compound to be tested for competing for binding with said antibody to said dopamine receptor or fragment thereof.
  • the present invention provides a method according to the invention wherein said antibody capable of binding to a dopamine receptor or fragment thereof is detected by a method which detects said antibody capable of binding to a dopamine receptor or fragment thereof in vivo.
  • the present invention in one aspect, provides use of an immune suppressive drug, an immunoglobulin, rituximab, cyclophosphamide, a compound capable of inhibiting the binding of an antibody to a dopamine receptor or fragment thereof or a combination thereof in the preparation of a medicament for the treatment of a central nervous system disorder identified by the method of the invention.
  • the invention provides use of an immune suppressive drug, an immunoglobulin, rituximab, cyclophosphamide, a compound capable of inhibiting the binding of an antibody to a dopamine receptor or fragment thereof or a combination thereof in the preparation of a medicament for the treatment of basal ganglia encephalitis, Sydenham chorea or Tourette Sydnrome
  • the invention provides an immunoglobulin, rituximab,
  • the invention provides an immunoglobulin, rituximab, cyclophosphamide, or a compound capable of inhibiting the binding of an antibody to a dopamine receptor or fragment thereof or a combination thereof for use in a method of treating basal ganglia encephalitis, Sydenham chorea or Tourette syndrome.
  • biomarker includes an indicator of a particular disease state or state of a subject. It can be used to identify a subject with a disease or having a risk of developing a disease.
  • the term “child” includes a subject up to the age of 18 years of age.
  • the term “adult” includes a subject over 18 years of age.
  • predetermined control level insofar as it relates to the level of an antibody, refers the level of an antibody that is exhibited by a population of subjects who do not exhibit or who are not susceptible to a central nervous system disorder as described herein. Methods of determining the predetermined control level of an antibody would be clear to the skilled addressee.
  • FIG. 1 Basal ganglia encephalitis serum is negative for NMDAR antibody but is immunoreactive to hippocampal and striatal primary neurons.
  • A Antibody reactivity to the subunit 1 of NMDAR (NR1 ) was determined by flow cytometry cell-based assay using
  • Sera from healthy control (HC), other neurological disease (OND), first episode of demyelination syndromes (DEM), viral encephalitis (V ENC), N-Methyl D-Aspartate Receptor encephalitis (NMDAR ENC), and basal ganglia encephalitis (BG ENC) were incubated with live HEK293 NR and HEK293 NR " cells at 1 :50 dilution, followed by AF647-conjugated anti-human IgG secondary antibody, and flow cytometry analysis.
  • AMFI was calculated using MFI obtained with live HEK293 NR + and HEK293 NR " .
  • Positivity threshold was determined by AMFI of three SD above the mean of HC (dotted line on graph).
  • NR1 antibody was detected in 0/17 BG ENC and 0/59 controls, but in all 8 NMDAR ENC patients. Representative dot plot out of three experiments is shown.
  • C Representative example of flow cytometry histograms for one NMDAR antibody-positive patient. MFI values are noted in legend.
  • E Fixed and live neurons (15 days in vitro) were co-labelled with two BG ENC or one HC sera followed by AF647 anti-human IgG secondary antibody (pseudocolored in green), then live neurons were fixed, and all neurons were permeabilized and stained with anti-neuron-specific microtubule- associated protein 2 (MAP2) antibody (red) followed by appropriate secondary antibody.
  • MAP2 anti-neuron-specific microtubule- associated protein 2
  • BG ENC immunolabelled non permeabilized dendrites and cell bodies of fixed MAP2+ neurons, whereas surface dendrites were immunolabelled in live MAP2+ neurons. Bar scale, 6.6 ⁇ in D, and 20 ⁇ in E. Representative images are shown. Nuclei stained with DAPI.
  • FIG. 2 Basal ganglia encephalitis is associated with D2R antibody.
  • A Antibody reactivity to D2R was determined by flow cytometry cell-based assay.
  • B Human surface D2R IgG antibody was detected in 12/17 BG ENC and 0/67 controls. Dotted line on graph represents the positivity threshold. Representative dot plot out of five experiments is shown. Samples were considered positive if they were above threshold at least four times out of five repeated experiments.
  • C Representative example of flow cytometry histograms for one D2R antibody-positive patient, and (D) for staining controls on live HEK293 D2R" (left) and
  • HEK293 D2R+ cells (right). Controls shown are cells stained with secondary AF647-conjugated anti-rabbit IgG antibody only (II Ab anti rab IgG; secondary antibody for the anti-hematoglutinin (HA) Ab), secondary AF647-conjugated anti-human IgG antibody only (II Ab anti hum IgG; secondary antibody for human serum). For comparison, staining of cells with anti-HA antibody followed by the appropriate secondary antibody is also shown (I and II Ab anti-HA). Only the latter staining gives a high MFI on HEK293 D2R+ cells. MFI values are noted in legend. (E) Low levels of immunoglobulin M (IgM) were detected in 2/10 patients positive for D2R IgG antibody. 10/12 D2R ENC sera were available for testing due to inadequate sera. Representative dot plot out of three experiments is shown.
  • IgM immunoglobulin M
  • FIG. 3 Immunoreactivity of basal ganglia encephalitis, N-MethylD-Aspartate Receptor encephalitis, and healthy control sera in the striatum of wild-type and D2R knock-out mice.
  • WT wild-type
  • HC healthy control
  • BG ENC D2R knock-out
  • N-Methyl-D-Aspartate Receptor encephalitis immunolabelling was still observed (NMDAR ENC, D).
  • the same basal ganglia encephalitis serum is showed in A and C. Lower rows of A, B, and C are 3.05-fold digital zoom from top images (white rectangle), and show co-localization between MAP2 and serum staining.
  • CC corpus callosum
  • S striatum
  • ILV left lateral ventricle.
  • Nuclei stained with DAPI Bar, 100 ⁇ and bar, 50 ⁇ (zoomed images). Representative images are shown.
  • FIG. 4 (A) Immunocytochemistry on fixed unpermeabilized HEK293 D2R+ cells confirmed basal ganglia encephalitis IgG co-labelled GFP-positive and hematoglutinin-D2R- positive (red) cells (GFP shown in green, left panel). Both hematoglutinin-D2R and basal ganglia encephalitis (BG ENC) IgG immunoreactivities are localized on the cell surface, whereas GFP is cytoplasmic. Healthy control (HC) IgG showed no significant
  • Immunoabsorption of basal ganglia encephalitis sera with HEK293 D2R+ cells also significantly reduced the surface labelling of HEK293 D2R+ cells (C), primary MAP2+ neurons (D), and brain wild-type sections (E) compared to immunoabsorption with HEK293 D2R" cells.
  • C corpus callosum
  • S striatum
  • ILV left lateral ventricle.
  • Nuclei stained with DAPI Bar, 6.70 ⁇ in C; bar, 10 ⁇ in D; and bar, 100 ⁇ in E. Representative images are shown.
  • FIG. 5 D2R antibody-positive encephalitis is associated with normal and abnormal brain MRI.
  • MRI were normal in 6/12 D2R antibody-positive encephalitis acute patients (upper panel), and abnormal in 6/12 D2R antibody-positive encephalitis acute patients (lower panel).
  • T2 axial image shows enhancement in caudate, putamen and globus pallidus
  • T2 FLAIR coronal image shows enhancement in substantia nigra.
  • FIG. 6 Sydenham chorea and Tourette syndrome, are associated with D2R antibody.
  • A Human surface D2R IgG antibody was detected in 10/30 Sydenham chorea (SC), 4/44 Tourette syndrome (TS), and 0/40 healthy control (HC) and other neurological diseases (OND) controls.
  • the dotted line on graph A represents the positivity threshold. Representative dot plots out of four (D2R) experiments are shown.
  • FIG. 7 Immunoreactivity of Sydenham chorea and Tourette sydrome sera in the striatum of wild-type and D2R knock-out D2R (-/-) mice.
  • D2R IgG antibody-positive Sydenham chorea (SC, A) and Tourette syndrome (TS, B) sera green) immunolabelled dendrites and cell bodies of MAP2+ neurons (red) in striatum of wild-type mouse.
  • the immunolabelling of Sydenham chorea (C) and Tourette syndrome (D) sera was significantly decreased in D2R knock-out striatum.
  • the same Sydenham chorea and Tourette syndrome sera are showed in A and C, and B and D, respectively.
  • Lower rows of A, B, C, and D are 3.05-fold digital zoom from top images (white rectangle), and show co-localization between MAP2 and serum staining.
  • CC corpus callosum
  • S striatum
  • rLV right lateral ventricle.
  • FIG. 8 Anti-D2R antibody-positive encephalitis sera do not bind hemagglutinin. Because the extracellular N-terminus of D2R cDNA is tagged with the human influenza hemagglutinin (HA) tag, we controlled that anti-D2R IgG antibody detected in basal ganglia encephalitis (BG ENC) did not bind to the hemagglutinin tag using hemagglutinin-syntaxin 4. Extracellular C-terminal hemagglutinin-syntaxin 4 was expressed at the surface HEK293 cells (A), and we performed cell-based assays. Threshold was defined as mean of healthy control + 3SD (dotted line on graph).
  • HA human influenza hemagglutinin
  • BG ENC basal ganglia encephalitis
  • Figure 9 Acute (A) and convalescent (C) anti-D2R antibody in three basal ganglia encephalitis patients.
  • Patients A and B were diagnosed retrospectively with anti-D2R antibody- positive encephalitis, whereas patient C was diagnosed prospectively.
  • Patient A a 5 year old female presented with encephalitis, dystonia-parkinsonism, and confusion.
  • Her MRI was normal and she was treated with oral prednisolone 2mg/kg for 2 weeks then a 6 week taper. The patient was reported to have made little improvement at annual reviews, and at 5 year follow-up she has residual hemidystonia, attention deficit disorder, rigid behaviours, and her anti-D2R antibodies remain elevated.
  • Patient B a 3 year old male presented with encephalitis, encephalopathy, dystonia-parkinsonism, and agitation. His MRI showed caudate and putamen lesions. He was treated with intravenous methylprednisolone 30mg/kg for 3 days then oral prednisolone 2mg/kg for 2 weeks, then an 8 week steroid taper. The patient was reported to have made little improvement at annual reviews, and at 8 year follow-up he has residual coordination disorder, anxiety, and mild learning difficulties and his anti-D2R antibodies remain elevated.
  • Patient C a 3 year old female presented with encephalitis with chorea, ataxia, ocular flutter, developmental regression, and two relapses in the first 12 months.
  • Her MRI was normal. She was given 2g/kg of intravenous immunoglobulin monthly for three months. She was also given oral prednisolone 2mg/kg/day for one month and remains on 1 mg/kg prednisolone on alternate days. One year after starting treatment, her chorea and ataxia have resolved, she has made significant developmental gains, and her development is now normal. Her anti-D2R antibody is now within the healthy control range (below threshold of positivity). Dotted lines on graphs represent the positivity threshold (obtained with 24 HC samples). P: prednisolone; IVIG: intravenous immunoglobulin. Representative dot plot out of three experiments is shown.
  • Serum used in antibody studies was from the first week of the acute admission, and before immune therapy (except in Fig. 9 in which convalescent samples were also used).
  • serum from 67 paediatric controls as outlined in Table 3.
  • the controls included viral encephalitis, N-Methyl D-Aspartate Receptor encephalitis, inflammatory demyelination, and basal ganglia disease of defined metabolic, genetic, or degenerative origin.
  • Table 1 Summary of clinical details in the patient cohorts
  • ADHD Attention deficit hyperactivity disorder
  • OCD Obsessive compulsive disorder or behaviour
  • ODD Oppositional defiant disorder
  • GAD generalised anxiety disorder
  • IgG immunoglobulin G
  • Basal ganglia controls included Wilson's disease, Leigh disease, Glutaric aciduria type 1 , basal ganglia stroke, Huntington disease
  • Viral encephalitis confirmed aetiology using CSF PCR
  • plRES2-GFP vector (Clontech, Mountain View, USA), a vector suitable for expression of N-terminal hemaglutinin-tagged transmembrane antigens with enhanced green fluorescent protein (GFP) reporter under control of a internal ribosome entry site (IRES) enabling both DR and GFP to be co-expressed in cells separately.
  • GFP enhanced green fluorescent protein
  • IRES internal ribosome entry site
  • Syntaxin 4 is a single-pass type IV membrane protein of 298 amino acids with only three extracellular amino acids (C terminus AA296 to 298) followed by the HA tag. Syntaxin 4 therefore “anchors" the hemaglutinin tag at the cell surface, and is a useful control for hematoglutinin immunoreactivity.
  • Lipofectamine was used to transfect human embryonic kidney 293 (HEK293) cells to obtain surface antigen-expressing cells (HEK293NR1+ and D2R+ cells) according to the manufacturer's instructions (Invitrogen). Control cells (HEK293NR1-and D2R-, cells) were obtained by transfection of HEK293 cells with empty vectors, either pcDNA-GFP or plRES2-GFP.
  • any type of eukaryotic cell transfection reagent for example polyethylenimine, can also be used to transfect cells.
  • Transiently transfected cells were washed and the culture medium was changed 6 hours after transfection and cells were kept in culture at 37C for a further two days post transfection. At that time, the cells were then harvested using versene (Invitrogen) and washed in PBS supplemented with 2% FBS (PBS/FBS) before cell-based assay. Additionally, GFP-positive HEK293D2R+ cells were sorted by flow cytometry, and cultured under 250 ⁇ g/ml of geneticin (Invitrogen) in order to obtain a polyclonal stable transfectant. High levels of surface expression of D2R and NMDAR after transfection were assessed by flow cytometry (Fig 1Aand 2A).
  • FACS analysis was used to detect antibody binding of patient serum IgG to surface brain antigens transfected in HEK293 cells. Specifically, two days after
  • the cells were harvested using versene (Invitrogen) and washed in PBS supplemented with 2% FBS (PBS/FBS).50,000 cells were then incubated with serum at a 1 :100 dilution in V-bottom plate (Corning) for 30 min at room temperature. Cells were then washed three times with 200 ⁇ PBS/FBS, and incubated with Alexa Fluor 647-conjugated goat anti-human IgG secondary antibody (Invitrogen) for 30 min at room temperature. Cells were washed three times with PBS/FBS, and then resuspended in 50 ⁇ PBS/FBS before analysis. Before acquisition, viability dye 7-AAD (BD Biosciences) was added to the cells to exclude dead cells.
  • viability dye 7-AAD BD Biosciences
  • Embryonic E16.5 mouse hippocampal and striatal neurons were cultured as previously described (Fath et al., 2009). Primary neurons and stably transfected HEK293 were fixed on 4% paraformaldehyde, and incubated with patient or control sera (diluted at 1 :50), primary antibodies, purified human IgG, and/or immunoabsorbed sera. Cells were then washed and incubated with a secondary Alexa Fluor 647-conjugated anti human IgG antibody, or appropriate secondary antibodies (Invitrogen).
  • live neurons were washed and incubated with patient and control sera (diluted 1 :50) followed by incubation with appropriate secondary antibody before fixation/permeabilization and incubation with anti-rabbit polyclonal anti-microtubule-associated protein 2 antibody (MAP2, Millipore, Billerica, MA, USA).
  • MAP2, Millipore, Billerica, MA, USA anti-rabbit polyclonal anti-microtubule-associated protein 2 antibody
  • two sera from control and D2R antibody-positive patients selected for positivity for D2R antibody by flow cell-based assay and adequate volume of serum available
  • six wells of live unpermeabilized HEK293 D2R+ or HEK293 D2R" cells Irani et al., 2010; Lai et al., 2010).
  • Pentobarbitone (100mg/kg), and then transcardially perfused with heparinized 0.1 M PBS at 37°C followed by fresh 4% paraformaldehyde in 0.1 M PBS. Brains were embedded in optimum cutting temperature (OCT) and immediately frozen in a dry ice-acetone bath.
  • OCT optimum cutting temperature
  • Case 1 A male Caucasian patient whose father had Tourette syndrome and attention deficit hyperactivity disorder presented with his tic disorder at 5 years of age. At the time of serum testing (15 years), he had severe Tourette syndrome plus comorbid attention deficit hyperactivity disorder, oppositional defiant disorder, obsessive compulsive disorder, generalised anxiety disorder and depression, and was severely impaired despite multiple medication trials. His anti-Streptolysin-0 titre (ASOT) at time of serum testing was elevated at 400 lU/ml, but there was never any infection-associated exacerbations during his disease course.
  • ASOT anti-Streptolysin-0 titre
  • Case 2 A male Asian patient with no family history of note presented at 6 years of age with tic disorder. At the time of serum testing (7 years of age) he had motor and vocal tics for more than 12 months, but had no associated comorbidity. His course waxed and waned but his impairment did not require medical treatment. His ASOT was negative at 50 lU/ml, and there has never been any infection-associated exacerbations during his disease course.
  • Case 3 A female Caucasian patient whose mother has longstanding throat clearing presented at 7 years of age with tic disorder. The patient has had motor and vocal tics for 8 years, and her course has relapsed and remitted in a more exaggerated way than typical Tourette syndrome, but there has never been a deterioration associated with infection. At the time of serum testing (15 years old), she still has Tourette syndrome, but no associated comorbidity. Her ASOT at the time of serum testing was negative at 55 lU/ml.
  • Case 4 A female Caucasian patient whose sister has alopecia and father has obsessive-compulsive disorder presented at 4 years of age with tic disorder. At the time of serum testing (8 years), she had Tourette syndrome, generalised anxiety disorder, separation anxiety, and obsessive compulsive behaviour. She has had a predisposition to Streptococcal infections, but there have not been any clear infection-associated exacerbations. Her ASOT at the time of serum testing was elevated at 455 lU/ml. Results
  • the symptoms at onset were variable although lethargy, psychiatric symptoms, abnormal movements, or gait disturbance were typical.
  • the established clinical syndrome was dominated by a spectrum of movement disorders including dystonia, parkinsonism, and chorea. Many of the patients with dystonia had coarse tremor compatible with dystonic tremor.
  • Oculogyric crises occurred in three patients with dystonia or parkinsonism, and ocular flutter occurred in one child with chorea and ataxia.
  • Psychiatric disturbance occurred in 9/1 2, particularly agitation, emotional lability, anxiety, and psychotic symptoms. Sleep disturbance, lethargy, drowsiness, brainstem dysfunction, seizures, and ataxia occurred less commonly.
  • a search for a tumour was not routinely performed although searching for neuroblastoma in four patients was negative.
  • Brain MRI was normal in 6/12 (Table 4), but when abnormal showed inflammatory changes localising to basal ganglia and brainstem structures (Fig. 5).
  • the CSF was abnormal in 9/1 2 patients although pleocytosis occurred in only three patients, and the median CSF cell count was 1 lymphocyte/mm 3 (Table 5).
  • the EEG was either normal or showed non-specific slowing compatible with encephalopathy. No patient had epileptic features on EEG. Characteristic Anti-D2R Anti-D2R
  • Dystonia including dystonic tremor 5/12 4/5
  • IVIG Intravenous immunoglobulin
  • ⁇ ADD Attention deficit disorder
  • ODD Oppositional defiant disorder
  • ASD autistic spectrum disorder
  • ADD Attention deficit disorder
  • ODD oppositional defiant disorder
  • OCD obsessive- compulsive disorder
  • OGC oculogyric crises
  • Encephalitis complicated by movement disorders has previously been termed encephalitic Parkinsonism, encephalitis lethargica, basal ganglia acute disseminated encephalomyelitis, or bilateral striatal necrosis (Dale ef a/Ann Neurol. 2009; 66(5): 704-9)
  • the inventors have previously shown that some encephalitis patients with dyskinesias,
  • Elevated dopamine-2 receptor immunoglobulin G were also found in 10/30 Sydenham chorea patients and 4/44 Tourette syndrome patients. Thus dopamine-2 receptor antibodies can define autoimmune movement and psychiatric disorders.
  • MR imaging was normal in 50% of anti-D2R encephalitis cases, but when abnormal lesions were strongly localised to the basal ganglia.
  • MRI is often normal in anti-D2R encephalitis and anti-NMDAR encephalitis which emphasizes the importance of autoantibodies in the identification of these disorders.
  • anti-NMDAR encephalitis most of the anti-D2R encephalitis patients did not have CSF pleocytosis, although elevated protein, neopterin, or oligoclonal bands were common.
  • EEG was rarely contributory, and often normal, further suggesting anti-D2R antibody encephalitis predominantly affects subcortical rather than cortical regions, in contrast to anti-NMDAR encephalitis which affects both.
  • both syndromes are typically post-infectious movement disorders evolving over days or weeks, both syndromes can respond to immune therapies, and both syndromes have a small but significant risk of relapse.
  • streptococcal infection was evident in all D2R antibody-positive Sydenham chorea patients, only a minority of basal ganglia encephalitis patients had positive streptococcal serology, suggesting that D2R antibody is not dependent upon streptococcal immunoreactivity.
  • the D2R antibody-positive encephalitis patients also tended to have a more severe clinical syndrome than Sydenham chorea, and were more likely to have basal ganglia radiological abnormalities and residual impairments.
  • Greenfield and Wolfsohn reported in 1922 that the pathology of basal ganglia encephalitis (so called encephalitis lethargica) and Sydenham chorea showed significant similarities, with perivenous inflammation predominantly affecting the striatum.
  • dopamine receptor or DAT antibody encephalitis for example D2R antibody encephalitis could represent an autoimmune model of parkinsonism, dystonia, chorea, psychosis, and attention deficit disorder.
  • anti-dopamine receptor antibody for example anti-D2R antibody can provide a biomarker which could assist in early intervention and improve outcome in patients presenting with a range of CNS disease states including encephalitis, basal ganglia encephalitis, a range of autoimmune movement disorders, for example Sydenham chorea, paediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS), Tourette syndrome, obsessive compulsive disorder (OCD) and other emotional disorders including depression and anxiety, opsoclonus myoclonus, cerebellar ataxia and psychosis. It may also be useful in the prediction of the risk of developing a CNS disease.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Hematology (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Biochemistry (AREA)
  • Analytical Chemistry (AREA)
  • Public Health (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Food Science & Technology (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Zoology (AREA)
  • Virology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

The present invention relates to a method of diagnosing or characterising a central nervous system disorder (CNS). The invention may also be useful in predicting the risk of developing a CNS disorder. The invention also relates to the identification of a biomarker of a CNS disorder. More specifically, the present invention contemplates the identification of an autoantibody to dopamine receptor D2R in a subject as a biomarker of a CNS disorder. The invention also relates to the treatment of a CNS disorder. Specifically, the invention contemplates the treatment of an autoimmune CNS disorder such as Sydenham's chorea, Tourette syndrome or basal ganglial encephalitis with an antagonist to antibodies to dopamine receptor D2R, such as soluble D2R.

Description

Assay for a biomarker of a central nervous system disorder Field of the Invention
[0001 ] The present invention relates to a method of diagnosing or characterising a central nervous system disorder (CNS). The invention may also be useful in predicting the risk of developing a CNS disorder. The invention also relates to the identification of a biomarker of a CNS disorder. More specifically, the present invention contemplates the identification of an autoantibody in a subject as a biomarker of a CNS disorder. The invention also relates to the treatment of a CNS disorder. Specifically, the invention contemplates the treatment of an autoimmune CNS disorder.
Background
[0002] Any discussion of the prior art throughout the specification should in no way be considered as an admission that such prior art is widely known or forms part of common general knowledge in the field.
[0003] Many CNS disorders are currently categorised on the basis of particular symptoms or a set of symptoms without necessarily identification of the mechanisms which cause such symptoms. This means that certain CNS disorders actually encompass a spectrum of more specific disease states, each of which may result from distinct mechanisms of action.
[0004] Without knowing the mechanism of action of a CNS disease state, current methods of treatment are often limited to addressing symptoms, without treating the cause of the symptoms. Thus early detection and specific characterisation of many CNS diseases remains difficult. Moreover, effective early treatment and improved outcomes for subjects presenting with certain CNS diseases remains elusive.
[0005] Autoimmune encephalitis is a recently recognized and important spectrum of CNS disorders currently defined by the presence of autoantibodies in the brain and cerebrospinal fluid. In certain CNS disease states, such autoantibodies are postulated to bind to proteins involved in neurotransmission thus perturbing signal transduction. [0006] Previously it has been shown that, for example, a high percentage of patients presenting with the CNS syndrome encephalitis lethargica (EL) exhibited antibodies reactive against human basal ganglia antigens (Dale et al Brain (2004) 127 21 -31 ). Specifically, in this study a number of unidentified autoantigens were detected predominantly in the range of 40, 45 and 60kDa. However, there is no disclosure in this study of the identity of the autoantigens Moreover, detection of the autoantigens relied on a methodology which fails to detect conformationally relevant autoantigens. Thus, this study provides no clue as to the identification of a specific autoantigen which may be involved in the onset of symptoms. Additionally, there is no indication that an autoantigen may be used as a biomarker to identify specific disease state which may exist within the syndrome of EL.
[0007] The identification of reliable autoantibody biomarkers for certain CNS disorders remains elusive as a result of the inherent complexity of the causative mechanisms of CNS disorders. In this regard, (Tanaka ef a/ (2003) Journal of Neuroimmunology 141 155-164) investigated the presence of autoantibodies against CNS antigens such as muscarinic cholinergic receptor 1 , mu opioid receptor 5-hydroxytryptamine receptor 1 A and dopamine receptor D2 in subjects with a range of central nervous system disorders. The results of this study identified some subjects who exhibited antibodies to antigens in the brain. However, as the percentage of subjects exhibiting these autoantigens was very low for the majority of cases, none of the identified autoantibodies could reliably be used as a biomarker for the tested CNS diseases.
[0008] At the present time, there are no autoantibodies that may be reliably used to better characterise or diagnose CNS disorders. Accordingly, many CNS disorders are currently vaguely described as part of a larger syndrome of CNS disease states. Without effective CNS biomarkers which aid in early detection and characterisation of specific CNS disease states, the treatment of such diseases will remain less than optimal thus potentially resulting in poor patient outcomes.
[0009] It is an object of the present invention to overcome or ameliorate at least one of the disadvantages of the prior art, or to provide a useful alternative.
Summary of the Invention
[0010] CNS diseases can be characterised by a wide range of symptoms which may include movement disorders, mood disorders, memory loss, mental confusion, psychiatric disorders, and cognitive dysfunction. Previous studies of CNS disorders have identified possible autoimmune involvement in these disorders.
[001 1 ] The inventors have surprisingly found that dopamine receptors represent
autoantigens that define specific central nervous system disorders. Epitopes are present within the dopamine receptors to which autoantibodies are capable of binding.
[0012] In particular, it has been found that subjects who present with symptoms of certain CNS disorders have autoantibodies to dopamine receptors. It has not escaped the inventors' attention that the presence of such autoantibodies may be used effectively as a biomarker(s) to diagnose or characterise specific CNS disease states which exist within an incompletely understood CNS disorder syndrome characterised on the basis of patient symptoms. They may also be useful in a method of predicting the risk of development of a CNS.
[0013] Accordingly in a one aspect, the present invention provides a method of diagnosing a central nervous system disorder, said method comprising the step of identifying in a subject an antibody capable of binding to a dopamine receptor or fragment thereof.
[0014] Specifically, the invention provides a method of diagnosing a central nervous system disorder in a subject said method comprising the step of detecting in a sample of said subject the presence of an antibody capable of binding to a dopamine receptor or fragment thereof wherein the presence of said antibody is indicative of said central nervous system disorder in said subject.
[0015] In another aspect, the present invention provides a method of characterising a central nervous system disorder in a subject said method comprising the step of identifying in a sample of said subject an antibody capable of binding to a dopamine receptor or fragment thereof.
[0016] In a another aspect, the present invention provides a method of determining a causative effect of a central nervous system disorder in a subject said method comprising the step of identifying in a sample of said subject an antibody capable of binding to a dopamine receptor or fragment thereof.
[0017] In another aspect, the present invention provides a method of identifying a biomarker of a central nervous system disorder said method comprising the step of identifying in a sample of said subject an antibody capable of binding to a dopamine receptor or fragment thereof wherein said antibody is the biomarker of a central nervous system disorder.
[0018] Preferably, the invention provides a method of diagnosing a CNS disorder, characterising a CNS disorder, determining the causative effect of a CNS disorder, or identifying a biomarker of a CNS disorder wherein an increase in the level of an antibody which binds to a dopamine receptor or fragment thereof relative to a predetermined control level is indicative of a CNS disorder.
[0019] In certain embodiments, the present invention provides a method according to the invention wherein said dopamine receptor is a D2-class receptor. Thus, the invention relates to a method of diagnosing a CNS disorder, characterising a CNS disorder, determining the causative effect of a CNS disorder, or identifying a biomarker of a CNS disorder said method comprising the step of identifying in a sample from a subject an antibody capable of binding to a dopamine D2-class receptor or fragment thereof.
[0020] It would be clear to the person skilled in the art that dopamine D2-class receptors include D2R.
[0021 ] In one specific embodiment, the present invention provides a method according to the invention wherein said dopamine receptor is D2R. Thus, the invention provides a method of diagnosing a CNS disorder, characterising a CNS disorder, determining the causative effect of a CNS disorder, or identifying a biomarker of a CNS disorder said method comprising the step of identifying in a sample from a subject an antibody capable of binding to a dopamine receptor D2R or fragment thereof.
[0022] Preferably, the invention provides a method of diagnosing a CNS disorder, characterising a CNS disorder, determining the causative effect of a CNS disorder, or identifying a biomarker of a CNS disorder wherein an increase in the level of an antibody which is capable of binding to a dopamine receptor D2R or fragment thereof relative to a
predetermined control level is indicative of a CNS disorder.
[0023] In the context of the method of the present invention, in certain embodiments the CNS disorder includes encephalitis, basal ganglia encephalitis, a range of autoimmune movement disorders, for example Sydenham chorea, paediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS), Tourette syndrome, obsessive compulsive disorder (OCD) and other emotional disorders including depression and anxiety, opsoclonus myoclonus, cerebellar ataxia or psychosis.
[0024] Thus the inventors have discovered that dopamine receptors or fragments thereof represent an autoantigen(s) that can be used for diagnosing, characterising, determining the causative effect of, or identifying a biomarker of encephalitis, for example basal ganglia encephalitis, a range of autoimmune movement disorders, for example Sydenham chorea, paediatric neuropsychiatric disorders associated with streptococcal infections (PANDAS), Tourette syndrome, obsessive compulsive disorder (OCD) and other emotional disorders including depression and anxiety, opsoclonus myoclonus, cerebellar ataxia or psychosis.
[0025] Thus the invention relates to a method of diagnosing, characterising, determining the causative effect of, or identifying a biomarker of a central nervous system disorder selected from the group consisting of encephalitis, of basal ganglia encephalitis, a range of autoimmune movement disorders, for example Sydenham chorea, paediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS), Tourette syndrome, obsessive compulsive disorder (OCD) and other emotional disorders including depression and anxiety, opsoclonus myoclonus, cerebellar ataxia or psychosis said method comprising the step of identifying in a subject an antibody capable of binding to a dopamine D2-class receptor or fragment thereof.
[0026] Preferably, the invention provides a method of diagnosing, characterising, determining the causative effect of, or identifying a biomarker of a central nervous system disorder selected from the group consisting of encephalitis, for example basal ganglia encephalitis, a range of autoimmune movement disorders, for example Sydenham chorea, paediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS), Tourette syndrome, obsessive compulsive disorder (OCD) and other emotional disorders including depression and anxiety, opsoclonus myoclonus, cerebellar ataxia or psychosis wherein an increase in the level of an antibody in subject, which binds to a dopamine D2-class receptor or fragment thereof relative to a predetermined control level is indicative of encephalitis, for example basal ganglia encephalitis, a range of autoimmune movement disorders, for example Sydenham chorea, paediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS), Tourette syndrome, obsessive compulsive disorder (OCD) and other emotional disorders including depression and anxiety, opsoclonus myoclonus, cerebellar ataxia or psychosis. [0027] In one embodiment, the invention provides a method of diagnosing, characterising, determining the causative effect of, or identifying a biomarker of a central nervous system disorder selected from the group consisting of encephalitis, for example basal ganglia encephalitis, a range of autoimmune movement disorders, for example Sydenham chorea, paediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS), Tourette syndrome, obsessive compulsive disorder (OCD) and other emotional disorders including depression and anxiety, opsoclonus myoclonus, cerebellar ataxia or psychosis said method comprising the step of identifying in a subject an antibody capable of binding to a dopamine receptor, D2R or fragment thereof.
[0028] Thus, the invention provides a method of diagnosing, characterising, determining the causative effect of, or identifying a biomarker of a central nervous system disorder selected from the group consisting of encephalitis, for example basal ganglia encephalitis, a range of autoimmune movement disorders, for example Sydenham chorea, paediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS), Tourette syndrome, obsessive compulsive disorder (OCD) and other emotional disorders including depression and anxiety, opsoclonus myoclonus, cerebellar ataxia or psychosis wherein an increase in the level of an antibody which binds to a dopamine D2R or fragment thereof relative to a predetermined control level is indicative of encephalitis, for example basal ganglia encephalitis, a range of autoimmune movement disorders, for example Sydenham chorea, paediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS), Tourette syndrome, obsessive compulsive disorder (OCD) and other emotional disorders including depression and anxiety, opsoclonus myoclonus, cerebellar ataxia or psychosis.
[0029] In a particularly preferred embodiment, the invention provides a method of diagnosing, characterising, determining the causative effect of, or identifying a biomarker of basal ganglia encephalitis said method comprising the step of identifying in a sample from a subject an antibody capable of binding to a dopamine receptor, D2R or fragment thereof.
[0030] Specifically, the invention provides a method of diagnosing, characterising, determining the causative effect of, or identifying a biomarker of basal ganglia encephalitis wherein an increase in the level of an antibody capable of binding to a dopamine D2R or fragment thereof relative to a predetermined control level is indicative of basal ganglia encephalitis. [0031 ] In a further preferred embodiment, the invention provides a method of diagnosing, characterising, determining the causative effect of, or identifying a biomarker of Sydenham chorea said method comprising the step of identifying in a sample from a subject an antibody capable of binding to a dopamine receptor, D2R or fragment thereof.
[0032] Specifically, the invention provides a method of diagnosing, characterising, determining the causative effect of, or identifying a biomarker of Sydenham chorea wherein an increase in the level of an antibody capable of binding to a dopamine D2R or fragment thereof relative to a predetermined control level is indicative of Sydenham chorea.
[0033] In a further preferred embodiment, the invention provides a method of diagnosing, characterising, determining the causative effect of, or identifying a biomarker of Tourette syndrome said method comprising the step of identifying in a sample from a subject an antibody capable of binding to a dopamine receptor, D2R or fragment thereof.
[0034] Specifically, the invention provides a method of diagnosing, characterising, determining the causative effect of, or identifying a biomarker of Tourette syndrome wherein an increase in the level of an antibody capable of binding to a dopamine D2R or fragment thereof relative to a predetermined control level is indicative of Tourette syndrome.
[0035] In a further aspect, the invention provides a method of identifying a biomarker of a central nervous system disorder in a subject wherein said subject is suspected of having or susceptible to a central nervous system disorder said method comprising the step of detecting in a sample from said subject the presence of an antibody capable of binding to a dopamine receptor or fragment thereof wherein the presence of said antibody is the biomarker of the central nervous system disorder.
[0036] In one embodiment, the method of the invention may be used on a subject who is suspected of being susceptible to development of a central nervous system disorder. Thus the invention also provides a method of predicting the risk of a subject developing a central nervous system disorder in particular encephalitis, basal ganglia encephalitis, a range of autoimmune movement disorders, for example Sydenham chorea, paediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS), Tourette syndrome, obsessive compulsive disorder (OCD) and other emotional disorders including depression and anxiety, opsoclonus myoclonus, cerebellar ataxia or psychosis), the method comprising the step of testing for: (a) the presence of an antibody capable of binding to a dopamine receptor in the subject, wherein the presence of the antibody in the subject is indicative of an increased risk of developing the central nervous system disorder relative to a control group; or
(b) the level of an antibody capable of binding to a dopamine receptor in the subject, wherein an increase in the level of the antibody in the subject relative to a control is indicative of an increased risk of developing the central nervous system disorder relative to a control group.
[0037] In one embodiment, the subject of the method of the invention is a child. In another embodiment, the subject of the method of the invention is an adult.
[0038] Without wishing to be bound by theory, the person skilled in the art would
understand that certain CNS disorders are categorised on the basis of particular symptoms without necessarily the identification of the mechanisms which cause such symptoms. It would also be clear that symptoms of certain CNS disorders may result from a number of distinct mechanisms of action, which frequently are unknown. Thus for certain CNS disorders, current available methods of treatment are limited to correcting the symptoms of a syndrome of disorders, without addressing the cause of the symptoms of a specific CNS disease state.
[0039] As the present invention relates to a method of diagnosing, characterising, determining the causative effect of, or identifying a biomarker of a CNS disease, it will be clear to the person skilled in the art that the invention may be used advantageously to define a specific CNS disease state within a broader spectrum of CNS disorders.
[0040] Thus in one embodiment, the method of the present invention permits the identification of a specific disease state from a syndrome of CNS disorders. This
advantageously allows for early effective treatment options which in turn may greatly improve patient outcomes. The person skilled in the art would understand that there are a number of treatment options that are available for treating subjects presenting with autoimmune disorders which would be suitable for the treating disease states identified by the method of the present invention. Such treatment, for example, may include immunotherapy such as administration of corticosteroids, administration of immunoglobulin, plasmapheresis or plasma exchange.
[0041 ] Accordingly, in a further aspect, the present invention provides a method of treating a central nervous system disorder wherein said central nervous system disorder is identified by the method of the invention said method of treating comprising the step of administering to a subject in need thereof an immune suppressive drug, immunoglobulin, rituximab, cyclophosphamide, a compound capable of inhibiting the binding of an antibody to a dopamine receptor or fragment thereof, plasmapheresis or plasma exchange or a combination thereof.
[0042] Preferably, the invention relates to the treatment of encephalitis, for example basal ganglia encephalitis, a range of autoimmune movement disorders, for example Sydenham chorea, paediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS), Tourette syndrome, obsessive compulsive disorder (OCD) and other emotional disorders including depression and anxiety, opsoclonus myoclonus, cerebellar ataxia or psychosis by administering to a subject in need thereof immune suppressive drug, immunoglobulin, rituximab, cyclophosphamide, a compound capable of inhibiting the binding of an antibody to a dopamine receptor or fragment thereof, plasmapheresis or plasma exchange or a combination thereof.
[0043] Thus in certain embodiments, the treatment options for disease states identified by the method of the present invention would include administering to a subject in need thereof a compound capable of, for example, reducing antibody availability or decreasing antibody production. The compound may be an immune suppressive drug such as a steroid, intravenous immunoglobulin (IVIG), rituximab or cyclophosphamide or a combination thereof.
[0044] Preferably, the invention relates to the treatment of encephalitis, for example basal ganglia encephalitis, a range of autoimmune movement disorders, for example Sydenham chorea, paediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS), Tourette syndrome, obsessive compulsive disorder (OCD) and other emotional disorders including depression and anxiety, opsoclonus myoclonus, cerebellar ataxia or psychosis by administering to a subject in need thereof a compound capable of, for example, reducing antibody availability or decreasing antibody production. The compound may be an immune suppressive drug such as steroid, IVIG, rituximab or cyclophosphamide or a combination thereof.
[0045] Advantageously, the method of the invention allows for the identification of treatments which specifically inhibit the binding of autoantibodies to specific relevant autoantigens. For example, treatments may include the administration of a compound to a subject in need thereof which is capable of inhibiting the binding of an antibody to a dopamine receptor or fragment thereof. [0046] In one embodiment, the method of the invention allows for the identification of treatments which specifically inhibit the binding of autoantibodies to relevant autoantigens. For example, treatments may include administering to a subject in need thereof a compound which is capable of inhibiting the binding of an antibody to a dopamine D2-class receptor, such as D2R or fragment thereof.
[0047] Thus, the invention in certain embodiments relates to a method of treating a CNS disorder with a compound capable of reducing or abrogating antibody/antigen interaction. This includes for example treating a CNS disorder by administration of a compound capable of inhibiting the binding of an antibody to a dopamine receptor or fragment thereof. Preferably, the dopamine receptor is a D2-class receptor, such as D2R.
[0048] Preferably, the invention relates to a method of treating encephalitis, for example basal ganglia encephalitis, a range of autoimmune movement disorders, for example
Sydenham chorea, paediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS), Tourette syndrome, obsessive compulsive disorder (OCD) and other emotional disorders including depression and anxiety, opsoclonus myoclonus, cerebellar ataxia or psychosis said method comprising the step of administering to a subject in need thereof a compound capable of inhibiting the binding of an antibody to a dopamine receptor or fragment thereof. Preferably, the dopamine receptor is a D2-class receptor, such as D2R or fragment thereof.
[0049] In a preferred embodiment, the invention relates to a method of treating basal ganglia encephalitis said method comprising the step of administering to a subject in need thereof immunotherapy such as administration of corticosteroids, administration of
immunoglobulin, plasmapheresis or plasma exchange.
[0050] In a further embodiment, the invention relates to a method of treating basal ganglia encephalitis said method comprising the step of administering to a subject in need thereof an immune suppressive drug, an immunoglobulin, rituximab, cyclophosphamide, a compound capable of inhibiting the binding of an antibody to a dopamine receptor or fragment thereof, plasmapheresis or plasma exchange or a combination thereof.
[0051 ] In a specific embodiment, the invention relates to a method of treating basal ganglia encephalitis said method comprising the step of administering to a subject in need thereof: a compound capable of inhibiting the binding of an antibody to a dopamine receptor or fragment thereof.
[0052] In a specific embodiment, the dopamine receptor is a D2-class receptor or fragment thereof, such as D2R or fragment thereof.
[0053] In a particularly preferred embodiment, the invention relates to a method of treating basal ganglia encephalitis said method comprising the step of administering to a subject in need thereof a compound capable of inhibiting the binding of an antibody to the dopamine receptor D2R or fragment thereof.
[0054] In a further preferred embodiment, the invention relates to a method of treating Sydenham chorea said method comprising the step of administering to a subject in need thereof a compound capable of inhibiting the binding of an antibody to the dopamine receptor D2R or fragment thereof.
[0055] In yet a further preferred embodiment, the invention relates to a method of treating Tourette syndrome said method comprising the step of administering to a subject in need thereof a compound capable of inhibiting the binding of an antibody to the dopamine receptor D2R or fragment thereof.
[0056] In the context of the present invention, the compound which inhibits the binding of an antibody to a dopamine receptor or fragment thereof would be understood to include any compound or molecule capable of inhibiting the binding of an antibody to a dopamine receptor or fragment thereof, for example, an antibody or fragment thereof capable of inhibiting the binding of an antibody to a dopamine receptor or fragment thereof.
[0057] Thus in one embodiment, the invention relates to a method of treating encephalitis, for example basal ganglia encephalitis, a range of autoimmune movement disorders, for example Sydenham chorea, paediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS), Tourette syndrome, obsessive compulsive disorder (OCD) and other emotional disorders including depression and anxiety, opsoclonus myoclonus, cerebellar ataxia or psychosis said method comprising the step of administering to a subject in need thereof an antibody or fragment thereof capable of inhibiting the binding of an antibody to a dopamine receptor or fragment thereof. [0058] The invention also relates to a method of treating a CNS disorder said method comprising the step of administering to a subject in need thereof a compound capable of competing for binding with an antibody to a dopamine receptor or fragment thereof wherein the dopamine receptor or fragment thereof is, for example, a dopamine D2-class receptor, such as D2R or fragment thereof.
[0059] Thus, in one embodiment, the invention relates to treating encephalitis, for example basal ganglia encephalitis, a range of autoimmune movement disorders, for example
Sydenham chorea, paediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS), Tourette syndrome, obsessive compulsive disorder (OCD) and other emotional disorders including depression and anxiety, opsoclonus myoclonus, cerebellar ataxia or psychosis said method comprising the step of administering to a subject in need thereof a compound capable of competing for binding with an antibody capable of binding a dopamine receptor or fragment thereof wherein the dopamine receptor is, for example, a dopamine D2-class receptor, such as D2R or fragment thereof.
[0060] In the context of the present invention, it would be understood that the compound capable of competing for binding with an antibody to a dopamine receptor or fragment thereof may include any compound which is capable of competing for binding with an antibody to a dopamine receptor - for example, a soluble dopamine receptor or fragment thereof wherein the soluble dopamine receptor or fragment thereof includes a soluble dopamine D2-class receptor, such as D2R or fragment thereof.
[0061 ] In one embodiment, the present invention provides a method according to the invention wherein said subject is suspected of being susceptible to development of a CNS disorder. Consequently, it will be clear to the skilled addressee that the methods of "treatment" of the invention may also be used to prevent or slow the onset of the CNS disorder.
[0062] Preferably, the present invention provides a method according to the invention wherein said antibody that is capable of binding to a dopamine receptor or fragment thereof is detected in a sample obtained from a subject, for example an ex vivo sample obtained from the subject. Preferably, said sample obtained from said subject is blood, a blood-derived sample, cerebrospinal fluid or a cerebrospinal fluid-derived sample or CNS tissue. [0063] Thus it would be clear to the skilled addressee that the method of the invention may be carried out using an ex vivo sample of blood, an ex vivo blood-derived sample, ex vivo cerebrospinal fluid, an ex vivo cerebrospinal fluid-derived sample or ex vivo CNS tissue.
[0064] In a particularly preferred embodiment, the method of the invention is carried out using ex vivo blood serum.
[0065] In a further aspect the present invention provides, a method of identifying an antibody capable of binding to a dopamine receptor or fragment thereof said method comprising the steps of: expressing a dopamine receptor or fragment thereof on the surface of a cell; exposing said surface of the cell to a sample obtained from a subject; and detecting an antibody from said sample obtained from said subject capable of binding to said dopamine receptor or fragment thereof.
[0066] Thus it would be clear that in one embodiment, the invention relates to a method of diagnosing a CNS disorder, characterising a CNS disorder, determining the causative effect of a CNS disorder, or identifying a biomarker of a CNS disorder in a subject comprising the step of detecting in a sample from the subject the presence of an antibody capable of binding to a dopamine receptor or fragment thereof wherein said antibody capable of binding to a dopamine receptor or fragment thereof is detected by a method comprising the steps of:
expressing a dopamine receptor or fragment thereof on the surface of a cell; exposing said surface of the cell to a sample obtained from the subject; and detecting an antibody capable of binding to said dopamine receptor or fragment thereof from said sample obtained from said subject wherein the presence of said antibody is indicative of said central nervous system disorder in said subject.
[0067] Specifically, in the context of the method described in paragraphs [0065] and [0066] the method provides for the identification of an increase in the level of an antibody capable of binding to a dopamine receptor or fragment thereof relative to a predetermined control level.
[0068] In the context of the method described in paragraphs [0065] to [0067], preferably, the dopamine receptor is a D2-class receptor or fragment thereof, such as D2R or fragment thereof.
[0069] In the context of the any one of the described methods of the invention, the phrase "dopamine receptor or fragment thereof" may encompass all of or any part of a dopamine receptor. In one embodiment, the dopamine receptor or fragment thereof is a D2-class receptor, such as D2R or fragment thereof. Preferably, the dopamine receptor or fragment thereof comprises at least one extracellular portion of a dopamine receptor such as D2R.
[0070] In the context of the method described in paragraphs [0065] to [0069] preferably said cell is a eukaryotic cell and more preferably said cell is a mammalian cell. In this regard, it would be clear to the skilled addressee that any mammalian cell suitable for the expression of a recombinant proteins, for example a CHO cell, could be used in the method of the invention described in paragraphs [0065] to [0069]. In a preferred embodiment, the cell used in the method described in paragraphs [0065] to [0069] is a human cell and in a particularly preferred embodiment the cell used in the method described in paragraphs [0065] to [0069] is a HEK 293 cell.
[0071 ] Thus in one particularly preferred embodiment, the invention relates to the method of the invention wherein said antibody capable of binding to a dopamine receptor or fragment thereof is detected by a method comprising the steps of: expressing a dopamine receptor or fragment thereof on the surface of a HEK 293 cell; exposing said surface of the HEK 293 cell to a sample obtained from a subject; and detecting an antibody from said sample obtained from said subject capable of binding to the dopamine receptor or fragment thereof, wherein the presence of said antibody is indicative of a central nervous system disorder in said subject.
[0072] Specifically, in the context of the method described in paragraph [0071 ], the method provides for the identification of an increase in the level of an antibody capable of binding to a dopamine receptor or fragment thereof relative to a predetermined control level.
[0073] In the context of the method described in paragraph [0072], preferably, the dopamine receptor is a D2-class receptor or fragment thereof, such as D2R or fragment thereof
[0074] In one embodiment, and in the context of the method of the invention said antibody capable of binding to a dopamine receptor or fragment thereof can be detected by flow cytometry such as fluorescence-activated cell sorting or alternatively by microscopy.
[0075] Thus it would be clear that the present invention provides a method according to the invention wherein the antibody capable of binding to a dopamine receptor or fragment thereof is detected using a method comprising the steps of: expressing a dopamine receptor or fragment thereof on the surface of a cell; exposing said surface of the cell to a sample obtained from a subject; and detecting by microscopy an antibody from said sample obtained from said subject capable of binding to the dopamine receptor or fragment thereof wherein the presence of said antibody is indicative of a central nervous system disorder in said subject
[0076] In a further embodiment, it would be clear that the present invention provides a method according to the invention wherein the antibody capable of binding to a dopamine receptor or fragment thereof is detected using a method comprising the steps of: expressing a dopamine receptor or fragment thereof on the surface of a cell; exposing said surface of the cell to a sample obtained from a subject; and detecting by flow cytometry an antibody from said sample obtained from said subject capable of binding to the dopamine receptor or part thereof wherein the presence of said antibody is indicative of a central nervous system disorder in said subject.
[0077] In the context of the method of the invention, preferably said sample obtained from said subject is blood, a blood-derived sample, cerebrospinal fluid or a cerebrospinal fluid- derived sample or CNS tissue.
[0078] In the context of the present invention, the term "blood-derived sample" includes any sample which may be obtained from blood, for example serum, plasma or any blood-derived products which may be isolated from blood including blood-borne proteins such as
immunoglobulin for example IgM, IgG, IgE, IgA or IgD.
[0079] In the context of the present invention, the term "cerebrospinal fluid-derived sample" includes any sample which may be obtained from cerebrospinal fluid including, for example, any products which may be isolated from cerebrospinal fluid including cerebrospinal fluid borne proteins such as immunoglobulin for example IgM, IgG, IgE, IgA or IgD.
[0080] The present invention also contemplates use of the method of the invention as a means of screening or identifying a compound capable of inhibiting the binding of an antibody to a dopamine receptor or fragment thereof.
[0081 ] The present invention further contemplates the use of the method of the invention as a means of screening or identifying a compound capable of competing for binding with an antibody to a dopamine receptor or fragment thereof.
[0082] Thus, according to a further aspect, the present invention provides a method of identifying a compound capable of inhibiting the binding of an antibody to a dopamine receptor or fragment thereof said method comprising the steps of: expressing a dopamine receptor or fragment thereof on the surface of a cell; exposing said surface of said cell to an antibody capable of binding to said dopamine receptor or fragment thereof; and exposing the surface of said cell to a compound to be tested for inhibiting the binding of said antibody to said dopamine receptor or fragment thereof.
[0083] According to another aspect, the present invention provides a method of identifying a compound capable of competing for binding with an antibody to a dopamine receptor or fragment thereof said method comprising the steps of: expressing a dopamine receptor or fragment thereof on the surface of a cell; exposing said surface of said cell to an antibody capable of binding to said dopamine receptor or fragment thereof; and exposing the surface of said cell to a compound to be tested for competing for binding with said antibody to said dopamine receptor or fragment thereof.
[0084] In an alternative embodiment, the present invention provides a method according to the invention wherein said antibody capable of binding to a dopamine receptor or fragment thereof is detected by a method which detects said antibody capable of binding to a dopamine receptor or fragment thereof in vivo.
[0085] The present invention in one aspect, provides use of an immune suppressive drug, an immunoglobulin, rituximab, cyclophosphamide, a compound capable of inhibiting the binding of an antibody to a dopamine receptor or fragment thereof or a combination thereof in the preparation of a medicament for the treatment of a central nervous system disorder identified by the method of the invention.
[0086] In a further aspect, the invention provides use of an immune suppressive drug, an immunoglobulin, rituximab, cyclophosphamide, a compound capable of inhibiting the binding of an antibody to a dopamine receptor or fragment thereof or a combination thereof in the preparation of a medicament for the treatment of basal ganglia encephalitis, Sydenham chorea or Tourette Sydnrome
[0087] In a further aspect, the invention provides an immunoglobulin, rituximab,
cyclophosphamide, a compound capable of inhibiting the binding of an antibody to a dopamine receptor or fragment thereof or a combination thereof for use in a method of treating a central nervous system disorder identified by the method of the invention. [0088] In still a further embodiment, the invention provides an immunoglobulin, rituximab, cyclophosphamide, or a compound capable of inhibiting the binding of an antibody to a dopamine receptor or fragment thereof or a combination thereof for use in a method of treating basal ganglia encephalitis, Sydenham chorea or Tourette syndrome.
[0089] In the context of the present invention, the term "biomarker" includes an indicator of a particular disease state or state of a subject. It can be used to identify a subject with a disease or having a risk of developing a disease.
[0090] In the context of the present invention, the term "child" includes a subject up to the age of 18 years of age. In the context of the present invention the term "adult" includes a subject over 18 years of age.
[0091 ] In the context of the present invention, the terms "comprise", "comprising" and the like are to be construed in their inclusive sense ie. in the sense of "including but not limited to" rather than in their exhaustive sense.
[0092] In the context of the present invention, the term "predetermined control level" insofar as it relates to the level of an antibody, refers the level of an antibody that is exhibited by a population of subjects who do not exhibit or who are not susceptible to a central nervous system disorder as described herein. Methods of determining the predetermined control level of an antibody would be clear to the skilled addressee.
Brief description of the Figures
[0093] Figure 1 : Basal ganglia encephalitis serum is negative for NMDAR antibody but is immunoreactive to hippocampal and striatal primary neurons. (A) Antibody reactivity to the subunit 1 of NMDAR (NR1 ) was determined by flow cytometry cell-based assay using
HEK293NR + cells expressing surface NR1 subunit of NMDAR, and HEK293NR " cells. (B) Sera from healthy control (HC), other neurological disease (OND), first episode of demyelination syndromes (DEM), viral encephalitis (V ENC), N-Methyl D-Aspartate Receptor encephalitis (NMDAR ENC), and basal ganglia encephalitis (BG ENC) were incubated with live HEK293NR and HEK293NR " cells at 1 :50 dilution, followed by AF647-conjugated anti-human IgG secondary antibody, and flow cytometry analysis. AMFI was calculated using MFI obtained with live HEK293NR + and HEK293NR ". Positivity threshold was determined by AMFI of three SD above the mean of HC (dotted line on graph). NR1 antibody was detected in 0/17 BG ENC and 0/59 controls, but in all 8 NMDAR ENC patients. Representative dot plot out of three experiments is shown. (C) Representative example of flow cytometry histograms for one NMDAR antibody-positive patient. MFI values are noted in legend. (D) Fixed and live (E) neurons (15 days in vitro) were co-labelled with two BG ENC or one HC sera followed by AF647 anti-human IgG secondary antibody (pseudocolored in green), then live neurons were fixed, and all neurons were permeabilized and stained with anti-neuron-specific microtubule- associated protein 2 (MAP2) antibody (red) followed by appropriate secondary antibody.
Compared to HC sera, BG ENC immunolabelled non permeabilized dendrites and cell bodies of fixed MAP2+ neurons, whereas surface dendrites were immunolabelled in live MAP2+ neurons. Bar scale, 6.6μηι in D, and 20μηι in E. Representative images are shown. Nuclei stained with DAPI.
[0094] Figure 2: Basal ganglia encephalitis is associated with D2R antibody. (A) Antibody reactivity to D2R was determined by flow cytometry cell-based assay. (B) Human surface D2R IgG antibody was detected in 12/17 BG ENC and 0/67 controls. Dotted line on graph represents the positivity threshold. Representative dot plot out of five experiments is shown. Samples were considered positive if they were above threshold at least four times out of five repeated experiments. (C) Representative example of flow cytometry histograms for one D2R antibody-positive patient, and (D) for staining controls on live HEK293D2R" (left) and
HEK293D2R+ cells (right). Controls shown are cells stained with secondary AF647-conjugated anti-rabbit IgG antibody only (II Ab anti rab IgG; secondary antibody for the anti-hematoglutinin (HA) Ab), secondary AF647-conjugated anti-human IgG antibody only (II Ab anti hum IgG; secondary antibody for human serum). For comparison, staining of cells with anti-HA antibody followed by the appropriate secondary antibody is also shown (I and II Ab anti-HA). Only the latter staining gives a high MFI on HEK293D2R+ cells. MFI values are noted in legend. (E) Low levels of immunoglobulin M (IgM) were detected in 2/10 patients positive for D2R IgG antibody. 10/12 D2R ENC sera were available for testing due to inadequate sera. Representative dot plot out of three experiments is shown.
[0095] Figure 3: Immunoreactivity of basal ganglia encephalitis, N-MethylD-Aspartate Receptor encephalitis, and healthy control sera in the striatum of wild-type and D2R knock-out mice. Basal ganglia encephalitis (BG ENC, green) immunolabelled dendrites and cell bodies of MAP2+ neurons (red) in striatum of wild-type (WT) mouse (A). By contrast, healthy control (HC) serum showed no significant immunolabelling to WT brain (B). The immunolabelling of BG ENC serum was significantly decreased in D2R knock-out (D2R(-/-)) striatum (C), whereas N-Methyl-D-Aspartate Receptor encephalitis immunolabelling was still observed (NMDAR ENC, D). The same basal ganglia encephalitis serum is showed in A and C. Lower rows of A, B, and C are 3.05-fold digital zoom from top images (white rectangle), and show co-localization between MAP2 and serum staining. CC: corpus callosum; S: striatum; ILV: left lateral ventricle. Nuclei stained with DAPI. Bar, 100μηι and bar, 50μηι (zoomed images). Representative images are shown.
[0096] Figure 4: (A) Immunocytochemistry on fixed unpermeabilized HEK293D2R+ cells confirmed basal ganglia encephalitis IgG co-labelled GFP-positive and hematoglutinin-D2R- positive (red) cells (GFP shown in green, left panel). Both hematoglutinin-D2R and basal ganglia encephalitis (BG ENC) IgG immunoreactivities are localized on the cell surface, whereas GFP is cytoplasmic. Healthy control (HC) IgG showed no significant
immunoreactivity. Nuclei stained with DAPI. Bar, 20μηι. (B) Immunoreactivity to D2R in HEK293D2R~- and HEK293D2R+-immunoabsorbed basal ganglia encephalitis and other neurological diseases (OND) sera was assessed by flow cell-based assay. HEK293D2R" - immunoabsorbed basal ganglia encephalitis sera were above the threshold of positivity (dotted line), whereas the immunoabsorption of basal ganglia encephalitis with HEK293D2R+ cells decreased the immunoreactivity to D2R. Immunoabsorption of basal ganglia encephalitis sera with HEK293D2R+ cells also significantly reduced the surface labelling of HEK293D2R+ cells (C), primary MAP2+ neurons (D), and brain wild-type sections (E) compared to immunoabsorption with HEK293D2R" cells. CC: corpus callosum; S: striatum; ILV: left lateral ventricle. Nuclei stained with DAPI. Bar, 6.70μηι in C; bar, 10μηι in D; and bar, 100 μηι in E. Representative images are shown.
[0097] Figure 5: D2R antibody-positive encephalitis is associated with normal and abnormal brain MRI. MRI were normal in 6/12 D2R antibody-positive encephalitis acute patients (upper panel), and abnormal in 6/12 D2R antibody-positive encephalitis acute patients (lower panel). In MRI-abnormal patients, T2 axial image (left panel) shows enhancement in caudate, putamen and globus pallidus, and T2 FLAIR coronal image (right panel) shows enhancement in substantia nigra.
[0098] Figure 6: Sydenham chorea and Tourette syndrome, are associated with D2R antibody. (A) Human surface D2R IgG antibody was detected in 10/30 Sydenham chorea (SC), 4/44 Tourette syndrome (TS), and 0/40 healthy control (HC) and other neurological diseases (OND) controls. The dotted line on graph A represents the positivity threshold. Representative dot plots out of four (D2R) experiments are shown. (B) Live neurons (15 days in vitro) were co- labelled with one D2R IgG positive SC or one D2R IgG-positive Tourette syndrome sera followed by AF647 anti-human IgG secondary antibody (pseudocolored in green), then fixed and permeabilized and stained with anti-MAP2 antibody (AF555, red). Both Sydenham chorea and Tourette syndrome sera immunolabelled surface dendrites of MAP2+ neurons. Bar scale, 20μηι. Representative images are shown. Nuclei stained with DAPI.
[0099] Figure 7: Immunoreactivity of Sydenham chorea and Tourette sydrome sera in the striatum of wild-type and D2R knock-out D2R (-/-) mice. D2R IgG antibody-positive Sydenham chorea (SC, A) and Tourette syndrome (TS, B) sera (green) immunolabelled dendrites and cell bodies of MAP2+ neurons (red) in striatum of wild-type mouse. The immunolabelling of Sydenham chorea (C) and Tourette syndrome (D) sera was significantly decreased in D2R knock-out striatum. The same Sydenham chorea and Tourette syndrome sera are showed in A and C, and B and D, respectively. Lower rows of A, B, C, and D are 3.05-fold digital zoom from top images (white rectangle), and show co-localization between MAP2 and serum staining. CC: corpus callosum; S: striatum; rLV: right lateral ventricle. Nuclei stained with DAPI. Bar, "Ι ΟΟμηι and bar, 50μηι (zoomed images). Representative images are shown.
[00100] Figure 8: Anti-D2R antibody-positive encephalitis sera do not bind hemagglutinin. Because the extracellular N-terminus of D2R cDNA is tagged with the human influenza hemagglutinin (HA) tag, we controlled that anti-D2R IgG antibody detected in basal ganglia encephalitis (BG ENC) did not bind to the hemagglutinin tag using hemagglutinin-syntaxin 4. Extracellular C-terminal hemagglutinin-syntaxin 4 was expressed at the surface HEK293 cells (A), and we performed cell-based assays. Threshold was defined as mean of healthy control + 3SD (dotted line on graph). (B) Anti-surface rat hemagglutinin syntaxin-4 IgG antibody was detected in 0/13 healthy control (HC), 0/8 anti-N-Methyl D-Aspartate Receptor encephalitis (NMDAR ENC), and 0/17 basal ganglia encephalitis sera. Representative dot plots out of three experiments are shown. (C) Representative flow cytometry histograms are shown for an anti- D2R antibody positive basal ganglia encephalitis serum. MFI values are noted in legend.
[00101 ] Figure 9: Acute (A) and convalescent (C) anti-D2R antibody in three basal ganglia encephalitis patients. Patients A and B were diagnosed retrospectively with anti-D2R antibody- positive encephalitis, whereas patient C was diagnosed prospectively. Patient A, a 5 year old female presented with encephalitis, dystonia-parkinsonism, and confusion. Her MRI was normal and she was treated with oral prednisolone 2mg/kg for 2 weeks then a 6 week taper. The patient was reported to have made little improvement at annual reviews, and at 5 year follow-up she has residual hemidystonia, attention deficit disorder, rigid behaviours, and her anti-D2R antibodies remain elevated. Patient B, a 3 year old male presented with encephalitis, encephalopathy, dystonia-parkinsonism, and agitation. His MRI showed caudate and putamen lesions. He was treated with intravenous methylprednisolone 30mg/kg for 3 days then oral prednisolone 2mg/kg for 2 weeks, then an 8 week steroid taper. The patient was reported to have made little improvement at annual reviews, and at 8 year follow-up he has residual coordination disorder, anxiety, and mild learning difficulties and his anti-D2R antibodies remain elevated. Patient C, a 3 year old female presented with encephalitis with chorea, ataxia, ocular flutter, developmental regression, and two relapses in the first 12 months. Her MRI was normal. She was given 2g/kg of intravenous immunoglobulin monthly for three months. She was also given oral prednisolone 2mg/kg/day for one month and remains on 1 mg/kg prednisolone on alternate days. One year after starting treatment, her chorea and ataxia have resolved, she has made significant developmental gains, and her development is now normal. Her anti-D2R antibody is now within the healthy control range (below threshold of positivity). Dotted lines on graphs represent the positivity threshold (obtained with 24 HC samples). P: prednisolone; IVIG: intravenous immunoglobulin. Representative dot plot out of three experiments is shown.
Descriptions of Embodiments
[00102] We investigated 17 patients seen between 2000-201 1 with clinical or radiological features compatible with a basal ganglia encephalitis (Table 1 ), previously termed encephalitis lethargica (Dale et al., 2004). The 17 patients had clinical features suggestive of basal ganglia involvement (movement disorder sometimes with a psychiatric or sleep disorder). Previous serological testing had been negative for autoantibodies to N-Methyl-D-Aspartate receptor (NMDAR) (n = 17), voltage-gated potassium channel-complexes (n = 17), glycine receptor (n = 10), glutamic acid decarboxylase (n = 10), leucine-rich, glioma inactivated 1 protein (n = 10) and contactin-associated protein-2 (n = 10) (Dale et al., 2009; Suleiman et al., 201 1 ). All 17 patients fulfilled criteria of encephalitis as previously defined including encephalopathy (n = 17), focal neurological signs (n = 17), fever (n = 9), MRI inflammatory lesions (n = 8), EEG compatible with encephalitis (n = 7), and CSF pleocytosis (n = 6) (Granerod et al., 2010). Patients were investigated empirically with a total of 349 negative aetiological investigations (mean 20, range 6-31 ; Table 2). All patients were treated briefly with intravenous antibiotics and acyclovir until bacterial infection or herpes simplex virus infection was excluded. Follow-up outcomes were assessed by child neurologists including functional differences compared to age-matched peers. Formal neuropsychology was only performed in four patients. Serum used in antibody studies was from the first week of the acute admission, and before immune therapy (except in Fig. 9 in which convalescent samples were also used). [00103] In order to define antibody specificity, we used serum from 67 paediatric controls as outlined in Table 3. The controls included viral encephalitis, N-Methyl D-Aspartate Receptor encephalitis, inflammatory demyelination, and basal ganglia disease of defined metabolic, genetic, or degenerative origin.
[00104] Sydenham chorea (n = 30). All patients fulfilled criteria for Sydenham chorea, namely modified Jones criteria, clinical characteristics, and evidence of streptococcal infection
(Cardoso et al., 1997). There was a preceding throat infection in 19, preceding vaccine in one, and no clinical precedent in ten. Serum was from the acute phase (<3 months) in 24, subacute phase (3-6 months) in three, or during relapse of SC in two or persistence of SC in one (Table 1 )-
[00105] Tourette syndrome (n = 44). All patients fulfilled DSM-IV criteria for Tourette syndrome. All patients had active tic disorders at the time of serum sampling. No patients had the PANDAS phenotype (Table 1 ).
Figure imgf000023_0001
Figure imgf000024_0001
Table 1 : Summary of clinical details in the patient cohorts
* Ashkenazi Jew n = 9, Sephardi Jew n = 3
** Anti-Streptolysin-0 titre-negative patients had positive anti-DNAse B (>300 lU/ml) or Anti-Group A Carbohydrate (ACHO) titres (>2.76 U/ml)
ADHD = Attention deficit hyperactivity disorder, OCD or OCB= Obsessive compulsive disorder or behaviour, ODD = Oppositional defiant disorder, GAD = generalised anxiety disorder
[00106] Patient sera had immunoglobulin G (IgG) concentrations measured by nephelometry (BN ProSpec, Siemens, Germany), and IgG values were within the normal range (6.2-14.4g/l).
Figure imgf000024_0002
Table 2. Negative investigations in 17 patients with basal ganglia encephalitis. All
investigations were conducted on serum or plasma unless stated. [00107] In order to define antibody specificity, we used serum from 67 paediatric controls as outlined in Table 3. Patient sera had IgG concentrations measured by nephelometry (BN ProSpec, Siemens, Germany), and IgG values were within the normal range (6-2-14-4g/l). Ethics approval for this study was granted by the Children's Hospital at Westmead ethics Committees (HREC 2007/035, SSA 07/CHW/58, HREC/09/CHW/56, and SSA/09/CHW/143), and written informed consent from all patients was obtained.
Figure imgf000026_0001
per (n = 1)
Table 3. Clinical details and demographics of controls (n=67)
* Basal ganglia controls included Wilson's disease, Leigh disease, Glutaric aciduria type 1 , basal ganglia stroke, Huntington disease
* 4/8 children with DEM were positive for anti-myelin oligodendrocyte glycoprotein (MOG) antibodies (Brilot et al., 2009).
† Viral encephalitis confirmed aetiology using CSF PCR
If Clinical phenotype and investigation as described (Dale et al., 2009).
Cloning and expression of human D2R and NMDAR
[00108] In order to detect antibodies against disease-relevant conformational surface antigens, we have expressed antigens at the surface of HEK293 after transfection of subcloned NMDAR subunit 1 (NR1 ) and D2R. Extracellular N-terminus hemaglutinin- tagged human D2R, cDNA was obtained from the Missouri S&T cDNA Resource Center (www.cdna.org). The nucleotide and amino acid sequences of the human D2R are shown below and designated SEQ ID No. 1 and SEQ ID No. 2 respectively. Using restriction enzymes Nhel and Xhol, sequence-verified D2R cDNA was subcloned into plRES2-GFP vector (Clontech, Mountain View, USA), a vector suitable for expression of N-terminal hemaglutinin-tagged transmembrane antigens with enhanced green fluorescent protein (GFP) reporter under control of a internal ribosome entry site (IRES) enabling both DR and GFP to be co-expressed in cells separately. The human subunit 1 of NMDAR (kind gift from Prof A. Vincent, Oxford, UK) was also subcloned into plRES2-GFP vector using BamHI and EcoRI, but was untagged. We used Syntaxin 4 as a control to exclude immunoreactivity of sera against the hemaglutinin tag. Syntaxin 4 is a single-pass type IV membrane protein of 298 amino acids with only three extracellular amino acids (C terminus AA296 to 298) followed by the HA tag. Syntaxin 4 therefore "anchors" the hemaglutinin tag at the cell surface, and is a useful control for hematoglutinin immunoreactivity.
SEQ ID No.1, Nucleotide sequence of human D2R
ATGTACCCATACGATGTTCCAGATTACGCTTACCCATACGATGTTCCAGATTACGCTTACCCATACG ATGTTCCAGATTACGCTGATGATCCACTGAATCTGTCCTGGTATGATGATGATCTGGAGAGGCAGAA CTGGAGCCGGCCCTTCAACGGGTCAGACGGGAAGGCGGACAGACCCCACTACAACTACTATGCCACA CTGCTCACCCTGCTCATCGCTGTCATCGTCTTCGGCAACGTGCTGGTGTGCATGGCTGTGTCCCGCG AGAAGGCGCTGCAGACCACCACCAACTACCTGATCGTCAGCCTCGCAGTGGCCGACCTCCTCGTCGC CACACTGGTCATGCCCTGGGTTGTCTACCTGGAGGTGGTAGGTGAGTGGAAATTCAGCAGGATTCAC TGTGACATCTTCGTCACTCTGGACGTCATGATGTGCACGGCGAGCATCCTGAACTTGTGTGCCATCA GCATCGACAGGTACACAGCTGTGGCCATGCCCATGCTGTACAATACGCGCTACAGCTCCAAGCGCCG GGTCACCGTCATGATCTCCATCGTCTGGGTCCTGTCCTTCACCATCTCCTGCCCACTCCTCTTCGGA CTCAATAACGCAGACCAGAACGAGTGCATCATTGCCAACCCGGCCTTCGTGGTCTACTCCTCCATCG TCTCCTTCTACGTGCCCTTCATTGTCACCCTGCTGGTCTACATCAAGATCTACATTGTCCTCCGCAG ACGCCGCAAGCGAGTCAACACCAAACGCAGCAGCCGAGCTTTCAGGGCCCACCTGAGGGCTCCACTA AAGGGCAACTGTACTCACCCCGAGGACATGAAACTCTGCACCGTTATCATGAAGTCTAATGGGAGTT TCCCAGTGAACAGGCGGAGAGTGGAGGCTGCCCGGCGAGCCCAGGAGCTGGAGATGGAGATGCTCTC CAGCACCAGCCCACCCGAGAGGACCCGGTACAGCCCCATCCCACCCAGCCACCACCAGCTGACTCTC CCCGACCCGTCCCACCATGGTCTCCACAGCACTCCCGACAGCCCCGCCAAACCAGAGAAGAATGGGC ATGCCAAAGACCACCCCAAGATTGCCAAGATCTTTGAGATCCAGACCATGCCCAATGGCAAAACCCG GACCTCCCTCAAGACCATGAGCCGTAGGAAGCTCTCCCAGCAGAAGGAGAAGAAAGCCACTCAGATG CTCGCCATTGTTCTCGGCGTGTTCATCATCTGCTGGCTGCCCTTCTTCATCACACACATCCTGAACA TACACTGTGACTGCAACATCCCGCCTGTCCTGTACAGCGCCTTCACGTGGCTGGGCTATGTCAACAG CGCCGTGAACCCCATCATCTACACCACCTTCAACATTGAGTTCCGCAAGGCCTTCCTGAAGATCCTC CACTGCTGA
SEQ ID No.2, Amino Acid sequence of human D2R
M Y P Y D V P D Y A Y P Y D V P D Y A Y P Y D V P D Y A D D P L N L S W Y D D D L E R Q N W S R P F N G S D G K A D R P H Y N Y Y A T L L T L L I A V I V F G N V L V C M A V S R E K A L Q T T T N Y L I V S L A V A D L L V A T L V M P W V V Y L E V V G E W K F S R I H C D I F V T L D V M M C T A S I L N L C A I S I D R Y T A V A M P M L Y N T R Y S S K R R V T V M I S I V W V L S F T I S C P L L F G L N N A D Q N E C I I A N P A F V V Y S S I V S F Y V P F I V T L L V Y I K I Y I V L R R R R K R V N T K R S S R A F R A H L R A P L K G N C T H P E D M K L C T V I M K S N G S F P V N R R R V E A A R R A Q E L E M E M L S S T S P P E R T R Y S P I P P S H H Q L T L P D P S H H G L H S T P D S P A K P E K N G H A K D H P K I A K I F E I Q T M P N G K T R T S L K T M S R R K L S Q Q K E K K A T Q M L A I V L G V F I I C W L P F F I T H I L N I H C D C N I P P V L Y S A F T W L G Y V N S A V N P I I Y T T F N I E F R K A F L K I L H C
[00109] Lipofectamine was used to transfect human embryonic kidney 293 (HEK293) cells to obtain surface antigen-expressing cells (HEK293NR1+ and D2R+ cells) according to the manufacturer's instructions (Invitrogen). Control cells (HEK293NR1-and D2R-, cells) were obtained by transfection of HEK293 cells with empty vectors, either pcDNA-GFP or plRES2-GFP. As an alternative to lipofectamine, any type of eukaryotic cell transfection reagent, for example polyethylenimine, can also be used to transfect cells. Transiently transfected cells were washed and the culture medium was changed 6 hours after transfection and cells were kept in culture at 37C for a further two days post transfection. At that time, the cells were then harvested using versene (Invitrogen) and washed in PBS supplemented with 2% FBS (PBS/FBS) before cell-based assay. Additionally, GFP-positive HEK293D2R+ cells were sorted by flow cytometry, and cultured under 250μg/ml of geneticin (Invitrogen) in order to obtain a polyclonal stable transfectant. High levels of surface expression of D2R and NMDAR after transfection were assessed by flow cytometry (Fig 1Aand 2A).
Cell-based assay for detection of antibodies to cell surface, D2R and NMDAR.
[00110] FACS analysis was used to detect antibody binding of patient serum IgG to surface brain antigens transfected in HEK293 cells. Specifically, two days after
transfection, the cells were harvested using versene (Invitrogen) and washed in PBS supplemented with 2% FBS (PBS/FBS).50,000 cells were then incubated with serum at a 1 :100 dilution in V-bottom plate (Corning) for 30 min at room temperature. Cells were then washed three times with 200μΙ PBS/FBS, and incubated with Alexa Fluor 647-conjugated goat anti-human IgG secondary antibody (Invitrogen) for 30 min at room temperature. Cells were washed three times with PBS/FBS, and then resuspended in 50μΙ PBS/FBS before analysis. Before acquisition, viability dye 7-AAD (BD Biosciences) was added to the cells to exclude dead cells. A total of 10,000 events/well were recorded on a BD LSRII instrument equipped with a high-throughput sampler (BD Biosciences). Data analysis was performed using Flow Jo software (TreeStar, Ashland, OR, USA) and Excel. Binding was expressed as mean fluorescence intensity (MFI) as previously described (Brilot et al., 2009; Brilot et ai, 201 1 ). Levels of antibody binding in GFP-positive transfected cells were expressed as AMFI. AMFI was determined by the subtraction of MFI obtained with HEK293NR " and HEK293D2R- cells from the MFI obtained with HEK293NR + and HEKD2R+ cells respectively. An AMFI greater than mean + 3 standards deviations of values of the healthy control samples was considered positive. Each experiment was performed at least three times. Cell-based assays were performed by blinded investigator and data was unblinded in order to calculate the threshold of positivity. All cell-based assays were optimized on prior assessment of antigen surface expression. Surface expression on transfected cells was analyzed by flow cytometry after staining with a rabbit polyclonal anti-hemaglutinin antibody (Clontech, Mountain View, CA, USA), mouse monoclonal anti-human extracellular NMDAR subunit 1 antibody (BD Biosciences), (in combination with an Alexa Fluor 647-conjugated appropriate secondary antibody (Invitrogen). Dot plots shown in Fig. 1 , 2, 6, and 8 were generated using Excel or Prism software version 4.0b (Graph Pad Software, Inc, La Jolla, CA, USA).
Immunocytochemistry on primary culture of murine hippocampal and striatal neurons and HEK293 cells.
[001 1 1 ] Embryonic E16.5 mouse hippocampal and striatal neurons were cultured as previously described (Fath et al., 2009). Primary neurons and stably transfected HEK293 were fixed on 4% paraformaldehyde, and incubated with patient or control sera (diluted at 1 :50), primary antibodies, purified human IgG, and/or immunoabsorbed sera. Cells were then washed and incubated with a secondary Alexa Fluor 647-conjugated anti human IgG antibody, or appropriate secondary antibodies (Invitrogen). Alternatively, live neurons were washed and incubated with patient and control sera (diluted 1 :50) followed by incubation with appropriate secondary antibody before fixation/permeabilization and incubation with anti-rabbit polyclonal anti-microtubule-associated protein 2 antibody (MAP2, Millipore, Billerica, MA, USA). To confirm that D2R was the main target antigen, two sera from control and D2R antibody-positive patients (selected for positivity for D2R antibody by flow cell-based assay and adequate volume of serum available) were serially incubated with six wells of live unpermeabilized HEK293D2R+ or HEK293D2R" cells (Irani et al., 2010; Lai et al., 2010). Successful immunoabsorption of D2R IgG was assessed by flow cytometry cell- based assay. We purified IgG from sera using protein G-agarose and Microcon (Millipore). [001 12] To visualize neurons and HEK293 cells, we used a confocal SP5 Leica microscope with 100X 1 .4 NA oil immersion lenses (with a digital zoom of 1 .5X for Fig. 1 D and 1 .43X for Fig. 1 E). Pictures were overlaid using Metamorph software version 7.1 (Molecular Devices, Sunnyvale, USA), and ImageJ software version 1 .44o (National Institute of Health, Bethesda, USA). Additionally, images from Alexa Fluor 647-conjugated anti-human IgG staining shown in Fig. 1 , 3, 4, 6 and 7 were pseudo-colored in green for clarity.
Immunofluorescence on mouse brain from wild-type and D2R knock-out mice
[001 13] Adult genotyped D2R knock-out mice on C57B6 background and wild-type littermates were deeply anaesthetized with an intraperitoneal injection of Sodium
Pentobarbitone (100mg/kg), and then transcardially perfused with heparinized 0.1 M PBS at 37°C followed by fresh 4% paraformaldehyde in 0.1 M PBS. Brains were embedded in optimum cutting temperature (OCT) and immediately frozen in a dry ice-acetone bath.
Sixteen-micron thick cryostat sections were thaw-mounted on SuperFrost Plus glass slides (Merzel, Braunschweig, Germany) and stored at -20°C. Sections were washed in 0.1 M PBS, then blocked and permeabilized for 30 min at room temperature with 0.3% Triton X-100 (Sigma), and 15% normal goat serum (Sigma) in 0.1 M PBS, and incubated overnight at 4<C with healthy control, basal ganglia encephalitis, N-Methyl D-Aspartate receptor encephalitis, Sydenham chorea, and Tourette syndrome sera (diluted 1 :100 in 0.1 M PBS supplemented with 0.3% Triton-X-100 and 5% normal goat serum). Slides were washed in 0.1 M PBS and incubated with the appropriate secondary antibodies (Invitrogen) for 2 h at room temperature. Then, slides were incubated with anti-MAP2 antibody for 2 h at room temperature, washed, then incubated with the secondary appropriate antibody for 2 h at room temperature. Slides were washed, mounted, and images were acquired by confocal microscopy using a 20X 0.7 NA objective with or without a digital zoom of 3.05X. Analysis of serum binding to wild-type and D2R knock-out brain was performed in a blinded manner. All procedures on animals are approved by the Florey Neuroscience Institutes animal ethics committee and conform to the National Health and Medical Research Council of Australia's published code of practice.
Statistical analysis
[001 14] Chi-square with Yates correction test was used to compare the positivity in patients compared to controls. A p value less than 0-05 was considered significant.
Brief case histories of anti-D2R antibody-positive Tourette syndrome patients [001 15] Case 1 : A male Caucasian patient whose father had Tourette syndrome and attention deficit hyperactivity disorder presented with his tic disorder at 5 years of age. At the time of serum testing (15 years), he had severe Tourette syndrome plus comorbid attention deficit hyperactivity disorder, oppositional defiant disorder, obsessive compulsive disorder, generalised anxiety disorder and depression, and was severely impaired despite multiple medication trials. His anti-Streptolysin-0 titre (ASOT) at time of serum testing was elevated at 400 lU/ml, but there was never any infection-associated exacerbations during his disease course.
[001 16] Case 2: A male Asian patient with no family history of note presented at 6 years of age with tic disorder. At the time of serum testing (7 years of age) he had motor and vocal tics for more than 12 months, but had no associated comorbidity. His course waxed and waned but his impairment did not require medical treatment. His ASOT was negative at 50 lU/ml, and there has never been any infection-associated exacerbations during his disease course.
[001 17] Case 3: A female Caucasian patient whose mother has longstanding throat clearing presented at 7 years of age with tic disorder. The patient has had motor and vocal tics for 8 years, and her course has relapsed and remitted in a more exaggerated way than typical Tourette syndrome, but there has never been a deterioration associated with infection. At the time of serum testing (15 years old), she still has Tourette syndrome, but no associated comorbidity. Her ASOT at the time of serum testing was negative at 55 lU/ml.
[001 18] Case 4: A female Caucasian patient whose sister has alopecia and father has obsessive-compulsive disorder presented at 4 years of age with tic disorder. At the time of serum testing (8 years), she had Tourette syndrome, generalised anxiety disorder, separation anxiety, and obsessive compulsive behaviour. She has had a predisposition to Streptococcal infections, but there have not been any clear infection-associated exacerbations. Her ASOT at the time of serum testing was elevated at 455 lU/ml. Results
Surface D2R IgG antibody in children with basal ganglia encephalitis
[001 19] We first optimized flow cytometry for detection of autoantibodies using NMDAR- antibody positive sera and HEK cells expressing the NMDAR subunit 1 . The mean intensity of the fluorescence (MFI) correlated with antibody concentration (Fig. 1 A). Using the mean plus 3 standard deviations to establish the threshold for positivity, NMDAR antibodies were found only in the N-Methyl D-Aspartate receptor encephalitis group (n = 8) compared with all other groups (n = 76) including basal ganglia encephalitis, healthy controls, other neurological diseases and viral encephalitis (Fig. 1 B and C, chi-square test with Yates correction, P < 0.0001 ), validating flow cytometry as an appropriate method to detect autoantibodies in patient sera.
[001 20] Although negative for surface NMDAR antibody, basal ganglia encephalitis sera immunolabelled cell bodies and MAP2-positive dendrites of fixed non- permeabilized striatal neurons (Fig. 1 D), and dendrites and cell surface of live primary neurons (Fig. 1 E), suggesting that these sera had IgG that bound antigens expressed at the surface of neurons. In order to investigate the dopamine signalling pathway specifically, we expressed disease-relevant conformational surface D2R at the surface of HEK293 cells, and used these cells to detect antibody against D2R (Fig. 2). Importantly, due to the lack of a commercial antibody that binds to an extracellular epitope of D2R, we labelled the extracellular N-terminus of D2R with a hematoglutinin tag which was readily detected on unpermeabilized cells by immunocytochemistry and flow cytometry (Fig. 2A and D). An empty vector was negative for surface D2R staining, as were cells incubated with primary and secondary antibody controls (Fig. 2A and D). As shown in Figure 1 A, MFI was directly dependent on antibody titre (Fig. 2A). Twelve of the 17 children with basal ganglia encephalitis had serum antibodies to surface D2R (71 %), compared to 0/67 controls (Fig. 2B and C, chi-square test with Yates correction, P < 0.0001 ). By contrast, only two patients showed any IgM reactivity to the cells (Fig. 2E).
[001 21 ] To further determine whether basal ganglia encephalitis sera bound to neurons, six sera (three basal ganglia encephalitis and three healthy controls) were applied to wild-type mouse brains, and co-labelled with the neuronal marker MAP2. Basal ganglia encephalitis samples brightly co-immunolabelled MAP2-positive neurons in the striatum (Fig. 3A), whereas healthy control sera did not (Fig. 3B). Importantly, the basal ganglia encephalitis immunolabelling was significantly decreased in D2R knock-out striatum (Fig. 3C), whereas N- Methyl D-Aspartate Receptor encephalitis immunolabelling was still observed (Fig. 3D). Immunoreactivity was clearly visible on the cell surface of unpermeabilized HEK293D2R+ cells, and co-localised with surface hematoglutinin-D2R staining, whereas there was no staining with IgGs purified from healthy control sera (Fig. 4A). To confirm the specificity for D2R, we successfully immunoabsorbed sera from two basal ganglia encephalitis patients using HEK293D2R+ cells (Fig. 4B), and found that absorption decreased immunolabelling of HEK293D2R+ cells, primary neurons, and wild-type mouse brains (Fig. 4C, D, and E).
[001 22] In addition, we showed that the D2R antibody positive sera did not bind to an extracellular hemaglutinin-tagged irrelevant antigen (syntaxin 4) (Fig. 8), further confirming that sera are immunoreactive against D2R and not hemaglutinin.
Clinical features of D2R antibody-positive basal ganglia encephalitis
[001 23] Table 4 summarizes the clinical characteristics and features of the 12 patients with D2R antibody-positive basal ganglia encephalitis. There was an even sex distribution, and children of all ages were affected. The children were of mixed ethnic background (Caucasian 5/12, Afro-Caribbean 3/1 2, East Asian 2/12, South Asian 1 /1 2, Polynesian 1 /1 2). Symptom onset frequently occurred in the post-infectious or post-vaccine setting. 5/1 2 had clinical history and serology suggestive of preceding infection with beta-haemolytic Streptococcus (n = 3), mycoplasma pneumonia (n = 1 ), and enterovirus (n = 1 ). The symptoms at onset were variable although lethargy, psychiatric symptoms, abnormal movements, or gait disturbance were typical. The established clinical syndrome was dominated by a spectrum of movement disorders including dystonia, parkinsonism, and chorea. Many of the patients with dystonia had coarse tremor compatible with dystonic tremor. Oculogyric crises occurred in three patients with dystonia or parkinsonism, and ocular flutter occurred in one child with chorea and ataxia. Psychiatric disturbance occurred in 9/1 2, particularly agitation, emotional lability, anxiety, and psychotic symptoms. Sleep disturbance, lethargy, drowsiness, brainstem dysfunction, seizures, and ataxia occurred less commonly. A search for a tumour was not routinely performed although searching for neuroblastoma in four patients was negative. Brain MRI was normal in 6/12 (Table 4), but when abnormal showed inflammatory changes localising to basal ganglia and brainstem structures (Fig. 5). The CSF was abnormal in 9/1 2 patients although pleocytosis occurred in only three patients, and the median CSF cell count was 1 lymphocyte/mm3 (Table 5). The EEG was either normal or showed non-specific slowing compatible with encephalopathy. No patient had epileptic features on EEG. Characteristic Anti-D2R Anti-D2R
antibody-positive antibody-negative
(" = 12) (n = 5)
Demographics
Male sex 6/12 2/5
Age mean, median (range) 7.4, 5.5 (1 .6-15) 6.5 (0.4-10)
Non-white 7/12 1/5
Prodromal symptoms
Infection 6/12 4/5
Vaccination 2/12 0/5
Drug 1/12 0/5
Nil 3/12 1/5
Symptom presentation
Lethargy, drowsy 5/12 2/5
Movement disorder 4/12 0/5
Paranoia, psychosis, hallucinations 3/12 0/5
Agitation, anxiety 2/12 2/5
Gait disturbance, ataxia 2/12 0/5
Seizure 2/12 1/5
Movement disorder
Any movement disorder 12/12 5/5
Dystonia, including dystonic tremor 5/12 4/5
Parkinsonism 5/12 2/5
Oculogyric crisis 3/12 0/5
Chorea 3/12 0/5
Hemidystonia and hemichorea 1/10 0/5
Ocular flutter 1/12 0/5
Psychiatric symptoms
Any psychiatric change or personality change 9/12 3/5
Agitation 5/12 0/5 Psychosis or hallucinations 3/12 0/5
Emotional lability, anxiety 2/12 3/5
Compulsive touching 2/12 0/5
Aggression 1/12 0/5
Sleep disorder
Any sleep disorder 6/12 3/5
Somnolence, lethargy 4/12 2/5
Insomnia 2/12 1/5
Other
Fever at any stage 6/12 3/5
Encephalopathy* 12/12 5/5
Reduced consciousness or confusion 5/12 3/5
Autonomic or hiccough 3/12 0/5
Ophthalmoplegia 2/12 0/5
Pyramidal weakness 2/12 1/5
Mutism 2/12 2/5
Seizures 2/12 2/5
Ataxia 2/12 0/5
MRI abnormal 6/12 2/5*
Table 4: Clinical comparison of anti-D2R antibody-positive (n = 12) and -negative (n = 5) basal ganglia encephalitis patients
[00124] Due to the diagnostic uncertainty, the patients were treated empirically, and some patients did not receive immune therapy (Table 5). The outcome was variable with a full recovery occurring in 5/12 (Table 5 and Table 6). Motor, cognitive, and psychiatric morbidity commonly occurred. Dystonia, dysexecutive cognitive problems, attention deficit disorder, and psychosis were characteristic outcomes. 5/12 patients had problems with learning with rigid thinking and dysexecutive features, although formal neuropsychology was only performed in four patients. Two patients with abnormal acute scans have shown basal ganglia atrophy and gliosis on follow-up; these patients have persistent cognitive and psychiatric morbidity. [00125] Although the cohort was treated empirically, the most recent patients have been treated aggressively and early with high dose methyl-prednisolone, oral prednisolone taper, and concomitant intravenous immunoglobulin (IVIG); these patients have made a complete recovery (Table 5 and Table 6). Acute and convalescent sera was available for three D2R antibody-positive patients (Fig.9). The two patients diagnosed retrospectively only received steroid treatment, have been left with permanent disability, and have elevated D2R antibody on convalescent testing. The prospectively diagnosed patient was treated with both steroid and IVIG, has made a complete clinical recovery, and D2R antibody has normalized on convalescent testing (Fig.9).
Spectrum of D2R antibody-associated movement and psychiatric disorders
[00126] We measured serum IgG reactivity to D2R in other putative autoimmune basal ganglia disorders including Sydenham chorea, and Tourette syndrome patients. We detected surface D2R IgG antibody in sera of 10/30 Sydenham chorea (30%), and 4/44 Tourette syndrome (9%) patients compared to 0/40 controls (Fig. 6A, chi-square test with Yates correction, Sydenham chorea vs controls; P < 0.0001 , Tourette syndrome vs controls; P < 0.1 1 ). Samples were considered positive if they were above threshold at least three times out of four repeated experiments. D2R antibody-positive Sydenham chorea and Tourette syndrome patients immunolabelled live neurons (Fig. 6B), co-labelled with MAP2 in the striatum of wild-type mouse (Fig. 7A and 7B), and the immunolabelling was significantly decreased in D2R knock-out striatum, suggesting that D2R is the main antibody target in these children (Fig. 7C and 7D).
Clinical features of D2R antibody-positive Sydenham chorea and Tourette syndrome
[00127] No obvious differences were observed between Sydenham chorea patients positive or negative for D2R antibody (Table 7). Clinical histories of D2R antibody-positive Tourette syndrome patients are presented in paragraphs [001 15] to [001 18]. Interestingly, 2/5 of the females with Tourette syndrome were D2R antibody positive, whereas only 2/39 males with Tourette syndrome were D2R antibody positive.
Clinical and demographic findings of D2R antibody positivity in autoimmune basal ganglia disorders [001 28] We identified a total of 26 individuals with D2R antibody in basal ganglia disorders. D2R antibodies were more common in females (1 7/45) compared to males (9/68, chi-square test with Yates correction P < 0.005), and non-white (13/35) compared to white patients (1 3/78, chi-square test with Yates correction P < 0.05). Streptococcal-0 titres were positive (>200 Ill/ml) in all of the Sydenham chorea, but in only 3/1 1 of the basal ganglia encephalitis patients. The movement disorder phenotype varied according to gender. In females positive for D2R antibodies, the movement disorders in descending order of frequency were chorea (n = 1 3), dystonia-parkinsonism (n = 3), and tics (n = 2). In D2R antibody-positive males, the movement disorders were dystonia-parkinsonism (n = 7), tics (n = 2), and chorea (n = 1 ).
Figure imgf000037_0001
* CSF Lymphocyte range 0-30 cells/mm3, median 1 cell/mm3
† IVMP= Intravenous methyl-prednisolone
IVIG= Intravenous immunoglobulin
# = complete treatment: 30mg/kg/day of Methylprednisolone for three days followed by three months of tapered oral prednisolone (starting 2mg/kg/day for one month). In addition, patients were given 2g/kg of intravenous immunoglobulin at the same time as the intravenous steroid.
†ADD = Attention deficit disorder §OCD = Obsessive compulsive disorder, ODD= Oppositional defiant disorder, ASD = autistic spectrum disorder
Table 5: Ancillary tests, treatment, and outcome in 12 D2R antibody positive children
[00129] A number of the patients were treated empirically, and some patients did not receive immune therapy (Table 5). Full recovery occurred in 5/12 (Table 5). Based on these results, the inventors believe that one of the potential benefits of the method of the invention is that it allows patients to be treated early and aggressively with beneficial outcomes.
Figure imgf000038_0001
*Patients receiving intraveneous Methyl prednisolone then oral prednisolone for 4 or more weeks in acute phase. **Patients receiving intravenous Methyl prednisolone and oral prednisolone for 4 or more weeks, and IVIG
ADD = Attention deficit disorder, ODD = oppositional defiant disorder, OCD = obsessive- compulsive disorder, OGC = oculogyric crises
Table 6. Clinical features, acute Magnetic resonance imaging features and outcome of basal ganglia encephalitis patients with D2R antibodies
Characteristic D2R D2R antibody- antibody- positive (n = negative (n = 10) 20)
Demographics
Female sex 9/10 15/20
Age mean (range) 8.4 (2-13) 1 1 .9 (7-16)
Non-white 5/10 6/20
Prodromal symptoms
Infection 7/10 12/20
Positive ASOT >200 lU/ml 10/10 18/20
Movement disorder
Chorea 8/10 14/20
Hemichorea 2/10 6/20
Psychiatric symptoms
Any psychiatric symptoms 7/10 16/20
Emotional lability, anxiety 7/10 14/20 Personality change 6/10 14/20
Attention deficit hyperactivity disorder 2/10 4/20
Generalised anxiety disorder 0/10 5/20
Other
Dysarthria 6/10 13/20
Carditis 6/10 13/20
Arthritis or arthralgia 5/10 8/20
Fever 1 /10 4/20
ASOT = anti-Streptococcal-0 titre
Table 7: Clinical comparison of D2R antibody-positive (n = 10) and -negative Sydenham chorea patients (n = 20)
Conclusions
[00130] Encephalitis complicated by movement disorders has previously been termed encephalitic Parkinsonism, encephalitis lethargica, basal ganglia acute disseminated encephalomyelitis, or bilateral striatal necrosis (Dale ef a/Ann Neurol. 2009; 66(5): 704-9) The inventors have previously shown that some encephalitis patients with dyskinesias,
encephalopathy, and seizures had anti-NMDAR antibodies, and have therefore been reclassified as anti-NMDAR encephalitis (Dale ef a/Ann Neurol. 2009; 66(5): 704-9) Herein, we have shown that patients with encephalitis complicated by movement disorders without anti- NMDAR antibodies instead have serum specific antibodies against Dopamine receptors, such as D2R, and have an encephalitis with clinical and radiological features localising to the basal ganglia which the inventors term anti-D2R encephalitis.
[00131 ] Elevated dopamine-2 receptor immunoglobulin G were also found in 10/30 Sydenham chorea patients and 4/44 Tourette syndrome patients. Thus dopamine-2 receptor antibodies can define autoimmune movement and psychiatric disorders.
[00132] MR imaging was normal in 50% of anti-D2R encephalitis cases, but when abnormal lesions were strongly localised to the basal ganglia. However MRI is often normal in anti-D2R encephalitis and anti-NMDAR encephalitis which emphasizes the importance of autoantibodies in the identification of these disorders. Unlike anti-NMDAR encephalitis, most of the anti-D2R encephalitis patients did not have CSF pleocytosis, although elevated protein, neopterin, or oligoclonal bands were common. EEG was rarely contributory, and often normal, further suggesting anti-D2R antibody encephalitis predominantly affects subcortical rather than cortical regions, in contrast to anti-NMDAR encephalitis which affects both.
[00133] Recently admitted patients with D2R antibody-positive encephalitis have been treated promptly and aggressively with high dose steroids and IVIG, and have made good recoveries with normalisation of D2R antibody titre in one patient. Additionally, although immune therapy is recommended in autoimmune encephalitis, a spontaneous and complete recovery occurred without immune therapy in two of the patients suggesting that the autoimmune process can be spontaneously reversible.
[00134] There are a number of similarities between basal ganglia encephalitis and Sydenham chorea; both syndromes are typically post-infectious movement disorders evolving over days or weeks, both syndromes can respond to immune therapies, and both syndromes have a small but significant risk of relapse. Although recent streptococcal infection was evident in all D2R antibody-positive Sydenham chorea patients, only a minority of basal ganglia encephalitis patients had positive streptococcal serology, suggesting that D2R antibody is not dependent upon streptococcal immunoreactivity. The D2R antibody-positive encephalitis patients also tended to have a more severe clinical syndrome than Sydenham chorea, and were more likely to have basal ganglia radiological abnormalities and residual impairments. Intriguingly, Greenfield and Wolfsohn reported in 1922 that the pathology of basal ganglia encephalitis (so called encephalitis lethargica) and Sydenham chorea showed significant similarities, with perivenous inflammation predominantly affecting the striatum.
[00135] Finally we found that female sex and non-white ethnicity were positively associated with D2R antibodies, which are described risk factors for N-Methyl D-Aspartate Receptor encephalitis, and autoimmunity in general.
[00136] On the basis of the current study the inventors propose that dopamine receptor or DAT antibody encephalitis for example D2R antibody encephalitis could represent an autoimmune model of parkinsonism, dystonia, chorea, psychosis, and attention deficit disorder. Thus, anti-dopamine receptor antibody, for example anti-D2R antibody can provide a biomarker which could assist in early intervention and improve outcome in patients presenting with a range of CNS disease states including encephalitis, basal ganglia encephalitis, a range of autoimmune movement disorders, for example Sydenham chorea, paediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS), Tourette syndrome, obsessive compulsive disorder (OCD) and other emotional disorders including depression and anxiety, opsoclonus myoclonus, cerebellar ataxia and psychosis. It may also be useful in the prediction of the risk of developing a CNS disease.
[00137] References
Brilot F, Dale RC, Selter RC, Grummel V, Kalluri SR, Aslam M, et al. Antibodies to native myelin oligodendrocyte glycoprotein in children with inflammatory demyelinating central nervous system disease. Ann Neurol. 2009; 66(6): 833-42.
Brilot F, Merheb V, Ding A, Murphy T, Dale RC. Antibody binding to neuronal surface in Sydenham chorea, but not in PANDAS or Tourette syndrome. Neurology. 201 1 ; 76(17): 1508- 13.
Cardoso F, Eduardo C, Silva AP, Mota CC. Chorea in fifty consecutive patients with rheumatic fever. Mov Disord 1997; 12: 701 -703.
Dale RC, Church AJ, Surtees RA, Lees AJ, Adcock JE, Harding B, et al. Encephalitis lethargica syndrome: 20 new cases and evidence of basal ganglia autoimmunity. Brain. 2004; 127(Pt 1 ): 21 -33.
Dale RC, Irani SR, Brilot F, Pillai S, Webster R, Gill D, et al. N-methyl-D-aspartate receptor antibodies in pediatric dyskinetic encephalitis lethargica. Ann Neurol. 2009; 66(5): 704-9.
Granerod J, Ambrose HE, Davies NW, Clewley JP, Walsh AL, Morgan D, et al. Causes of encephalitis and differences in their clinical presentations in England: a multicentre, population-based prospective study. Lancet Infect Dis 2010; 10: 835-844.
Irani SR, Bera K, Waters P, Zuliani L, Maxwell S, Zandi MS, et al. N-methyl-Daspartate antibody encephalitis: temporal progression of clinical and paraclinical observations in a predominantly non-paraneoplastic disorder of both sexes. Brain 2010; 133: 1655-1667.
Lai M, Huijbers MG, Lancaster E, Graus F, Bataller L, Balice-Gordon R, et al. Investigation of LGI1 as the antigen in limbic encephalitis previously attributed to potassium channels: a case series. Lancet Neurol 2010; 9: 776-785.
Suleiman J, Brenner T, Gill D, Brilot F, Antony J, Vincent A, et al. VGKC antibodies in pediatric encephalitis presenting with status epilepticus. Neurology 201 1 ; 76: 1252-1255.
Tanaka ef a/ (2003) Journal of Neuroimmunology 141 155-164

Claims

1 . A method of diagnosing a central nervous system disorder in a subject said method comprising the step of detecting in a sample from said subject the presence of an antibody capable of binding to a dopamine receptor or fragment thereof wherein the presence of said antibody is indicative of said central nervous system disorder in said subject.
2. The method of claim 1 wherein an increase in the level of said antibody relative to a predetermined control level is indicative of said central nervous system disorder in said subject.
3. The method according to claim 1 or claim 2 wherein said dopamine receptor or fragment thereof is a dopamine D2R or fragment thereof.
4. The method according to any one of claims 1 to 3 wherein said central nervous system disorder is selected from the group consisting of encephalitis, basal ganglia
encephalitis, a range of autoimmune movement disorders, including Sydenham chorea, paediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS), Tourette syndrome, obsessive compulsive disorder (OCD) and other emotional disorders including depression and anxiety, opsoclonus myoclonus, cerebellar ataxia or psychosis.
5. The method according to any one of claims 1 to 4 wherein said central nervous system disorder is basal ganglia encephalitis.
6. The method according to any one of claims 1 to 4 wherein said central nervous system disorder is Tourette syndrome.
7. The method according to any one of claims 1 to 4 wherein said central nervous system disorder is Sydenham chorea.
8. The method according to any one of claims 1 to 7 wherein said subject is a child.
9. The method according to any one of claims 1 to 7 wherein said subject is an adult
10. A method of identifying a biomarker of a central nervous system disorder in a subject wherein said subject is suspected of having or susceptible to a central nervous system disorder said method comprising the step of detecting in a sample from said subject the presence of an antibody capable of binding to a dopamine receptor or fragment thereof wherein the presence of said antibody is the biomarker of the central nervous system disorder.
1 1 . The method according to any one of claims 1 to 10 wherein said antibody capable of binding to a dopamine receptor or fragment thereof is detected in an ex vivo sample obtained from said subject.
12. The method according to any one of claims 1 to 1 1 wherein said sample of said subject is blood, a blood-derived sample, cerebrospinal fluid, a cerebrospinal fluid-derived sample or CNS tissue.
13. The method according to any one of claims 1 to 12 wherein said sample of said subject is blood serum.
14. The method according to any one of claims 1 to 13 wherein said antibody capable of binding to a dopamine receptor or fragment thereof is detected by microscopy.
15. The method according to any one of claims 1 to 13 wherein said antibody capable of binding to a dopamine receptor or fragment thereof is detected by flow cytometry.
16. A method of treating a central nervous system disorder wherein said central nervous system disorder is identified by the method of any one of claims 1 to 15 wherein said method of treating comprises the step of administering to a subject in need thereof an immune suppressive drug, immunoglobulin, rituximab, cyclophosphamide, a compound capable of inhibiting the binding of an antibody to a dopamine receptor or fragment thereof,
plasmapheresis or plasma exchange or a combination thereof.
17. The method according to claim 16 wherein said central nervous system disorder is selected from the group consisting of encephalitis, basal ganglia encephalitis, a range of autoimmune movement disorders, including Sydenham chorea, paediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS), Tourette syndrome, obsessive compulsive disorder (OCD) and other emotional disorders including depression and anxiety, opsoclonus myoclonus, cerebellar ataxia or psychosis.
18. A method of treating basal ganglia encephalitis wherein said method comprises the step of administering to a subject in need thereof an immune suppressive drug, an
immunoglobulin, rituximab, cyclophosphamide, a compound capable of inhibiting the binding of an antibody to a dopamine receptor or fragment thereof, plasmapheresis or plasma exchange or a combination thereof.
19. The method according to any one of claims 16 to 18 wherein said immune suppressive drug is a steroid.
20. The method according to any one of claims 16 to 18 wherein said method of treating comprises the step of administering to a subject in need thereof a compound capable of inhibiting the binding of an antibody to D2R or fragment thereof.
21 . The method according to any one of claims 16 to 18 or 20 wherein said compound capable of inhibiting the binding of an antibody to a dopamine receptor or fragment thereof is a soluble dopamine receptor or fragment thereof.
22. The method according to any one of claims 16 to 21 wherein said subject is a child.
23. The method according to any one of claims 16 to 21 wherein said subject is an adult.
24. A method of identifying an antibody capable of binding to a dopamine receptor or fragment thereof said method comprising the steps of: expressing a dopamine receptor or fragment thereof on the surface of a cell; exposing said surface of said cell to a sample obtained from a subject; and detecting an antibody from said sample obtained from said subject capable of binding to said dopamine receptor or fragment thereof.
25. A method of identifying a compound capable of inhibiting the binding of an antibody to a dopamine receptor or fragment thereof said method comprising the steps of: expressing a dopamine receptor or fragment thereof on the surface of a cell; exposing said surface of said cell to an antibody capable of binding to said dopamine receptor or fragment thereof; and exposing the surface of said cell to a compound to be tested for inhibiting the binding of said antibody to said dopamine receptor or fragment thereof.
26. A method of identifying a compound capable of competing for binding with an antibody to a dopamine receptor or fragment thereof said method comprising the steps of: expressing a dopamine receptor or fragment thereof on the surface of a cell; exposing said surface of said cell to an antibody capable of binding to said dopamine receptor or fragment thereof; and exposing the surface of said cell to a compound to be tested for competing for binding with said antibody to said dopamine receptor or fragment thereof.
27. A method of diagnosing a CNS disorder in a subject comprising the step of detecting in a sample from the subject the presence of an antibody capable of binding to a dopamine receptor or fragment thereof wherein said antibody capable of binding to a dopamine receptor or fragment thereof is detected by a method comprising the steps of: expressing a dopamine receptor or fragment thereof on the surface of a cell; exposing said surface of the cell to a sample obtained from said subject; and detecting an antibody capable of binding to said dopamine receptor or fragment thereof from said sample obtained from said subject, wherein the presence of said antibody is indicative of said central nervous system disorder in said subject.
28. The method of claim 27 wherein an increase in the level of said antibody relative to a predetermined control level is indicative of said central nervous system disorder in said subject.
29. The method according to claim 27 or claim 28 wherein said cell is a eukaryotic cell.
30. The method according to claim 29 wherein said eukaryotic cell is a mammalian cell.
31 . The method according to claim 30 wherein said mammalian cell is a human cell.
32. The method according to claim 31 wherein said human cell is a HEK 293 cell.
33. The method according to any one of claims 27 to 32 wherein said dopamine receptor or fragment thereof is D2R or a fragment thereof.
34. The method according to any one of claims 27 to 33 wherein said sample obtained from said subject is blood, a blood-derived sample, cerebrospinal fluid or a cerebrospinal fluid- derived sample or CNS tissue.
35. The method according to any one of claims 27 to 33 wherein said sample obtained from said subject is blood serum.
36. The method according to any one of claims 27 to 33 wherein said sample obtained from said subject is cerebrospinal fluid.
37. The method according to any one of claims 27 to 36 wherein said antibody capable of binding to a dopamine receptor or fragment thereof is detected by microscopy.
38. The method according to any one of claims 27 to 36 wherein said antibody capable of binding to a dopamine receptor or fragment thereof is detected by flow cytometry.
39. Use of an immune suppressive drug, an immunoglobulin, rituximab,
cyclophosphamide, or a compound capable of inhibiting the binding of an antibody to a dopamine receptor or fragment thereof or a combination thereof in the preparation of a medicament for the treatment of a central nervous system disorder selected from the group consisting of encephalitis, basal ganglia encephalitis, a range of autoimmune movement disorders, including Sydenham chorea, paediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS), Tourette syndrome, obsessive compulsive disorder (OCD) and other emotional disorders including depression and anxiety, opsoclonus myoclonus, cerebellar ataxia or psychosis.
40. Use of an immune suppressive drug, an immunoglobulin, rituximab,
cyclophosphamide, or a compound capable of inhibiting the binding of an antibody to a dopamine receptor or fragment thereof or a combination thereof in the preparation of a medicament for the treatment of a central nervous system disorder selected from the group consisting of basal ganglia encephalitis, Sydenham chorea, and Tourette syndrome.
41 . An immunoglobulin, rituximab, cyclophosphamide, or a compound capable of inhibiting the binding of an antibody to a dopamine receptor or fragment thereof or a combination thereof for use in a method of treating a central nervous system disorder selected from the group consisting of encephalitis, basal ganglia encephalitis, a range of autoimmune movement disorders, including Sydenham chorea, paediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS), Tourette syndrome, obsessive compulsive disorder (OCD) and other emotional disorders including depression and anxiety, opsoclonus myoclonus, cerebellar ataxia or psychosis.
42. An immunoglobulin, rituximab, cyclophosphamide, or a compound capable of inhibiting the binding of an antibody to a dopamine receptor or fragment thereof or a combination thereof for use in a method of treating a central nervous system disorder selected from the group consisting of basal ganglia encephalitis, Sydenham chorea, and Tourette syndrome.
43. A method of diagnosing a central nervous system disorder in a subject said method comprising the step of testing for:
(a) the presence of an antibody capable of binding to a dopamine receptor in the subject, wherein the presence of the antibody in the subject is indicative of the presence of the central nervous system disorder in the subject; or
(b) the level of an antibody capable of binding to a dopamine receptor in the subject, wherein an increase in the level of the antibody in the subject relative to a control is indicative of the presence of a central nervous system disorder in the subject.
44. A method of predicting the risk of a subject developing a central nervous system disorder said method comprising the step of testing for:
(a) the presence of an antibody capable of binding to a dopamine receptor in the subject, wherein the presence of the antibody in the subject is indicative of an increased risk of developing the central nervous system disorder relative to a control group; or
(b) the level of an antibody capable of binding to a dopamine receptor or in the subject, wherein an increase in the level of the antibody in the subject relative to a control is indicative of an increased risk of developing the central nervous system disorder relative to a control group.
45. A method according to claim 43 or claim 44 wherein the presence or the level of the antibody is tested for in a sample taken from the subject.
PCT/AU2013/000046 2012-01-24 2013-01-24 Assay for a biomarker of a central nervous system disorder WO2013110121A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
AU2012900261A AU2012900261A0 (en) 2012-01-24 Assay for a biomarker of a central nervous system disorder
AU2012900261 2012-01-24
AU2012904191 2012-09-25
AU2012904191A AU2012904191A0 (en) 2012-09-25 Assay for a biomarker of a central nervous system disorder

Publications (1)

Publication Number Publication Date
WO2013110121A1 true WO2013110121A1 (en) 2013-08-01

Family

ID=48872820

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU2013/000046 WO2013110121A1 (en) 2012-01-24 2013-01-24 Assay for a biomarker of a central nervous system disorder

Country Status (1)

Country Link
WO (1) WO2013110121A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2015075395A (en) * 2013-10-09 2015-04-20 公益財団法人ヒューマンサイエンス振興財団 QUANTITATIVE METHOD OF CONCENTRATION OF EACH IgG SUBCLASS OF ANTI-NMDAR ANTIBODY

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
ANONYMOUS: "Anti-Dopamine D2 Receptor Antibody AB 1558", MILLIPORE, XP003031281, Retrieved from the Internet <URL:http://www.millipore.com/catalogue/item/ab1558> *
BEN-PAZI, H. ET AL.: "Striatal Microinjection of Sydenham Chorea Antibodies: Using a Rat Model to Examine the Dopamine Hypothesis", JOURNAL OF MOLECULAR NEUROSCIENCE, vol. 46, 2012, pages 162 - 166, XP035003297 *
DALE, R.C. ET AL.: "Antibodies to surface dopamine-2 receptor in autoimmune movements and psychiatric disorders", BRAIN, vol. 135, no. 11, 1 November 2012 (2012-11-01), pages 3453 - 3468 *
DALE, R.C. ET AL.: "Encephalitis lethargica syndrome: 20 new cases and evidence of basal ganglia autoimmunity", BRAIN, vol. 127, 2004, pages 21 - 33, XP055078741 *
GOSINK, J. ET AL.: "Cell-based immunoassays: a new technology for autoimmune diagnostics", CLINICAL LABORATORY INTERNATIONAL, 2010, pages 12 - 14, XP055078750, Retrieved from the Internet <URL:http://www.cli-online.com/index.php?id=3026andwww.eslbioscience.com/fileslnewsletters/cell_basedimmunoassays.pdf> [retrieved on 20130424] *
SINGER, H.S. ET AL.: "Antibodies against human putamen in children with Tourette syndrome", NEUROLOGY, vol. 50, 1998, pages 1618 - 1624, XP055078742 *
TANAKA, S. ET AL.: "Autoantibodies against four kinds of neurotransmitter receptors in psychiatric disorders", JOURNAL OF NEUROIMMUNOLOGY, vol. 141, 2003, pages 155 - 164, XP055080217 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2015075395A (en) * 2013-10-09 2015-04-20 公益財団法人ヒューマンサイエンス振興財団 QUANTITATIVE METHOD OF CONCENTRATION OF EACH IgG SUBCLASS OF ANTI-NMDAR ANTIBODY

Similar Documents

Publication Publication Date Title
Dale et al. Antibodies to surface dopamine-2 receptor in autoimmune movement and psychiatric disorders
Pathmanandavel et al. Antibodies to surface dopamine-2 receptor and N-methyl-D-aspartate receptor in the first episode of acute psychosis in children
Elliott et al. Functional identification of pathogenic autoantibody responses in patients with multiple sclerosis
Sinmaz et al. Autoantibodies in movement and psychiatric disorders: updated concepts in detection methods, pathogenicity, and CNS entry
CN102203613B (en) Neurological autoimmune disorders
US11041005B2 (en) Methods for detecting autoantibodies against a GABA(A) receptor alpha 1 subunit and/or beta 3 subunit in autoimmune seizure and/or encephalitis
Armangue et al. EU paediatric MOG consortium consensus: Part 3–Biomarkers of paediatric myelin oligodendrocyte glycoprotein antibody-associated disorders
Yang et al. Astrocytic damage in glial fibrillary acidic protein astrocytopathy during initial attack
Kuehn et al. Adult-onset temporal lobe epilepsy suspicious for autoimmune pathogenesis: Autoantibody prevalence and clinical correlates
Fehmi et al. Contactin-1 antibodies link autoimmune neuropathies to nephrotic syndrome
Bechter et al. Psychiatric syndromes other than dementia
US10877033B2 (en) Method of detecting the presence or absence of autoantibodies
WO2013110121A1 (en) Assay for a biomarker of a central nervous system disorder
DK2646462T3 (en) METHODS AND COMPOSITIONS FOR MONITORING PHAGOCYTIC ACTIVITY
US11644463B2 (en) Detection of an autoantibody
Guo et al. Autoantibody against the Rab6A/Rab6B in primary autoimmune cerebellar ataxia associated with Sjogren's syndrome: A case report
US10802019B2 (en) Method for detecting GABAA receptor autoantibodies
Xu et al. Identification of anti-Collapsin response mediator protein 2 antibodies in patients with encephalitis or encephalomyelitis
EP3938787A1 (en) Autoantibodies as biomarker of paraneoplastic encephalitis associated with testicular cancer
Wang et al. Identification of Medium-Length Antineurofilament Autoantibodies in Patients with Anti-N-Methyl-D-Aspartate Receptor Encephalitis
US20220308073A1 (en) Biomarker for alzheimer&#39;s disease
Xu et al. Characterization of A Novel Autoimmune Encephalitis Associated Antibody against CRMP2
WO2018212261A1 (en) Specific binding reagent for detecting qualitative difference of 4-repeat tau, and detection method, detection kit, and medication screening method using same
Dale Autoimmune encephalitis: overview of clinical recognition, autoantibody diagnostic markers, and treatment of autoimmune encephalitis
Deisenhammer et al. Psychiatric syndromes other than dementia

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13741620

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13741620

Country of ref document: EP

Kind code of ref document: A1