WO2013081426A1 - Composition for preventing or treating asthma, comprising phytoncide as active ingredients - Google Patents

Abstract

The present invention relates to a composition for preventing or treating asthma, comprising, as active ingredients, phytoncide of the concentration of 0.1 to 2% (v/v). The phytoncide of the concentration of 0.1 to 2% (v/v) according to the present invention may significantly reduce bronchial hyperresponsiveness and cell penetration into bronchial tubes through the functional mechanisms for inhibiting production of IL-4 (which is a cytokine secreted by Th2 cells and involved in inflammatory mechanisms of allergic reaction) and increasing interferon-gamma (which is a cytokine secreted by Th1 cells and involved in defense mechanisms against viruses and bacterial infection) and through the immunological tolerance functional mechanisms by promoting the generation of IL-10 generated in regulatory lymphocytes. Thus, the composition of the present invention which comprises phytoncide as active ingredients may be valuably used in preventing or treating asthma. Particularly, phytoncide is a natural material which is a functional material harmless to humans, and therefore, the composition of the present invention comprising the phytoncide as an active ingredient may have the benefits of being safe to use over a long period of time.

Description

Composition for the prevention or treatment of asthma comprising phytoncide as an active ingredient

The present invention relates to a composition for preventing or treating asthma, and more particularly, to a composition for preventing or treating asthma, which contains phytoncide at a concentration of 0.1 to 2% (v / v) as an active ingredient.

Bronchial asthma is an airway remodeling pathologically accompanied by chronic inflammation of the airway, as well as pathophysiologically bronchial hyperresponsiveness and clinically reversible, as well as temporary contractions caused by bronchial spasms caused by the causative agent or any stimulus. It is a disease characterized by airway obstruction.

Asthma can be divided into exogenous and endogenous asthma depending on the cause. Exogenous asthma refers to asthma, which is caused by irritation as well as when exposed to the causative antigen. A skin test or bronchial challenge test for the causative antigen is positive and usually occurs young. House dust mites are the most common cause antigens, and pollen, animal epithelium, and fungi act as the cause antigens. In the case of endogenous asthma, upper respiratory tract infection, exercise, emotional instability, cold climate and humidity conversion, causing or worsening asthma, which is common in adult asthma. Other medications include asthma, exercise-induced asthma and occupational asthma. In the case of the most problematic exogenous asthma, a skin test can be used to identify the causative antigen. In exogenous asthma, total IgE in serum is increased and antigen-specific IgE is detected.

In terms of pathophysiology, asthma is recognized as a chronic inflammatory disease caused by inflammatory cells proliferating, differentiating, and activating by cytokines produced by Th2 immune cells, moving to and invading the airways. At this time, chemical media that induce inflammation and allergic diseases are known as leukotriens, prostaglandines and platelet activating factor (PAF).

In addition, the imbalance of the Th1 / Th2 response is a key factor in association with the immunological etiology of asthma, and as the Th2 immune response increases, the Th1 response decreases. Th2 cells produce IL-4, IL-5, IL-13, and are particularly involved in the mechanism of allergic inflammatory response. These cells induce IgE production, mast cell differentiation, eosinophil maturation, migration and activation. Cain and the like play an important role, while Th1 cells are known to produce interferon-gamma, IL-2 and the like and play an important role in defense against viral and bacterial infections.

Therefore, many studies have been conducted to develop substances for inhibiting the production of cytokines such as IL-4, IL-5 and IL-13, which are involved in inflammatory cell activation in relation to asthma treatment, and also Th1- and Th2-related immunity. There is also an active research on controlled therapy.

On the other hand, phytoncide (phytoncide) is a compound word in Greek synthesized phyton (plants), which means plants and bactericidal power (killers) means a fungicide secreted by plants. All plants make their own defenses as a means of defending themselves, unlike animals, which make them self-defense. These phytoncides are extracted from cypresses, cypresses, etc. Refers to an organic compound of the terpene family. The main components of phytoncide are terpene-type compounds, which have a unique directionality and are known to be the most important contributors to various forest bath effects such as cardiopulmonary function, vascular function, respiratory reinforcement and skin disinfection.

The present inventors inhibit the production of cytokines (IL-4, IL-5, IL-13, etc.) involved in inflammatory cell activation, and at the same time are involved in defense mechanisms against viral and bacterial infections (interferon-gamma, While trying to find a natural substance with excellent action to treat asthma by promoting the production of IL-2, etc., the pharmacological effects of phytoncide were examined and the physiological effects of phytoncide in mouse model induced asthma. Inhibition of bronchial hyperresponsiveness and infiltration of inflammatory cells in the bronchus was significantly reduced, and this effect was inhibited by the production of IL-4 (which is a cytokine secreted by Th2 cells and involved in the inflammatory response mechanism) and interone gamma. From regulatory T lymphocytes that induce immunorelevance and increase (involved in defense mechanisms against viral and bacterial infections by cytokines secreted by Th1 cells) By re-check that is done through the mechanism of IL-10 is produced and completed the present invention.

Accordingly, it is an object of the present invention to provide a composition capable of preventing or treating asthma by significantly reducing bronchial hypersensitivity and inflammatory cell infiltration in the bronchus, as well as organic immunomodulation of Th1 and Th2.

The present invention also provides an immunotolerant inducer comprising 0.1 to 2% (v / v) phytoncide as an active ingredient having a production promoting activity of IL-10.

The present invention also provides a dietary supplement that can prevent or improve asthma by remarkably reducing bronchial hypersensitivity and bronchial hyperinvasion by organic immunomodulation and immunorelationship of Th1 and Th2.

In order to achieve the object of the present invention as described above, the present invention provides a composition for the prevention or treatment of asthma comprising 0.1 to 2% (v / v) phytoncide as an active ingredient.

In one embodiment of the present invention, the phytoncide may be extracted from one plant selected from the group consisting of pine, pine, cypress, birches and rhyme and plants.

In one embodiment of the present invention, the extraction is one extraction method selected from the group consisting of hot water extraction, cold extraction, reflux cooling extraction, solvent extraction, supercritical extraction, steam distillation, ultrasonic extraction, elution and compression It may be to be extracted.

In one embodiment of the invention, the formulation form of the composition is selected from the group consisting of granules, powders, tablets, coated tablets, capsules, suppositories, solutions, syrups, juices, suspensions, emulsions, drops and inhalants It may be.

In one embodiment of the present invention, the phytoncide concentration of 0.1 to 2% (v / v) inhibits the production of inflammatory cytokines IL-4 and IL-5, the production of IFN-γ and IL-10 It may have activity to promote and reduce airway resistance and cellular penetration in the bronchus through immunotolerance.

In one embodiment of the present invention, the phytoncide concentration of 0.1 to 2% (v / v) is to suppress the allergic reaction by Th2 lymphocytes through the production of IL-10, and to induce a response by Th1 lymphocytes Can be.

In one embodiment of the present invention, the inhibition of allergic reaction by Th2 lymphocytes may occur through phytoncid IgE antibody production inhibitory activity.

In one embodiment of the present invention, the induction of response by Th1 lymphocytes may occur through phytoncide's IgG, IgG1, IgG2a antibody production promoting activity.

In addition, the present invention provides an immune tolerance inducer comprising 0.1 to 2% (v / v) phytoncide as an active ingredient having a production promoting activity of IL-10.

In addition, the present invention provides a health functional food for the prevention or improvement of asthma comprising 0.1 to 2% (v / v) phytoncide as an active ingredient.

In one embodiment of the invention, the food is selected from the group consisting of beverages, meat, chocolate, foods, confectionery, pizza, ramen, other noodles, gums, candy, ice cream, alcoholic beverages, vitamin complexes and health supplements Can be.

Phytoncide at a concentration of 0.1-2% (v / v) of the present invention inhibits the production of IL-4 (which is involved in the inflammatory response mechanism by cytokines secreted by Th2 cells) and interferon-gamma (cytokines secreted by Th1 cells). Increase involvement in defense against viral and bacterial infections) and induce IL-10 production to significantly reduce bronchial hyperresponsiveness and cellular invasion through bronchial immune mechanisms. The composition can be usefully used for the prevention or treatment of asthma. In particular, phytoncide is a natural substance, which corresponds to a functional substance that is harmless to the human body, and the composition of the present invention comprising the same as an active ingredient has a safe advantage even for long-term use.

1 is an experimental group and a control group inhaled phytoncide of the present invention by concentration (0.5%, 1%, 2.5%, 5%, 10%, 100% [v / v]) in a mouse model induced asthma. The results of analyzing airway resistance are shown.

FIG. 2 is a light microscopic observation of eosinophil cells infiltrated in the experimental group and the control group inhaled phytoncide of the present invention by concentration (0.5%, 1%, 10% [v / v]) in a mouse model induced asthma. One picture is shown.

Figure 3 shows the lungs from the group inhaled phytoncide of the present invention by concentration (0.5%, 1%, 2.5%, 5%, 10%, 100% [v / v]) in the mouse model induced asthma After separation, RT-PCR was performed to show the comparative analysis of the expression levels of IL-4, IL-10 and interferon-gamma.

FIG. 4 shows the collection of bronchoalveolar lavage fluid from the group inhaled with the phytoncide of the present invention and the control group without inhalation in the mouse model induced asthma, and the amount of cytokines present in the bronchoalveolar lavage fluid was measured by spectrophotometer. It is shown.

FIG. 5 shows serum obtained from a group in which the phytoncide of the present invention was inhaled and a control group not inhaled in an asthma-induced mouse model, and the amount of IgE antibody and IgG antibody in the serum was measured by immunoenzyme method. will be.

The present invention is characterized by providing a composition for preventing or treating asthma, which contains phytoncide at a concentration of 0.1 to 2% (v / v) as an active ingredient.

Phytoncide (phytoncide) of the present invention is a generic name of a bactericidal substance produced by plants to protect themselves from pests or microorganisms, and terpene compounds are the main components, strengthening cardiopulmonary function, enhancing blood vessel function, and skin disinfecting action. It is known that it contributes the most to various forest bathing effects.

In the present invention, phytoncide having the above characteristics inhibits production of IL-4 and IL-5 and increases interferon-gamma at a concentration of 0.1 to 2% (v / v), as well as IL-10 production. Through immune immunity (immunity tolerance) through the effect of significantly reducing bronchial hypersensitivity and bronchial cell infiltration, it was first identified that asthma can be prevented or treated.

That is, according to one embodiment of the present invention, in order to determine whether the phytoncide can be used as a therapeutic agent for asthma treatment inhaled phytoncide by concentration in an asthma mouse model by sensitizing yolk sensitization to improve the asthma of the bronchus Analysis of airway resistance and infiltration inhibition effect of eosinophils and inflammatory cells into bronchial alveoli showed that the experimental group inhaled with phytoncide significantly reduced airway resistance, compared to the control group without inhalation of phytoncide. The treatment was effective in the group inhaled below% (v / v), and the treatment effect was insufficient at high concentration.

Airway resistance is caused by airway obstruction caused by airway hypersensitivity, a hallmark of bronchial asthma. The phytoncide according to the present invention, preferably less than 2% (v / v), can effectively reduce airway resistance. The number of eosinophils infiltrated with alveoli was also significantly reduced.

On the other hand, the present invention is characterized in that the use of phytoncide as a therapeutic agent for asthma and the optimal phytoncide treatment concentration range for maximizing the treatment of asthma, in general, asthma is produced by cytokines produced in TH2 immune cells. Chronic inflammatory disease caused by proliferation, differentiation, and activation of inflammatory cells to migrate and invade airways and peri airway tissues (Elias JA, et al., J. Clin. Invest., 111, p291-297, 2003) And key mediators for inducing allergic diseases include leukotriens, prostaglandines, and platelet activating factor (PAF). These include phospholipase A2 and cyclooctane. It is produced from the precursor arachidonic acid by cyclooxygenase and lipoxygenase.

Leukotriene constitutes a group of locally acting hormones produced in vivo from arachidonic acid, and important leukotrienes include leukotriene B4 (LTB4), leukotriene C4 (LTC4), leukotriene D4 (LTD4) and leukotriene E4 (LTE4). have. Biosynthesis of these leukotrienes begins by the enzyme 5-lipoxygenase acting on arachidonic acid to produce an epoxide known as leukotriene A4, which is produced by successive enzymatic reaction steps (LTB4, LTC4, LTD4, LTE4). Is converted to). Among them, cysteinyl leukotrienes (LCC4, LTD4, LTE4) is the substance that induces the strongest bronchial contraction action and eosinophil increase (Barnes PJ, et al., Pharmacol. Rev., 50, p515-596, 1998).

Eosinophils also produce large amounts of cysteine leukotriene, so their increase in airway tissue and bronchoalveolar lavage fluid (BALF) is an important factor exacerbating asthma (Underwood DC, et al., Am. J. Respir Crit Care Med., 154, p850-857, 1996). Therefore, inhibiting eosinophils is an important part of treating one inflammation of asthma. Asthma's inflammatory response is mainly caused by cytokines such as IL-4, IL-5 and IL-13 produced from inflammatory cells. (Gani, F. et al., Tecenti. Prog. Med., 89, p520-528, 1998)

Asthma is a complex disease involving several chemical media, cytokines, inflammatory cells, etc. Therefore, treatment for one cytokine, chemical media or a single cell is undesirable.

In particular, asthma, an airway allergy, is an airway hypersensitivity disease caused by allergic inflammation and is not a general inflammatory response by Th1 lymphocytes and neutrophils, but an allergic inflammatory response by Th2 lymphocytes and eosinophils.

Therefore, in the case of asthma treatments currently under development, methods using cytokine antibodies, that is, IL-2 antibodies, IL-5 antibodies or antagonistic cytokines of IL-8, anti-IgE antibodies, etc. have been tried. These substances are only substances that cause or worsen, and most of these substances are low molecular weight proteins, causing side effects and continuous unavailability due to their use.

Therefore, the development of a new concept as a treatment for asthma, that is, the need for the development of treatments through immune tolerance, has started to emerge, and researches to treat the treatment of asthma by the mechanism of immune tolerance are continuing. Is made through IL-10 of cytokines, and research has been attempted to develop interleukin-10 as an asthma therapeutic agent, but interleukin is a protein that causes a decrease in drug efficacy due to an immune response to heterologous proteins after prolonged administration. There is also a problem that antigen-antibody reactions occur and adversely affect other organs. Therefore, researches on therapeutic methods through substances capable of promoting their production are continuing, rather than using IL-10 itself.

Therefore, the inventors of the present invention to determine whether the phytoncide therapeutic effect of the phytoncide of the present invention is a mechanism through immune tolerance, lungs from the group inhaled phytoncide in the asthma-induced mice and the control group not inhaled After isolation, the expression levels and protein levels of mRNA of IL-4, IL-5, IL-10 and interferon-gamma were analyzed.

As a result, the group of asthma mice inhaled with phytoncide showed increased mRNA expression levels of IL-10 and interferon-gamma compared to the control group without inhalation of phytoncide, whereas the inflammatory cytokines IL-4 and IL- were increased. The expression level of 5 was found to be reduced, and this result was confirmed to be the same in the protein level analysis (see FIGS. 3 and 4).

From these results, the present inventors have found that the phytoncide of the present invention can prevent and treat asthma through the mechanism of immune tolerance through promoting the production of IL-10 in asthma disease.

On the other hand, the immunological mechanism of allergic disease is mainly described as "hygiene hypothesis" (hygiene hypothesis, imbalance of Th1 / Th2 response). Normally, the Th1 and Th2 responses are balanced by antagonizing each other.However, in order to develop allergic diseases including bronchial asthma, the Th1 response is reduced and the imbalance of the immune system where the Th2 response is enhanced is essential. Factor (Mosmann TR, et al., J Immunol. 136: 2348-57.1986). In allergic diseases such as allergic rhinitis and asthma, abnormal Th2 immune responses caused by IL-4, IL-5, and IL-13 cause eosinophilic inflammation, and in eosinophil inflammation, Th1 and Th2 cytokines antagonize each other and are selected. Inhibition of the Th2 response is important in suppressing allergic inflammation (Wilson MS, et al., J Exp Med 202: 1199-212, 2005; Park Y, et al. J Allergy Clin Immunol 108: 570-6 , 2001).

In addition, factors that determine the differentiation between Th1 and Th2 cells include a number of factors, such as interaction between antigen-presenting cells and T cells, the amount of antigen exposed, and cytokine secretion. Plays a key role in determining / Th2 response. A representative cytokine that increases the Th2 response is IL-4, and IL-12 is known as a cytokine that increases the Th1 response.

Therefore, the present inventors confirmed that the phytoncide of the present invention has an immune tolerant effect through the production of IL-10, and a response conversion (induction) effect of Th2 lymphocyte response to Th1 lymphocyte involved in a general inflammatory reaction. According to one embodiment, blood is collected from a group in which the phytoncide of the present invention is inhaled and a control group not inhaled in an asthma-induced mouse, and then IgG antibodies and Th2 lymphocytes, which are antibodies that lead to a response by Th1 lymphocytes The level of IgE antibody, which is the antibody which leads the reaction by, was measured. As a result, the yolk-specific IgE antibody was decreased in the phytoncide treated group compared to the untreated group, whereas the IgG antibody, IgG1 antibody, IgG2a antibody. Was found to increase (see FIG. 5).

Therefore, the present inventors have found that the phytoncide of the present invention can suppress the Th2 response, which is an allergic immune response, and induce immune tolerance, resulting in the treatment of asthma.

Therefore, the present invention provides a composition capable of preventing or treating asthma by containing phytoncide at a concentration of 0.1 to 2% (v / v) as an active ingredient, and also having 0.1 to 2% ( It is possible to provide an immune tolerance inducer comprising v / v) phytoncide as an active ingredient.

Phytoncide according to the present invention can be used commercially available, or those obtained by extraction and separation from nature using extraction and separation methods known in the art, preferably pine, pine, cypress, It can be extracted from one plant selected from the group consisting of birches and horticulture.

As the extraction method, any one of hot water extraction method, solvent extraction method, supercritical extraction method, cold leaching extraction method, reflux cooling extraction method, steam distillation method, ultrasonic extraction method, elution method, and compression method can be used. In addition, the desired extract may further be subjected to a conventional fractionation process, it may be purified using conventional purification methods. There is no limitation on the production method of the phytoncide of the present invention, and any known method may be used.

As a suitable solvent for extracting phytoncide from the pine, pine, cypress, birches, and one plant selected from the group consisting of rhyme and plants, any pharmaceutically acceptable solvent may be used, and water or organic A solvent may be used, but is not limited thereto, and includes, for example, 1 to 4 carbon atoms including purified water, methanol, ethanol, propanol, isopropanol, butanol, and the like. Alcohols, acetone, ether, benzene, chloroform, ethyl acetate, methylene chloride, hexane and cyclohexane The solvents may be used alone or in combination.

In addition, the primary extract extracted by the hydrothermal extraction or solvent extraction method can be prepared in a powder state by an additional process such as vacuum distillation and freeze drying or spray drying. The primary extract may be further purified using various chromatography such as silica gel column chromatography, thin layer chromatography, high performance liquid chromatography, and the like. You can also get

In addition, the phytoncide of the present invention was obtained by crushing the leaves, stems, roots, etc. of one plant selected from the group consisting of pine, pine, cypress, birches and horticulture and plants, to obtain a powder, supercritical fluid carbon dioxide It may be extracted by adding a mixed extraction solvent in which ethanol and water are mixed.

Supercritical fluids are incompressible fluids at temperatures and pressures above the critical point and exhibit unique characteristics not found in conventional solvents. In particular, supercritical fluids have molecular associations due to density fluctuations near the critical point, so that they have a high density close to liquid, low viscosity close to gas, high diffusion coefficient, and very low surface tension. At the same time has excellent properties. Since the supercritical fluid can continuously change the density from the lean state close to the ideal gas to the high density state close to the liquid density, it is possible to control the equilibrium properties, the transfer properties, and the molecular aggregation state of the fluid.

Carbon dioxide can be used as a supercritical fluid. Carbon dioxide is not only present in nature in abundantly, but also abundantly produced in the steel industry or petrochemical industry, and is colorless, odorless, harmless to the human body, and chemically stable. Best of all, it has lower critical temperature (31.1 ° C) and critical pressure (7.4 MPa) than any other fluid, so it can be easily adjusted to supercritical conditions, resulting in high energy efficiency. In addition, the extraction method of the phytoncide using the conventional organic solvent is organic solvent remaining in the final product, difficulty in removing the solvent, environmental pollution problems and low extraction yield, the extraction time is usually 24 to 28 hours Although there is a problem that takes a long time, by using a supercritical fluid extraction method it is possible to solve the problems caused by the organic solvent as described above can obtain a high purity phytoncide component.

The composition of the present invention containing the phytoncide at a concentration of 0.1 to 2% (v / v) may be a pharmaceutical composition or a food composition.

The pharmaceutical composition of the present invention may be prepared using a pharmaceutically suitable and physiologically acceptable adjuvant in addition to the active ingredient, and the adjuvant may include excipients, disintegrants, sweeteners, binders, coating agents, swelling agents, lubricants, Lubricants, flavors and the like can be used.

The pharmaceutical composition may be preferably formulated into a pharmaceutical composition including one or more pharmaceutically acceptable carriers in addition to the above-described active ingredient for administration.

Formulation forms of the pharmaceutical compositions may be granules, powders, tablets, coated tablets, capsules, suppositories, solutions, syrups, juices, suspensions, emulsions, drops, inhalants or injectable solutions. For example, for formulation in the form of tablets or capsules, the active ingredient may be combined with an oral, nontoxic, pharmaceutically acceptable inert carrier such as ethanol, glycerol, water and the like. In addition, if desired or necessary, suitable binders, lubricants, disintegrants and coloring agents may also be included in the mixture. Suitable binders include, but are not limited to, natural and synthetic gums such as starch, gelatin, glucose or beta-lactose, corn sweeteners, acacia, trackercance or sodium oleate, sodium stearate, magnesium stearate, sodium Benzoate, sodium acetate, sodium chloride and the like. Disintegrants include, but are not limited to, starch, methyl cellulose, agar, bentonite, xanthan gum, and the like. Acceptable pharmaceutical carriers in compositions formulated in liquid solutions are sterile and physiologically compatible, including saline, sterile water, Ringer's solution, buffered saline, albumin injectable solutions, dextrose solution, maltodextrin solution, glycerol, ethanol and One or more of these components may be mixed and used, and other conventional additives such as antioxidants, buffers and bacteriostatic agents may be added as necessary. Diluents, dispersants, surfactants, binders and lubricants may also be added in addition to formulate into injectable formulations, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like. Furthermore, the method disclosed in Remington's Pharmaceutical Science, Mack Publishing Company, Easton PA can be formulated according to each disease or component, as appropriate in the art.

In one embodiment of the invention, the phytoncide of 0.1 to 2% (v / v) concentration of the present invention may be included in 0.1 to 50% by weight relative to the total weight of the composition.

The composition of the present invention may also be a food composition, which contains 0.1 to 2% (v / v) of phytoncide as an active ingredient, in addition to various flavors or natural carbohydrates as in conventional food compositions. May be contained as an additional component.

Examples of the above-mentioned natural carbohydrates include monosaccharides such as glucose, fructose and the like; Disaccharides such as maltose, sucrose and the like; And conventional sugars such as polysaccharides such as dextrin, cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. The aforementioned flavoring agents can advantageously be used natural flavoring agents (tautin), stevia extracts (for example rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.).

The food composition of the present invention may be formulated in the same manner as the pharmaceutical composition, used as a functional food, or added to various foods. Foods to which the composition of the present invention may be added include, for example, beverages, meat, chocolate, foods, confectionery, pizza, ramen, other noodles, gums, candy, ice creams, alcoholic beverages, vitamin complexes, and health supplements. There is this.

In addition, the food composition may contain various nutrients, vitamins, minerals (electrolytes), synthetic flavors and natural flavors, as well as phytoncide in concentrations of 0.1 to 2% (v / v) as an active ingredient, colorants and neutralizers (cheese). , Chocolate and the like), pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH adjusting agents, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated drinks, and the like. In addition, the food composition of the present invention may contain a fruit flesh for producing natural fruit juice and fruit juice beverage and vegetable beverage.

Phytoncide concentration of 0.1 to 2% (v / v), an active ingredient of the present invention, is a natural substance, and thus has little toxicity and side effects. Therefore, the phytoncide may be used safely in prolonged inhalation for the purpose of preventing or treating asthma.

The present invention also provides a health functional food for preventing or improving asthma, which contains phytoncide at a concentration of 0.1 to 2% (v / v) as an active ingredient.

The health functional food of the present invention may be prepared and processed in the form of tablets, capsules, powders, granules, liquids, pills and the like for the purpose of preventing or improving asthma.

In the present invention, the health functional food refers to foods manufactured and processed using raw materials or ingredients having functional properties useful for the human body according to Act No. 6767 of the Health Functional Food Act, and control nutrients to the structure and function of the human body. Or ingestion for the purpose of obtaining useful effects in health applications such as physiological effects.

The health functional food of the present invention may include a conventional food additive, and the suitability as a food additive, unless otherwise specified, in accordance with the General Regulations of the Food Additives and General Test Methods approved by the Food and Drug Administration, etc. Judging by the standards and standards.

Examples of the items loaded on the food additive revolution include, for example, chemical compounds such as ketones, glycine, calcium citrate, nicotinic acid and cinnamon acid; Natural additives such as dark blue pigment, licorice extract, crystalline cellulose, high color pigment and guar gum; And mixed preparations such as sodium L-glutamate, algae additives, preservatives and tar dyes.

For example, a dietary supplement is granulated in a conventional manner by mixing a mixture of excipients, binders, disintegrants and other additives with phytoncide at a concentration of 0.1 to 2% (v / v), the active ingredient of the present invention. Then, the lubricant may be added by compression molding, or the mixture may be directly compression molded. In addition, the health functional food in the form of tablets may contain a mating agent or the like as necessary.

Hard capsules among the health functional foods in the form of capsules may be prepared by filling a mixture of additives, such as excipients, with a phytoncide having a concentration of 0.1 to 2% (v / v), which is the active ingredient of the present invention, in a conventional hard capsule. The soft capsule may be prepared by filling a capsule base, such as gelatin, with a mixture of a dolomite extract and an additive such as an excipient. The soft capsule agent may contain a plasticizer such as glycerin or sorbitol, a colorant, a preservative, and the like, as necessary.

The health functional food in the form of a cyclic form may be prepared by molding a mixture of a phytoncide, an excipient, a binder, a disintegrant, and the like having a concentration of 0.1 to 2% (v / v) as an active ingredient of the present invention. If necessary, the coating may be carried out with sugar or other coatings, or the surface may be coated with a substance such as starch or talc.

The health functional food in the form of granules can be prepared by granulating a mixture of a phytoncide, an excipient, a binder, a disintegrant, and the like having an active ingredient of 0.1 to 2% (v / v) in the present invention. If necessary, it may contain a flavoring agent, a mating agent and the like.

The health functional food containing 0.1 to 2% (v / v) phytoncide of the present invention as an active ingredient has a functional mechanism for inhibiting the production of IL-4 and increasing interferon-gamma as confirmed in the following examples. In addition, it is effective in preventing or improving asthma because it can significantly reduce bronchial hyperresponsiveness and cell invasion through bronchial immune mechanism through IL-10 production.

The health functional food may be beverages, meat, chocolate, foods, confectionery, pizza, ramen, other noodles, gum, candy, ice cream, alcoholic beverages, vitamin complexes and health supplements.

The present invention also provides the use of a composition comprising phytoncide at a concentration of 0.1 to 2% (v / v) for the manufacture of a medicament or food for the prevention or treatment of asthma. The composition of the present invention containing the phytoncide of 0.1 to 2% (v / v) concentration as an active ingredient can be used for the manufacture of a medicine or food for the prevention or treatment of asthma.

The present invention also provides a method for preventing or treating asthma, comprising administering a phytoncide at a concentration of 0.1 to 2% (v / v) to a mammal.

As used herein, the term "mammal" refers to a mammal that is the subject of treatment, observation or experimentation, preferably human.

As used herein, the term “therapeutically effective amount” means an amount of an active ingredient or pharmaceutical composition that induces a biological or medical response in a tissue system, animal or human, as thought by a researcher, veterinarian, doctor or other clinician, which Amounts that induce alleviation of the symptoms of the disease or disorder being treated. It will be apparent to those skilled in the art that the therapeutically effective dosages and frequency of administrations for the active ingredients of the present invention will vary depending on the desired effect. Therefore, the optimal dosage to be administered can be readily determined by one skilled in the art and includes the type of disease, the severity of the disease, the amount of active ingredients and other ingredients contained in the composition, the type of formulation, and the age, weight, general health of the patient. It may be adjusted according to various factors including the condition, sex and diet, time of administration, route of administration and the rate of secretion of the composition, the duration of treatment, and the drugs used simultaneously. In the treatment method of the present invention, in the case of an adult, phytoncide at a concentration of 0.1 to 2% (v / v) of the present invention is administered at a dose of 1 mg / kg to 250 mg / kg once or several times a day. It is desirable to.

In the treatment method of the present invention, the composition comprising 0.1 to 2% (v / v) phytoncide of the present invention as an active ingredient may be administered in a conventional manner through oral, rectal, intravenous, intraperitoneal, topical, intradermal and inhalation routes. Can be administered.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are intended to illustrate the present invention more specifically, but the scope of the present invention is not limited to these examples.

<Example 1>

Finding out the effect of phytoncide on asthma treatment by mouse animal model experiment

<1-1> Effect of Concentration of Phytoncide on Airway Resistance

In order to analyze the optimal concentration range for treating asthma among phytoncide, we first created an asthma mouse model to analyze the effect of concentration-specific phytoncide application on resistance in airways. In other words, 6 weeks-old male C57BL / 6 mice were sensitized yolk to create an asthma-induced mouse model. More specifically, 20 μg of egg yolk was dissolved in 100 μl of physiological saline, and then the same volume of Imject Alum complex was added thereto, and 200 μl of this yolk solution was injected intraperitoneally of the mouse. Thereafter, 2% egg yolk was sensitized daily using a nebulizer (neubilizer, Pari-Inhaler Boy) for 10 minutes every day from day 21 to day 23 of the experiment to prepare a mouse model induced asthma.

Thereafter, the phytoncide purchased from Sino Foreign Pharmaceuticals was prepared for each concentration (v / v) from the 23rd to the 25th day of the experiment and treated for 30 minutes using NEUBILIZER. The control group was inhaled with saline.

Then, to investigate whether the phytoncide inhibits airway hyperresponsiveness that is characteristic of bronchial asthma, the degree of airway resistance induced by airway obstruction was measured. Inhaled with 2% egg yolk for 10 minutes to sensitize yolk, then gradually increase the concentration from 2.5 mg / ml to 25 mg / ml of methacholine for 2 minutes in each mouse group. It was calculated as Penh (enhanced pause) using 3000 (Allmedicus, Anyang, Korea).

As a result, as shown in Figure 1, when inhalation of the phytoncide of the present invention for each asthma mouse model induces airway hypersensitivity, in the experimental group to which the concentration of 0.5% and 1% (v / v) was applied In contrast, the resistance was significantly reduced, but in contrast, the experimental groups applying the concentrations of 2.5%, 5% and 10% (v / v) showed little reduction in airway resistance.

Therefore, the present inventors found that the low concentration (2% or less) of phytoncide is effective in treating asthma, while the effect of asthma treatment is insignificant at other concentrations.

<1-2> Analysis of Inflammatory Inhibitory Effect of Concentrated Phytoncide

Experimental mice and control mice used in Example <1-1> (the experimental group inhaled phytoncide by concentration of the present invention in asthma-induced mice and the group inhaled physiological saline instead of phytoncide) were anesthetized after the chest of each mouse Incision was performed to separate the airways, and then a polyethylene tube was inserted, 1 ml of saline was injected into the airways through the tube, and the lungs were gently massaged to collect bronchoalveolar lavage fliude (BALF). Subsequently, a total of 1.8 ml of the collected bronchoalveolar lavage fluid was centrifuged to separate cells, and a slide was made using cytospin, an automatic cell smearing device. Light-Giemsa staining was performed, and then 100 cells were counted at a × 400 magnification field using an optical microscope to calculate the number of infiltrating eosinophils. In addition, neutrophils and macrophages were also examined by an optical microscope to measure the number of cells.

As a result, as shown in Figure 2, in the experimental group applying the phytoncide concentration of 0.5% and 1% (v / v), the number of eosinophils as well as the total number of inflammatory cells infiltrated into the bronchoalveolar alveolar due to yolk sensitization is significantly reduced. On the other hand, in the experimental group to which the concentration of 10% (v / v) was applied, the inflammatory cells infiltrated into the bronchoalveolar algae did not decrease and showed a similar form to the control group.

These experimental results are consistent with the above Examples 1-1, and the present inventors reaffirmed that low concentrations (up to 2%) of phytoncide are effective in treating asthma, while the effects of asthma treatment are insignificant at other concentrations. Could.

<1-3> Inflammation-related cytokine expression analysis by RT-PCR

The present inventors conducted the following experiments to determine whether the low concentration (2% or less) phytoncide prevents or treats asthma due to the expression of inflammation-related cytokines. That is, the mRNA of each mouse was used to isolate the lungs used in the experiment of Example <1-2>. The PCR reaction conditions were 35 cycles of IL-4, IFN-γ, IL-10 annealing at 94 ℃ for 1 minute, 56 ℃ for 1 minute at 72 ℃ for 2 minutes, 72 ℃ for 10 minutes extension. PCR was performed using DNA thermal Cycle 480 (Perkin ElmerNorwalk, USA) and the resulting product was electrophoresed to identify each band at 399 bp for IL-4 and 460 bp for IFN-γ at 300 bp for IL-10. The primer used for RT-PCR is as follows.

Table 1

PCR product		Primer sequences
IL-4	Forward	5'ATGGGTCTCAACCCCCAGCAT3 '
	Reverse	5'GCTCTTTAGGCTTTCCAGGAAGTC3 '
IFN-	Forward	5'TGAACGCTACACACTGCATCTTGG3 '
	Reverse	5'CGACTCCTTTTCCGCTTCCTGAG3 '
IL-10	Forward	5'AGCTGGACAACATACTGCTAACC3 '
	Reverse	5'TCATTCATGGCCTTGTAGACAC3 '

As a result, as shown in FIG. 3, the level of cytokine expression of IL-4 was significantly decreased in the experimental group to which 0.5% and 1% (v / v) of phytoncide was applied (0.5% of phytoncide). Was not shown in the experimental group), and in contrast, in the experimental group to which the concentrations of 2.50%, 5% and 10% (v / v) were applied, the level of cytokine expression of IL-4 was increased. . In addition, the expression levels of interferon gamma (IFN-γ) and IL-10 showed that the expression of interferon gamma (IFN-γ) was rapidly increased only in phytoncide at concentrations of 0.5% and 1% (v / v). .

Based on these results, the inventors found that only low concentrations of phytoncide (2% or less) reduced IL-4 production, increased interferon gamma (IFN-γ) expression, and increased IL-10 expression to prevent asthma. It can be seen that it can be suppressed and treated.

In other words, it is a kind of cytokine secreted by Th2 cells, which reduces the production of IL-4 which is the most fundamental of allergic inflammatory reaction mechanisms, and an interferon gamma (IFN-) that is involved in the defense mechanism against viral and bacterial infections by a kind of cytokines secreted by Th1 cells. bilateral mechanisms of action that enhance expression of γ) (inhibition of inflammation and enhancement of defense against infection at the same time) and immune perforation by promoting IL-10 production significantly reduce bronchial hyperresponsiveness and cellular infiltration into bronchial asthma. It has been experimentally demonstrated that the optimal concentration of phytoncide that can be prevented or treated is 2% or less.

<1-4> Inflammation-related cytokine expression analysis at the protein level

Furthermore, the present inventors have confirmed that the phytoncide has an activity of inhibiting the expression of inflammation-related cytokines at the mRNA level through the experimental results of the above <1-3>, so that the phytoncide may be the same at the protein level. Whether the inhibition of the production was analyzed through the following experiment. To this end, bronchoalveolar lavage fluid was collected from each mouse used in the above example and stored at −70 ° C. to immunize cytokines IL-4, 5, 10 and INF-γ using a Quantikine kit (R & D Systems). It measured by the enzyme method.

More specifically, 50 μl of analytical dilution RD1 per well was put into a 96-microwell plate for immunoenzyme, the plate was covered with a cover, and then left at room temperature and then removed, and each sample was left at room temperature for 2 hours. After washing 5 times with a washing buffer, 100 μl of each mouse cytokine-conjugate was added to each well and allowed to stand at room temperature for 3 hours. Again washed three times with the washing solution, 100 ㎕ each substrate was placed and allowed to stand at room temperature for 30 minutes. Wash three times and add reaction stop solution and mix well. After 30 minutes, absorbance (optical density, OD) was measured with a spectrophotometer (BEP II plus, Germany). In addition, the bronchoalveolar lavage fluid was anesthetized with ketamine for each of the mice, the incision was made after the thoracic incision, and the airway was incised slightly to intubate the polyethylene tube. Then, after injecting 1 ml of saline solution, the lungs were gently massaged, and bronchial alveolar lavage fluid (Bronchoalveolar lavage fluid, BALF) was collected and used.

As a result, as shown in Figure 4, the group inhaled phytoncide of the present invention showed that IL-4 and IL-5 significantly decreased compared to the asthma-induced mouse group (non-phytoncide inhaled group), , IL-10 and INF-r were significantly increased in the phytoncide-aspirated group compared to the control group.

Therefore, through these results, the present inventors found that the phytoncide of the present invention promotes the activation of tidal lymphocytes, thereby increasing the production of IL-10, thereby inhibiting the Th2 allergic reaction and activating the opposite Th1 response to improve airway hyperresponsiveness. It can be seen that it is possible to suppress the inflammatory response by inhibiting inflammatory cells.

<Example 2>

Analysis of the effects of phytoncide on allergen-specific sensitizing IgE and IgG antibody production

As described above, asthma is an airway hypersensitivity disease caused by allergic inflammation. In other words, inflammatory reactions occur due to exposure of allergens, wherein general inflammation is known to be led by IgG antibodies, and allergic inflammation is known to be led by IgE antibodies.

Therefore, the present inventors conducted the following experiment to investigate whether the phytoncide of the present invention affects these IgG and IgE antibody levels.

Blood was collected by puncturing the heart of the mouse for each mouse used in the above example, and stored at −70 ° C., and the levels of yolk specific IgE, IgG1 and IgG2 antibodies were measured by immunoenzyme method. Specifically, 5 μg / ml of egg yolk was added to 20 μl per well in a 96-microwell plate for immunoenzyme and covered with a plate, and then left at 4 ° C. overnight. After removing the yolk solution, 300 μl of 1% BSA dissolved in PBS (phosp-hate buffered solution) was added to each well and left at room temperature for 1 hour. After washing three times with PBST (PBS containing 0.05% Tween 20), 100 μl of mouse serum was added to the wells and left at room temperature for 1 hour, washed three times with PBST again, and diluted with a secondary antibody. 100 μl of IgE monoclonal antibody (2 ug / ml in PBS-1% BSA) was added thereto and allowed to stand at room temperature for 1 hour. After washing three times with PBST, 100 μl of Av-HRP diluted 1: 1000 with PBS-1% BSA was added thereto and allowed to stand at room temperature for 30 minutes. After washing 3 times with PBST again, 100 μl of 30% H ₂ O ₂ was added to the substrate buffer in which ABTS was dissolved in 0.1M citric acid, and the mixture was left at room temperature for 30 minutes. 50 μl of SDS / DMF solution dissolved in 200 ml NN-dimethyl formamide (40% SDS) as a colorant was added, and then the optical density (OD) was measured at 405 nm using a spectrophotometer. The same was measured by the same immunoenzyme method, except that the concentration of the secondary antibody was diluted 1: 1 using PBS solution at 1: 10000.

As shown in FIG. 5, the asthma-induced mouse group treated with the phytoncide of the present invention showed that the production of egg yolk, especially IgE antibodies, was reduced compared to the asthma-induced mouse group without the phytoncide treated, whereas IgG, IgG1 And the degree of production of IgG2 has been shown to be increased.

Therefore, these results indicate that the phytoncide of the present invention can induce asthma, which is a response of Th2 lymphocytes, to a response to Th1 lymphocytes involved in a general inflammatory response, ultimately caused by Th2 cytokines. It was found that allergic asthma can be effectively prevented and treated.

So far I looked at the center of the preferred embodiment for the present invention. Those skilled in the art will appreciate that the present invention can be implemented in a modified form without departing from the essential features of the present invention. Therefore, the disclosed embodiments should be considered in descriptive sense only and not for purposes of limitation. The scope of the present invention is shown in the claims rather than the foregoing description, and all differences within the scope will be construed as being included in the present invention.

Claims (11)

1. Asthma prophylaxis or treatment composition comprising a phytoncide of 0.1 to 2% (v / v) concentration as an active ingredient.
2. The method of claim 1,

   The phytoncide is a composition characterized in that it is extracted from one plant selected from the group consisting of pine, pine, cypress, birches and rhyme and plants.
3. The method of claim 2,

   The extraction is characterized in that the extraction by hot water extraction, cold extraction, reflux cooling extraction, solvent extraction, supercritical extraction, steam distillation, ultrasonic extraction, elution and compression method selected from the group consisting of one extraction method.
4. The method of claim 1,

   The formulation form of the composition is selected from the group consisting of granules, powders, tablets, coated tablets, capsules, suppositories, solutions, syrups, juices, suspensions, emulsions, drops and inhalants.
5. The method of claim 1,

   The phytoncide at the concentration of 0.1 to 2% (v / v) inhibits the production of inflammatory cytokines IL-4 and IL-5, and promotes the production of IFN-γ and IL-10, thereby promoting airway resistance and A composition, characterized in that it has an activity to reduce cellular penetration in the bronchus.
6. The method of claim 1,

   The phytoncide concentration of 0.1 to 2% (v / v) inhibits allergic reactions by Th2 lymphocytes through promoting production of IL-10 and induces a response by Th1 lymphocytes.
7. The method of claim 6,

   Inhibition of allergic reaction by Th2 lymphocytes is characterized in that the phytoncide occurs through the inhibitory activity of the IgE antibody production.
8. The method of claim 6,

   Induction of a response by Th1 lymphocytes is characterized in that the phytoncide occurs through the IgG, IgG1, IgG2a antibody production promoting activity.
9. An immune tolerance inducer comprising 0.1 to 2% (v / v) phytoncide as an active ingredient having a production promoting activity of IL-10.
10. Health functional food for the prevention or improvement of asthma comprising 0.1 to 2% (v / v) phytoncide as an active ingredient.
11. The method of claim 10,

    The food is a health functional food, characterized in that selected from the group consisting of beverages, meat, chocolate, food, confectionery, pizza, ramen, other noodles, gum, candy, ice cream, alcoholic beverages, vitamin complexes and dietary supplements.

Images