WO2013081198A1 - Kit de détection du virus de l'hépatite c et procédé de détection du virus de l'hépatite c l'utilisant - Google Patents

Kit de détection du virus de l'hépatite c et procédé de détection du virus de l'hépatite c l'utilisant Download PDF

Info

Publication number
WO2013081198A1
WO2013081198A1 PCT/KR2011/009134 KR2011009134W WO2013081198A1 WO 2013081198 A1 WO2013081198 A1 WO 2013081198A1 KR 2011009134 W KR2011009134 W KR 2011009134W WO 2013081198 A1 WO2013081198 A1 WO 2013081198A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
nucleotide sequence
primer
probe
hcv
Prior art date
Application number
PCT/KR2011/009134
Other languages
English (en)
Korean (ko)
Inventor
에이. 옵다이크제이슨
쳉윈덴
린이핑
Original Assignee
삼성테크윈 주식회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 삼성테크윈 주식회사 filed Critical 삼성테크윈 주식회사
Priority to PCT/KR2011/009134 priority Critical patent/WO2013081198A1/fr
Publication of WO2013081198A1 publication Critical patent/WO2013081198A1/fr

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C12Q1/706—Specific hybridization probes for hepatitis
    • C12Q1/707—Specific hybridization probes for hepatitis non-A, non-B Hepatitis, excluding hepatitis D
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification

Definitions

  • the present invention discloses a kit for detecting hepatitis C virus and a method for detecting hepatitis C virus using the same. Also disclosed are oligonucleotides suitable for use in the method.
  • Hepatitis C virus is a parenteral infectious virus that causes hepatitis and interstitial hepatitis in most cases after blood transfusion, and it is estimated that about 1% of the world's population is infected. HCV infection is associated with acute hepatitis, chronic hepatitis, cirrhosis and subsequent liver cancer. HCV is classified as Hepacivirus and consists of about 9,500 nucleotide positive RNA molecules with a single large ORF encoding a polyprotein precursor of about 3,000 amino acids.
  • a kit for the detection of HCV is provided.
  • a method for real time detection of HCV in a sample is disclosed.
  • kits for real-time detection of HCV comprising a first primer, a second primer, and a probe, which enables sensitive and accurate detection of HCV genotype specific target sequences.
  • the first primer may have a sequence of SEQ ID NO: 1, 2, 12 or 13.
  • the second primer may have a sequence of SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, 14 or 15.
  • the probe may have a sequence of SEQ ID NO: 10, 11, 16 or 17.
  • kits for real-time detection of HCV is selected from the group consisting of the following primer sets and probes:
  • a primer set comprising a first primer having a nucleotide sequence of SEQ ID NO: 1 and a second primer having a nucleotide sequence of SEQ ID NO: 3, and a probe having a nucleotide sequence of SEQ ID NO: 10;
  • a primer set comprising a first primer having a nucleotide sequence of SEQ ID NO: 1 and a second primer having a nucleotide sequence of SEQ ID NO: 4, and a probe having a nucleotide sequence of SEQ ID NO: 10;
  • a primer set comprising a first primer having a nucleotide sequence of SEQ ID NO: 1 and a second primer having a nucleotide sequence of SEQ ID NO: 5, and a probe having a nucleotide sequence of SEQ ID NO: 10;
  • a primer set comprising a first primer having a nucleotide sequence of SEQ ID NO: 1 and a second primer having a nucleotide sequence of SEQ ID NO: 6, and a probe having a nucleotide sequence of SEQ ID NO: 10;
  • a primer set comprising a first primer having a nucleotide sequence of SEQ ID NO: 1 and a second primer having a nucleotide sequence of SEQ ID NO: 7, and a probe having a nucleotide sequence of SEQ ID NO: 10;
  • a primer set comprising a first primer having a nucleotide sequence of SEQ ID NO: 1 and a second primer having a nucleotide sequence of SEQ ID NO: 8, and a probe having a nucleotide sequence of SEQ ID NO: 10;
  • a primer set comprising a first primer having a nucleotide sequence of SEQ ID NO: 1 and a second primer having a nucleotide sequence of SEQ ID NO: 9, and a probe having a nucleotide sequence of SEQ ID NO: 10;
  • a primer set comprising a first primer having a nucleotide sequence of SEQ ID NO: 1 and a second primer having a nucleotide sequence of SEQ ID NO: 3, and a probe having a nucleotide sequence of SEQ ID NO: 11;
  • a primer set comprising a first primer having a nucleotide sequence of SEQ ID NO: 1 and a second primer having a nucleotide sequence of SEQ ID NO: 4, and a probe having a nucleotide sequence of SEQ ID NO: 11;
  • a primer set comprising a first primer having a nucleotide sequence of SEQ ID NO: 1 and a second primer having a nucleotide sequence of SEQ ID NO: 5, and a probe having a nucleotide sequence of SEQ ID NO: 11;
  • a primer set comprising a first primer having a nucleotide sequence of SEQ ID NO: 1 and a second primer having a nucleotide sequence of SEQ ID NO: 6, and a probe having a nucleotide sequence of SEQ ID NO: 11;
  • a primer set comprising a first primer having a nucleotide sequence of SEQ ID NO: 1 and a second primer having a nucleotide sequence of SEQ ID NO: 7, and a probe having a nucleotide sequence of SEQ ID NO: 11;
  • a primer set comprising a first primer having a nucleotide sequence of SEQ ID NO: 1 and a second primer having a nucleotide sequence of SEQ ID NO: 8, and a probe having a nucleotide sequence of SEQ ID NO: 11;
  • a primer set comprising a first primer having a nucleotide sequence of SEQ ID NO: 1 and a second primer having a nucleotide sequence of SEQ ID NO: 9, and a probe having a nucleotide sequence of SEQ ID NO: 11;
  • a primer set comprising a first primer having a nucleotide sequence of SEQ ID NO: 2 and a second primer having a nucleotide sequence of SEQ ID NO: 3, and a probe having a nucleotide sequence of SEQ ID NO: 10;
  • a primer set comprising a first primer having a nucleotide sequence of SEQ ID NO: 2 and a second primer having a nucleotide sequence of SEQ ID NO: 4, and a probe having a nucleotide sequence of SEQ ID NO: 10;
  • a primer set comprising a first primer having a nucleotide sequence of SEQ ID NO: 2 and a second primer having a nucleotide sequence of SEQ ID NO: 5, and a probe having a nucleotide sequence of SEQ ID NO: 10;
  • a primer set comprising a first primer having a nucleotide sequence of SEQ ID NO: 2 and a second primer having a nucleotide sequence of SEQ ID NO: 6, and a probe having a nucleotide sequence of SEQ ID NO: 10;
  • a primer set comprising a first primer having a nucleotide sequence of SEQ ID NO: 2 and a second primer having a nucleotide sequence of SEQ ID NO: 7, and a probe having a nucleotide sequence of SEQ ID NO: 10;
  • a primer set comprising a first primer having a nucleotide sequence of SEQ ID NO: 2 and a second primer having a nucleotide sequence of SEQ ID NO: 8, and a probe having a nucleotide sequence of SEQ ID NO: 10;
  • a primer set comprising a first primer having a nucleotide sequence of SEQ ID NO: 2 and a second primer having a nucleotide sequence of SEQ ID NO: 9, and a probe having a nucleotide sequence of SEQ ID NO: 10;
  • a primer set comprising a first primer having a nucleotide sequence of SEQ ID NO: 2 and a second primer having a nucleotide sequence of SEQ ID NO: 3, and a probe having a nucleotide sequence of SEQ ID NO: 11;
  • a primer set comprising a first primer having a nucleotide sequence of SEQ ID NO: 2 and a second primer having a nucleotide sequence of SEQ ID NO: 4, and a probe having a nucleotide sequence of SEQ ID NO: 11;
  • a primer set comprising a first primer having a nucleotide sequence of SEQ ID NO: 2 and a second primer having a nucleotide sequence of SEQ ID NO: 5, and a probe having a nucleotide sequence of SEQ ID NO: 11;
  • a primer set comprising a first primer having a nucleotide sequence of SEQ ID NO: 2 and a second primer having a nucleotide sequence of SEQ ID NO: 6, and a probe having a nucleotide sequence of SEQ ID NO: 11;
  • a primer set comprising a first primer having a nucleotide sequence of SEQ ID NO: 2 and a second primer having a nucleotide sequence of SEQ ID NO: 7, and a probe having a nucleotide sequence of SEQ ID NO: 11;
  • a primer set comprising a first primer having a nucleotide sequence of SEQ ID NO: 2 and a second primer having a nucleotide sequence of SEQ ID NO: 8, and a probe having a nucleotide sequence of SEQ ID NO: 11;
  • a primer set comprising a first primer having a nucleotide sequence of SEQ ID NO: 2 and a second primer having a nucleotide sequence of SEQ ID NO: 9, and a probe having a nucleotide sequence of SEQ ID NO: 11;
  • a primer set comprising a first primer having a nucleotide sequence of SEQ ID NO: 13 and a second primer having a nucleotide sequence of SEQ ID NO: 15, and a probe having a nucleotide sequence of SEQ ID NO: 16;
  • a primer set comprising a first primer having a nucleotide sequence of SEQ ID NO: 13 and a second primer having a nucleotide sequence of SEQ ID NO: 15, and a probe having a nucleotide sequence of SEQ ID NO: 17;
  • a primer set comprising a first primer having a nucleotide sequence of SEQ ID NO: 12 and a second primer having a nucleotide sequence of SEQ ID NO: 14, and a probe having a nucleotide sequence of SEQ ID NO: 16;
  • a primer set comprising a first primer having a nucleotide sequence of SEQ ID NO: 12 and a second primer having a nucleotide sequence of SEQ ID NO: 14, and a probe having a nucleotide sequence of SEQ ID NO: 17;
  • a primer set comprising a first primer having a nucleotide sequence of SEQ ID NO: 13 and a second primer having a nucleotide sequence of SEQ ID NO: 14, and a probe having a nucleotide sequence of SEQ ID NO: 16;
  • a primer set comprising a first primer having a nucleotide sequence of SEQ ID NO: 13 and a second primer having a nucleotide sequence of SEQ ID NO: 14, and a probe having a nucleotide sequence of SEQ ID NO: 17;
  • a primer set comprising a first primer having a nucleotide sequence of SEQ ID NO: 12 and a second primer having a nucleotide sequence of SEQ ID NO: 15, and a probe having a nucleotide sequence of SEQ ID NO: 16; or
  • a primer set comprising a first primer having a nucleotide sequence of SEQ ID NO. 12 and a second primer having a nucleotide sequence of SEQ ID NO. 15, and a probe having a nucleotide sequence of SEQ ID NO.
  • the first primer oligonucleotide is an oligonucleotide having the sequence of SEQ ID NO: 18, wherein X 1 is absent or G, X 2 is absent or T, and X 3 is absent or G Includes:
  • the first primer may be one selected from the group consisting of oligonucleotides of SEQ ID NOs 1-2 and 12-13:
  • the second primer may be one selected from the group consisting of oligonucleotides of SEQ ID NOs: 3-9 and 14-15:
  • CAGAGAGGCCAGTATCAGCACTCTCTGCAG SEQ ID NO: 7
  • GGCCTTTCGCGACCCAACACTAC SEQ ID NO: 14
  • the probe is selected from the group consisting of oligonucleotides of SEQ ID NOs: 10-11 and 16-17, wherein the nucleotides “rU”, “rC”, “rA” and “rG” are ribonucleotides It can be one that becomes:
  • the probe may be coupled with a detectable label, as described above, at either or both its 3'- and 5'-ends.
  • kits comprising a first primer and a second primer, as described above.
  • the kit further comprises a probe as described above.
  • kits are suitable and useful for the accurate, sensitive, rapid detection of HCV in a sample.
  • the kit may further comprise a cleaving agent capable of cleaving reverse transcriptase activity, polymerase activity, and the internal site of the probe oligonucleotide.
  • the cleavage agent may be selected from the group consisting of RNase H, Kamchatka crab duplex specific nuclease, endonucleases, and nicking endonucleases.
  • the kit may further comprise uracil-N-glycosylase, as described above.
  • a sample to be tested for the presence of HCV extracting RNA from the sample;
  • a nucleic acid comprising said RNA and a detectable marker having uracil-n-glycosylase, DNA polymerase, reverse transcriptase, appropriate deoxyribonucleotide triphosphate, DNA and RNA nucleic acid sequences substantially complementary to HCV target cDNA Generating an amplification medium by mixing the binding probe, the reaction buffer, and the upstream and downstream primers; Incubating the amplification medium at a temperature sufficient for activating the uracil-N-glycosylase and removing carryover that contaminates the template nucleic acid and for a time; Incubating the amplification medium at a temperature and for a time sufficient to inactivate the uracil-N-glycosylase and contact the RNA with a reverse transcriptase and downstream primers to synthesize cDNA; Incubating the amplification medium at a temperature and for a time sufficient
  • the real-time increase in signal release from the label located on the probe is due to RNase H cleavage of the heteroduplex formed between one of the strands of the probe and PCR fragment.
  • the method can be used to determine the amount of HCV in the sample.
  • kits for detecting HCV are provided, which is suitable for carrying out the method described above.
  • Target DNA or “target RNA” or “target nucleic acid” or “target nucleic acid sequence” means a nucleic acid that is targeted by DNA amplification.
  • the target nucleic acid sequence serves as a template for amplification in a PCR reaction or reverse transcription-PCR reaction.
  • Target nucleic acid sequences include natural and synthetic molecules.
  • the target nucleic acid can be, for example, but not limited to genomic DNA or genomic RNA.
  • nucleotide is a deoxyribonucleotide or ribonucleotide that exists in single- or double-stranded form, and is interpreted to include analogs of nucleotides unless otherwise specified.
  • probe refers to a linear oligomer with natural or modified monomers or bonds, including deoxyribonucleotides and / or ribonucleotides that can hybridize to a specific polynucleotide sequence.
  • the probe according to one embodiment may be a sequence that is perfectly complementary to the polynucleotide sequence that is a template, but may be a sequence that is substantially complementary to the extent that it does not prevent specific hybridization. Conditions suitable for hybridization are as described above.
  • the term "substantially complementary” means that two nucleic acid strands that are sufficiently complementary in a sequence anneal and form a stable duplex.
  • the complementarity need not be complete; For example, there may be several mismatches of base pairs between two nucleic acids. However, if the number of mismatches is so large that hybridization does not occur even under minimal stringent hybridization conditions, the sequence is not a substantially complementary sequence.
  • substantially complementary it is meant that the sequences are sufficiently complementary to allow each other to hybridize under selected reaction conditions, such as stringent hybridization conditions.
  • stringent hybridization conditions The relationship between sufficient complementarity of nucleic acids and stringency of hybridization to achieve specificity is well known in the art.
  • Two substantially complementary strands may include, for example, one to many mismatches, so long as they are completely complementary or, for example, sufficiently to allow for differences between paired and unpaired sequences.
  • a "substantially complementary" sequence can mean a sequence having up to 99, 95, 90, 80, 75, 70, 60, 50%, or any percent base pair complementarity between the numbers in the double stranded region. .
  • substantially complementary sequence means a sequence that can hybridize with a polynucleotide that is a template under stringent conditions known in the art.
  • stringent conditions refers to Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001) and Haymes, BD, et al., Nucleic acid hybridization, A Practical Approach , IRL Press, Washington, DC (1985), stringent conditions can be determined by controlling temperature, ionic strength (buffer concentration) and the presence of compounds such as organic solvents, and the like, depending on the sequence being hybridized. For example, stringent conditions may be a) washed with a temperature of 50 ° C.
  • primer refers to a single strand of single strand that can act as a starting point for template-directed DNA synthesis under suitable conditions (ie, four different nucleoside triphosphates and polymerases) in suitable buffers at suitable temperatures. Means oligonucleotides.
  • Suitable lengths of primers are typically 15-35 nucleotides, depending on various factors, such as temperature and the use of the primer. Short primers may generally require lower temperatures to form a hybridization complex that is sufficiently stable with the template.
  • the terms "forward primer” and “reverse primer” refer to primers that bind to the 3 'end and the 5' end, respectively, of a predetermined portion of the template to be amplified by the polymerase chain reaction.
  • the sequence of the primer does not need to have a sequence that is completely complementary to some sequences of the template, and it is sufficient to have sufficient complementarity within a range capable of hybridizing with the template to perform the primer-specific function. Therefore, the primer set according to one embodiment does not need to have a sequence that is perfectly complementary to the nucleotide sequence that is a template, and it is interpreted that it is sufficient to have sufficient complementarity within a range capable of hybridizing to the sequence and acting as a primer.
  • Primers according to one embodiment are hybridized or annealed to one site of the template to form a double chain structure.
  • Conditions for nucleic acid hybridization suitable for forming such double chain structures are described in Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001) and Haymes, BD, et al. Hybridization, A Practical Approach , IRL Press, Washington, DC (1985).
  • Hepatitis C Virus belongs to the hepacivirus of the flaviviridae family, and is an enveloped, single-stranded RNA virus. HCV is known as a pathogen that infects liver cells to cause inflammation and cause liver damage.
  • the hepatitis C virus is divided into six genotypes and may be, for example, HCV genotype 1, HCV genotype 2, HCV genotype 3, HCV genotype 4, HCV genotype 5, and HCV genotype 6 types.
  • HCV can be divided into more diverse subspecies such as, for example, HCV 1a, HCV 1b and HCV 1c.
  • HCV specific primers that can be commonly recognized for various HCV types to detect HCV was prepared by adjusting the size of the amplification product to 50 to 300 bp.
  • the probe may be labeled by different detectable means from each other.
  • the detectable means means compounds, biomolecules or biomolecular analogs, etc., which can be linked, coupled, or attached to a probe to determine density, concentration, amount, etc. in a conventional manner.
  • a fluorescent labeling factor, a luminescent material, a bioluminescent material, an isotope, etc. which are commonly used, but are not limited thereto.
  • the 5 'end of the probe is one fluorescent labeling factor selected from the group consisting of FAM, VIC, TET, JOE, HEX, CY3, CY5, ROX, RED610, TEXAS RED, RED670, TYE563 and NED Is labeled with 6-TAMRA, BHQ-1,2,3, Iowa Black RQ-Sp and MGBNFQ (molecular grove binding non-fluorescence quencher), one fluorescence inhibitor selected from the group (Quencher) It may be labeled with.
  • the fluorescent labeling factors are currently commercially available in large numbers and are readily available commercially.
  • the fluorescent labeling factor has different excitation and emission wavelengths depending on the type, and the method of use is also different.
  • Fluorescent labeling factors can be labeled on the probes according to conventional methods known in the art.
  • Cataclyphic probe according to an embodiment is a PCR by modifying the 5 'end with a fluorescent labeling factor (for example, Texas Red 615, etc.) the 3' end with a fluorescent inhibitor (for example, Iowa Black RQ-Sp, etc.) It can be added to the reaction solution.
  • a fluorescent labeling factor for example, Texas Red 615, etc.
  • a fluorescent inhibitor for example, Iowa Black RQ-Sp, etc.
  • the probe may be a Kata cleaves probes (probe Catacleave TM).
  • Cataclyb probe technology differs from TaqMan TM in that the probe is cleaved by a second enzyme that does not have DNA polymerase activity, RNase H.
  • Catalytic probes have a base sequence, ie, a cleavage site, within the probe molecule that is the target of an endonuclease such as, for example, a restriction enzyme or an RNase.
  • the cataclyb probe has a chimeric structure consisting of DNA at the 5 'and 3' ends of the probe and a cleavage site made of RNA.
  • the DNA sequence portion of the probe may be labeled terminally or internally with a FRET pair.
  • the PCR reactant may comprise an RNase H enzyme that specifically cuts the RNA sequence portion of the RNA-DNA duplex.
  • two half probes ie, donor and acceptor
  • FRET Fluorescence Resonance Energy Transfer
  • the cleavage and separation will regenerate the position on the amplicon for the binding of additional catacleb probes. In this way, multiple probe cleavages are possible until one amplicon acts as a target or the primer extends through the binding site of the catacleb probe.
  • the cataclibe probe Anal. Biochem. 333: 246-255, 2004 and US Pat. No. 6,787,304, which is incorporated herein by reference.
  • oligonucleotide may in some cases be mixed with “primer” or “polynucleotide”.
  • Oligonucleotides can be synthesized and prepared by appropriate methods (such as chemical synthesis), according to methods known in the art. Oligonucleotides can also be purchased commercially.
  • annealing and “hybridization” can be used interchangeably, where one nucleic acid and another nucleic acid cause the formation of duplexes, triplexes, or other high-dimensional structures by base pairing interactions.
  • the primary interaction is base specific by Watson / Crick and Hoogsteen-type hydrogen bonding, such as, for example, A / T and G / C.
  • base-stacking and hydrophobic interactions can also contribute to duplex stability.
  • Synthesized oligos can generally be 12 to 36 bp in length, depending on the melting temperature (Tm) value near 55 ° C.
  • label may refer to any chemical moiety bound to a nucleotide, nucleotide polymer, or nucleic acid binding factor, which binding may be covalent or non-covalent. Can be.
  • the label is detectable and may be the nucleotide or nucleotide polymer detectable to the experimenter of the present invention.
  • Detectable labels include luminescent molecules, chemiluminescent molecules, fluorescent dyes, fluorescent quenching agents, color molecules, radioactive isotopes or scintillants.
  • Detectable labels also include any useful linker molecule (e.g., biotin, avidin, strapavidin, HRP, protein A, protein G, antibody or fragment thereof, Grb2, polyhistidine, Ni 2+ , FLAG tag, myc Tags), heavy metals, enzymes (e.g. alkaline phosphatase, peroxidase and luciferase), electron donors / acceptors, acridinium esters, dyes and calorimetric substrates It includes.
  • detectable labels may be considered in indicating a change in mass, such as in the case of surface plasmon resonance detection. Those skilled in the art will readily be able to recognize useful detectable labels not mentioned above, and these may also be used in the practice of the present invention.
  • Another aspect includes separating total nucleic acid from a subject sample; Mixing the isolated total nucleic acid and the kit to perform real-time PCR; And it provides a method for detecting HCV comprising the step of confirming the presence of HCV from the real-time PCR results.
  • the method may include separating total nucleic acid from a subject sample.
  • the detection method according to one embodiment may be applied to a sample expected to be infected with HCV.
  • the sample includes, but is not limited to, bodily fluids such as cultured cells, animal or human liver cells, blood, plasma, serum, semen, saliva or mucus. Isolation of the nucleic acid can be made through various methods known in the art. Specific methods for this are disclosed in Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001), which is incorporated herein by reference.
  • mixing the separated total nucleic acid and the kit may include performing a real-time PCR.
  • the method may further include performing a reverse transcription reaction on the separated total RNA before performing the real-time PCR. Since the method targets HCV, an RNA virus, the isolated RNA must be transformed into DNA (cDNA), a template that can be used for real-time PCR reactions. Reverse transcription reactions can be carried out using a variety of reverse transcriptase enzymes well known in the art.
  • the HCV virus detection kit can be carried out using conventional real-time PCR methods and apparatus.
  • the real-time PCR method is a method of detecting and quantitating fluorescence appearing in real time every cycle of PCR by the principle of DNA polymerase and FRET using a device in which a thermal cycler and a spectral fluorescent photometer are integrated. This method distinguishes specific amplification products from non-specific amplification products and makes it easy to obtain analysis results in an automated fashion.
  • Devices that can be used in the real-time PCR method include, but are not limited to, AB real-time PCR devices 7900, 7500, 7300, Stratagene Mx3000p, BioRad Chromo 4 and Roche Lightcycler 480 devices.
  • the laser of the real-time PCR device may implement a peak as shown in FIG. 1 by detecting a fluorescent labeling factor labeled on a probe of the amplified PCR product.
  • the real-time PCR reaction may be carried out under conventional conditions known in the art, for example, after initial denaturation at 95 ° C. for 10 minutes, Denaturation (10 seconds at 95 ° C.), annealing and reaction of RNase HII (10 seconds at 55 ° C.) and elongation (elongation, 30 seconds at 72 ° C.) may be carried out under 50 conditions.
  • the HCV detectable by the above method is as described above.
  • HCV HCV
  • the presence or absence of the HCV can be confirmed by calculating the C t value, which is the number of cycles when the PCR amplification product is amplified by a certain amount from the curve displayed by detecting a fluorescent labeling factor labeled on the probe of the PCR product amplified in the real-time PCR process.
  • the C t value may be determined to be present in the HCV genus when 15 to 50, or 20 to 45. Meanwhile, the calculation of the C t value may be automatically performed by a program included in the real time PCR device.
  • the kit for detecting HCV and the method for detecting HCV using the kit it is possible to quickly check the detection result in real time even with a small number of target samples.
  • the disclosed embodiments have many advantages, including the ability to detect HCV nucleic acid sequences in a sample in real time.
  • the detection method is fast, accurate and suitable for high efficiency.
  • nucleic acid amplification is performed by polymerase chain reaction (PCR) or Ligase Chain Reaction, Self-Sustained Sequence Replication, Strand Displacement Amplification, Transcriptional Amplification System, Q-Beta Replicase, Nucleic Acid Sequence It can be performed by a variety of methods including amplification reactions such as based amplification (NASBA), cleavage fragment length polymorphism, isothermal and chimeric primer-initiated amplification of nucleic acid, ramification-extension amplification method or other suitable nucleic acid amplification method.
  • PCR polymerase chain reaction
  • Ligase Chain Reaction Ligase Chain Reaction
  • Self-Sustained Sequence Replication Strand Displacement Amplification
  • Transcriptional Amplification System Transcriptional Amplification System
  • Q-Beta Replicase Nucleic Acid Sequence It can be performed by a variety of methods including amplification reactions such as based amplification (NASBA), cleavage fragment length polymorphism, is
  • PCR Polymerase chain reaction
  • PCR generally means a method for amplifying in vitro a desired nucleotide sequence. The process is described in detail in US Pat. Nos. 4,683,202, 4,683,195, 4,800,159, and 4,965,188, the contents of which are incorporated herein in their entirety.
  • the PCR process consists of placing an oligonucleotide primer complementary to the opposite strand of the double stranded target sequence in excess of two molar concentrations into a reaction mixture comprising the desired target sequence (s).
  • the reaction mixture is subjected to a thermal cycling program in the presence of DNA polymerase, to amplify the desired target sequence between the DNA primer sets.
  • the DNA polymerase may be, for example, a heat stable DNA polymerase obtained from Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis , Thermis flavus , Thermococcus literalis or Pyrococcus furiosus (Pfu).
  • RNase H includes, but is not limited to, thermally stable RNase H enzymes such as, for example, Pyrococcus furiosus RNase H II, Pyrococcus horikoshi RNase H II, Thermococcus litoralis RNase HI or Thermus thermophilus RNase HI.
  • Buffer solutions are compounds that are added to amplification reactions that modify the stability, activity, and / or lifetime of one or more components of the amplification reaction by adjusting the pH of the amplification reaction, and such buffer solutions are well known in the art, For example, it may be, but is not limited to, Tris, Tricine, MOPS, or HEPES.
  • the kit may comprise a dNTP mixture (dATP, dCTP, dGTP, dTTP) and a DNA polymerase cofactor.
  • the primer set and probe may be packaged in one reaction vessel, strip or microplate, and may be packaged by methods known in the art.
  • RNA sequence a template for mRNA sequence (s) for amplification by PCR.
  • s mRNA sequence
  • the method takes advantage of the high sensitivity and specificity of the PCR process and is widely used for the detection and quantification of RNA.
  • the reverse transcriptase-PCR process performed as an end-point or real time assay, involves two steps of separate molecular synthesis: (i) synthesis of cDNA from an RNA template; And (ii) replication of the newly synthesized cDNA via PCR amplification.
  • a number of protocols have been developed, taking into account the three basic steps of the process: (a) denaturation of RNA and hybridization of reverse primers; (b) synthesis of cDNA; And (c) PCR amplification.
  • reverse transcriptase-PCR reverse transcriptase-PCR
  • reverse transcriptase-PCR reverse transcriptase-PCR
  • dNTP deoxyribonucleoside triphosphate
  • the annealing of the reverse primer is a separate step before the addition of the enzyme and then added to a single reaction vessel.
  • reverse transcriptase activity is a component of thermostable Tth DNA polymerase. Annealing and cDNA synthesis are performed in the presence of Mn 2+ , and then PCR is performed in the presence of Mg 2+ after Mn 2+ is removed by chelating reagent.
  • the “continuous” method eg, one step reverse transcriptase-PCR
  • Continuous reverse transcriptase-PCR is a single enzyme system using DNA polymerase and reverse transcriptase activity (eg Tth or ZO5) and enzymes with reverse transcriptase activity (eg AMV, MMLV, etc.) and DNA polymerase. It is described as a two enzyme system that combines two enzymes of an active enzyme (eg, Taq DNA polymerase). The RNA denaturation step is omitted.
  • RNA: DNA hybrids can be the substrate of RNase H, the presence of RNase H in the reaction buffer will result in unwanted degradation of the RNA: DNA hybrid formed in the first step of the process. There are two main ways to overcome this problem.
  • RNase H is physically separate from the rest of the reverse transcription reaction by using a wax-like membrane that can melt during the high temperatures of the beginning of the DNA denaturation step.
  • the second method is to modify RNase H to inactivate at reverse transcription temperature which is generally 45-55 ° C.
  • Several methods are known in the art, including reacting RNase H with an antibody or including reversible chemical modifications. For example, hot start RNase H is disclosed.
  • RNAse H enzymes and hot start RNAse H enzymes that can be used in the present invention are disclosed in US Patent Application 2009/0325169 to Walder et al.
  • One step reverse transcriptase-PCR offers several advantages over unlinked reverse transcriptase-PCR.
  • One step reverse transcriptase-PCR is the handling of reaction mixture reagents and nucleic acid products compared to unlinked reverse transcriptase-PCR (e.g., opening a reaction tube for the addition of components or enzymes between two reactions). Are less demanding, thus less labor intensity and less time required.
  • One step reverse transcriptase-PCR also requires less sample and can reduce the risk of contamination.
  • the sensitivity and specificity of one-step reverse transcriptase-PCR has proven to be suitable for studying the expression level of one or several genes in the detection of a given sample or pathogenic RNA. In general, this process limits the use of gene-specific primers to initiate cDNA synthesis.
  • Real time methods were developed to monitor amplification during the PCR process. These methods generally use a fluorescently labeled probe that binds to newly synthesized DNA or a die that increases in fluorescence emission when intercalated to two strands of DNA.
  • the probe is generally designed such that in the absence of a target, donor emission can be extinguished by fluorescence resonance energy transfer (FRET) between two chromophores.
  • FRET fluorescence resonance energy transfer
  • a donor chromophore delivers energy to an acceptor chromophore in an excited state when the pair of chromophores is located at close range. This transfer always occurs non-radially, through dipole-dipole coupling. Any process that sufficiently increases the distance between chromophores reduces the FRET efficiency, allowing radioactive detection of donor chromophore release.
  • Common receptor chromophores include FAM, TAMRA, VIC, JOE, Cy3, Cy5, Texas Red and the like.
  • Receptor chromophores are chosen such that the emission spectra of the donor and the excitation spectra can overlap.
  • this binding pair is FAM-TAMRA.
  • FAM-TAMRA There may also be nonfluorescent receptors that quench a wide range of donors.
  • Other examples of suitable donor-receptor FRET pairs are well known to those skilled in the art.
  • Molecular beacons are single-stranded oligonucleotides, in which the probe is designed to form a secondary structure that is close to the donor and acceptor chromophores, thereby reducing donor release. At the appropriate reaction temperature, the beacons are unstructured and in particular bind to amplicons.
  • Taq-Man and CataCleave techniques differ from molecular beacons in that the FRET probes used are cleaved, leaving the donor and acceptor chromophores sufficiently low to alter the FRET.
  • the Taq-Man technique utilizes single stranded oligonucleotide probes labeled with a donor chromophore at the 5 'end and labeled with a receptor chromophore at the 3' end.
  • the DNA polymerase used for amplification must have 5 '-> 3' exonuclease activity.
  • Taq-Man probes bind to one strand of the amplicon as the primers bind. While the DNA polymerase stretches the primers, the polymerase will eventually encounter the bound Taq-Man probe. At this time, the exonuclease activity of the polymerase will sequentially degrade the Taq-Man probe starting at the 5 'end.
  • the mononucleotide containing the probe comes out of the reaction buffer.
  • the FRET changes. Release from the donor is monitored to confirm probe cleavage. Because of the action of Taq-Man, a particular amplicon can only be detected once per cycle of PCR. Extension of the primer through the Taq-Man target site produces a double stranded product and prevents further binding of the Taq-Man probe until the amplicon is denatured in the next PCR cycle.
  • CataCleave Another real-time detection method (named CataCleave).
  • the CataCleave technique differs from Taq-Man in that the cleavage of the probe is performed by a secondary enzyme without polymerase activity.
  • CataCleave probes have a sequence in the target molecule of an endonuclease such as, for example, a restriction enzyme or an RNase.
  • the CataCleave probe has a chimeric structure, wherein the 5 'and 3' ends of the probe are made of DNA and the cleavage site is made of RNA.
  • the DNA sequence portion of the probe is labeled with a FRET pair at or inside the sock end.
  • the PCR reaction includes an RNase H enzyme that can specifically cleave the RNA sequence portion of the RNA-DNA double strand. After cleavage, both halves of the probe dissociate in the target amplicon at the reaction temperature and disperse into the reaction solution. As donor and receptor are separated, FRET is changed in the same way as Taq-Man probe, and donor release can be monitored. Cleavage and dissociation will reproduce sites for further CataCleave binding. In this way, a single amplicon can be repeated multiple times as a target or probe cleavage until the primer is stretched through the CataCleave probe binding site.
  • probe includes polynucleotides comprising specific moieties designed to hybridize in a sequence-specific manner having complementary regions of specific nucleic acid sequences, such as, for example, target nucleic acid sequences.
  • the oligonucleotide probe ranges from 15 to 60 nucleotides. More preferably, the oligonucleotide probe ranges from 18 to 45 nucleotides.
  • the exact sequence and length of the oligonucleotide probes of the present invention will depend in part on the nature of the target polynucleotide to which the probe binds. Bonding locations and lengths may vary to achieve the desired annealing and denaturation properties in certain embodiments.
  • label or “detectable lebel” shall mean any label of a CataCleave probe comprising a fluorescent dye compound bound to the probe by covalent or non-covalent bonds. Can be.
  • fluorescent donor or or fluorescence donor means a fluorescent dye that emits light as measured in the assays disclosed herein. More specifically, the fluorescent donor provides light absorbed by the fluorescent acceptor.
  • fluorescent acceptor or fluorescence acceptor refers to a second fluorescent dye or quenching molecule that absorbs energy emitted from a fluorescent donor. The second fluorescent dye absorbs energy emitted from the fluorescent donor and emits light of a longer wavelength than the light emitted by the fluorescent donor. The quenching molecule absorbs the energy released by the fluorescent donor.
  • the light emitting molecule may be, for example, Alexa Fluor 350, Alexa Fluor 430, Alexa Fluor 488, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 633, Alexa Fluor 647, Alexa Fluor 660, Alexa Fluor 680, 7-diethylaminocowmarin-3-carboxylic acid, fluorescein, Oregon Green 488, Oregon Green 514, tetramethyltamine, rhodamine X, Texas red dye, QSY 7, QSY33, Dabcyl, BODIPY FL , BODIPY 630/650, BODIPY 6501665, BODIPY TMR-X, BODIPY TR-X, Dialkylaminocoumarin, Cy5.5, Cy5, Cy3.5, Cy3, DTPA (Eu)
  • the 3 'terminal nucleotide of the oligonucleotide probe is blocked or prevented from expanding by nucleic acid polymerase. Such blocking can be conveniently performed by attaching a reporter or quencher molecule to the terminal 3 'region of the probe.
  • the reporter molecule is a fluorescent organic dye derived for attachment at the end of the 3 'end or 5' end of the probe via a linking moiety.
  • the quencher molecule is an organic dye, which may or may not be fluorescent according to embodiments of the invention.
  • the quencher molecule is non-fluorescent. In general, if the quencher molecule is fluorescence or simply emits energy delivered from the reporter by non-radioactive degradation, the absorption band of the quencher will substantially overlap with the absorption band of the fluorescence emission of the reporter molecule. In this specification, non-fluorescent quencher molecules that are absorbed from the excited reporter molecules but do not release radioactive energy are to be interpreted as chromogenic molecules.
  • the reporter-quencher pair may be selected from xanthene dyes, including, for example, fluorescein and rhodamine dyes. Various suitable forms of these compounds are widely available commercially, having substituents on phenyl moieties that can be used as binding sites for binding oligonucleotides or as binding functionality.
  • Another group of fluorescent compounds are naphthylamines having amino groups in the alpha or beta position.
  • the naphthylamino compounds include compounds such as 1-dimethylaminonaphthyl-5-sulfonate, 1-anilino-8-naphthalene sulfonate and 2-p-touridinyl-6-naphthalene sulfonate.
  • dyes include acridine such as 3-phenyl-7-isocyanatocomarin, 9-isothiocyanatoacridine and acridine orange; N- (p- (2-benzooxazolyl) phenyl) maleimide; Benzoxadiazole, stilbene, pyrene and the like.
  • the reporter and quencher molecule are selected from fluorescein and non-fluorescent quencher dyes.
  • Rhodamine and non-fluorescent quencher dyes may also be conveniently attached to the 3 'end of the oligonucleotide at the beginning of solid phase synthesis, see, for example, Woo et al., US Pat. No. 5,231,191; And Hobbs, Jr., US Pat. No. 4,997,928.
  • the oligonucleotide probe can be attached to a solid support. Different probes can be attached to a solid support and used to detect different target sequences in a sample simultaneously. Reporter molecules with different fluorescence wavelengths can be used for different probes, thus allowing hybridization to different probes to be detected separately.
  • solid support for immobilization of oligonucleotide probes examples include polystyrene, avidin coated polystyrene bead cellulose, nylon, acrylamide gel and activated dextran, controlled pore glass (CPG), glass plates and Highly cross-linked polystyrene.
  • CPG controlled pore glass
  • Such solid supports are preferred in hybridization and diagnostic studies because of their chemical stability, ease of functionalization and well-defined surface area.
  • Solid supports, such as controlled pore glass (500 mm 3, 1000 mm 3) and non-expanded high cross-linked polystyrene (1000 mm 3) are particularly preferred because of their compatibility with oligonucleotide synthesis.
  • Oligonucleotide probes can be attached to the solid support in a variety of ways.
  • the probe can be attached to the solid support by attaching a 3 'or 5' terminal nucleotide of the probe to the solid support.
  • the probe may be attached to the solid support by a linker that distances the probe from the solid support.
  • the linker is most preferably at least 30 atoms long, more preferably at least 50 atoms long.
  • Hybridization of probes immobilized on a solid support generally requires the probe to be separated from the solid support by at least 30 atoms, more preferably at least 50 atoms.
  • the linker generally comprises a spacer located between the linker and the 3 ′ nucleoside.
  • the linker arm is usually attached to the 3'-OH of the 3 'nucleoside by an ester bond that is cleaved with a basic reagent to free the oligonucleotide from the solid support.
  • linkers are known in the art that can be used to attach oligonucleotide probes to a solid support.
  • the linker may be formed of any compound that does not significantly interfere with the hybridization of the target sequence to the probe attached to the solid support.
  • the linker may be formed of homopolymer oligonucleotides that can be easily added to the linker by automated synthesis.
  • polymers such as functionalized polyethylene glycols can be used as the linker. Such polymers are preferred over homopolymer oligonucleotides because they do not significantly interfere with the hybridization of the probe to the target oligonucleotide.
  • Polyethylene glycol is particularly preferred because it is commercially available, soluble in both organic and aqueous media, convenient to functionalize, and completely stable under oligonucleotide synthesis and post-synthesis conditions.
  • the bond between the solid support, the linker and the probe is preferably not cleaved during the removal of the base protecting group under base conditions at high temperature.
  • Examples of preferred bonds include carbamate and amide bonds.
  • Immobilization of probes is well known in the art and one skilled in the art can determine immobilization conditions.
  • the hybridization probe is immobilized on a solid support. Oligonucleotide probes are contacted with a sample of nucleic acid under conditions favorable for hybridization. In the nonhybridized state, the fluorescent label is suppressed by the quencher. Upon hybridization with the target, the fluorescent label separates from the quencher and fluoresces.
  • Immobilization of hybridization probes to a solid support also allows for easy separation of the target sequence hybridized to the probe from the sample.
  • the isolated target sequence can be separated from the solid support and processed (eg, purified, amplified) by methods well known in the art, depending on the particular needs of the investigator.
  • the labeled oligonucleotide probe is a Salmonella in the sample. It can be used as a probe for real time detection of target nucleic acid sequences.
  • CataCleave oligonucleotide probes are first synthesized with DNA and RNA sequences that are complementary to sequences found in PCR amplicons containing selected Salmonella target sequences.
  • the probe is labeled with a FRET pair, eg, one end of the probe is a fluorescein molecule and the other end is a non-fluorescent quencher molecule.
  • FRET pair eg, one end of the probe is a fluorescein molecule and the other end is a non-fluorescent quencher molecule.
  • RNase H hydrolyzes RNA in RNA-DNA hybrids.
  • the enzyme was first identified in bovine mammary glands but has since been found in a variety of organisms.
  • RNase H activity is ubiquitous in eukaryotes and bacteria.
  • RNase H consists of a protein family of various molecular weights and nuclear lytic activity, substrate requirements appear similar between the various isotypes. For example, most of the RNase Hs studied so far function as endonucleases and produce divalent cations (eg, Mg 2+ , to produce cleavage products having 5 'phosphate and 3' hydroxyl ends). Mn 2+ ).
  • RNase HI from E. coli is the best known of the RNase H family.
  • RNase HI a second E. coli RNase H, RNase HII was cloned and characterized (Itaya, M., Proc. Natl. Acad. Sci. USA, 1990, 87, 8587-8591).
  • RNase HI consists of 155 amino acids, compared to 213 amino acids.
  • E. coli RNase HII shows only 17% homology with E. coli RNase HI.
  • RNase H cloned from S. typhimurium differs from E. coli RNase HI in only 11 positions and consists of 155 amino acids (Itaya, M. and Kondo K., nucleic acids Res., 1991, 19, 4443 -4449).
  • Proteins exhibiting RNase H activity were cloned and purified from several viruses, other bacteria and yeasts (Wintersberger, U. Pharmac. Ther., 1990, 48, 259-280). In many cases, proteins with RNase H activity appear as fusion proteins in which RNase H is fused to the amino or carboxy terminus of another enzyme, usually a DNA or RNA polymerase.
  • the RNase H domain has been consistently found to be highly homologous to E. coli RNase HI, but the other domains are substantially diverse, resulting in very high molecular weight and other properties of the fusion protein.
  • RNase H Two classes of RNase H in higher eukaryotes have been defined based on differences in molecular weight, the effects of divalent cations, sensitivity to sulfhydryl reagents and immunological cross-reactivity (Busen et al., Eur J. Biochem., 1977, 74, 203-208).
  • RNase HI enzymes have a molecular weight in the range of 68-90 kDa, have been reported to be activated by Mn 2+ or Mg 2+ and are insensitive to sulfhydryl reagents.
  • RNase H II enzymes have a molecular weight in the range of 31-45 kDa, require Mg 2+ , show high sensitivity to sulfhydryl reagents, and have been reported to be inhibited by Mn 2+ (Busen, W. , and Hausen, P., Eur. J. Biochem., 1975, 52, 179-190; Kane, CM, Biochemistry, 1988, 27, 3187-3196; Busen, W., J. Biol. Chem., 1982, 257, 7106-7108.).
  • Enzymes with RNase HII properties were purified almost homogeneously from the human placenta (Frank et al., Nucleic acids Res., 1994, 22, 5247-5254). This protein has a molecular weight of about 33 kDa, is activated in a pH range of 6.5-10 and is reported to have an optimal pH of 8.5-9.
  • the enzyme requires Mg 2+ and has been reported to be inhibited by Mn 2+ and n-ethyl maleimide.
  • the product of the cleavage reaction has 3 'hydroxyl and 5' phosphate ends.
  • real time nucleic acid amplification is performed on the target polynucleotide in the presence of a thermostable nucleic acid polymerase, RNase H activity, a pair of PCR amplification primers that can hybridize to a Salmonella target polynucleotide, and a labeled CataCleave oligonucleotide probe.
  • a thermostable nucleic acid polymerase RNase H activity
  • a pair of PCR amplification primers that can hybridize to a Salmonella target polynucleotide
  • a labeled CataCleave oligonucleotide probe e.g., cleavage of the probe by RNase H separates the fluorescent donor from the fluorescent quencher such that the fluorescence of the probe increases in real time as the real-time detection of Salmonella target DNA sequences in the sample.
  • real time nucleic acid amplification enables real time detection of a single target DNA molecule in up to about 45 PCR amplification cycles.
  • the method includes the step of separating total nucleic acid from a subject sample.
  • the detection method may be applied to a sample expected to be infected with HCV.
  • the sample includes, but is not limited to, bodily fluids such as cultured cells, animal or human liver cells, blood, plasma, serum, semen, saliva or mucus. Isolation of the nucleic acid can be made through various methods known in the art. Specific methods for this are disclosed in Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001), which is incorporated herein by reference.
  • the method includes performing real time PCR by mixing the isolated total nucleic acid and related reaction components.
  • the method may further include performing a reverse transcription reaction on the separated total RNA before performing the real-time PCR. Since the method targets HCV, an RNA virus, the isolated RNA must be transformed into DNA (cDNA), a template that can be used for real-time PCR reactions. Reverse transcription reactions can be carried out using a variety of reverse transcriptase enzymes well known in the art isolated from Avian Myeloblastosis Virus (AMV) or Moloney Murine Leukemia Virus (MMLV).
  • AMV Avian Myeloblastosis Virus
  • MMLV Moloney Murine Leukemia Virus
  • a device for performing temperature cycling and real-time detection of the resultant amplified product is commercially available.
  • Devices that can be used in the real-time PCR method include, but are not limited to, Applied Biosystems Incorporated's real-time PCR devices 7900, 7500, 7300, Stratagene's Mx3000p, BioRad's Chromo 4 and Roche Lightcycler 480 devices.
  • Applied Biosystems Incorporated's real-time PCR devices 7900, 7500, 7300, Stratagene's Mx3000p, BioRad's Chromo 4 and Roche Lightcycler 480 devices During the real-time PCR, these instruments monitor the change in emission intensity from the detectable label and convert the information into graphical and / or numerical information that can be analyzed to determine whether the target template is present in the test sample.
  • the real-time PCR reaction may be carried out under conventional conditions known in the art, for example, after initial denaturation at 95 ° C. for 10 minutes, Denaturation (10 seconds at 95 ° C.), annealing and reaction of RNase HII (10 seconds at 55 ° C.) and elongation (elongation (30 seconds at 72 ° C.)) can be carried out under 60 conditions.
  • the HCV detectable by the above method is as described above.
  • HCV HCV
  • the presence or absence of the HCV can be confirmed by calculating the C t value, which is the number of cycles when the PCR amplification product is amplified by a certain amount from the curve displayed by detecting a fluorescent labeling factor labeled on the probe of the PCR product amplified in the real-time PCR process.
  • the C t value may be determined to be present in the HCV genus when 15 to 50, or 20 to 45. Meanwhile, the calculation of the C t value may be automatically performed by a program included in the real time PCR device.
  • the enzyme "Hot Start" RNase HII used in the Examples below is a reversibly modified RNase HII.
  • the modified enzyme is used in the reaction with Tris based buffer and the temperature is raised to 95 ° C., the pH of the solution drops and RNase H activity is restored.
  • This method allows for the inclusion of RNase H in the reaction mixture prior to the start of reverse transcription.
  • RNase HII and details thereof are disclosed in US Provisional Application No. 61 / 347,984, filed May 25, 2010, which is incorporated herein by reference in its entirety.
  • the detection result can be quickly confirmed in real time even with only a small number of target samples.
  • FIG. 1 is a result showing an amplification curve by a real-time PCR reaction for HCV-1 RNA (AcroMetrix) using a kit according to one embodiment.
  • Example 2 is a result of detecting HCV RNA (AcroMetrix) according to Example 4.
  • nucleotide sequences within the 5'-UTR and 3'-UTR X-tail regions of the reference HCV species, HCV-1 H77 were obtained and a set of primers available for real-time PCR was selected. It was.
  • the selected nucleotide primers were first prepared in silico to determine whether the nucleotide sequence of the selected primers could only amplify a portion of the 5'-UTR or 3'-UTR X-tail region in the genome of HCV-1 H77. silico) was tested using a basic local alignment search tool (BLAST) (genomic sequence of HCV-1 isolated species H77 can be found in Genbank accession number AF009606). Reference 3'-UTR X-tail sequences can be found in NCBI Accession # AB001040.
  • BLAST basic local alignment search tool
  • the probe was prepared by catacleave probe (Catacleave TM probe) that can specifically bind to the template target of the PCR to detect the amount of the PCR product generated during the real-time PCR.
  • the amount of amplified PCR product was detected using fluorescence emitted from the probe during PCR.
  • This probe-detection method is more specific and sensitive than the gel electrophoresis method of identifying conventional PCR products.
  • the probe was selected based on the 5'-UTR and 3'-UTR regions of HCV, the template amplified by the primer set, by the same method as the preparation of the primer.
  • the 5 'end was labeled with TYE TM 563 and the 3' end was labeled with Black Hole Quencher (Integrated DNA Technologies, Coralville, IA).
  • the determined primers were synthesized by Sigma-Genosys, and the probe was synthesized by IDT.
  • Table 1 shows the base sequences of the primers and probes used in this experiment.
  • RNA base ie rG is riboguanosine
  • TYE563 represents TYE TM 563
  • BFQ Black Hole Quencher for short wavelength divergence.
  • RNA of HCV for use as a template in a real-time PCR reaction was extracted according to the manufacturer's protocol using a magnetic-bead based viral nucleic acid separation kit (Chemagen, AG). In this experiment, all real-time PCR was performed using a mixture containing 17 ⁇ l of CataCleave TM master mix and 33 ⁇ l of the isolated RNA. The components of the CataCleave TM master mix are listed in Table 2 below.
  • RNA was used as a template and reverse transcription was performed at 50 ° C. for 15 minutes to synthesize cDNA (first reaction), followed by heat at 95 ° C. to spontaneously denature the RNA: cDNA duplex and inactivate reverse transcription activity. Activated, and hot-start DNA polymerase activity was activated. Finally, in real time by denaturing at 95 ° C. for 10 seconds, annealing of primers and catalytic probes at 55 ° C. for 10 seconds, and reaction of RNase HII and elongation reaction at 65 ° C. for 30 seconds in real time. PCR reaction (second reaction) was performed.
  • Generation of the real-time amplified signal was performed by cleaving the catalytic probe with RNase HII during the annealing step of the PCR.
  • the first and second reactions were run one-step in the same tube and were carried out using the Roche Lightcycler 480 II system.
  • Figure 1 shows the amplification curves obtained by real time PCR using the CataCleave TM master mix and the following primer and probe combinations: HCV 3'X 1F (SEQ ID NO: 1), HCV 3'X 1.5R (SEQ ID NO: 4) , And HCV 3'X CataP4rc probe (SEQ ID NO: 10).
  • the reaction was carried out in a Roche LightCycler 480 II system with 50 ⁇ l RT-PCR.
  • Table 3 below shows the results of calculating the C t value (the number of cycles when the PCR amplification product is amplified by a certain amount) from the amplification curve of FIG. 1.
  • the initial concentrations of HCV genomic RNA in this experiment were 3.7e3, 3.7e2, 3.7e1, and 3.7e0 International Units (IU), which were counted as copy numbers: 1e4, 1e3, 1e2, and 1e1 copies.
  • IU International Units
  • the template was prepared. 2 ⁇ l in each dilution was used as RNA template in one-step RT-PCR with 23 ⁇ l PCR mix.
  • the final concentration of each component in the RT-PCR reaction is as follows: 1 X PCR reaction buffer, 400 uM of each dATP dCTP dGTP, 800 uM dUTP, 300 nM forward primer (SEQ ID NO: 13), 300 nM reverse Primer (SEQ ID NO: 15), 200 nM probe (SEQ ID NO: 16), 5 U hot-start RNase HII, 0.4 U thermostable UDG (Bacillus ssp.), 2.5 U Platinum Tfi exo-DNA Polymerase (Life Technologies ) And 0.5 U of Superscript III reverse transcriptase from Life Technologies.
  • RT-PCR reactions were performed using the following cycle parameters on a LightCycler 480 II real-time PCR instrument (Roche): first strand cDNA synthesis at 50 ° C. for 15 minutes, heat at 95 ° C. for 5 minutes. Reverse transcriptase was inactivated and RNase HII and DNA polymerase were activated, followed by 50 cycles of denaturation at 95 ° C. for 10 seconds, annealing at 55 ° C. for 10 seconds and extension at 72 ° C. for 30 seconds. Detection of fluorescence was carried out in each cycle during the 72 ° C. stretching process. The results are shown in FIG.
  • FIG. 2 shows that HCV genomic RNA can be detected with these primer / probe sets when there are about 20 copies of the template present in the reaction.
  • HBV can be efficiently detected even with a smaller amount of samples compared to the conventional method, and time and effort are required to detect HBV from the sample. You can see the savings.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Communicable Diseases (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Virology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Kit de détection du VHC à partir d'un échantillon d'essai. Un procédé de détection du VHC en temps réel à partir d'un échantillon d'essai utilisant ledit kit est également décrit. Selon le procédé de détection ci-décrit, le résultat de la détection peut être rapidement confirmé en temps réel même à partir d'un échantillon d'essai contenant un bas nombre de copies.
PCT/KR2011/009134 2011-11-29 2011-11-29 Kit de détection du virus de l'hépatite c et procédé de détection du virus de l'hépatite c l'utilisant WO2013081198A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/KR2011/009134 WO2013081198A1 (fr) 2011-11-29 2011-11-29 Kit de détection du virus de l'hépatite c et procédé de détection du virus de l'hépatite c l'utilisant

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/KR2011/009134 WO2013081198A1 (fr) 2011-11-29 2011-11-29 Kit de détection du virus de l'hépatite c et procédé de détection du virus de l'hépatite c l'utilisant

Publications (1)

Publication Number Publication Date
WO2013081198A1 true WO2013081198A1 (fr) 2013-06-06

Family

ID=48535633

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2011/009134 WO2013081198A1 (fr) 2011-11-29 2011-11-29 Kit de détection du virus de l'hépatite c et procédé de détection du virus de l'hépatite c l'utilisant

Country Status (1)

Country Link
WO (1) WO2013081198A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017212023A1 (fr) * 2016-06-10 2017-12-14 Roche Diagnostics Gmbh Compositions et procédés de détection du génotype 3 du virus de l'hépatite c

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DREXLER, J. F. ET AL.: "A novel diagnostic target in the hepatitis C virus genome", PLOS MEDICINE., vol. 6, no. 2, 10 February 2009 (2009-02-10), pages E31, XP003031317 *
HARVEY, J. J. ET AL.: "Characterization and applications of CataCleave probe in real-time detection assays", ANALYTICAL BIOCHEMISTRY., vol. 333, no. 2, 15 October 2004 (2004-10-15), pages 246 - 255, XP004573012 *
MORANDI, L. ET AL.: "Monitoring HCV RNA viral load by locked nucleic acid molecular beacons real time PCR", JOURNAL OF VIROLOGICAL METHODS., vol. 140, no. 1-2, 15 December 2006 (2006-12-15), pages 148 - 154, XP005870422 *
RAMJIT, R. T. ET AL.: "Performance characteristics of the MultiCode-RTx hepatitis C virus load test targeting the 3' untranslated region", JOURNAL OF CLINICAL MICROBIOLOGY., vol. 48, no. 5, May 2010 (2010-05-01), pages 1771 - 1774, XP003031318 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017212023A1 (fr) * 2016-06-10 2017-12-14 Roche Diagnostics Gmbh Compositions et procédés de détection du génotype 3 du virus de l'hépatite c
US10370731B2 (en) 2016-06-10 2019-08-06 Roche Molecular Systems, Inc. Compositions and methods for detection of hepatitis C virus genotype 3

Similar Documents

Publication Publication Date Title
JP7210203B2 (ja) リコンビナーゼポリメラーゼ増幅を多重化するための方法
WO2012046981A2 (fr) Détection par pcr en temps réel de polymorphismes nucléotidiques simples
WO2013168924A1 (fr) Détection d'acide nucléique par des sondes oligonucléotidiques clivées à la fois par une exonucléase et une endonucléase
WO2017122896A1 (fr) Marqueur génétique servant à distinguer et à détecter le virus responsable d'une maladie infectieuse touchant les poissons marins, et procédé de distinction et de détection du virus causal utilisant le marqueur
WO2013133680A1 (fr) Composition pour une réaction de transcription inverse à démarrage à chaud ou une réaction en chaîne de la polymérase de transcription inverse à démarrage à chaud
US20120052501A1 (en) Kit for detecting htlv strains and use thereof
WO2015126078A1 (fr) Procédé de détection d'acide nucléique au moyen d'une amplification isotherme asymétrique d'acide nucléique et d'une sonde signal
KR20120018734A (ko) 헤파티티스 ｂ 바이러스 검출용 키트 및 이를 이용한 헤파티티스 ｂ 바이러스의 검출 방법
KR102488559B1 (ko) 가닥-침투 기반 dna 증폭방법
KR20120020067A (ko) 헤파티티스 ｃ 바이러스 검출용 키트 및 이를 이용한 헤파티티스 ｃ 바이러스의 검출 방법
WO2020145711A1 (fr) Adn polymérase pour la détection de mutation d'egfr et trousse comprenant celle-ci
KR102146523B1 (ko) 표적 핵산의 향상된 증폭
WO2023106868A1 (fr) Procédé de génération d'un brin unique et procédé de détection d'une mutation l'utilisant
WO2020145715A1 (fr) Adn polymérase pour détecter des mutations tert et trousse comprenant cette derniere
WO2013081198A1 (fr) Kit de détection du virus de l'hépatite c et procédé de détection du virus de l'hépatite c l'utilisant
US20120088246A1 (en) Real time pcr detection of single nucleotide polymorphisms
WO2015105336A1 (fr) Procédé de test de gène mutant par réaction en chaîne de la polymérase en temps réel utilisant de l'adn polymérase ayant une activité inhibée d'endonuclease 5'flap
WO2013081199A1 (fr) Trousse de détection de virus de l'hépatite b et méthode de détection de virus de l'hépatite b faisant appel à ladite trousse
WO2013081200A1 (fr) Trousse de détection du vih-2, et méthode de détection du vih-2 faisant appel à ladite trousse
US9163289B2 (en) Kit for detecting HIV-1 and method for detecting HIV-1 using the same
WO2018016683A1 (fr) Méthode de détection de séquence d'acide nucléique cible utilisant une amplification nichée de signal de type amplification multiple
US20130029316A1 (en) Method for real-time detection of west nile virus using a cleavable chimeric probe
WO2013081201A1 (fr) Kit de détection du vih-1 et procédé de détection du vih-1
KR20120021268A (ko) 나이세리아 고노리아 종 검출용 키트 및 이를 이용한 나이세리아 고노리아 종의 검출 방법
EP3469102B1 (fr) Compositions et procédés de détection du génotype 3 du virus de l'hépatite c

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11876797

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11876797

Country of ref document: EP

Kind code of ref document: A1