WO2013075233A1 - Procede de traitement du cancer du cerveau - Google Patents

Procede de traitement du cancer du cerveau Download PDF

Info

Publication number
WO2013075233A1
WO2013075233A1 PCT/CA2012/050829 CA2012050829W WO2013075233A1 WO 2013075233 A1 WO2013075233 A1 WO 2013075233A1 CA 2012050829 W CA2012050829 W CA 2012050829W WO 2013075233 A1 WO2013075233 A1 WO 2013075233A1
Authority
WO
WIPO (PCT)
Prior art keywords
drr
cells
sirna
rna
seq
Prior art date
Application number
PCT/CA2012/050829
Other languages
English (en)
Inventor
Kevin Petrecca
Masad Damha
Glen Deleavey
Original Assignee
The Royal Institution For The Advancement Of Learning / Mcgill University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Royal Institution For The Advancement Of Learning / Mcgill University filed Critical The Royal Institution For The Advancement Of Learning / Mcgill University
Publication of WO2013075233A1 publication Critical patent/WO2013075233A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1135—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/341—Gapmers, i.e. of the type ===---===
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/31—Combination therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2330/00—Production
    • C12N2330/50—Biochemical production, i.e. in a transformed host cell
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • This invention relates to novel pharmaceutical compositions and methods for treating malignant glioma and other invasive cancers such as breast carcinoma, prostate carcinoma, and squamous cell carcinoma.
  • Gliomas arise from the supporting cells of the brain, called the glia.
  • Gliomas are the most common primary brain cancers and are amongst the most devastating of human malignancies.
  • the tumors are graded from the lowest grade 1 to highest grade 4, with glioblastoma multiforme (GBM) being the highest grade and deadliest type of glioma.
  • GBM glioblastoma multiforme
  • High-grade glioma or GBM is the most common primary malignant brain tumor, as well as the most devastating, accounting for 19 percent of all primary brain tumors.
  • Benign gliomas known as pilocytic astrocytomas
  • astrocytomas oligodendrogliomas or glioblastomas
  • astrocytomas oligodendrogliomas or glioblastomas
  • astrocytomas oligodendrogliomas or glioblastomas
  • brain invasion Unlike benign gliomas which do not invade normal brain, malignant gliomas are highly invasive. As a rule, high-grade gliomas almost always grow back even after complete surgical excision.
  • Malignant gliomas can be further divided into low grade and high grade.
  • Low grade malignant gliomas are highly invasive but have low proliferation rates, often invading multiple lobes prior to clinical presentation. Over time, low grade malignant gliomas may incur genetic changes that increase their proliferation rate and convert them to a higher grade (Louis, D.N. et al., Cancer Cell 1 : 125-128, 2002).
  • the prognosis for patients with high-grade gliomas is generally poor.
  • Malignant gliomas are among the most challenging of all cancers to treat successfully because they are characterized not only by aggressive proliferation and expansion, but also by their aggressive invasion of distant brain tissue. Of approximately 10,000 Americans diagnosed each year with malignant gliomas, about half are alive 1 year after diagnosis, and 25% after two years. Those with anaplastic astrocytoma survive about three years. Glioblastoma multiforme has a worse prognosis with less than 12 month survival after diagnosis. Standard treatment includes surgical resection followed by chemotherapy and radiation therapy. Unfortunately, this multimodal approach still translates to a mean survival of only 12 to 14 months. Gliomas cannot be cured.
  • MGC malignant glial cell
  • MGCs While there are many similarities between cell movement in normal physiologic conditions and in cancer, MGCs are thought to utilize additional or alternate mechanisms (Beadle et al., Mol Biol Cell. 19:3357-68,2008). Recent studies have suggested that MGCs invade the dense substance of the brain using a mode of cell movement that is similar to neural progenitor cell movement.
  • EGFR epidermal growth factor receptor
  • PI3K phosphatidylinositol 3- kinase
  • Akt Akt pathway
  • Phosphatase and tensin homolog reverses this process by dephosphorylating PI P 3 to PIP 2 .
  • PIP 3 binds the pleckstrin homology domain of Akt thereby recruiting it to the cell membrane. Once there, it is activated by phosphorylation at Thr308 and Ser473 by PDK1 and mTORC2, respectively (Hers et al., Cell. Signal. 23: 1515-1527, 201 1 ).
  • Akt Activated Akt translocates from the membrane to the cytosol and nucleus where it drives downstream pathways affecting cell proliferation, survival, metabolism and invasion (Manning and Cantley, Cell 129: 1261 -1274, 2007; Fan and Weiss, Curr. Top. Microbiol. Immunol. 347:279-296, 2010; Hers et al., Cell. Signal. 23: 1515-1527, 201 1 ).
  • Akt can also be activated independent of receptor tyrosine kinase
  • RTK viral oncogene
  • PI3K activity PI3K activity.
  • the viral oncogene v-akt is created by the addition of a myristoylation signal to the amino terminus of Akt. This allows Akt to associate with the cell membrane becoming constitutively active, bypassing the need for upstream RTK or PI3K involvement (Andejelkovic et al., J. Biol. Chem. 272: 31515-31524, 1997; Ahmed et al., Oncogene 7: 1957-1963, 1993).
  • mutation in the pleckstrin homology domain of Akt leads to association of Akt with the cell membrane and constitutive activation in breast, colorectal and ovarian cancers (Carpten et al., Nature 448: 439-444, 2007).
  • events promoting Akt localization to the cell membrane can be sufficient for its activation.
  • the "down regulated in renal cell carcinoma (DRR1 )" gene (also known as TU3A, and referred to herein as DRR, DRR-1 and DRR1 interchangeably) was originally cloned from the short arm of chromosome 3 from patients with renal cell carcinoma (Wang et al., Genes Chromosomes & Cancer 27: 1 -10, 2000). Wang et al. reported that the gene showed significant loss of expression in renal cell carcinoma (RCC) cell lines, as well as in primary tumours, and that transfection of the gene into DRR negative cell lines resulted in growth suppression, suggesting a role as a tumour suppressor for DRR. The function of the DRR gene product is not known.
  • RCC renal cell carcinoma
  • DRR down regulated in renal cell carcinoma
  • DRR disassembly and cell invasion.
  • DRR is not expressed in normal human brain glia, but is highly expressed in the invasive component of malignant gliomas, indicating a strong correlation between DRR expression in malignant gliomas and invasion.
  • DRR also induces Akt phosphorylation and recruits Akt to focal adhesions.
  • antisense oligonucleotide- mediated ablation of DRR prevents tumor cell invasion in a mouse xenograft model.
  • DRR as a novel regulator of cancer invasion, e.g., brain cancer invasion, and a target for therapeutic intervention in the treatment of metastatic or invasive cancers such as glioma, breast, prostate, squamous cell, lung, renal, or colon cancer.
  • compositions and methods for the treatment of cancer comprising nucleic acid molecules effective at reducing the expression of DRR in tumor cells.
  • the nucleic acid molecules of the invention include, for example, therapeutic RNAs such as antisense oligonucleotides, or short interfering RNAs (siRNA) molecules or vectors which encode antisense oligonucleotides or siRNAs.
  • the siRNA molecules or the vectors that encode them are also referred to here as RNAi molecules.
  • RNAi refers to "RNA interference", the process by which gene silencing is achieved by these siRNA molecules (Watts et al., Drug Discovery Today, 13: 842-855, 2008).
  • RNAi or antisense molecule comprising the sequence of SEQ I D NOs: 1 , 2, 5, 6, 7, 8, 9, 10, 14, 15, 16, 17/18, 19/20, 21 /22 or 23/24, or a fragment or derivative thereof, to tumor cells, wherein the RNAi molecule or antisense molecule (e.g., antisense oligonucleotide or antisense RNA) reduces the expression of DRR in the tumor cells.
  • DRR renal cell carcinoma
  • RNAi or antisense molecule for reducing the expression of downregulated in renal cell carcinoma (DRR) in tumor cells comprising the sequence of SEQ ID NO: 1 , 2, 5, 6, 7, 8, 9, 10, 14, 15, 16, 17/18, 19/20, 21/22 or 23/24, or a fragment or derivative thereof.
  • a method for reducing the expression of downregulated in renal cell carcinoma (DRR) in tumor cells comprising providing to tumor cells a DNA molecule comprising a sequence which encodes the sequence of SEQ I D NO: 1 , 2, 5, 6, 7, 8, 9, 10, 14, 15, 16, 17/18, 19/20, 21 /22 or 23/24, or a fragment or derivative thereof, wherein the DNA encodes a siRNA molecule or antisense molecule suitable for reducing the expression of DRR in the tumor cells.
  • the DNA molecule is inserted in an expression vector suitable for the production of dsRNA or suitable for the production of antisense RNA.
  • the expression vector may, for example, comprise a sequence encoding the sequence of SEQ ID NO: 1 , 2, 5, 6, 7, 8, 9, 10, 14, 15, 16, 17/18, 19/20, 21/22 or 23/24, or a fragment or derivative thereof.
  • RNAi or antisense molecules described herein or a vector that encodes siRNAs comprising administering the RNAi or antisense molecules described herein or a vector that encodes siRNAs to a subject in need thereof.
  • Methods of delaying the progression of cancer comprising administering the RNAi or antisense molecules described herein or a vector that encodes them to a subject in need thereof are also provided.
  • the antisense and RNAi molecules and/or the vectors described herein may be used in combination with one or more cancer therapies selected from the group consisting of surgical resection, chemotherapy, radiation therapy, immunotherapy, and gene therapy.
  • the tumor cells are glioma cells, such as malignant glioma cells or glioblastoma cells.
  • the tumor cells are breast carcinoma cells, prostate carcinoma cells, squamous cell carcinoma cells, lung carcinoma cells, renal carcinoma cells, or colon carcinoma cells.
  • a pharmaceutical composition for the treatment of cancer comprising an RNAi or antisense molecule of the invention, or a vector that encodes the antisense molecule or RNAi molecule of the invention, and a pharmaceutically acceptable carrier.
  • the cancer is glioma, in particular malignant glioblastoma.
  • the cancer is metastatic or invasive breast, prostate, squamous cell, lung, renal, or colon cancer.
  • a vector will not encode a chemically modified siRNA directly, but rather produces short hairpin RNAs (shRNAs) which are subsequently processed by DICER to produce native siRNA duplexes that have sequences targeting the RNA of interest, e.g. , DRR mRNA.
  • shRNAs short hairpin RNAs
  • DICER DICER
  • a vector or DNA "encoding a siRNA” refers to a vector or DNA producing a precursor RNA, e.g., a short hairpin RNA, which is processed to produce the siRNA.
  • an "RNAi molecule" of the invention is an unmodified siRNA, e.g., produced by a vector in a cell in its native form.
  • an RNAi molecule of the invention is a chemically modified siRNA, e.g., a FANA-based molecule as described herein.
  • kits comprising the pharmaceutical compositions of the invention, and instructions for use thereof.
  • the kits provided herein may further comprise a second active compound suitable for treating cancer, e.g., glioma, and/or for delaying the progression thereof, for simultaneous, separate or sequential administration to a subject.
  • the present invention also provides a method for enhancing efficacy of a cancer therapy for treatment of cancer, e.g., glioma, comprising administering an RNAi or antisense molecule of the invention or a vector that encodes the RNAi molecule or antisense molecule to a subject in need thereof, and simultaneously, separately or sequentially administrating a second cancer therapy.
  • the second cancer therapy may be, for example, surgical resection, chemotherapy, radiation therapy, immunotherapy, and/or gene therapy.
  • RNAi or antisense molecule of the invention or a fragment or derivative thereof, wherein the RNAi or antisense molecule reduces the expression of DRR in the tumor cells.
  • malignant glial cell invasion is inhibited in a subject by providing to tumor cells a DNA molecule comprising the sequence encoding SEQ ID NO: 1 , 2, 5, 6, 7, 8, 9, 10, 14, 15, 16, 17/18, 19/20, 21/22 or 23/24, or a fragment or derivative thereof, wherein the DNA encodes an RNAi molecule or an antisense RNA suitable for reducing the expression of DRR in the tumor cells.
  • breast, prostate, squamous cell, lung, renal, or colon cancer cell invasion is inhibited in a subject by providing to tumor cells a DNA molecule comprising the sequence encoding SEQ ID NO: 1 , 2, 5, 6, 7, 8, 9, 10, 14, 15, 16, 17/18, 19/20, 21/22 or 23/24, or a fragment or derivative thereof, wherein the DNA encodes an RNAi molecule or an antisense RNA suitable for reducing the expression of DRR in the tumor cells.
  • a method for diagnosis or prognosis of glioma in a subject comprising measuring DRR expression in the glioma cells of the subject, wherein DRR expression indicates invasiveness of the cells.
  • a method for visualizing invasive glioma cells in a subject comprising contacting glioma cells with a molecule which specifically binds DRR protein or mRNA and measuring DRR protein or mRNA levels in the cells, wherein cells which express DRR are invasive, is provided.
  • a method for diagnosis or prognosis of invasive cancer in a subject comprising measuring DRR expression in the cancer cells of the subject, wherein DRR expression indicates invasiveness of the cells, is provided.
  • a method for visualizing invasive cancer or tumor cells in a subject comprising contacting cancer or tumor cells with a molecule which specifically binds DRR protein or mRNA and measuring DRR protein or mRNA levels in the cells, wherein cells which express DRR are invasive, is provided.
  • the invasive cancer may be, for example, breast, prostate, squamous cell, lung, renal, or colon cancer.
  • kits for diagnosis or prognosis of invasive cancer e.g., invasive glioma
  • a detectably-labelled probe specific for DRR RNA or protein comprising a detectably-labelled probe specific for DRR RNA or protein, a reporter means for detecting binding of the probe to the DRR RNA or protein, and instructions for use thereof.
  • a method for treating cancer comprising administering a therapeutic nucleic acid, e.g. an RNAi molecule or antisense molecule (e.g., a siRNA, an antisense oligonucleotide, or an antisense RNA), which reduces expression of DRR, or a vector encoding the therapeutic RNA to a subject in need thereof.
  • a therapeutic nucleic acid e.g. an RNAi molecule or antisense molecule (e.g., a siRNA, an antisense oligonucleotide, or an antisense RNA), which reduces expression of DRR, or a vector encoding the therapeutic RNA to a subject in need thereof.
  • a therapeutic nucleic acid e.g. an RNAi molecule or antisense molecule (e.g., a siRNA, an antisense oligonucleotide, or an antisense RNA)
  • progression of cancer is delayed, malignant cell invasion is inhibited,
  • the cancer is metastatic or invasive breast, prostate, squamous cell, lung, renal, or colon cancer.
  • the therapeutic RNA which reduces expression of DRR is complementary to or specifically hybridizes to DRR mRNA, or a fragment or derivative thereof.
  • nucleic acids e.g., RNAi molecules, siRNAs, antisense oligonucleotides, ribozymes, etc.
  • therapeutic nucleic acids e.g., RNAi molecules, siRNAs, antisense oligonucleotides, ribozymes, etc.
  • DNAs or vectors encoding the therapeutic RNAs of the invention are also encompassed herein.
  • Nucleic acids aptamers which are sequences that adopt a unique three-dimensional structure that recognizes (binds to) DRR through protein-nucleic acid interactions, are also encompassed herein.
  • siRNA molecule wherein said siRNA molecule consists of: (a) a duplex region; and (b) either no overhang regions or at least one overhang region, wherein each overhang region contains six or fewer nucleotides, wherein the duplex region consists of a sense region and an antisense region, wherein said sense region and said antisense region together form said duplex region and each of said sense region and said antisense region is 18-30 nucleotides in length and said antisense region comprises a sequence that is the complement of SEQ ID NO: 4 or a fragment or portion thereof. In one embodiment, the antisense region and the sense region are each 19-25 nucleotides in length.
  • the antisense region and the sense region are each 21 nucleotides in length.
  • the siRNA molecule may have at least one overhang region or may have no overhang regions.
  • the siRNA comprises one or more FANA nucleotides and/or one or more FRNA residues.
  • the siRNA comprises the sequence of siRNAI (SEQ ID NO: 17/18), siRNA2 (SEQ ID NO: 19/20) or siRNA3 (SEQ ID NO: 23/24).
  • the siRNA consists of the sequence of siRNAI , siRNA2 or siRNA3.
  • the antisense region comprises a sequence that is complementary to nucleotides from position 227 to 245 of SEQ ID NO: 4.
  • DRR expression is downregulated by the siRNA.
  • RNA interference RNA interference
  • the sense region comprises a nucleotide sequence set forth in SEQ ID NO: 17, 19, or 23, and wherein the antisense region comprises a sequence that is complementary to a nucleotide sequence consisting of SEQ I D NO: 4 or a fragment or portion thereof.
  • the antisense region comprises a nucleotide sequence set forth in SEQ ID NO: 18, 20 or 24.
  • the antisense region consists of a nucleotide sequence which is set forth in SEQ ID NO: 18, 20 or 24.
  • the antisense region is complementary to nucleotides at positions 227-245 of SEQ ID NO: 4.
  • a recombinant nucleic acid construct or vector comprising a nucleic acid that is capable of directing transcription of a small interfering RNA (siRNA), the nucleic acid comprising: (a) at least one promoter; (b) a DNA polynucleotide segment that is operably linked to the promoter; (c) a linker sequence comprising at least 4 nucleotides operably linked to the DNA polynucleotide segment of (b); and (d) operably linked to the linker sequence a second polynucleotide, wherein the polynucleotide segment of (b) comprises a polynucleotide that is selected from the group consisting of SEQ ID NOs: 17, 19 and 23, wherein the second polynucleotide of (d) comprises a polynucleotide that is complementary to at least one polynucleotide that is selected from the group consisting of SEQ ID Nos: 17, 19 and 23.
  • siRNA small interfering
  • the DNA polynucleotide sequence may comprise SEQ ID NO: 17, 19 or 23 and/or the second polynucleotide may comprise SEQ ID NO: 18, 20 or 24.
  • An isolated host cell transformed or transfected with a recombinant nucleic acid construct described herein is also provided.
  • an siRNA expression vector for downregulating expression of DRR in a subject in need therof, wherein the vector comprises: (1 ) a bacterial cassette comprising a bacterial origin of replication and a bacterial selectable marker M 1 ; (2) a cassette for selection in eukaryotic cells comprising a selectable marker M2 for eukaryotic cells, and in particular for mammalian cells, under the control of an appropriate promoter; (3) an siRNA transcription cassette comprising at least one region encoding an siRNA corresponding to a DRR gene, under control of regulatory elements for transcription in mammalian cells, which regulatory elements include at least one promoter capable of transcribing an siRNA in mammalian cells and a transcription terminator; wherein said siRNA transcription cassette is immediately downstream of the transcription initiation site or else a maximum of at most 20 base pairs away from the latter; said transcription initiation site being CCG and said siRNA transcription cassette comprising, downstream of the sequence encoding the siRNA, a transcription terminator which comprises a
  • compositions comprising siRNAs or recombinant DNA constructs and vectors described herein, and a pharmaceutically acceptable carrier.
  • an siRNA molecule wherein said siRNA molecule consists of a duplex region, said duplex region consisting of a sense region and an antisense region, wherein: (a) said sense region and said antisense region together form said duplex region; (b) each of said sense region and said antisense region is 18-30 nucleotides in length; and (c) said antisense region comprises a sequence that is complementary to a nucleotide sequence consisting of SEQ ID NO: 4 or a fragment or portion thereof.
  • the sequence of said antisense region is complementary to a sequence comprising nucleotides from position 227 to 245 of SEQ ID NO: 4.
  • sequence of said antisense region is complementary to a sequence consisting of nucleotides from position 227 to 245 of SEQ ID NO: 4.
  • the antisense region and sense region may each be, e.g., 19-25 nucleotides in length.
  • the sense region comprises the sequence set forth in SEQ ID NO: 17, 19 or 23 and the antisense region comprises the sequence set forth in SEQ ID NO: 18, 20 or 24.
  • the siRNA molecule consists of a duplex comprising the sequence set forth in SEQ ID NO: 17/18, 19/20 or 23/24.
  • the siRNA molecule consists of a duplex consisting of the sequence set forth in SEQ ID NO: 17/18, 19/20 or 23/24.
  • the siRNA molecules provided herein comprise one or more FANA nucleotides and/or one or more FRNA residues.
  • Fig. 1 shows the validation of DRR as a regulator of invasion, wherein:
  • (A) shows and outline of a functional genetic screening assay
  • (B) shows a mixed tumor spheroid containing WT glial cells (cytotracker red label) and DRR overexpressing cells (DRR + , transparent) showing hyperinvasion of DRR + cells; solid circle demarcates invasion front of WT cells, and dashed circle demarcates invasion front of DRR + cells;
  • (C) shows control mixed tumor spheroid showing equal invasion of WT cytotracker red labeled cells and WT unlabelled cells demonstrating that cytotracker red labeling does not influence invasion;
  • (D) shows quantitative analysis of invasion;
  • (E) shows quantification of maximal invasion of WT- (red bars) and DRR + - (empty bars) cells; data are mean ⁇ s.e.m.
  • (n 14 for each cell line); asterisk, P ⁇ 0.001 ;
  • (F) shows tumor spheroid generated from DRR " cells, wherein circle demarcates invasion front;
  • G shows tumor spheroid generated from WT cells, wherein circle demarcates invasion front;
  • (H) shows high magnification image of inset in (F), showing that DRR " cells have a round cell shape;
  • (I) shows high magnification image of inset in (G), showing that WT cells have an elongated cell shape;
  • (J) shows quantification of cell invasion comparing DRR " cells and WT cells; Cells invading greater than 400 ⁇ were counted; data are mean ⁇ s.e.m.
  • (n 8 for each cell line); asterisk, P ⁇ 0.001 ;
  • (K) shows quantification of the effect of DRR expression on cell shape showing that DRR expression promotes an elongated cell shape;
  • (N) shows quantification of cell proliferation in DRR + , WT, and DRR " cells.
  • Fig. 2 shows that DRR is expressed in neurons and human gliomas but not in normal glia.
  • DRR immunolabeling of normal human brain at low (A and B) and high (C and D) magnification shows that DRR is found within the cortex but not in white matter (wm).
  • Expression of the glial marker GFAP does not overlap with DRR (A-D).
  • DRR is not expressed in the aneuronal molecular layer (ml) of the cortex (C).
  • High magnification imaging shows that DRR is highly expressed in neurons (E) but not in white matter (F).
  • Rat brain cultures similarly show that DRR expression overlaps with the neuronal marker MAP2 in neurons (G-l) but not with the glial marker GFAP in glia (J- L).
  • DRR expression in eight malignant gliomas of each grade was assessed. Both grade 2 and grade 3 gliomas (left panels, top and bottom) uniformly express high levels of DRR. In contrast, only the invasive peripheral tumor (PT) portions of grade 4 gliomas uniformly express DRR (right panel, bottom). The central tumor (CT) portion exhibits variable DRR expression, negative in 5 and positive in 3 tumors (right panel, top and middle). H & E: hematoxylin and eosin, Ki-67: marker of cell division revealing high levels of proliferation in the central tumor region.
  • Fig. 3 shows that DRR associates with the actin cytoskeleton and interacts with LC2.
  • A shows that transfected DRR localizes along actin stress fibers and focal adhesions. Arrows indicate expression at FA sites. Actin is labeled with phalloidin. The non-actin binding DRR APEPE , and the non-LC2 binding DRR AHRE , are diffusely expressed in the cytoplasm. They do not localize to actin or FAs. DRR AHRE can also be found in the nucleus.
  • B shows co-localization of FLAG-DRR and MYC-LC2 along actin stress fibres, lamellipodia and membrane ruffles.
  • (C) shows co-immunoprecipitation of heterologously expressed FLAG-DRR and MYC-LC2 from glial cells.
  • MYC- LC2 co-immunoprecipitates with FLAG-DRR and FLAG-DRR APEPE but not when the conserved N-terminal HRE sequence, DRR AHRE , is mutated.
  • Fig. 4 shows that DRR association with actin and LC2 is required for cell invasion.
  • A shows 3D invasion assays of WT, DRR + , DRR APEPE and DRR AHRE in a 3D collagen matrix.
  • B shows a closer view of the spheroid margins showing cell invasion. Asterisk indicates the spheroid edge in DRR APEPE cells.
  • C Quantitative analysis of cell invasion after 24, 48 and 72h.
  • Fig. 5 shows that DRR promotes focal adhesion dynamics.
  • WT cells were transfected with GFP-paxillin and imaged using confocal videomicroscopy for 170 minutes at 1 minute intervals.
  • A shows DRR + cells transfected with GFP-paxillin. Representative cell showing dynamic membrane protrusions and FA assembly and disassembly. Arrows indicate areas of robust FA assembly and disassembly. Boxes, b and c, represent high magnification areas shown in (B) and (C).
  • D shows WT cell transfected with GFP-paxillin. Representative cell showing a lack of membrane protrusions and stable FAs. No FAs were identified that assembled or disassembled over the imaging interval.
  • Fig. 6 shows that DRR promotes focal adhesion disassembly. DRR " ,
  • DRR + (A) and DRR APEPE (B) were starved for 24h and left untreated or treated for 4h with 10 ⁇ nocodazole. The MT depolymerizer was then washed out for the indicated time. DRR expression promotes FA
  • Fig. 7 shows that DRR organizes the actin and microtubular cytoskeletons.
  • C A working model summarizing the role of DRR in cytoskeletal organization and invasion. We propose that with LC2, DRR acts as an actin-MT crosslinker.
  • DRR targets MTs to FAs promoting their disassembly, cell rear retraction, and cell invasion.
  • Fig. 8 shows DRR protein expression in DRR " and DRR + stable cell lines.
  • (A) shows protein blotting showing increased DRR expression in the
  • DRR + cell line and reduced DRR expression in the DRR " cell line in comparison to wild-type cells shows DRR + cells implanted into mouse brain showing elongated cell shape and invasion into corpus callosum (cc).
  • Fig. 9 shows that DRR regulates the morphology of migrating cells.
  • Fig. 10 shows DRR expression in human cortex.
  • DRR immunolabelling of normal human brain cortex at high magnification shows that DRR is not expressed in the aneuronal molecular layer (ml).
  • adjacent section GFAP immunolabelling shows the presence of astrocytes in the molecular layer (arrows) which are DRR negative.
  • Fig. 11 shows that DRR regulates focal adhesion dynamics and invasion in multiple glioma cell lines.
  • Control U343 or U343-DRR " cells (A) and control C6 or C6-DRR " cells (B) were colabeled for actin (phalloidin) and
  • FAs (vinculin). Control cells contain small FAs whereas cells with reduced
  • Fig. 12 shows localization of endogenous DRR in malignant glial cells.
  • Immunolabeling wild-type U251 cells with the anti-DRR antibody reveals localization along actin stress fibers, FAs, membrane ruffles, and in the nucleus.
  • Fig. 13 shows a comparison of amino acid sequences within regions required for DRR-actin association across species.
  • Fig. 14 shows truncation analysis to identify DRR regions required for stress fibre localization.
  • dsRed was fused to the C-terminus of full length and truncated versions of DRR.
  • the DRR-dsRED fusion proteins were expressed in WT U251 and assayed for stress fibre localization. These data show that amino acids 62-100 and 108-120 are required for stress fibre localization.
  • Fig. 15 shows that DRR reduction using RNA interference leads to specific on-target effects on focal adhesion dynamics.
  • A shows U251 cells expressing GFP-RNAi targeting DRR
  • B shows DRR rescue cell transiently expressing DRR as identified by immunolabeling DRR (arrow)
  • C FAs were visualized by immunolabeling vinculin.
  • DRR + FA phenotype reduced FA size and increased FA number
  • DRR in DRR " cells.
  • Fig. 16 shows that reduction of DRR expression inhibits human glioma invasion.
  • Human high grade gliomas were surgically resected and immediately placed in culture. Two weeks later they were transfected with a control GFP vector or DRR-RNAi (vector also contains GFP). Tumor spheroids were generated from these cells and implanted into a collagen matrix. Brightfield (upper lanes) and fluorescence images (lower lanes) were captured at 1 to 14 days post-implantation.
  • Non-transfected tumors (A) and control GFP-transfected tumors B
  • DRR-RNAi transfected tumors do not.
  • D shows quantification of invasion distance from spheroid edge, wherein D indicates days, GFP is green fluorescent protein and GBM is glioblastoma (high grade glioma).
  • Fig. 17 shows comparison of efficacy of different DRR antisense oligonucleotides in reducing DRR expression.
  • DRR+ cells were transfected with the indicated DRR antisense (Antisense 4 (SEQ ID NO: 14), Antisense 5 (SEQ ID NO: 15) or Antisense 6 (SEQ ID NO: 16); a non-targeting control antisense (Ctl Antisense); or left untransfected (Untransfected). 72 hours post-transfection, cells were lysed and analysed using 12% SDS-PAGE. DRR expression level was detected with anti-DRR antibody. Western blot of tubulin is included as loading control.
  • Fig. 18 shows visualization of changes in DRR actin's cytoskeletal and focal adhesion.
  • DRR+ cells were transfected with a non-targeting control antisense (ctl Antisense), the indicated DRR antisense (Antisense G4 (SEQ ID NO: 14), Antisense G5 (SEQ ID NO: 15) or Antisense G6 (SEQ ID NO: 16)) or left untransfected (Untransfected).
  • ctl Antisense non-targeting control antisense
  • Antisense G4 SEQ ID NO: 14
  • Antisense G5 SEQ ID NO: 15
  • Antisense G6 SEQ ID NO: 16
  • Fig. 19 shows analysis of DRR+ cell migration using an in vitro scratch assay.
  • DRR+ cells were untransfected (CTL) or transfected with a non- targeting control antisense (Ctl Antisense) or transfected with the indicated antisense (antisense G4 (SEQ I D NO: 14), antisense G5 (SEQ ID NO: 15) or antisense G6 (SEQ ID NO: 16)).
  • CTL untransfected
  • Ctl Antisense Ctl Antisense
  • antisense G4 SEQ I D NO: 14
  • antisense G5 SEQ ID NO: 15
  • antisense G6 SEQ ID NO: 16
  • Fig. 20 shows analysis of DRR+ cell invasion using an in vitro 3D invasion assay.
  • DRR+ cells were untransfected (CTL) or transfected with indicated antisense G6 (SEQ ID NO: 16).
  • CTL untransfected
  • SEQ ID NO: 16 indicated antisense G6
  • A Images of cell invasion were acquired at 0, 24, 48, 72 and 96 hours; G6 (sphere#1 )and G6b (sphere#2) are two separate examples of tumors treated with antisense G6.
  • B shows analysis of DRR+ cell invasion using an in vitro 3D invasion assay.
  • Fig. 21 shows visualization of changes in GBM6 actin's cytoskeletal and focal adhesion.
  • GBM6 cells were transfected with indicated antisense (Untransfected; Ctl antisense; or antisense G6 (SEQ ID NO: 16) using lipofectamine 2000 reagent. At 72 hours, cells were fixed, counterstained, and analyzed by confocal microscopy to visualize vinculin (green; left column) and actin (red; right column).
  • Fig. 22 shows analysis of GBM6 cell migration using an in vitro scratch assay.
  • GBM6 cells were transfected with the indicated antisense (Antisense G4 (SEQ ID NO: 14), Antisense G5 (SEQ ID NO: 15), or
  • Antisense G6 (SEQ ID NO: 16)) or a non-targeting control antisense (CTL Antisense) acquired at 0 and 24 hours.
  • CTL Antisense a non-targeting control antisense acquired at 0 and 24 hours.
  • Fig. 23 shows comparison of efficacy of different DRR siRNA oligonucleotides in reducing DRR expression.
  • DRR+ cells were transfected with the indicated DRR siRNA (siRNAI (SEQ ID NO: 17/18), siRNA2 (SEQ ID NO: 19/20) or siRNA3 (SEQ ID NO: 23/24); a non-targeting control siRNA (Ctl siRNA; SEQ ID NO: 25/26); or left untransfected (Untransfected). 72 hours post-transfection, cells were lysed and analysed using 12% SDS- PAGE. DRR expression level was detected using an anti-DRR antibody. Western blot of tubulin is included as a loading control.
  • Fig. 24 shows comparison of efficacy of different DRR siRNA oligonucleotides in reducing DRR expression.
  • MNI 1 stem cells were transfected with the indicated DRR siRNA (siRNAI (SEQ ID NO: 17/18), siRNA2 (SEQ ID NO: 19/20) or siRNA3 (SEQ ID NO: 23/24); a non-targeting control siRNA (Ctl siRNA; SEQ ID NO: 25/26); or left untransfected
  • Fig. 25 shows changes in actin cytoskeletal and focal adhesions when DRR expression is reduced.
  • DRR+ cells were transfected with a non- targeting control siRNA (ctl siRNA), the indicated DRR siRNA (siRNAI (SEQ ID NO: 17/18), and siRNA2 (SEQ ID NO: 19/20) or left untransfected (Untransfected).
  • siRNA2 was fluorescently labelled with cy5 (SEQ ID NO: 21 /22) and transfected into DRR+ cells.
  • cy5 SEQ ID NO: 21 /22
  • Fig. 26 shows changes in actin cytoskeletal and focal adhesions when DRR expression is reduced in GBM6 cells.
  • GBM6 cells were transfected with a non-targeting control siRNA (ctl siRNA), the indicated DRR siRNAI (SEQ ID NO: 17/18), or left untransfected (Untransfected).
  • ctl siRNA non-targeting control siRNA
  • DRR siRNAI DRR siRNAI
  • Untransfected left untransfected
  • Fig. 27 shows extent of human glioblastoma cell migration following reduction of DRR expression using an in vitro scratch assay for observing cell invasiveness.
  • GBM6 glioma cells were "scratched” to clear cells from an area of the plate; the ability of the plated GBM6 glioma cells to "invade” back into the cleared area was monitored over time.
  • GBM6 cells were transfected with the indicated siRNAs or left untransfected (control). Images of the scratch were acquired at 0, 24, 48, 72, and 96 hours.
  • Fig. 28 shows changes in actin cytoskeletal and focal adhesions when malignant glioma cells are treated with DRR targeting siRNA.
  • the top row shows malignant glioma cells (Ctl); they are elongated, and lack strong focal adhesions at the surface.
  • the middle row shows malignant glioma cells treated with siRNAI (SEQ ID NO: 17/18; referred to in the figure as D1 ).
  • the bottom row shows malignant glioma cells treated with Cy5-siRNA2 (SEQ ID NO: 21/22; referred to in the figure as D2-Cy5).
  • the green dye (vinculin) stains focal adhesions; the red dye (phalloidin) stains actin (the cytoskeleton of the cell); for D2-Cy5, siRNA is labelled with a Cy5 dye (blue), which allows the location of the siRNAs to be visualized within the cells (blue).
  • the left panel shows visualization of vinculin (green); the second panel from the left shows visualization of actin (red); the third panel from the left shows visualization of siRNA (blue); and the right-most panel shows visualization of all three stains.
  • Fig. 29 shows Phospho-Akt is elevated in DRR over-expressing cells, (a): DRRov cells co-labelled with vinculin (green) and DRR (red); (b): Western blot showing the expression of DRR, Serine 473 and Threonine 308 Akt phosphorylation, Akt, NFkB, pGsk3, Gsk3 in DRRov and CTL cells.
  • Tubulin is shown as a loading control;
  • Tubulin is shown as a loading control.
  • Fig. 30 shows that high expression level of pAkt in DRRov is EGFR- independent
  • Fig. 31 shows Western blots showing: (a): pAkt expression level in DRRov and CTL cells untreated or treated with U0126 inhibitor or with DMSO in the absence or presence of EGF (50ng/ml); (b): pAkt level in response to Rho inhibitor, C3 transferase ⁇ g/mL) treatment in DRRov or CTL; (c): Phospho-Akt levels in DRRov transfected with siRNA (si) against integrin- linked kinase (ILK) [or scramble (scr)] at 100 and 120nM after 48 and 72 hours post-transfection; (d): Phospho-Akt and total Akt levels in response to the SFK inhibitor PP2 (5 ⁇ ) and its inactive analog PP3 (5 ⁇ ) treatment in DRRov and CTL cells; (e): pAkt and Akt levels in response to PP2 (10 ⁇ ) treatment in DRRov and DRRkd after being plated on fibronectin
  • pFAK and Fak levels are shown to verify FN efficacy;
  • Phosphotyrosine (pTyr) levels are shown to verify EGF stimulation.
  • DMSO is a vehicle control
  • Phospho-FAK (pFAK) levels are shown to verify FN treatment.
  • tubulin is shown as a loading control.
  • Fig. 32 shows that Phospho-Akt signaling is cell-adhesion dependent and DRR recruits Akt to the focal adhesion, (a): Western blot showing in
  • Fig. 33 shows that SFK and PI3K inhibition prevent invasion of DRR- overexpressing cells, (a): 3D invasion assays of DRRov and CTL cells untreated or treated with PP2 or LY294002 at time 0 and 48 hours; (b):
  • Fig. 34 shows DRR as a therapeutic target for brain cancer invasion
  • Tubulin is shown as a loading control
  • Fig. 35 shows fold change in normalized DRR mRNA expression for the indicated tissue or tumour samples. Normalized expression of DRR was calculated by taking the relative quantity (DRR) divided by the relative quantity of a reference gene (HS14) and graphed as fold change expression. Increased DRR expression is correlated with invasiveness in breast, prostate and squamous cell carcinoma.
  • Fig. 36 shows a comparison of different DRR antisense efficacy in reducing DRR expression.
  • DRR+ cells were transfected with 20 nM of indicated DRR antisense oligonucleotides (AONs) using Lipofectamine 2000, and DRR expression level was assessed following 72 hours post- transfection.
  • AONs indicated DRR antisense oligonucleotides
  • G5 SEQ ID NO: 15
  • G6 SEQ ID NO: 16
  • G1 non-targeting control antisense
  • SEQ I D NO: 1 1 left untransfected (0).
  • 72h post-transfection cells were lysed and analysed in
  • Fig. 37 shows visualization of changes in DRR actin's cytoskeletal and focal adhesion.
  • DRR+ cells were transfected with a non-targeting control antisense (G1 ), the indicated DRR antisense (G5, G6) or left untransfected (not shown).
  • G1 non-targeting control antisense
  • G5, G6 DRR antisense
  • left untransfected not shown.
  • cells were fixed, counterstained, and analyzed by confocal microscopy to visualize vinculin (green) and actin (red).
  • the third panel from the left shows the blue channel; nothing is visualized since the antisense oligonucleotides were not tagged with cy5 in this experiment.
  • the right panel shows a merge of the vinculin and actin panels.
  • Fig. 38 shows tagged DRR antisense oligonucleotides efficiently reduce DRR levels.
  • a western blot showing a DsredDRR stable cell line transfected with the indicated antisense oligonucleotide or untransfected (CTL). 72h post-transfection, cells were lysed and analysed in 12% SDS-Page. Anti-DRR (top) or anti-Dsred (bottom) antibodies were used to detect DRR expression levels. Tubulin was included as loading control. Quantification indicated significant decrease in DRR level in cells transfected with G5-Cy5, G6-Cy5, G5 or G6.
  • Fig. 39 shows reduction of DRR and larger focal adhesion observed with the expression of targeted DRR antisense.
  • DsredDRR stable cells were transfected with the indicated Cy5-tagged antisense.
  • 72h post-transfection cells were fixed and labelled with vinculin (green) to visualize focal adhesion.
  • DRR expression level could be directly detected in the red channel
  • dsredDRR antisense expression was detected in the blue channel. DsredDRR could no longer be detected in cells highly expressing G5-cy5 or G6-cy5 antisense, while non-targeting G1 -cy5 antisense did not affect dsredDRR levels.
  • the far right panel shows a merge images of the 3 channels in the other 3 panels.
  • Fig. 40 shows analysis of DRR+ cell migration by in vitro scratch assay. DRR+ cells were left untransfected (0), or transfected with a non- targeting control antisense oligonucleotide (G1 ) or the indicated antisense oligonucleotide (G5, G6). Cell migration was assessed at Oh, 24h and 48h. (A): Images of the scratch were acquired at Oh and 48h; (B): Quantitative analysis of cell migration is shown.
  • Fig. 41 shows that DRR silencing with G6-cy5 antisense showed reduced invasion in comparison with random antisense G1 -cy5.
  • Analysis of DRR+ cell invasion was done by in vitro 3D invasion assay.
  • A Western blot of DRR+ cells untransfected (0) or transfected with the indicated antisense (G6, G6-cy5, G1 -cy5) is shown; cell lysates were analyzed 72h post- transfection. Drr expression was detected with an anti-DRR antibody. Tubulin was included as loading control.
  • B Cell invasion images of DRR+ cells expressing G1 -cy5 or G6-cy5 (blue cells) are shown.
  • Fig. 42 shows antisense G5 and G6 successfully inhibit human glioma stem cell invasion.
  • A 3D in vitro invasion images of human glioma stem cells left untransfected (CTL), transfected with control non-targeting antisense (G1 ) or with DRR targeting antisense (G5 or G6), as indicated, captured at different intervals (day 2, 6, or 9) with a 5x objective.
  • B 3D in vitro invasion images of human glioma stem cells left untransfected (CTL), transfected with control non-targeting antisense (G1 ) or with DRR targeting antisense (G5 or G6), as indicated, captured at different intervals (day 2, 6, or 9) with a 5x objective.
  • B 3D in vitro invasion images of human glioma stem cells left untransfected (CTL), transfected with control non-targeting antisense (G1 ) or with DRR targeting antisense (G5 or G6), as indicated, captured at
  • Fig. 43 shows DRR targeted antisense prevent human glioma stem cell invasion in an in vivo mouse model.
  • A There are shown mouse brain sections showing injected human glioma stem cells expressing control Cy5- non-targeting antisense (G1 -cy5) or DRR targeting antisense tagged with Cy5 (G5-cy5 or G6-cy5), as indicated. Human glioma stem cells expressing the antisense were directly detected with Cy5 fluorescence (left panel) and an H&E stained section was included to show tumor mass (middle panel; HNE).
  • Fig. 44 shows a comparison of different DRR siRNA efficacy in reducing DRR expression.
  • DRR4 siRNA non-targeting control siRNA (DRR4 siRNA (scramble)
  • DRR expression level was detected with anti-DRR antibody.
  • Western blot of tubulin is included as loading control. Results indicate that DRR1 siRNA, which is the unmodified siRNA, was the most efficient in decreasing DRR expression.
  • Fig. 45 shows visualization of changes in DRR actin's cytoskeletal and focal adhesion.
  • DRR+ cells were transfected with the indicated siRNA (20 nM) using Lipofectamine 2000 reagent, or left untransfected. At 72 hours post-transfection, cells were fixed, counterstained, and analyzed by confocal microscopy to visualize vinculin (VINC; green) and actin (ACTIN; red). The last panel shows merged images. Reduction in DRR expression induced changes in cell morphology associated with decreased actin stress fibres, increased cortical actin and increases in focal adhesion size.
  • Fig. 46 shows visualization of changes in DRR actin's cyroskeletal and focal adhesion.
  • DRR+ cells were transfected with siRNA2 fluorescently labelled with cy5.
  • siRNA2 fluorescently labelled with cy5.
  • cells were fixed, counterstained, and analyzed by confocal microscopy to visualize vinculin (green), actin (red), and siRNA (blue).
  • Cells expressing DRR2 siRNA-cy5 showed large focal adhesion and increased in cortical actin.
  • the right panel shows a merge images of the three other panels.
  • the present invention relates to the identification of downregulated in renal carcinoma (referred to herein as DRR, DRR1 or DRR-1 ) as a novel regulator of cancer, e.g., brain cancer, invasion and a target for therapeutic intervention in the treatment of invasive cancers, e.g., glioma, particularly malignant glioblastoma.
  • DRR renal carcinoma
  • novel compounds, pharmaceutical compositions and methods for inhibiting glioma tumor cell invasion and/or treating glioma comprising molecules which reduce the expression of DRR in glioma tumor cells.
  • novel compounds, pharmaceutical compositions and methods for treating metastatic or invasive cancers of any type such as breast, prostate, skin (e.g., squamous cell carcinoma), lung, renal, or colon cancer.
  • the present invention thus provides compounds, in particular oligonucleotides and similar species, for use in modulating the function or effect of nucleic acid molecules encoding DRR. In some embodiments, this is accomplished by providing oligonucleotides which specifically hybridize with one or more nucleic acid molecules encoding DRR.
  • a compound of this invention which hybridizes with its target nucleic acid is generally referred to as “antisense” and consequently, the mechanism of inhibition of DRR is referred to as “antisense inhibition.”
  • antisense inhibition is typically based upon hydrogen bonding-based hybridization of oligonucleotide strands or segments such that the target RNA molecule is cleaved, degraded, or otherwise rendered inoperable.
  • the present invention is concerned with targeting specific nucleic acid molecules which encode for DRR or a portion thereof, such as the mRNA encoding DRR.
  • hybridization refers to the pairing of complementary strands of oligomeric compounds.
  • the preferred mechanism of pairing involves hydrogen bonding, which may be Watson- Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases (nucleobases) of the strands of oligomeric compounds.
  • nucleobases complementary nucleoside or nucleotide bases
  • adenine and thymine are complementary nucleobases which pair through the formation of hydrogen bonds.
  • Hybridization can occur under varying circumstances.
  • “Complementary,” as used herein, refers to the capacity for precise pairing between two nucleobases of an oligomeric compound.
  • a nucleobase at a certain position of an oligonucleotide is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, said target nucleic acid being a DNA, RNA, or oligonucleotide molecule
  • the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be a complementary position.
  • the oligonucleotide and the further DNA, RNA, or oligonucleotide molecule are complementary to each other when a sufficient number of complementary positions in each molecule are occupied by nucleobases which can hydrogen bond with each other.
  • An antisense compound is specifically hybridizable when binding of the compound to the target nucleic acid, e.g. DRR mRNA, interferes with the normal function of the target nucleic acid to cause a loss of activity, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target nucleic acid sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and under conditions in which assays are performed in the case of in vitro assays.
  • the target nucleic acid e.g. DRR mRNA
  • an antisense compound need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable.
  • an oligonucleotide may hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure or hairpin structure).
  • the antisense compounds of the present invention comprise at least 70% sequence complementarity to a target region within the target nucleic acid, more preferably that they comprise at least 80% sequence complementarity, at least 85% sequence complementarity, at least 90% sequence complementarity or at least 95% sequence complementarity to the target nucleic acid sequence.
  • an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize would represent 90 percent complementarity.
  • the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases.
  • an antisense compound which is 18 nucleobases in length having 4 (four) noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention.
  • Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol. 215: 403-410, 1990; Zhang and Madden, Genome Res. 7: 649-656, 1997).
  • stringent hybridization conditions or “stringent conditions” refers to conditions under which a compound of the invention will hybridize to its target sequence, but to a minimal number of other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances and in the context of this invention, "stringent conditions" under which oligomeric compounds hybridize to a target sequence are determined by the nature and composition of the oligomeric compounds and the assays in which they are being investigated.
  • a non-limiting example of a hybridization condition is hybridization in 6x SSC buffer (900 mM sodium chloride containing 90 mM sodium citrate at pH 7.
  • Antisense drugs are typically small (e.g.12-21 nucleotides, or 15-30 nucleotides) pieces of DNA or RNA that are chemically modified to engineer good drug properties. Antisense drugs work after binding (hybridizing) to a target RNA and forming a duplex. The formation of this duplex, or two- stranded molecule, prevents the RNA from functioning normally and/or from producing a protein. Antisense oligonucleotides inhibit mRNA translation via a number of alternative mechanisms including destruction of the target mRNA through RNaseH recruitment, interference with RNA processing or translation, nuclear export, folding or ribosome scanning.
  • RNAs may target non-coding RNAs, such as microRNAs, which are involved in the regulation of protein production within the cell.
  • microRNAs are small naturally occurring RNA molecules that are created inside cells and appear to have critical functions in controlling processes or pathways of gene expression.
  • microRNAs There are nearly 700 microRNAs that have been identified in the human genome, and these are believed to regulate the expression of approximately one-third of all human genes.
  • Other antisense drugs may for example control splicing, to favour production of one protein versus another.
  • antisense oligonucleotides are known and may be used in the compositions and methods of the invention. It is contemplated that any of the known antisense technologies may be used to target DRR and reduce DRR expression.
  • oligonucleosides having alternating segments of sugar-modified nucleosides e.g., 2'-0-modified ribonucleosides or arabinonucleosides
  • 2'-deoxynucleosides and/or oligonucleotides having alternating segments of sugar-modified nucleotides and 2'-deoxynucleotides
  • gapmers and "altimers” and may be used for the preparation of antisense oligonucleotides.
  • the therapeutic RNA of the invention is an antisense comprising an olignonucleoside comprising alternating segments of sugar- modified nucleosides and 2'-deoxynucleosides, wherein the segments or units each independently comprise at least one sugar-modified nucleoside or 2'-deoxynucleoside, respectively.
  • the oligonucleoside comprises alternating first and second segments, wherein the first segment comprises at least one sugar-modified nucleoside, and wherein the second segment comprises at least one 2'-deoxynucleoside.
  • the oligonucleoside comprises at least 2 of each of the first and second segments thereby comprising at least 4 alternating segments.
  • an oligonucleoside comprises an internucleoside linkage comprising a phosphate, thereby being an oligonucleotide.
  • the sugar-modified nucleosides and/or 2'-deoxynucleosides comprise a phosphate, thereby being sugar-modified nucleotides and/or 2'- deoxynucleotides.
  • the invention provides an oligonucleotide comprising alternating segments or units of arabinonucleotides and 2'-deoxynucleotides, wherein said segments or units each independently comprise at least one arabinonucleotide or 2'- deoxynucleotide, respectively.
  • an oligonucleotide comprises at least 2 arabinonucleotide segments and at least 2 2'- deoxynucleotide segments thereby having at least 4 of the alternating units.
  • a sugar-modified oligonucleotide is capable of adopting a DNA-like conformation.
  • a sugar-modified nucleotide is selected from the group consisting of arabinonucleotides, alpha- L-locked nucleic acids, cyclohexene nucleic acids, and ribonucleotides lacking an electronegative 2'-oxygen atom.
  • ribonucleotides lacking an electronegative 2'-oxygen atom are selected from the group consisting of 2'-alkyl-D-ribose and 2'-SCH 3 -D-ribose.
  • segments each independently comprise about 1 to about 6 arabinonucleotides or 2'- deoxynucleotides. In further embodiments, segments each independently comprise about 2 to about 5 or about 3 to about 4 arabinonucleotides or 2'-deoxynucleotides. In a further embodiment, segments each independently comprise about 3 arabinonucleotides or 2'- deoxynucleotides.
  • an oligonucleotide has a structure selected from the group consisting of:
  • each of m, x and y are each independently an integer greater than or equal to 1 , n is an integer greater than or equal to 2, A is an sugar-modified nucleotide and D is a 2'-deoxyribonucleotide.
  • an alkyl group is a lower alkyl group.
  • a lower alkyl group is selected from the group consisting of methyl, ethyl and propyl groups.
  • a functionalized alkyl group is selected from the group consisting of methylamino, ethylamino and propylamino groups.
  • an alkoxy group is selected from the group consisting of methoxy, ethoxy and propoxy groups.
  • a sugar-modified nucleotide is an arabinonucleotide.
  • a 2' substituent is fluorine and an arabinonucleotide is a 2'- fluoroarabinonucleotide (2'F-ANA ; also abbreviated "FANA").
  • an antisense oligonucleotide of the invention comprises one or more internucleotide linkages selected from the group consisting of: a) phosphodiester; b) phosphotriester; c) phosphorothioate; d) phosphorodithioate; e) Rp-phosphorothioate ; f) Sp-phosphorothioate ; g) boranophosphate; h) methylene (methylimino) (3'CH 2 -N (CH 3 )-05'); i) 3'- thioformacetal (3'S-CH 2 -05') j) amide (3'CH 2 -C (O) NH-5'); k) methylphosphonate; I) phosphoramidate (3'-OP (0 2 )-N5'); and m) any combination of (a) to (I).
  • an antisense oligonucleotide consists of about 30 or fewer nucleotides, in a further embodiment, about 8 to about 25 nucleotides, and in yet a further embodiment, about 18 nucleotides. In an embodiment, an antisense oligonucleotide has about 12 nucleotides, about 15 nucleotides, about 18 nucleotides, about 20 nucleotides, about 25 nucleotides, or about 30 nucleotides. In another embodiment, an antisense oligonucleotide is from about 12 to about 30 nucleotides long.
  • an antisense oligonucleoside further comprises a third segment comprising a modified nucleoside, wherein said third segment is adjacent to (a) the 5'end of said alternating first and second segments, (b) the 3'end of said alternating first and second segments, or (c) both (a) and (b).
  • an antisense oligonucleotide further comprises a third segment comprising a modified nucleotide, wherein said third segment is adjacent to (a) the 5' end of said alternating first and second segments, (b) the 3' end of said alternating first and second segments, or (c) both (a) and (b).
  • a modified nucleotide is a modified ribonucleotide.
  • a modified ribonucleotide comprises a modification at its 2' position.
  • a 2' modification is selected from the group consisting of methoxy, methoxyethyl, fluoro and propylamino groups.
  • an antisense oligonucleotide is an altimer comprising alternating segments of arabinonucleotide (ANA) such as 2'F- ANA (or FANA) and DNA.
  • ANA arabinonucleotide
  • FANA FANA
  • Arabinonucleotide refers to a nucleotide comprising an arabinofuranose sugar.
  • RNA for antisense binding may include not only the information to encode a protein, but also associated ribonucleotides, which for example form the 5'- untranslated region, the 3'-untranslated region, the 5' cap region and intron/exon junction ribonucleotides.
  • Antisense molecules (oligonucleosides or oligonucleotides) of the invention may include those which contain intersugar backbone linkages such as phosphotriesters, methyl phosphonates, 3'-thioformacetal, amide, short chain alkyl or cycloalkyi intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages, phosphorothioates and those with CH 2 - NH-0-CH 2 , CH 2 -N (CH 3 )-0-CH 2 (known as methylene (methylimino) or MMI backbone), CH 2 -0-N (CH 3 ) -CH 2 , CH 2 -N (CH 3 ) -N (CH 3 )-CH 2 and O- - N (CH 3 ) -CH 2 -CH 2 backbones (where phosphodiester is O-P (0) 2 -0- CH 2 ).
  • intersugar backbone linkages such as phosphotriesters, methyl phosphon
  • antisense oligonucleotides may have a peptide nucleic acid (PNA, sometimes referred to as "protein” or “peptide” nucleic acid) backbone, in which the phosphodiester backbone of the oligonucleotide may be replaced with a polyamide backbone wherein nucleosidic bases are bound directly or indirectly to aza nitrogen atoms or methylene groups in the polyamide backbone (see for example, Nielsen et al., Science, 1991 ,254: 1497 and U. S. Pat. No. 5,539, 082). Phosphodiester bonds may be substituted with structures that are chiral and enantiomerically specific.
  • PNA peptide nucleic acid
  • oligonucleotides may also include species which include at least one modified nucleotide base.
  • nucleotide of a sugar-modified nucleotide segment may comprise modifications on its pentofuranosyl portion.
  • modifications are 2'-0-alkyl-and 2'- halogen- substituted nucleotides.
  • Some specific examples of modifications at the 2' position of sugar moieties which are useful in the present invention are OH, SH, SCH 3 , F, OCN, O (CH 2 ) n , NH 2 or O (CH 2 ) n CH 3 where n is from 1 to about 10; Ci to CIO lower alkyl, substituted lower alkyl, alkaryl or aralkyl; CI; Br; CN; CF 3 ; OCF 3 ; 0-, S-, or N-alkyl; 0-, S-, or N- alkenyl; 'SOCH 3 S0 2 CH 3 ; ON0 2 ; N0 2 ; N 3 ; NH 2 ; heterocycloalkyl; heterocycloalkaryl; aminoalkylamino; polyalkylamino; substituted silyl; an RNA cleaving group; a reporter group; an intercalator
  • Nucleoside refers to a base (e. g. a purine [e. g. A and G] or pyrimidine [e. g. C, 5-methyl-C, T and U] ) combined with a sugar (e. g. [deoxy] ribose, arabinose and derivatives).
  • Nucleotide refers to a nucleoside having a phosphate group attached to its sugar moiety. In embodiments these structures may include various modifications, e. g. either in the base, sugar and/or phosphate moieties.
  • Modified nucleotide/nucleoside refers to a nucleotide/nucleoside that differs from and thus excludes the defined native form.
  • Oligonucleotide refers to a sequence comprising a plurality of nucleotides joined together.
  • An oligonucleotide may comprise modified structures in its backbone structure and/or in one or more of its component nucleotides.
  • oligonucleotides of the invention are about 1 to 200 bases in length, in further embodiments from about 5 to about 50 bases, from about 8 to about 40 bases, and yet further embodiments, from about 12 to about 25 bases in length.
  • a therapeutic RNA of the invention comprises an antisense RNA comprising a "gapmer".
  • Gapmer which are also known as “chimeric antisense” oligos, are described for example in PCT international publication no. WO/2002/20773, the contents of which are hereby incorporated by reference.
  • an antisense oligonucleotide may be a chimera constructed from arabinonucleotide or modified arabinonucleotide residues, flanking a series of deoxyribose nucleotide residues of variable length, that form a duplex with its target RNA sequence.
  • Such resulting antisense oligonucleotide/RNA duplex is a substrate for RNaseH, an enzyme that recognizes this duplex and degrades the RNA target portion.
  • RNaseH mediated cleavage of RNA targets is considered to be a major mechanism of action of antisense oligonucleotides.
  • a therapeutic RNA is an antisense hybrid chimera, constructed from 2'-deoxy-2'-fluoro-B-D- arabinonucleotides (FANA) flanking a defined sequence constructed from R>-D-2'- deoxyribonucleotides (DNA).
  • FANA 2'-deoxy-2'-fluoro-B-D- arabinonucleotides
  • DNA R>-D-2'- deoxyribonucleotides
  • an oligonucleotide comprises a chimera of modified arabinose and 2'-deoxy sugars.
  • Such an oligonucleotide has a general backbone composition of "[FANA WI NG]-[DNA GAP]-[FANA W1 NG]", or 5'RO (FANA-p)x-(DNA-p)y- (FANA-p)z-(FANA)3'OH, and more precisely has the general structure:
  • R is selected from the group consisting of hydrogen, thiophosphate, and a linker moiety that enhances cellular uptake of such oligonucleotide.
  • an antisense oligonucleotide or a therapeutic RNA has the formula:
  • R is selected from the group consisting of hydrogen, thiophosphate, and a linker moiety that enhances cellular uptake of such oligonucleotide
  • B is selected from the group consisting of adenine, guanine, uracil, thymine, cytosine, inosine, and 5-methylcytosine
  • Y at the internucleotide phosphate linkage is selected from the group consisting of sulfur, oxygen, methyl, amino, alkylamino, dialkylamino (the alkyl group having one to about 20 carbon atoms), methoxy, and ethoxy
  • X at the furanose ring (position 4') is selected from the groups oxygen, sulfur, and methylene (CH 2 ); and Z at the 2' position of the sugar ring is selected from the group consisting of a halogen (fluorine, chlorine, bromine, iodine), alkyl, al
  • RNA or an antisense oligonucleotide has the formula:
  • R is selected from the group consisting of hydrogen, thiophosphate, and a linker moiety that enhances cellular uptake of such oligonucleotide
  • B is selected from the group consisting of adenine, guanine, uracil, thymine, cytosine, inosine, and 5-methylcytosine.
  • R is selected from the group consisting of hydrogen, thiophosphate, and a linker moiety that enhances cellular uptake of such oligonucleotide
  • B is selected from the group consisting of adenine, guanine, uracil, thymine, cytosine, inosine, and 5-methylcytosine
  • Y at the internucleotide phosphate linkage is selected from the group consisting of sulfur, oxygen, methyl, amino, alkylamino, dialkylamino (the alkyl group having one to about 20 carbon atoms), methoxy, and ethoxy
  • X at the furanose ring (position 4') is selected from the groups oxygen, sulfur, and methylene (CH 2 )
  • Z at the 2' position of the sugar ring is selected from the group consisting of a halogen (fluorine, chlorine, bromine, iodine), hydroxyl
  • antisense oligonucleotides entirely made up of FANA units, as described in WO/1999/67378 are used in the compositions and methods of the invention.
  • an antisense oligonucleotide may comprise sugar-modified oligomers composed of P- D- arabinonucleotides (i. e., ANA oligomers) and 2'- deoxy-2'-fluoro-B-D- arabinonucleosides (i. e., 2'F-ANA oligomers), such as those described in International PCT publication no. WO/1999/67378.
  • an antisense oligonucleotide of the invention may be a nucleic acid ligand (or "aptamer") capable of forming a G- tetrad and comprising at least one arabinose modified nucleotide.
  • an arabinose modified nucleotide may be 2' -deoxy-2' - fluoroarabinonucleotide (FANA).
  • An arabinose modified nucleotide may be in the loop of the G-Tetrad or alternatively a guanosine residue of the G-tetrad.
  • an aptamer is fully substituted with arabinonucleotides.
  • an antisense RNA is a chimera constructed from 2' - deoxyribonucleotide (DNA) and 2'-deoxy-2' -fluoroarabinonucleotide (FANA).
  • an antisense RNA of the invention is an aptamer having a sugar-phosphate backbone composition selected from any combination of arabinose and deoxyribose nucleotides.
  • arabinose nucleotides are 2'-deoxy-2' -fluoroarabinonucleotide (FANA).
  • arabinonucleotide comprises a 2' substituent selected from the group consisting of fluorine, hydroxyl, amino, azido, alkyl, alkoxy, and alkoxyalkyi groups.
  • an alkyl group is selected from the group consisting of methyl, ethyl, propyl, butyl, and functionalized alkyl groups such as ethylamino, propylamino and butylamino groups.
  • an alkoxyalkyl group is selected from the group consisting of methoxyethyl , and ethoxyethyl.
  • a 2' substituent is fluorine and the arabinonucleotide is a 2'- fluoroarabinonucleotide (FANA).
  • a FANA nucleotide is araF-G and araF-T.
  • an antisense oligonucleotide of the invention is an aptamer comprising one or more internucleotide linkages selected from the group consisting of: a) phosphodiester; b) phosphotriester; c) phosphorothioate;d) methylphosphonate; e) boranophosphate; and f) any combination of (a) to (e) .
  • antisense oligonucleotides such as those described in PCT international publication no. WO/2007/038869 are used in the compositions and methods of the invention.
  • Such oligonucleotides may be nucleic acid ligands (or aptamers) capable of forming a G- tetrad and comprising at least one arabinose modified nucleotide.
  • an arabinose modified nucleotide is 2' -deoxy-2' -fluoroarabinonucleotide (FANA).
  • An arabinose modified nucleotide is preferably in the loop of the G- Tetrad or alternatively a guanosine residue of the G-tetrad.
  • an aptamer may have any number of arabinonucleotides at any location in the aptamer, for example:
  • A is an arabinonucleotide and D is a 2'- deoxyribonucleotide .
  • an aptamer is fully substituted with arabinonucleotides.
  • arabinonucleotides For example: 5' -AAAAAAAAAAAAAAA-3 ' .
  • chimeras constructed from 2' -deoxyribonucleotide (DNA) and 2'- deoxy-2' -fluoroarabinonucleotide (FANA) capable of binding DRR selectively are provided.
  • DNA 2' -deoxyribonucleotide
  • FANA 2'- deoxy-2' -fluoroarabinonucleotide
  • an antisense RNA of the invention is an aptamer of any one of sequence 5'-GGTTGGTGTGGTTGG-S', dT 2 G 4 T 2 and d [G 4 T 4 G 4 Jn, having a sugar-phosphate backbone composition selected from any combination of arabinose and deoxyribose nucleotides.
  • Arabinose nucleotides may be 2'- deoxy-2' -fluoroarabinonucleotide (FANA).
  • an arabinonucleotide comprises a 2' substituent selected from the group consisting of fluorine, hydroxyl, amino, azido, alkyl, alkoxy, and alkoxyalkyi groups.
  • an alkyl group is selected from the group consisting of methyl, ethyl, propyl, butyl, and functionalized alkyl groups such as ethylamino, propylamino and butylamino groups.
  • an alkoxyalkyi group is selected from the group consisting of methoxyethyl , and ethoxyethyl .
  • a 2' substituent is fluorine and the arabinonucleotide is a 2'- fluoroarabinonucleotide (FANA).
  • a FANA nucleotide is araF-G and araF-T.
  • an antisense RNA is an aptamer comprising one or more internucleotide linkages selected from the group consisting of: a) phosphodiester; b) phosphotriester; c) phosphorothioate; d) methylphosphonate; e) boranophosphate; and f) any combination of (a) to (e).
  • an antisense RNA is an aptamer with at least one nucleotide of the aptamer, preferably in a loop of the aptamer that forms a G-tetrad, replaced with an arabinose modified nucleotide, preferably 2'- deoxy-2'- fluoroarabinonucleotide (FANA).
  • an arabinose modified nucleotide preferably 2'- deoxy-2'- fluoroarabinonucleotide (FANA).
  • antisense oligonucleotides such as those described in WO/2003/037909 may be used in the methods and compositions of the invention.
  • such oligonucleotides have the structure: [R'-XJ a -R 2 ]a
  • an oligonucleotide comprises at least one modified deoxyribonucleotide, i.e. either R 1 , R 2 or both may comprise at least one modified deoxyribonucleotide.
  • a modified deoxyribonucleotide is selected from the group consisting of ANA, PS-ANA, PS-DNA, RNA-DNA and DNA-RNA chimeras, PS- [RNA-DNA] and PS-[DNA- RNA] chimeras, PS- [ANA-DNA] and PS-[DNA-ANA] chimeras, RNA, PS- RNA, PDE- or PS-RNA analogues, locked nucleic acids (LNA) , phosphorodiamidate morpholino nucleic acids, N3'-P5' phosphoramidate DNA, cyclohexene nucleic acid, alpha-L-LNA, boranophosphate DNA, methylphosphonate DNA, and combinations thereof.
  • an ANA is FANA (e.g. PDE- or PS-FANA).
  • PS refers to a phosphorothioate linkage.
  • PS-DNA refers to DNA with phosphorothioate linkages between nucleotides. PS-DNA is known to induce RNase H degradation of targeted RNAs and is resistant to degradation by serum and cellular nucleases.
  • PDE refers to a phosphodiester linkage.
  • the above-mentioned PDE- or PS-RNA analogues are selected from the group consisting of 2' -modified RNA wherein the 2'- substituent is selected from the group consisting of alkyl, alkoxy, alkylalkoxy, F and combinations thereof.
  • an acyclic linker is selected from the group consisting of an acyclic nucleoside and a non-nucleotidic linker.
  • an acyclic nucleoside is selected from the group consisting of purine and pyrimidine seconucleosides.
  • a purine seconucleoside is selected from the group consisting of secoadenosine and secoguanosine.
  • a pyrimidine seconucleoside is selected from the group consisting of secothymidine, secocytidine and secouridine.
  • a non-nucleotidic linker comprises a linker selected from the group consisting of an amino acid and an amino acid derivative.
  • an amino acid derivative is selected from the group consisting of (a) an N- (2-aminoethyl) glycine unit in which an heterocyclic base is attached via a methylene carbonyl linker (PNA monomer); and (b) an O-PNA unit.
  • PNA monomer methylene carbonyl linker
  • O-PNA unit an antisense oligonucleotide chimera of general structure lb:
  • AON1 is an oligonucleotide chain, which in embodiments is selected from the group consisting of ANA (e.g. FANA), DNA, PS-DNA, 5' -RNA-DNA-3' chimeras, as well as other RNase H-competent oligonucleotides, for example arabinonucleic acids (2' -OH substituted ANA) (Damha, M.J. et al . J. Am . Chem . Soc . 1998, 120, 12976), cyclohexene nucleic acids (Wang J.
  • ANA e.g. FANA
  • DNA DNA
  • PS-DNA DNA
  • 5' -RNA-DNA-3' chimeras as well as other RNase H-competent oligonucleotides, for example arabinonucleic acids (2' -OH substituted ANA) (Damha, M.J. et al . J. Am . Chem . Soc . 1998, 120
  • AON2 is an oligonucleotide chain, which in embodiments is selected from the group consisting of FANA, DNA, PS-DNA, 5'-DNA-RNA-3' chimeras, as well as other RNase H-competent oligonucleotides such as those described above, or combinations thereof.
  • Internucleotide linkages of the AON1 and AON2 include but are not necessarily limited to phosphodiester, phosphotriester, phosphorothioate, methylphosphonate, and/or phosphoramidate (5'N-3'P and 5'P-3'N) groups.
  • a substituent directly attached to the C2'-atom of the arabinose sugar in ANA-X-ANA chimera constructs includes but is not limited to fluorine, hydroxyl, amino, azido, alkyl (e.g. 2' -methyl, ethyl, propyl, butyl, etc.), and alkoxy groups (e.g., 2'-OMe, 2'-OEt, 2'-OPr, 2'-0Bu, 2'-OCH 2 CH 2 OMe, etc.).
  • oligonucleotide of the invention has the structure:
  • each of m, n, q and a are independently integers greater than or equal to 1 ; wherein each of R and R 2 are independently at least one nucleotide, wherein each of Z 1 and Z 2 are independently selected from the group consisting of an oxygen atom, a sulfur atom, an amino group and an alkylamino group;
  • each of Y 1 and Y 2 are independently selected from the group consisting of oxygen, sulfur and NH; and wherein R 3 is selected from the group consisting of H, alkyl, hydroxyalkyl, alkoxy, a purine, a pyrimidine and combinations thereof.
  • R 3 is adenine or guanine, or derivatives thereof.
  • R 3 is thymine, cytosine, 5- methylcytosine, uracil, or derivatives thereof.
  • each of R 1 and R 2 noted above are independently selected from the group consisting of ANA, PS-ANA, PS-DNA, RNA-DNA and DNA-RNA chimeras, PS- [RNA- DNA] and PS- [DNA-RNA] chimeras, PS- [ANA-DNA] and PS-[DNA-ANA] chimeras, alpha-L-LNA, cyclohexene nucleic acids, RNA, PS-RNA, PDE- or PS-RNA analogues, locked nucleic acids (LNA) , phosphorodiamidate morpholino nucleic acids, N3'-P5' phosphoramidate DNA,
  • LNA locked nucleic acids
  • each of R 1 and R 2 noted above independently may comprise at least two nucleotides connected via an internucleotide linkage, wherein said internucleotide linkage is selected from the group consisting of phosphodiester, phosphotriester, phosphorothioate, methylphosphonate, phosphoramidate (5'N-3'P and 5'P-3'N) groups and combinations thereof.
  • each of R 1 and R 2 noted above independently comprise ANA.
  • the above-noted ANA comprises a 2 ' - substituent selected from the group consisting of fluorine, hydroxyl, amino, azido, alkyl (e.g.
  • methyl, ethyl, propyl and butyl and alkoxy (e.g. methoxy, ethoxy, propoxy, and methoxyethoxy) groups.
  • a 2' - substituent is fluorine and said ANA is FANA.
  • an alkyl group is selected from the group consisting of methyl, ethyl, propyl and butyl groups.
  • an alkoxy group is selected from the group consisting of methoxy, ethoxy, propoxy, and methoxyethoxy groups .
  • oligonucleotide of the invention targeting DRR is selected from the group consisting of:
  • R 1 , R 2 , n, a, Z 1 , Z 2 , Y 1 and Y 2 are as defined above and each of R 4 and R 5 are independently selected from the group consisting of a purine (e.g. adenine and guanine or derivatives thereof) and a pyrimidine (e.g.
  • R 1 is PDE- [RNA-DNA]
  • R 2 is PDE- [DNA- RNA]
  • a l.
  • R 1 is RNA
  • R 2 is [DNA-RNA]
  • a l.
  • R 1 is S- [ (2'0-alkyl) RNA-DNA]
  • R 2 is S-[DNA- (20- alkyl)RNA]
  • a l.
  • R 1 is S- [ (2'0-alkyl) RNA-DNA]
  • R 1 is S- [ (2' O- alkoxyalkyl) RNA-DNA] ;
  • R 1 is S- [ (2' O-alkoxyalkyl) RNA-DNA] ;
  • R 1 is PS- [ (2' O-alkoxyalkyl-RNA) -DNA] ;
  • R 1 is PS-[DNA];
  • R 1 is PDE- [DNA];
  • oligonucleotide has structure lie in which Y 1 , Y 2 are oxygen; Z 1 , Z 2 are both oxygen or sulfur.
  • R 1 is PS- [FANA];
  • R 1 is PDE- [FANA];
  • a 2 and each of R 1 and R 2 independently consist of at least 3 nucleotides, in a further embodiment, of 3- 8 nucleotides.
  • a 3 and each of R 1 and R 2 independently consist of at least 2 nucleotides, in a further embodiment, wherein each of R 1 and R 2 independently consist of 2-6 nucleotides.
  • the oligonucleotide is antisense to a target RNA.
  • RNA interference or “RNAi” is a term initially applied to a phenomenon observed in plants and worms where double-stranded RNA (dsRNA) blocks gene expression in a specific and post-transcriptional manner.
  • RNAi provides a useful method of inhibiting gene expression in vitro or in vivo.
  • RNAi involves using small interfering RNA, or siRNA, to target an mRNA sequence.
  • siRNA small interfering RNA
  • RISC protein complex
  • therapeutic RNA relates to oligonucleotides and similar species, for use in reducing or inhibiting DRR expression.
  • therapeutic RNAs include antisense RNAs, RNAi, siRNA, dsRNA, shRNA, and other like RNAs, as are known in the art to reduce expression of a target RNA; in an embodiment, a target RNA is DRR mRNA or a fragment or portion thereof.
  • RNA interfering agents that perform gene knockdown of message (mRNA) by degradation or translational arrest of the mRNA, e.g., inhibition of tRNA and rRNA functions
  • small interfering RNA siRNA
  • shRNA short hairpin RNA
  • microRNA non-coding RNA and the like
  • Short RNAs Dicer-substrate siRNAs (DsiRNAs); UsiRNAs; Self-delivering RNA (sdRNA); siNA; nucleotide based agents inhibiting the pre-mRNA maturation step of polyA tail addition; Ul adaptors; aptamers; triple-helix formation; DNAzymes; antisense; Morpholinos (e.g., PMO, phosphorodiamidate morpholino oligo); ribozymes; and combinations thereof.
  • RNA interfering agents that perform gene knockdown of message (mRNA) by degradation or translational arrest of the mRNA, e.g., inhibition of tRNA and rRNA functions
  • a therapeutic RNA encompasses oligonucleotides which specifically hybridize with one or more nucleic acid molecules encoding DRR or a portion or fragment thereof.
  • oligonucleotides comprising the sequence of SEQ ID NO: 1 , 2, 5, 6, 7, 8, 9, 10, 14, 15, 16, 17/18, 19/20, 21/22 or 23/24, or a fragment or derivative thereof, are encompassed.
  • a therapeutic RNA of the invention is an oligonucleotide which is complementary to or specifically hybridizes with a fragment or portion of the DRR mRNA.
  • a fragment or portion of DRR mRNA to which a therapeutic RNA is complementary or specifically hybridizes include the following: nucleotides 170-190 of the DRR mRNA; nucleotides 175-195 of the DRR mRNA; nucleotides 180-200 of the DRR mRNA; nucleotides 185-205 of the DRR mRNA; nucleotides 190-210 of the DRR mRNA; nucleotides 195-215 of the DRR mRNA; nucleotides 200- 220 of the DRR mRNA; nucleotides 205-225 of the DRR mRNA; nucleotides 210-230 of the DRR mRNA; nucleotides 215-235 of the DRR mRNA; nucleotides 220-240 of the DRR
  • a therapeutic RNA has a sequence complementary to or specifically hybridizing to nucleotides 425 to 439 of the DRR mRNA, or complementary to or specifically hybrizing to nucleotides 420 to 444 of the DRR mRNA, or complementary to or specifically hybrizing to nucleotides 415 to 439 of the DRR mRNA, or complementary to or specifically hybrizing to nucleotides 424 to 439 of the DRR mRNA, 423 to 439, 422 to 439, 421 to 439, or 420 to 439, or 420 to 434 of the DRR mRNA; or a fragment, portion or derivative thereof.
  • nucleic acids hybridizing to an additional 1 to 3 nucleotides at either end or to a smaller fragment or to a derivative of the recited sequences and regions are also encompassed.
  • nucleic acid sequences may include extra nucleotides required for function of a therapeutic RNA molecule, such as those required to form a short hairpin loop.
  • a therapeutic RNA of the invention is an antisense oligonucleotide which has the structure of an altimer, a gapmer, an aptamer, and/or comprises one or more modified nucleotide such as 2' - deoxy-2' -fluoroarabinonucleotide (FANA), as described herein.
  • FANA 2' - deoxy-2' -fluoroarabinonucleotide
  • RNA tools DNA molecules encoding a therapeutic RNA of the invention and expression vectors suitable for production of therapeutic RNAs of the invention are also provided.
  • Therapeutic RNAs are also referred to as "RNA tools" herein.
  • dsRNA relates to double stranded RNA capable of causing RNA interference.
  • any suitable double-stranded RNA fragment capable of directing RNAi or RNA-mediated gene silencing of the target gene can be used.
  • double-stranded ribonucleic acid molecule refers to any RNA molecule, fragment or segment containing two strands forming an RNA duplex, notwithstanding the presence of single stranded overhangs of unpaired nucleotides.
  • a double-stranded RNA comprises annealed complementary strands, one of which has a nucleotide sequence which corresponds to the target nucleotide sequence (i.e. to at least a portion of the mRNA transcript) of the target gene to be down- regulated.
  • the other strand of the double-stranded RNA is complementary to the target nucleotide sequence.
  • a double-stranded RNA need only be sufficiently similar to a mRNA sequence of the target gene to be down-regulated such that it has the ability to mediate RNAi.
  • the invention has the advantage of being able to tolerate sequence variations that might be expected due to genetic mutation, strain polymorphism or evolutionary divergence.
  • the number of tolerated nucleotide mismatches between the target sequence and a nucleotide sequence of a dsRNA sequence is no more than 1 in 5 basepairs, or 1 in 10 basepairs, or 1 in 20 basepairs, or 1 in 50 basepairs.
  • a "dsRNA” or “double stranded RNA”, whenever said expression relates to RNA that is capable of causing interference, may be formed from two separate (sense and antisense) RNA strands that are annealed together.
  • An antisense (or “guide”) strand is a strand that is complementary to the mRNA
  • a sense (or “passenger”) strand of a siRNA duplex has a sequence that is complementary to the guide or antisense strand (and identical to a region of an mRNA strand).
  • a dsRNA may have a foldback stem-loop or hairpin structure wherein the two annealed strands of the dsRNA are covalently linked.
  • sense and antisense strands of a dsRNA are formed from different regions of a single RNA sequence that is partially self- complementary.
  • RNAi molecule is a generic term referring to double stranded RNA molecules including small interfering RNAs (siRNAs), hairpin RNAs (shRNAs), and other RNA molecules which can be cleaved in vivo to form siRNAs.
  • RNAi molecules can comprise either long stretches of dsRNA identical or substantially identical to the target nucleic acid sequence or short stretches of dsRNA identical or substantially identical to only a region of the target nucleic acid sequence.
  • RNAi molecules can be "small interfering RNAs" or "siRNAs.”
  • siRNA molecules are usually synthesized as double stranded molecules in which each strand is around 19-32 nucleotides in length, or around 21 -31 nucleotides in length, or around 21 to 23 nucleotides in length, or around 23 to 29 nucleotides in length, or around 29 nucleotides in length.
  • siRNAs are understood to recruit nuclease complexes and guide the complexes to a target mRNA by pairing to the specific sequences. As a result, the target mRNA is degraded by the nucleases in the protein complex.
  • siRNA molecules comprise a 3' hydroxyl group.
  • siRNA constructs can be generated by processing of longer double-stranded RNAs, for example, in the presence of the enzyme dicer.
  • RNAi molecule is in the form of a hairpin structure, named as hairpin RNA or shRNA.
  • Hairpin RNAs can be synthesized exogenously or can be formed by transcribing from RNA polymerase III promoters in vivo.
  • hairpin RNAs are engineered in cells or in an animal to ensure continuous and stable suppression of a desired gene. It is known in the art that siRNAs can be produced by processing a hairpin RNA in the cell.
  • RNAi molecules may include modifications to either the phosphate- sugar backbone or the nucleoside, e.g., to reduce susceptibility to cellular nucleases, improve bioavailability, improve formulation characteristics, and/or change other pharmacokinetic properties.
  • At least one strand of an RNAi molecule has a 3' overhang from about 1 to about 6 nucleotides in length, and for instance from 2 to 4 nucleotides in length. More preferably, 3' overhangs are 1 -3 nucleotides in length. In certain embodiments, one strand has a 3' overhang and the other strand is blunt-ended or also has an overhang. The length of the overhangs may be the same or different for each strand. In order to further enhance stability of the RNAi molecules, 3' overhangs can be stabilized against degradation. In one embodiment, an RNA is stabilized by including purine nucleotides, such as adenosine or guanosine nucleotides.
  • substitution of pyrimidine nucleotides by modified analogues e.g., substitution of uridine nucleotide 3' overhangs by 2'-deoxythymidine is tolerated and does not affect the efficiency of RNAi.
  • RNAi molecules can be carried out by chemical synthetic methods or by recombinant nucleic acid techniques. RNAi molecules may be produced enzymatically or by partial/total organic synthesis. Any modified ribonucleotide can be introduced by in vitro enzymatic or organic synthesis.
  • RNAi molecules can be purified using a number of techniques known to those of skill in the art. For example, gel electrophoresis can be used to purify RNAi molecules. Alternatively, non-denaturing methods, such as non- denaturing column chromatography, can be used to purify RNAi molecules. In addition, chromatography (e.g., size exclusion chromatography), glycerol gradient centrifugation, and/or affinity purification with antibody can be used to purify RNAi molecules. Nucleic Acids, RNAi Molecules and Expression Constructs
  • the invention is in one aspect related to use of a nucleic acid sequence (e.g. a therapeutic RNA, a DNA encoding same, or a vector producing same) to prepare an antisense RNA or RNAi molecule suitable for reducing expression of a target gene, e.g. DRR, in tumor cells, e.g. glioma cells.
  • a nucleic acid sequence e.g. a therapeutic RNA, a DNA encoding same, or a vector producing same
  • an antisense RNA or RNAi molecule suitable for reducing expression of a target gene e.g. DRR
  • tumor cells e.g. glioma cells.
  • reducing the expression of a target gene refers to the ability of a present therapeutic RNA, e.g. antisense, RNAi or other therapeutic molecules, to block expression of the target gene in a specific and post-transcriptional manner.
  • RNA sequence to prepare a therapeutic RNA molecule as defined herein.
  • a RNA molecule is an RNAi molecule, such as a siRNA molecule.
  • Said therapeutic RNA molecule is characterized by one or more, and in one embodiment by all, of the following criteria: having at least 50% sequence identity, or at least 70% sequence identity, or at least 80% sequence identity, or at least 90% sequence identity with the target mRNA; having a sequence which targets the exon area of the target gene; and/or showing a preference for targeting the 3' end of the target gene rather than for targeting the 5' end of the target gene.
  • a target gene is DRR or a fragment of the gene encoding DRR.
  • a therapeutic RNA molecule may be further characterized by one or more, or by all, of the following criteria: having a nucleic acid length of between 15 to 25 nucleotides, or of between 18 to 22 nucleotides, or of 19 nucleotides, or of between 19 to 33 nucleotides, 21 to 31 nucleotides, or of 29 nucleotides; or of 13 to 17 nucleotides, having a GC content comprised between 30 and 50%; showing a TT(T) sequence at its 3' end; showing no secondary structure when adopting the duplex form; having a Tm (melting temperature) of lower than 20° C; or having the nucleotides indicated in SEQ ID NOs: 1 , 2, 5 -10, 14-16, 17/18, 19/20, 21 /22 or 23/24 (nucleotide sequences are given in Table 1 ; "nt” stands for nucleotide).
  • a therapeutic RNA molecule has a nucleic acid length of between 15 to
  • a therapeutic RNA comprises 15 nucleotides complementary to DRR mRNA with additional nucleotides necessary to improve function as a therapeutic RNA, such as sequences which facilitate creation of a short hairpin loop in the therapeutic nucleic acid or RNA.
  • a therapeutic nucleic acid molecule has the sequence of SEQ ID NO: 1 or 2.
  • a therapeutic nucleic acid molecule has a sequence complementary to or specifically hybrizing to nucleotides 425 to 439 of the DRR mRNA, or complementary to or specifically hybrizing to nucleotides 420 to 444 of the DRR mRNA or a fragment or derivative thereof, or complementary to or specifically hybrizing to nucleotides 415 to 439 of the DRR mRNA or a fragment or derivative thereof, or complementary to or specifically hybrizing to nucleotides 424 to 439 of the DRR mRNA, 423 to 439, 422 to 439, 421 to 439, or 420 to 439, or 420 to 434 of the DRR mRNA.
  • nucleic acids hybridizing to an additional 1 to 3 nucleotides at either end or to a smaller fragment or derivative of the recited sequences are also encompassed.
  • nucleic acid sequences may include extra nucleotides required for function of the therapeutic RNA molecule, such as those required to form a short hairpin loop.
  • a therapeutic RNA of the invention comprises the sequences provided herein, for example SEQ ID NOs: 1 , 2, 5 - 10, 14-16, 17/18, 19/20, 21 /22 or 23/24.
  • a therapeutic RNA of the invention consists of the sequences provided herein, for example SEQ ID NOs: 1 , 2, 5 - 10, 14-16, 17/18, 19/20, 21 /22 or 23/24.
  • a therapeutic RNA of the invention has the sequence of SEQ ID NO: 14, 15 or 16. In yet another embodiment, a therapeutic RNA of the invention has the sequence of SEQ ID NO: 17/18, 19/20, 21 /22 or 23/24.
  • p means 5' phosphate
  • uppercase indicates RNA and lowercase indicates DNA
  • S indicates sense strand
  • AS indicated antisense strand.
  • FRNA also referred to as 2'F-RNA
  • siRNAs are generally duplexes of two strands, a sense strand and an antisense strand; both strands are listed in Table 1 .
  • siRNAI siRNA duplex targeting DRR referred to herein as "siRNAI " is a duplex of SEQ ID NOs: 17 and 18, where SEQ ID NO: 17 is the sense strand and SEQ ID NO: 18 is the antisense strand.
  • the siRNAI duplex is also referred to herein as “SEQ ID NO: 17/18", and "DRR1 siRNA”.
  • siRNA2 is a duplex of SEQ ID NOs: 19 and 20, where SEQ ID NO: 19 is the sense strand and SEQ ID NO: 20 is the antisense strand.
  • the siRNA2 duplex is also referred to herein as “SEQ ID NO: 19/20” and “DRR2 siRNA”.
  • siRNA2-Cy5 is a duplex of SEQ ID NOs: 21 and 22, where SEQ ID NO: 21 is the sense strand and SEQ ID NO: 22 is the antisense strand.
  • the siRNA2-Cy5 duplex is also referred to herein as "SEQ ID NO: 21/22".
  • siRNA3 is a duplex of SEQ ID NOs: 23 and 24, where SEQ ID NO:
  • siRNA3 duplex is also referred to herein as "SEQ ID NO: 23/24" and "DRR3 siRNA”.
  • the "siRNA control sequence" in Table 1 is an siRNA which does not target DRR.
  • the siRNA control sequence is a duplex of SEQ I D NOs: 25 and 25, where SEQ ID NO: 25 is the sense strand and SEQ ID NO: 26 is the antisense strand.
  • the siRNA control sequence duplex is also referred to herein as "SEQ ID NO: 25/26” and “DRR4 siRNA” and "siRNA4".
  • Effective antisense sequences targeting DRR were designed using an antisense oligonucleotide (AON) sequence selection tool available from Integrated DNA Technologies (IDT®)
  • the invention is related to the use of an RNA sequence containing any of the following sequences: SEQ ID NO: 1 , 2, 5, 6, 7, 8, 9, 10, 14, 15, 16, 17/18, 19/20, 21/22 or 23/24, or a fragment or derivative thereof, to prepare a therapeutic RNA molecule, for example an antisense or RNAi molecule, suitable for reducing expression of DRR in glioma cells.
  • “derivative” refer to nucleic acids that may differ from the original nucleic acid in that they are extended or shortened on either the 5' or the 3' end, on both ends or internally, or extended on one end, and shortened on the other end, provided that the function of the resulting molecule, namely down-regulation of a target gene, is not abolished or inhibited.
  • fragment and “derivative” also refer to nucleic acids that may differ from an original nucleic acid in that one or more nucleotides of the original sequence are substituted by other nucleotides and/or (chemically) modified by methods available to a skilled person, provided that function of the resulting molecule is not abolished or inhibited.
  • fragment and “derivative” may typically show at least 80%, e.g., at least 85%, at least 90%, at least 95% or even at least 99% sequence identity to the original nucleic acid.
  • Sequence identity between two nucleotide sequences can be calculated by aligning the said sequences and determining the number of positions in the alignment at which the two sequences contain the same nucleic acid base vs. the total number of positions in the alignment.
  • nucleic acid sequences in Table 1 which retain an ability to reduce or decrease DRR expression are encompassed.
  • nucleic acid sequences comprising about 12, about 13, about 14, about 15, about 16, about 17, about 18 or about 19 contiguous nucleotides from sequences given in Table 1 , and retaining an ability to reduce/decrease DRR expression, are encompassed.
  • any of the above- given sequences or complementary sequences thereof may be used to prepare a therapeutic RNA molecule, e.g. an antisense or RNAi molecule, for example a double stranded RNA molecule.
  • a person of skill in the art knows how to prepare an antisense or RNAi molecule when the above disclosed nucleic acids, particularly RNAs, are provided. Briefly, required nucleic acids may be synthesized by any available method and strands annealed, as required, under appropriate conditions. Annealing conditions, e.g. temperatures and incubation periods, may be adjusted according to the respective nucleic acid sequences.
  • the invention relates to the use of an RNA sequence containing the sequence of SEQ ID NO: 1 , 2, 5, 6, 7, 8, 9, 10, 14, 15, 16, 17/18, 19/20, 21/22 or 23/24, a fragment or derivative thereof, to prepare a therapeutic RNA molecule, such as an RNAi molecule, and preferably an siRNA molecule.
  • a therapeutic RNA molecule such as an RNAi molecule, and preferably an siRNA molecule.
  • the invention relates to the use of an RNA sequence containing the sequence of SEQ ID NO: 1 , 2, 5, 6, 7, 8, 9, 10, 14, 15, 16, 17/18, 19/20, 21/22 or 23/24, or a fragment or derivative thereof, to prepare an antisense molecule.
  • RNAs antisense, RNAi molecules, siRNA and so on
  • target cells e.g., human GBM cells.
  • nucleic acid can be directly injected into a target cell/target tissue.
  • Other methods include fusion of a recipient cell with bacterial protoplasts containing a nucleic acid, use of compositions like calcium chloride, rubidium chloride, lithium chloride, calcium phosphate, DEAE dextran, cationic lipids or liposomes or methods like receptor-mediated endocytosis, biolistic particle bombardment ("gene gun” method), infection with viral vectors, electroporation, and the like.
  • RNAi molecules as defined herein include continuous delivery of an RNAi molecule as defined herein from poly(lactic-Co-Glycolic Acid) polymeric microspheres or the direct injection of protected (stabilized) RNAi molecule(s) into micropumps delivering the product in the cavity of surgical resection to tumor cells still present at a site of surgery, e.g., in a hole of neurosurgical resection to tumor cells still present in the brain parenchyma, as has been detailed previously for the use of other anti-migratory compounds (see for example Lefranc et al., Neurosurgery 52: 881 -891 , 2003).
  • RNAi molecules as defined herein
  • Another possibility is use of implantable drug-releasing biodegradable microspheres, as those reviewed by Menei and Benoit, Acta Neurochir 88:51 -55, 2003. It shall be clear that also a combination of different above-mentioned delivery modes or methods may be used.
  • Another approach is to use either an Ommaya reservoir (micropumps) delivering RNA molecules versus encapsulated RNA molecules in biodegradable microspheres, or both approaches at the same time.
  • RNA silencing with therapeutic RNAs, such as antisense and RNAi technologies, is delivery.
  • therapeutic RNAs such as antisense and RNAi technologies
  • thermal stability resistance to nuclease digestion and to enhance cellular uptake of the RNAs, various approaches have been tested in the art.
  • RNAi RNA tools in various types of liposomes (immunoliposomes, PEGylated (immuno) liposomes), cationic lipids and polymers, nanoparticules or dendrimers, poly(lactic-Co-Glycolic Acid) polymeric microspheres, implantable drug-releasing biodegradable microspheres, co-injection of the RNAi tools with a protective agent, and so on. It shall be understood that these methods and others known in the art may be used in the methods of the present invention.
  • RNA tools of the present invention are delivered at a site of a tumor, e.g., a primary tumor and/or metastases.
  • a site of a tumor e.g., a primary tumor and/or metastases.
  • a manner of achieving localized delivery is use of an Ommaya reservoir as described elsewhere.
  • Another way of targeting present RNA tools to tumor cells is to use antibody- directed, cell type-specific delivery.
  • RNAi e.g., siRNA
  • Fab specifically recognizing tumor cells, such as Fab- protamine-complexed (Song et al., Nat Biotechnol 23:709-717, 2005), or RNAi may be encapsulated in immunoliposomes.
  • Such antibody-targeted RNAi tools e.g. , in the form of nanoparticles, can be administrated by various means, such as systemic administration (i.v. injection, subcutaneous injection, intramuscular injection, oral administration, nasal inhalation, etc.) or locally, e.g., using an Ommaya reservoir.
  • systemic administration i.v. injection, subcutaneous injection, intramuscular injection, oral administration, nasal inhalation, etc.
  • locally e.g., using an Ommaya reservoir.
  • convection delivery with injection at a remote date or at time of surgery may be used.
  • Inhalative administration of the present RNA tools e.g., in the form of nasal sprays or aerosol mixtures, may also be employed.
  • Another option is use of nanotechnology for delivery.
  • RNA tools In vivo delivery of RNA tools has been described, e.g., intravenous, intracerebroventricular or intranasal administration of naked or lipid- encapsulated siRNA molecules. Intravenous administration of shRNA vectors encapsulated in immunoliposomes or in viral particles have also been described and are known in the art.
  • RNAi molecule i.e. reduction of expression of a target gene
  • a nucleic acid preferably a DNA, encoding a respective target RNA molecule
  • a DNA is transcribed into the corresponding RNA which is capable of forming the desired antisense or RNAi molecule.
  • expression constructs are provided to facilitate introduction into a host cell and/or facilitate expression and/or facilitate maintenance of a nucleotide sequence encoding therapeutic RNA molecules according to the invention.
  • Expression constructs may be inserted into a plasmid, a virus, or a vector, which may be commercially available.
  • the invention therefore relates to the use of a DNA sequence to prepare an RNA molecule as defined herein.
  • DNA sequences may comprise DNA sequences which correspond to or encode RNA sequences depicted in SEQ ID NOs: 1 , 2, 5, 6, 7, 8, 9, 10, 14, 15, 16, 17/18, 19/20, 21/22 or 23/24, a linker, and a sequence complementary to the DNA.
  • a linker is preferably 4 to 15 nucleotides in length, more preferably a linker is 4 to 10 nucleotides long and most preferably it is 4 to 8 nucleotides long.
  • a linker can consist of any suitable nucleotide sequence.
  • DNA sequences consist of 15 nt sequences derived from the DRR gene which are separated by a 4 to 15 nucleotide linker, from the reverse complement of the same 15 nt sequences and showing an tt(t) sequence at its 3' end.
  • DNA sequences are inserted into an expression vector suitable for use in the methods provided herein.
  • Expression vectors capable of giving rise to transcripts which form dsRNA as defined herein, can for instance be cloning vectors, binary vectors or integrating vectors.
  • the invention thus also relates to a vector comprising any of the DNA sequences described herein.
  • the expression vector is preferably a eukaryotic expression vector, or a retroviral vector, a plasmid, bacteriophage, or any other vector typically used in the biotechnology field. Such vectors are known to a person skilled in the art.
  • a DNA nucleic acid can be operatively linked to regulatory elements which direct synthesis of mRNA in eukaryotic cells.
  • these vectors usually contain an RNA Polymerase I, an RNA Polymerase II, an RNA Polymerase III, T7 RNA polymerase or SP6 RNA polymerase and preferably RNA polymerase III promoters, such as the H1 or U6 promoter, since RNA polymerase III expresses relatively large amounts of small RNAs in mammalian cells and terminates transcription upon incorporating a string of 3-6 uridines.
  • Type III promoters lie completely upstream of the sequence being transcribed which eliminates any need to include promoter sequence in the therapeutic RNA molecule.
  • the preferred DNA thus contains on each of its strands the desired coding region of the target gene and its reverse complementary sequence, wherein the coding and its reverse complementary sequences are separated by a nucleotide linker, allowing for the resulting transcript to fold back on itself to form a so-called stem-loop structure, and to form so-called shRNA molecules.
  • the shRNA is transcribed from specific promoters, processed by the DICER RNAse into short double stranded RNA (siRNA) and incorporated into RISC (Dykxhoorn et al., Nat Rev Mol Cell Biol 4:457- 467, 2003) with subsequent inactivation of the targeted mRNA.
  • RISC short double stranded RNA
  • transcription termination sequences may also be incorporated in the expression vector.
  • transcription termination sequence encompasses a control sequence at the end of a transcriptional unit, which signals 3' processing and poly-adenylation of a primary transcript and termination of transcription. Additional regulatory elements, such as transcriptional or translational enhancers, may be incorporated in an expression construct.
  • retroviral vectors For therapeutic purposes, use of retroviral vectors has been proven to be most appropriate to deliver a desired nucleic acid into a target cell. It shall be understood that retroviral vectors or adenoviral vectors, of which many are known in the art, may also be used in the vectors, compositions and methods provided herein. It shall also be understood that expression vectors containing DNA sequences of the present invention can be introduced into a target cell by any of the delivery methods described above or otherwise known in the art. Uses, Compositions and Kits
  • Therapeutic RNA molecules e.g. antisense RNA or RNAi, e.g. siRNA molecules, and/or vectors according to the present invention may be used as a medicament for treating cancer, preferably glioma, more preferably glioblastoma, or for the manufacture of a medicament for treating cancer, preferably glioma, more preferably glioblastoma.
  • Therapeutic RNA molecules and/or vectors according to the present invention may also be used as a medicament for delaying progression of cancer, for example glioma, such as glioblastoma.
  • RNA molecules and/or vectors according to the present invention may be used to inhibit brain cancer invasion, for example malignant glial cell (MGC) invasion.
  • MMC malignant glial cell
  • therapeutic RNA molecules e.g., antisense RNA or RNAi, e.g., siRNA molecules, and/or vectors according to the present invention are used as a medicament for treating any cancer having an invasive phenotype and/or characterized by increased DRR expression.
  • any cancer or tumor which is invasive or metastatic, and/or which has elevated DRR expression levels compared to non-cancerous cells, is contemplated for treatment with the therapeutic RNA molecules and/or vectors of the invention.
  • therapeutic RNA molecules and/or vectors according to the present invention are used as a medicament for treating breast cancer, e.g., metastatic breast carcinoma, prostate cancer, e.g., metastatic prostate carcinoma, and/or skin cancer, e.g., metastatic squamous cell carcinoma.
  • therapeutic RNA molecules and/or vectors according to the present invention are used as a medicament for treating lung cancer, renal cancer, and/or colon cancer.
  • Akt activation has been associated with many different cancers including, for example, breast cancer, prostate cancer, skin cancer, melanoma, pancreatic cancer, ovarian cancer, colorectal cancer, lung cancer, colon cancer, and renal cancer (see, e.g.,Cariao and Park, J. Mammary Gland Biol. Neoplasia, 2012; Arker et al., Clin. Cancer Res., 15: 4799-4805,2009; deSouza et al., Curr. Cancer Drug Targets, 9: 163-175, 2009; Davies, Cancer J. 18: 142-147, 2012; Gaikwad and Ray, Am. J. Nucl. Med. Mol.
  • Akt, and PI3K/Akt pathways in general, are widely accepted targets for cancer therapeutics.
  • DRR expression increases the rate at which Akt activation has been implicated in pathogenesis of the disease.
  • therapeutic RNA molecules and/or vectors according to the present invention may be used as a medicament for treating cancers or tumors associated with Akt activation, such as, for example, metastatic or invasive breast carcinoma, prostate carcinoma, squamous cell carcinoma, lung carcinoma, renal cell carcinoma, or colon carcinoma.
  • Akt phosphorylation and/or activation is inhibited by therapeutic RNA molecules and/or vectors and methods of the invention.
  • tumor or cancer cell invasiveness is inhibited by therapeutic RNA molecules and/or vectors and methods of the invention.
  • cancer progression is delayed or inhibited.
  • metastasis is inhibited.
  • RNA molecules and/or vectors according to the present invention may be used alone or in combination with other cancer therapies.
  • other cancer therapies include resection of the cancer, chemotherapy, radiation therapy, immunotherapy, and/or gene- based therapy.
  • resection refers to surgical removal or excision of part or all of a tumor.
  • radiation therapy refers to treatment of cancer using radiation.
  • chemotherapy refers to treatment of cancer with chemical substances, so-called chemotherapeutics.
  • immunotherapeutics refers to stimulation of reactivity of the immune system towards eliminating cancer cells by using immunotherapeutics.
  • gene-based therapy refers to treatment of cancer based upon transfer of genetic material (DNA, or possibly RNA) into an individual.
  • cancer therapies include: chemotherapeutics including but not limited to temozolomide, vincristine, vinorelbine, procarbazine, carmustine, lomustine, taxol, taxotere, tamoxifen, retinoic acid, 5-fluorouracil, cyclophosphamide and thalidomide; immunotherapeutics such as but not limited to activated T cells and pulsed dendritic cells; gene transfer of CD3, CD7 and CD45 in glioma cells, concomitantly with delivery of an RNA molecule as defined herein.
  • RNA molecules and/or vectors according to the present invention may be administered alone or in combination with one or more additional cancer therapy.
  • the latter can be administered before, after or simultaneously with administration of RNA molecules and/or expression vectors.
  • a further object of the present invention are pharmaceutical preparations which comprise a therapeutically effective amount of an antisense or RNAi molecule and/or expression vector of the invention and a pharmaceutically acceptable carrier.
  • therapeutically effective amount means that amount of RNA molecule(s) and/or expression vector(s) that elicits a biological or medicinal response in a tissue, system, animal or human that is being sought by a researcher, veterinarian, medical doctor or other clinician.
  • the invention therefore relates to a pharmaceutical composition for treatment of cancer, preferably glioma, and more preferably glioblastoma, comprising an RNA molecule and/or expression vector according to the invention, and a pharmaceutically acceptable carrier.
  • the invention relates to a pharmaceutical composition for delay of progression of cancer, preferably glioma, and more preferably glioblastoma, comprising an RNA molecule and/or expression vector according to the invention, and a pharmaceutically acceptable carrier.
  • the invention relates to a pharmaceutical composition for inhibition of cancer invasion, preferably glioma, and more preferably glioblastoma, comprising an RNA molecule and/or expression vector according to the invention, and a pharmaceutically acceptable carrier.
  • the invention relates to a pharmaceutical composition for inhibition of malignant glial cell (MGC) invasion.
  • MMC malignant glial cell
  • the invention relates to a pharmaceutical composition for treatment of a metastatic or invasive cancer, such as breast carcinoma, prostate carcinoma, squamous cell carcinoma, lung carcinoma, colon carcinoma, colorectal carcinoma, or renal cell carcinoma.
  • a pharmaceutical composition for inhibition of Akt phosphorylation or activation in a cancer or tumor cell in an embodiment, relates to a pharmaceutical composition for inhibition of Akt phosphorylation or activation in a cancer or tumor cell.
  • the pharmaceutical composition according to the invention may further comprise at least one additional cancer therapeutic, as discussed above.
  • the pharmaceutical composition according to the invention can be administered orally, for example in the form of pills, tablets, lacquered tablets, sugar-coated tablets, granules, hard and soft gelatin capsules, aqueous, alcoholic or oily solutions, syrups, emulsions or suspensions, or rectally, for example in the form of suppositories. Administration can also be carried out parenterally, for example subcutaneously, intramuscularly or intravenously in the form of solutions for injection or infusion.
  • Suitable administration forms are, for example, percutaneous or topical administration, for example in the form of ointments, tinctures, sprays or transdermal therapeutic systems, or inhalative administration in the form of nasal sprays or aerosol mixtures, or, for example, microcapsules, implants or wafers.
  • compositions can be carried out as known in the art.
  • a therapeutic RNA and/or an active compound together with one or more solid or liquid pharmaceutical carrier substances and/or additives (or auxiliary substances) and, if desired, in combination with other pharmaceutically active compounds having therapeutic or prophylactic action, are brought into a suitable administration form or dosage form which can then be used as a pharmaceutical in human medicine.
  • compositions can also contain additives, of which many are known in the art, for example fillers, disintegrants, binders, lubricants, wetting agents, stabilizers, emulsifiers, dispersants, preservatives, sweeteners, colorants, flavorings, aromatizers, thickeners, diluents, buffer substances, solvents, solubilizers, agents for achieving a depot effect, salts for altering the osmotic pressure, coating agents or antioxidants.
  • additives of which many are known in the art, for example fillers, disintegrants, binders, lubricants, wetting agents, stabilizers, emulsifiers, dispersants, preservatives, sweeteners, colorants, flavorings, aromatizers, thickeners, diluents, buffer substances, solvents, solubilizers, agents for achieving a depot effect, salts for altering the osmotic pressure, coating agents or antioxidants.
  • a carrier includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible.
  • a carrier is suitable for parenteral administration.
  • a carrier may be suitable for intravenous, intraperitoneal, intramuscular, sublingual or oral administration.
  • Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in pharmaceutical compositions of the invention is contemplated. Supplementary active compounds can also be incorporated into compositions.
  • compositions typically must be sterile and stable under the conditions of manufacture and storage.
  • a composition can be formulated as a solution, microemulsion, liposome, or other ordered structure suitable to high drug concentration.
  • a carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof.
  • Proper fluidity can be maintained, for example, by use of a coating such as lecithin, by maintenance of a required particle size in the case of dispersion and by use of surfactants.
  • an oligonucleotide of the invention can be administered in a time release formulation, for example in a composition which includes a slow release polymer.
  • a modified oligonucleotide can be prepared with carriers that will protect the modified oligonucleotide against rapid release, such as a controlled release formulation, including implants and microencapsulated delivery systems.
  • Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, polylactic acid and polylactic, polyglycolic copolymers (PLG) .
  • Sterile injectable solutions can be prepared by incorporating an active compound, such as a therapeutic RNA or an oligonucleotide of the invention, in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
  • dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above.
  • preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of an active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • Therapeutic RNAs and oligonucleotides of the invention may also be formulated with one or more additional compounds that enhance their solubility.
  • a dosage or amount of a therapeutic RNA and/or expression vector used, alone or in combination with one or more active compounds to be administered, depends on an individual case and is, as is customary, to be adapted to individual circumstances to achieve an optimum effect. Thus, it depends on the nature and the severity of the disorder to be treated, and also on the sex, age, weight and individual responsiveness of the human or animal to be treated, on the efficacy and duration of action of the compounds used, on whether the therapy is acute or chronic or prophylactic, or on whether other active compounds are administered in addition to the therapeutic RNA and/or expression vector. It shall be understood that dosing and administration regimens are within the purview of the skilled artisan.
  • the invention provides a kit comprising a RNA therapeutic or expression vector or a pharmaceutical composition according to the invention, and instructions for use thereof.
  • therapeutic benefits of knocking-down and thus significantly reducing DRR expression in tumor cells may be mediated by inhibiting invasion of a tumor into the brain, for example by inhibiting malignant glial cell (MGC) invasion, so as to reduce or delay cancer invasion into adjacent healthy tissues (e.g., the brain in the case of glioma), based on our novel and unexpected findings that DRR is highly expressed in an invasive component of malignant gliomas and drives MGC invasion in both in vivo and in vitro invasion assays.
  • MMC malignant glial cell
  • therapeutic benefits of reducing DRR expression in tumor cells may be mediated by inhibiting invasion of a tumor into other tissues, for example by inhibiting metastasis of breast, prostate, squamous cell, lung, colon or renal cancer, or in any cancer associated with upregulation of DRR expression and/or Akt phosphorylation or activation.
  • DRR renal cell carcinoma
  • DRR is a novel actin/MT crosslinker that regulates FA disassembly.
  • DRR localizes to the actin cytoskeleton and FAs and interacts with the LC2 subunit MAPI A.
  • DRR expression organizes both the actin and MT cytoskeletons so that MTs approach FAs and promote their disassembly.
  • DRR deficiency, or the disruption of this complex by abolishing DRR-actin or DRR-LC2 association leads to a loss of coordination between actin and MTs, as well as the inability of MTs to reach FAs.
  • the invention provides a method for treating cancer, such as glioma, for example glioblastoma, in a subject in need thereof, comprising administering a therapeutic RNA of the invention, a vector or a pharmaceutical composition as described herein to said subject.
  • the invention relates to a method for delaying progression of cancer, such as glioma, for example glioblastoma, in a subject in need thereof, comprising administering a therapeutic RNA, a vector or a composition as provided herein to said subject.
  • subject as used herein preferably refers to a human, but veterinary applications are also in the scope of the present invention targeting for example domestic livestock, laboratory or pet animals.
  • the invention further provides methods for down-regulating DRR expression, for example decreasing DRR expression by more than 50%, by more than 70%, or by more than 90%.
  • DRR expression is decreased or reduced by about 50%, about 60%, about 70%, about 80%, or about 90%.
  • the invention relates to a method for inhibiting or reducing migration or invasiveness of tumor cells, preferably cells of glioma such as glioblastoma, comprising administering a therapeutic RNA, a vector or a composition of the invention to a subject in need thereof.
  • the invention further provides methods for inhibiting Akt activation or phosphorylation, for example inhibiting Akt activation by more than 50%, by more than 70%, or by more than 90%.
  • Akt activation is decreased or reduced by about 50%, about 60%, about 70%, about 80%, or about 90%.
  • the invention relates to a method for inhibiting or reducing migration or invasiveness of tumor cells, preferably cells of metastatic or invasive breast carcinoma, prostate carcinoma, squamous cell carcinoma, lung carcinoma, colon carcinoma, or renal cell carcinoma, comprising administering a therapeutic RNA, a vector or a composition of the invention to a subject in need thereof.
  • the invention provides a method for treating cancer, such as metastatic or invasive breast carcinoma, prostate carcinoma, squamous cell carcinoma, lung carcinoma, colon carcinoma, and renal cell carcinoma, in a subject in need thereof, comprising administering a therapeutic RNA of the invention, a vector or a pharmaceutical composition as described herein to said subject.
  • the invention relates to a method for delaying progression of such a cancer in a subject in need thereof, comprising administering a therapeutic RNA, a vector or a composition as provided herein to said subject.
  • the invention relates to a method for inhibiting or reducing migration or invasiveness of tumor cells for such a cancer, comprising administering a therapeutic RNA, a vector or a composition of the invention to a subject in need thereof.
  • the invention further provides a method for enhancing efficacy of cancer therapies for treatment of cancer, in particular glioma (preferably glioblastoma), or metastatic or invasive breast carcinoma, prostate carcinoma, squamous cell carcinoma, lung carcinoma, colon carcinoma, or renal cell carcinoma, selected from the group comprising resection, chemotherapy, radiation therapy, immunotherapy, and/or gene therapy, comprising administering a therapeutic RNA molecule, a vector or a composition as defined herein, and simultaneously, separately or sequentially administrating said cancer therapy.
  • enhancing efficacy of a cancer therapy refers to an improvement of conventional cancer treatments and includes reduction of the amount of an anti-cancer composition which is applied during conventional cancer treatment, e.g.
  • enhancing efficacy of a cancer therapy refers to prolonging survival rate of subjects receiving a therapy.
  • DRR as a biomarker for invasive brain cancer cells. Detection of elevated DRR expression can be used to identify invasive tumor cells and for diagnosis and/or prognosis of a tumor, based on DRR expression. Accordingly methods for diagnosis and prognosis of malignant glioma are provided, along with use of DRR as a biomarker for invasiveness. In one embodiment, there is also provided the use of DRR as a biomarker for EGFR-independent cancer invasion, e.g., EGFR-independent brain cancer invasion.
  • Kits for use in diagnostic and prognostic applications are also provided.
  • Such kits can comprise a carrier, package or container that is compartmentalized to receive one or more containers such as vials, tubes, and the like, each of the container(s) comprising one of the separate elements to be used in the method.
  • a container(s) can comprise a probe that is or can be detectably labeled.
  • a probe can be, for example, an antibody specific for a DRR biomarker or an RNA specifically hybridizing to DRR.
  • a kit can also include a container comprising a reporter- means, such as a biotin-binding protein, e.g., avidin or streptavidin, bound to a detectable label, e.g., an enzymatic, florescent, or radioisotope label.
  • a kit can include all or part of the amino acid sequence of a biomarker protein, or a nucleic acid molecule that encodes such amino acid sequences, or a nucleic acid molecule that binds to mRNA of a DRR biomarker, or a nucleic acid molecule that encodes a nucleic acid molecule binding to mRNA of a DRR biomarker.
  • a kit of the invention will typically comprise a container as described above and one or more other containers comprising materials desirable from a commercial and user standpoint, including buffers, diluents, filters, needles, syringes, and package inserts with instructions for use.
  • a label can be provided on a container to indicate that a composition is used for a specific application.
  • Directions and or other information can also be included on an insert which is included with a kit.
  • the invention provides a kit comprising at least one agent that binds DRR protein or DRR mRNA; and instructions for use of the at least one agent for determining invasiveness of cancer cells, e.g., brain cancer cells, in a subject.
  • the present invention relates to use of an anti-DRR therapeutic approach to treat malignant gliomas as well as other invasive or metastatic cancers.
  • the present therapeutic approach is based on the use of anti-DRR tools relating to RNA interference-(RNAi), antisense-, viral-vector-, or any other related approaches aiming to knock-down DRR expression in human tumor cells.
  • RNAi RNA interference-
  • antisense- antisense-
  • viral-vector- or any other related approaches aiming to knock-down DRR expression in human tumor cells.
  • the technical feasibility of the present approach is further illustrated by means of the following non-limiting examples.
  • a normal human adult brain cDNA library (Clontech) was subcloned into the pLib retroviral vector (Clontech) and used to transfect the PT67 packaging cell line using Lipofectamine PLUS reagent (Clontech).
  • the secreted replication deficient retrovirus was collected from the supernatant 24-72 hours post transfection and used to consecutively transduce, over a 72 hour time course, the WT-U251 glial cell line (Fig. 1A).
  • Tissues obtained from the operating room (OR) were first washed twice with Phosphate Buffered Saline 1 x (PBS) before being transferred to cell culture Petri dishes where the neurosurgeon separated necrotic tissues and blood vessels from the tumor with a blade. Tissues were then cut, using a blade, into very small pieces and incubated with 5ml of 1 .25% of trysin- EDTA for 30 minutes at 37°C.
  • PBS Phosphate Buffered Saline 1 x
  • DMEM Dulbecco's modified Eagle's medium
  • FBS fetal bovine serum
  • penicillin G 250 U/mL penicillin G
  • streptomycin sulfate 250 U/mL
  • amphotericin B 4.4 ⁇ g/mL amphotericin B (Fungizone)
  • This step was repeated twice to maximize cell recovery from the cell strainer.
  • the material was then centrifuged for 20 minutes at 1000 rpm at 4°C to pellet cells.
  • the cell mixture was incubated for 15 minutes at RT and then 15 ml of culture media was added to the sample, mixed thoroughly and mix was then centrifuged for 10 minutes at 1000 rpm. The supernatant was discarded and cells were resuspended in culture media.
  • U251 human oligodendroglioma cell line (WT), human glial tumor cell line (U343MG), rat astrocytoma cell line (C6), DRR " and DRR + cells were cultured in DMEM high-glucose supplemented with 10% FBS and a penicillin- streptomycin antibiotic mixture.
  • Human glioblastoma cell line (U87MG) (Cavanee lab, University of California at San Diego) were grown in DMEM high-glucose supplemented with 10% inactivated FBS and a penicillin- streptomycin antibiotic mixture.
  • DRR " cell lines were generated using short hairpin RNAs (Paddison et al., 2002) and retroviral transduction. The distal C-terminal sequence
  • GCTCTCTCTCTTCGCCGGCCAATGCGGCA was used to generate the short hairpin loop.
  • RT-PCR was used to confirm reduced DRR mRNA levels and western blotting was used to demonstrate reduced protein levels (Fig. S1 ).
  • DRR APEPE and DRR AHRE constructs were generated using the
  • DRR + , DRR APEPE and DRR AHRE stable cell lines were generated by transfecting WT-U251 cells with DRR, DRR APEPE or DRR AHRE expression vectors using Lipofectamine 2000 following the manufacturer's protocol. 72 hours post-transfection cells were expanded and selected in DMEM supplemented with 0.6 mg/ml of G418 for 2 weeks. The resistant colonies were trypsinized and expanded in the selection media. E18-19 rat hippocampal neurons were a generous gift from Dr. P. McPherson (McGill University). Cells were fed every seven days with Neurobasal medium supplemented with B-27, N-2, l-glutamine (500 ⁇ ) and penicillin/streptomycin (100 units/ml) (Invitrogen).
  • GBM6 cells were prepared by extraction from tissues as described above.
  • MNI 1 cells are primary brain cancer cells grown directly from a patient's tumor using methods as described above.
  • Affinity-purified rabbit polyclonal anti-DRR antibody directed against amino acids 67-92 was generated by Covance.
  • Mouse anti-vinculin and mouse anti-tubulin antibodies, nocodazole, and G418 were purchased from Sigma.
  • Rat anti-tubulin and mouse anti-GFAP antibodies were purchased from Chemicon.
  • Rhodamine-phalloidin, rabbit anti-FAKpY and Alexa 488-, 694-, and 647-conjugated secondary antibodies, and lipofectamine 2000 were purchased from Invitrogen.
  • Chicken anti-MAP2 antibody was purchased from Encor Biotechnology Inc.
  • GFP-paxillin cDNA plasmid was a generous gift from Dr. I.R. Nabi (University of British Columbia).
  • Cells were trypsinized and counted using the Coulter Z Series counter (Beckman-Coulter, Inc.). Measurements were taken twice for two samples of the same cell line and averaged. Cells were plated in a 6-well plate and counted after 24, 48, 72 and 96 hours. To assess 2D cell migration, cells were grown to confluency and a scratch was generated using a pipette tip. Images were captured at regular intervals 1 -1 1 hours post scratch. Tumor spheroids were generated using the hanging drop method and implanted in a collagen type 1 matrix as previously described (Werbowetski-Ogilvie et al., Cancer Research 66: 1464-1472, 2006).
  • the implanted spheroids were imaged after the following time points (0, 24, 48 and 72 hours). Invading areas were measured by calculating the extreme diameter at 4 different angles and by subtracting the extreme diameter of the spheroids at time zero. All experiments were performed in triplicate and are from 3 independent experiments.
  • the scratch assay shown in Figure 22 the following procedure was used: Following 72 hours post-transfection, cells have reached a monolayer. A 200 ⁇ pipette was used to perform a scratch. Cells were rinsed 3 times with PBS and fresh media was added to the cells. Images were captured with a 5x objective at the beginning of the scratch and at 24 hours and 48 hours. For each image, distances between one side of the scratch and the other were measured. The distance ( ⁇ ) of cell migration was quantified by measuring the distance of the scratch at each time interval and subtracting it from the distance of the scratch at time zero.
  • DRR expression levels in WT DRR " and DRR + cells
  • cells were allowed to grow to 80% confluency, washed in cold PBS and lysed with RIPA buffer or 2% hot SDS. Lysates (30 ⁇ 9) were separated on a 12% polyacrylamide gel and transferred to a nitrocellulose membrane. Membranes were probed with rabbit anti-DRR and mouse anti-tubulin antibodies followed by the appropriate HRP-conjugated secondary antibodies (Jackson
  • the mouse was secured to a stereotactic frame (Kopf Instruments) and a small incision was made in the scalp at the midline. A burr hole was created 0.5 mm anterior and 2 mm lateral to bregma. A microliter syringe (Hamilton Company) was slowly lowered through the burr hole to a depth of 4.4 mm and a cell suspension containing 2x10 5 cells in 3 ⁇ of PBS was injected over 12 minutes. Animals were euthanized at one month post- injection to assess tumour growth and invasion.
  • Yeast two-hybrid screens were performed using the MatchmakerTM Two-Hybrid System 3 (Clontech). Full-length DRR was used as the bait to screen a human brain cDNA library (Clontech).
  • cells were fixed with 4% PFA and permeabilized with 0.5% TritonX-100 before being processed for immunostaining, as described above.
  • Cells were labelled with mouse anti- vinculin to visualize focal adhesions and rhodamine-phalloidin was used to stain actin. Fluorescently labelled cells were visualized with a Zeiss 510 confocal microscope using 63x objectives.
  • WT or DRR + cells were seeded on 35 mm glass bottom culture dishes (MatTek Corporation) before being transfected with GFP-paxillin. 24 - 48h post-transfection the images were captured every 1 min for 170 minutes using a Zeiss 510 confocal microscope (63x objective). Five DRR + and five control (WT) cells were analyzed, and a total of 17 FAs were analyzed for DRR + cells. The apparent rate constants for the incorporation of GFP-paxillin into FAs and its disassembly from FAs was quantified using the technique described in Webb et al., 2004. Measurements were obtained from five cells, 5-10 FAs/cell. In control cells, no FAs were identified that assembled or disassembled within the 170 minute imaging interval. Data is presented as mean ⁇ standard error.
  • Tissues obtained from surgical resection were rinsed two times with Phosphate Buffered Saline 1x (PBS) before being transferred to cell culture dishes. Necrotic tissues and blood vessels were separated from the tumor. Tissues were then cut and incubated with 5ml of 1 .25% of trysin-EDTA for 30 minutes at 37°C, after which 7.5 ml of cell culture media (Dulbecco's modified Eagle's medium (DMEM) supplemented with 20% fetal bovine serum (FBS), 250 U/mL penicillin G, 250 ⁇ g/mL streptomycin sulfate, and 4.4 ⁇ g/mL amphotericin B (Fungizone)) was added to the sample to neutralize trypsin- EDTA.
  • DMEM Dulbecco's modified Eagle's medium
  • FBS fetal bovine serum
  • FBS fetal bovine serum
  • drops (20 ⁇ ) of cell culture media containing 25 000 cells were suspended from an inverted Petri dish lid. 5 ml of PBS was added at the bottom of the dish to prevent evaporation of the drops. To form cell aggregates, the hanging drops were incubated for 72h at 37°C. The aggregates were transferred to 2% agar/PBS (pH 7.4) coated Petri dishes containing 10 ml culture media and were incubated at 37°C for another 48h period to allow the aggregates to become round like a spheroid.
  • spheroids were implanted into a liquid collagen Type I solution (2.5 mg/ml 0.012N HCL) mixed with 10x DMEM and 0.1 mM NaOH at a ratio of (8: 1 :1 ). Collagen-containing spheroids were allowed to solidify at 37°C for 30 min after which 0.5 ml of tissue culture media was added to each well. The implanted spheroids were imaged after the following time points: 0, 24, 48, 72 and 96 hours. Invading areas were measured by calculating the extreme diameter at 4 different angles and by subtracting the extreme diameter of the spheroids at time zero.
  • transfection was carried out as follows: The day before transfection, cells were plated so as to reach 75% confluency at the time of transfection. Cell media was replaced with fresh media before transfection. Complexes of DRR oligomer and lipofectamine 2000 (Invitrogen) were prepared according to the manufacturer's instructions. Briefly, lipofectamine was gently mixed in opti-MEM and left at room temperature for 5 min. DRR oligomer was first mixed with opti-MEM (so that the final concentration added to the cells was 20nM) and gently mixed with lipofectamine. Lipofectamine-DRR oligomer complexes were incubated at room temperature for 20 minutes before being added to the cells. The day after transfection, fresh cell media was added to the transfected cells. Cells were fixed or lysed following 72 hours post-transfection.
  • Antisense oligonucleotide synthesis Standard phosphoramidite solid-phase synthesis conditions were used for the synthesis of all modified and unmodified oligonucleotides (Damha and Ogilvie, 1993, In Agrawal, S. (ed.), Protocols for Oligonucleotides and Analogs: Synthesis and Properties, Methods in Molecular Biology, Vol. 20, The Humana Press Inc., Totowa, NJ, pp/ 81 -1 14). Syntheses were performed on an Applied Biosystems 3400 DNA Synthesizer at a 1 ⁇ scale using Unylink CPG support (ChemGenes).
  • phosphoramidites were prepared as 0.15M solutions in acetonitrile (ACN), except DNA, which was prepared as 0.1 M. 5-ethylthiotetrazole (0.25M in ACN) was used to activate phosphoramidites for coupling. Detritylations were accomplished with 3% trichloroacetic acid in CH 2 CI 2 for 1 10s. Capping of failure sequences was achieved with acetic anhydride in tetrahydrofuran (THF) and 16% N- methylimidazole in THF. Sulphurizations were accomplished using a 0.1 M solution of xanthane hydride in 1 :1 v/v pyridine/ACN.
  • ACN acetonitrile
  • Coupling times were 1 10s for DNA amidites (270s for guanosine), and 600s for 2'F-ANA phosphoramidites, with the exception of guanosine phosphoramidites which were allowed to couple for 900s.
  • Deprotection was accomplished with an on- column decyanoethylation step using anhydrous 2:3 TEA:ACN in three 15min washes followed by an ACN wash.
  • Deprotection and cleavage from the solid support was accomplished with either 3: 1 NH40H:EtOH for 48h at room temperature (RT), or with 40% methylamine for 10 min at 65°C (Bellon, L, 2000, Curr. Protocols. Nucleic Acid Chem., 3.6.1 -3.6.13).
  • oligonucleotides Purification of crude oligonucleotides was done either by preparative denaturing polyacrylamide gel electrophoresis (PAGE) using 24% acrylamide gels, or by reverse phase HPLC on a Waters 1525 HPLC using a Varian Pursuit 5 reverse phase C18 column with a stationary phase of l OOmmol triethylammonium acetate in water with 5% ACN, and a mobile phase of HPLC-grade acetonitrile. Gel bands were extracted overnight in DEPC- treated autoclaved Millipore water, and lyophilized to dryness. All purified oligonucleotides were desalted with Nap-25 Sephadex columns from GE Healthcare. Sequences were verified by ESI-LCMS. Sequences targeting DRR mRNA were designed using the published mRNA sequences available on the NCBI website. Effective antisense sequences targeting DRR were designed using an antisense oligonucleotide (AON) sequence selection tool available
  • AONs targeting DRR are shown in Table 1 (G4 (SEQ ID NO: 14), G5 (SEQ ID NO: 15), and G6 (SEQ ID NO: 16)), and control AONs not targeting DRR were also prepared for control experiments (G1 (SEQ ID NO: 1 1 ), G2 (SEQ ID NO: 12), G3 (SEQ ID NO: 13)).
  • DRR-targeting AON sequences provided herein, e.g., in Table 1
  • other DRR-targeting AON sequences could be selected using these methods by choosing sequences complementary to other DRR mRNA regions, while ensuring specificity for DRR mRNA but not other mRNA sequences. It should be understood that any antisense molecule, e.g., antisense oligonucleotide, which targets DRR and reduces or decreases DRR expression is encompassed.
  • Oxidation was done using 0.1 M l 2 in 1 :2: 10 pyridine:water:THF. Coupling times were 600s for RNA, 2'F-ANA, and 2'F- RNA phosphoramidites, with the exception of their guanosine
  • Cyanine 5 phosphoramidites (Glen Research) were coupled at 0.1 M concentration using a manual coupling step carried out under anhydrous conditions on- column between two 1 ml_ syringes containing activation reagent and Cyanine 5 phosphoramidite in acetonitrile (CAN) (capping, oxidation, and dethtylations were done as usual on the DNA synthesizer, with the exception that a 0.02M oxidation solution was used in place of the regular 0.1 M solution).
  • CAN acetonitrile
  • 5'- phosphorylation of chemically modified antisense strands was achieved using bis-cyanoethyl-N, N-diisopropyl-2-cyanoethyl phosphoramidite at 0.15 M (600s coupling time).
  • Deprotection and cleavage from the solid support was accomplished with either 3: 1 NH OH:EtOH for 48h at room temperature (RT), or with 40% aqueous methylamine for 10 min at 65°C.
  • Oligonucleotides containing RNA were synthesized with standard 2'- TBDMS phosphoramidites, and desilylation was achieved with either neat triethylamine trihydrofluoride for 48h at ambient temperature, or with triethylamine trihydrofluoride/N-methyl pyrrolidinone/triethylamine (1 .5:0.75: 1 by volume) for 2.5h at 65°C.
  • oligonucleotides Purification of crude oligonucleotides was done either by preparative denaturing polyacrylamide gel electrophoresis (PAGE) using 24% acrylamide gels, or by reverse phase HPLC on a Waters 1525 HPLC using a Varian Pursuit 5 reverse phase C18 column with a stationary phase of l OOmmol triethylammonium acetate in water with 5% ACN (pH 7), and a mobile phase of HPLC-grade acetonitrile (Sigma). Gel bands were extracted overnight in DEPC-treated autoclaved Millipore water, and lyophilized to dryness. All purified oligonucleotides were desalted with Nap- 25 Sephadex columns from GE Healthcare.
  • PAGE polyacrylamide gel electrophoresis
  • siRNAs were prepared by annealing equimolar quantities of complementary oligonucleotides in siRNA buffer (100 mM KOAc, 30 mM HEPES-KOH, 2 mM Mg(OAc) 2 , pH 7.4) by slowly cooling from 96°C to RT in a ceramic heat block. Sequences targeting DRR mRNA (isoforms 1 and 2) were designed using the published mRNA sequences available on the NCBI website. mRNAs were submitted to the Whitehead siRNA design tool (http://jura.wi.mit.edu/bioc/siRNAext/), and siRNA sequences targeting the open reading frame of the mRNA were selected.
  • the selected sequences have less than 15 % identity with other cellular mRNAs. From the sequence selection tool output, the sequence shown below in Table 1 was chosen for chemical modification with successful chimeric designs identified previously (Deleavey, G.F., et al. (2010) Nucleic Acids Research, 38, 4547-4557).
  • siRNAs siRNAI , siRNA2, and siRNA3 target DRR mRNA, whereas Control is a scrambled control.
  • MGC invasiveness can be assayed using a 3D invasion model (Del Duca, D. et al., Journal of Neurooncology 67:295-303, 2004).
  • a 3D invasion model (Del Duca, D. et al., Journal of Neurooncology 67:295-303, 2004).
  • MGCs the U251 glioma cell line
  • Tumor spheroids were generated from the transduced MGCs and their invasiveness was assessed in the 3D invasion model. Distinguishable hyperinvasive cells were then captured and expanded in culture and the originally transduced gene was identified (Fig. 1 A). DRR was identified as a strong promoter of invasion using this forward genetic approach.
  • DRR + cells migrate with long thin protrusions whereas WT and DRR " cells migrate with a uniform broad lamella (Fig. 9).
  • An elongated spindle cell shape has been shown to be the preferred mode of MGC movement through brain (Beadle et al., Mol Biol Cell. 19:3357-68, 2008).
  • DRR + and DRR " tumors were implanted into the subcallosal/caudate region of mice and invasion was assessed (Fig. 1 L & M).
  • DRR " tumors grow as a well circumscribed mass without invasion into the adjacent parenchyma, and these cells have a round morphology.
  • DRR + tumors are highly invasive. These invasive cells, which are distinguished by their large, hyperchromatic and elongated nuclei, have an elongated shape, separate from the tumor mass, invade parenchyma, and, importantly, move towards and into the corpus callosum.
  • DRR DRR is Expressed in Neurons and Human Gliomas but not in Normal Glia
  • DRR DRR leads to a significant perturbation of the actin cytoskeleton and abolishes actin association with the remaining stress fibres (Fig. 3A).
  • DRR non-actin binding form
  • DRR DRR associated protein
  • the rate constant for GFP-paxillin incorporation into FAs was (6.2 ⁇ 0.9) x 10 ⁇ 3 min "1 and the rate constant for GFP-paxillin disassembly was (8.6 ⁇ 0.7) x 10 "3 min "1 .
  • FAs were not dynamic in WT control cells. We were unable to detect FAs that formed or disassembled within the 170 minute imaging interval (Fig 5D). These data strongly support a mechanism whereby DRR drives cell invasion by enhancing FA dynamics.
  • FA disassembly requires polymerized microtubules (MTs) (Kaverina et al., J. Cell Biol. 142: 181-190,1998; Kaverina et al., J. Cell Biol. 146: 1033-1044, 1999; Krylyshkina et al., J. Cell Biol.
  • MTs microtubules
  • DRR expression leads to a highly organized MT system that strongly parallels the localization pattern of the actin cytoskeleton (Fig. 7A).
  • DRR deficiency leads to an irregular, poorly organized MT cytoskeleton that does not parallel the actin cytoskeleton (Fig. 7B).
  • DRR deficiency also leads to a profound change in the actin cytoskeleton with loss of stress fiber formation and the promotion of a cortical actin system (Fig. 7 A and B). The promotion of a stress fiber actin system allows for actomyosin contraction and thus cell rear retraction (Verkhovsky et al., J. Cell Biol.
  • gliomas Human high grade gliomas were surgically resected and immediately placed in culture. Two weeks later they were transfected with a control GFP vector or DRR-RNAi (SEQ ID NO: 1 ) (vector also contains green fluorescent protein (GFP)). Tumor spheroids were generated from these cells and implanted into a collagen matrix. Brightfield (upper lanes) and fluorescence images (lower lanes) were captured at 1 to 14 days post-implantation (Fig. 16). Non-transfected tumors (Fig. 16A) and control GFP-transfected tumors (Fig. 16B) readily invade, whereas DRR-RNAi transfected tumors (Fig. 16C) do not. Fig. 16D shows quantification of invasion distance from spheroid edge.
  • GFP green fluorescent protein
  • DRR+ cells were transfected with the indicated DRR antisense (Antisense G4 (SEQ ID NO: 14; an altimer), Antisense G5 (SEQ ID NO: 15; a gapmer) or Antisense G6 (SEQ ID NO: 16; a gapmer); a non-targeting control antisense (Ctl Antisense); or left untransfected (Untransfected).
  • Antisense G4 SEQ ID NO: 14; an altimer
  • Antisense G5 SEQ ID NO: 15; a gapmer
  • Antisense G6 SEQ ID NO: 16; a gapmer
  • Ctl Antisense non-targeting control antisense
  • left untransfected Untransfected
  • Oligonucleotide G1 (SEQ ID NO: 1 1 ) is a non-targeting altimer control, and oligonucleotides G2 (SEQ ID NO: 12) and G3 (SEQ ID NO: 13) are non- targeting gapmer controls.
  • DRR expression level was determined 72 hours post-transfection using Western blotting (Fig. 17). The results show that different antisense oligonucleotides are effective at reducing DRR expression.
  • oligonucleotides (Fig. 18). The results show that reduction of DRR expression by treatment with DRR antisense oligonucleotides induced cells to shift from an elongated spindle morphology to a round morphology. We also found that treatment with DRR antisense oligonucleotides leads to large focal adhesions.
  • DRR+ cell invasion was also analyzed using an in vitro 3D invasion assay (Fig. 20). It can be seen that control DRR+ tumor spheroids are highly invasive whereas treatment with DRR antisense oligonucleotides impairs tumor spheroid invasion. Quantification of invasion reveals that treatment with DRR antisense oligonucleotides leads to a significant reduction in invasion (Fig 20B).
  • oligonucleotides leads to large focal adhesions.
  • DRR siRNA oligonucleotides reduce DRR expression
  • DRR+ cells were transfected with a DRR siRNA as indicated (siRNAI (SEQ ID NO: 17/18), siRNA2 (SEQ ID NO: 19/20); or siRNA3 (SEQ ID NO: 23/24; a FANA FRNA altimer)); or a non-targeting control sequence (Ctl siRNA; SEQ ID NO: 25/26).
  • siRNAI SEQ ID NO: 17/18
  • siRNA2 SEQ ID NO: 19/20
  • siRNA3 SEQ ID NO: 23/24; a FANA FRNA altimer
  • Ctl siRNA SEQ ID NO: 25/26
  • DRR expression level was determined 72 hours post-transfection using Western blotting in DRR+ cells (Fig. 23). The results showed that siRNA oligonucleotides were effective at reducing DRR expression.
  • DRR expression level in MNI 1 stem cells was determined 72 hours post-transfection using Western blotting in DRR+ cells (Fig. 24). The results showed that various siRNA oligonucleotides were effective at reducing DRR expression.
  • DRR Characterization of DRR expression in normal human brain and gliomas reveals that in normal brain DRR is abundantly expressed in neurons but not in glia. In contrast, DRR is uniformly and highly expressed in the invasive regions of both low and high grade gliomas, whereas its expression in the central proliferative region of high grade gliomas is variable. We also demonstrate that reduction of DRR expression inhibits human glioma invasion.
  • DRR is an important regulator of glioma invasion and a target for therapeutic treatment of glioma.
  • DRR is a useful biomarker to delineate invasive regions and grade malignant gliomas.
  • DRR is involved in the EFGR/PI3K-PTEN/Akt pathway
  • EFGR/PI3K-PTEN/Akt pathway has been shown to be a driver of GBM invasion that is altered in over 80% of GBMs and pAkt is elevated in a high percentage of GBMs, and, as reported herein, DRR is overexpressed in invasive gliomas compared to normal glial cells, we tested whether DRR is involved in the EFGR/PI3K-PTEN/Akt pathway. As reported below, we found that DRR expression leads to elevated Akt activation by recruiting Akt to FAs in an adhesion and src family kinase (SFK) dependent manner. This augmented Akt activation leads to NFkB activation and transcription of MMPs involved in glioma invasion.
  • SFK adhesion and src family kinase
  • DRR represents a novel GBM target and therapeutic RNA molecules provided herein, e.g., DRR antisense oligonucleotides, are a novel therapeutic approach to prevent brain cancer invasion.
  • Antibodies and reagents Anti-phospho-AKT (Ser473), anti- phospho-AKT (Thr308), anti-AKT, anti-phospho-p44/42 MAPK
  • Anti-DRR Covance, Princeton, NJ
  • anti-a-tubulin Anti-a-vinculin and fibronectin from bovine plasma
  • bovine plasma Sigma- Aldrich, St. Louis, MO
  • AG1478, U0126, LY294002, wortmannin, PP2, PF-228, GRGDSP peptide Calbiochem, Merck KGaA, Darmstadt, Germany
  • C3 transferase Cytoskeleton Inc, Denver, CO
  • Texas Red EGF Invitrogen
  • PureCol® Bovine Collagen Solution Type 1 (Advanced BioMatrix Inc., Poway, CA), SYBR Green PCR Master Mix (Roche) were used.
  • hGSCs human glioma stem cells
  • NeuroCultTM Proliferation Media StemCell Technologies, Vancouver, BC
  • 10% Neurocult 1 : 1000 heparin sulfate, 20ng/ml_ hFGF2, and 20ng/ml_ hEGF.
  • hGSCs were transfected in Neurobasal media supplemented with B27, N2, L-glutamine, 20ng/ml_ hFGF2 and 20ng/ml_ hEGF.
  • AG1478 assay For AG1478 treatment, cells were plated in a 24 well- plate and the following day they were treated overnight with 1 -20 ⁇ AG1478 [ ⁇ 20 ⁇ DMSO (vehicle)], before being treated with 50ng/ml_ EGF either alone or in the presence of 1 -20 ⁇ AG1478 (or DMSO) for 10 minutes at 37°C.
  • U0126 assay Cells were plated at a density of 80,000 cells/well in a 24-well plate. On the third day, cells were pre-treated with 5-20 ⁇ U0126 (or DMSO) for 2 hours at 37°C. Cells were then stimulated with EGF alone or in the presence of U0126 for 10 minutes at 37°C before lysis.
  • C3 transferase assay Cells were plated at a density of 60,000 cells/well in a 24-well plate. On the third day, cells were treated with 0.5, 1 or 2ug/ml_ for 5 hours at 37°C before lysis. Cells were visualized with a Zeiss light microscope 5x objective. Cells were plated on glass coverslips and treated with C3 transferase then fixed for immuno-labeling with rhodamine phalloidin.
  • PP2 assay The same protocol as the C3 transferase assay was used. On the third day, cells were treated with 5 ⁇ PP2 (or PP3) for 5 hours at 37°C before lysis. For the experiments in which fibronectin was used, 24- well plates were coated with 50ug/ml_ fibronectin overnight at 4°C. Fibronectin was then removed and the plate was allowed to air dry at room temperature for ⁇ 1 hr before the addition of cells. Meanwhile, cells were grown to -95% confluency in 6-well plates and pre-treated with 10 ⁇ PP2 for 5 hours, at which point they were then trypsinized and re-suspended in media with PP2 and plated at a cell density of 200,000 cells/well for the indicated time.
  • PF-228 assay The same protocol as the C3 transferase assay was used. On the third day, cells were treated with 100nM, 500nM or 1 ⁇ PF-228 for 1 hour at 37°C before lysis. For the experiments in which fibronectin was used, the same protocol was used as for PP2. Cells were pre-treated with PF-228 for 1 hour, at which point they were then trypsinized and re- suspended in media with PF-228 and plated at a cell density of 200,000 cells/well for the indicated time.
  • LY294002 assay The same protocol as for U0126 was used. Cells were pre-treated with 5-20 ⁇ LY294002 (or DMSO) for 2 hours and then stimulated with EGF alone or in the presence of LY294002 for 10 minutes at 37°C before lysis. For the experiments in which fibronectin was used, the same protocol was used as for PP2. Cells were pre-treated with 5 ⁇
  • LY294002 for 2 hours, at which point they were then trypsinized and re- suspended in media with LY294002 and plated at a cell density of 200,000 cells/well for the indicated time.
  • RGD assay Plates were coated with fibronectin. Cells were treated with 500 ⁇ RGD in suspension on a rotating platform at room temperature for 30 minutes. 200,000 cells/well were plated onto fibronectin for 30 minutes. Cells that did not adhere were removed and lysed.
  • Immunocytochemistry Cells were grown to -70% confluency on glass coverslips uncoated or coated with fibronectin (50 ⁇ / ⁇ _) fixed with 3% paraformaldehyde and permeabilized with 0.5% Triton X-100 in 0.5% PBS- BSA. Cells are then labelled with indicated primary and secondary antibodies and coverslips were mounted with Dako mounting medium. Stained cells were imaged with the Zeiss LSM700 confocal microscope using a 63x oil immersion objective. Transient transfections: Cells were plated at the appropriate confluency and transfected the following day. Either GeneJuice® (Novagen) or Lipofectamine 2000 (Invitrogen) was used according to the manufacturer's protocol.
  • 3D invasion assay 25,000 cells/drop were plated onto the lid of a
  • spheroids were transferred to 2% agar and on the sixth day, spheroids were implanted into a collagen type I matrix. Collagen was allowed to polymerize for 30 minutes at 37°C before the appropriate media was added (regular DMEM or supplemented with PP2/LY294002/AG1478). Spheroids were imaged over 24 hour intervals with a Zeiss light microscope 5x objective.
  • mice Female CD1 athymic nude mice (Charles River, Canada) were anesthetized at six weeks of age using intra-peritoneal injection containing Ketamine, Xylazine, and
  • Acepromazine The mice were placed on a stereotaxic apparatus and a midline scalp incision was made. A burrhole (3-5 mm) was created 2.2 mm lateral to the bregma using a high-powered drill. The injection needle containing 100,000 cells pretreated with the anti-sense oligonucleotide was then lowered into the burr-hole to a depth of 3.0 mm to allow tumour implantation at the center of the caudate nucleus. Animals were euthanized 3 weeks post-implantation, and their brains were harvested following
  • the slides were then blocked for 40 minutes with a commercial protein block (Spring Bioscience), incubated for 1 hour with anti-human Sox2 primary antibody (R&D), and 20 minutes with secondary antibody (Invitrogen). Then, the slides were washed with 0.05% TBS-Tween for 15 minutes. A wash was carried out between each step throughout the staining process. After the slides were mounted, they were imaged with a LSM 700 confocal microscope using a 20x objective.
  • DRR Induced Akt Phosphorylation is Independent of EGFR Signaling Because EGFR signaling is amplified in 45-55% of GBMs and is a well-characterized activator of the PI3K/Akt pathway under normal and pathophysiological conditions (Akhavan et al., Neuro. Oncol. 12: 882-889, 2010; Fan and Weiss, Curr. Top. Microbiol. Immunol. 347: 279-296, 2010), we determined EGFR/pEGFR expression in the context of DRR expression. We found that DRRov cells express significantly higher levels of total cell EGFR (Fig. 30a) and cell surface EGFR compared to CTL cells (Fig. 30b). This elevated EGFR expression translated into pEGFR following EGF stimulation (Fig. 30a).
  • EGFR kinase inhibitor AG1478 We tested the EGFR kinase inhibitor AG1478 to determine if the increased EGFR/pEGFR expression was responsible for the DRR-induced Akt phosphorylation. Surprisingly, EGFR blockade did not reduce pAkt levels in DRRov cells (Fig. 30c). And, in a 3D invasion assay, EGFR inhibition did not reduce DRRov cell invasion (Fig. 30d, e). Thus, although EGFR/pEGFR expression was elevated DRRov cells, it was not involved in DRR-induced Akt phosphorylation or cell invasion.
  • Akt Phosphorylation is Adhesion and SFK Dependent Activating inputs leading to Akt phosphorylation include
  • Ras/Raf/MEK/Erk Rho-GTPases, integrin like kinase (ILK), src-family kinases (SFKs), focal adhesion kinase (FAK) and PI3K.
  • ILK integrin like kinase
  • SFKs src-family kinases
  • FAK focal adhesion kinase
  • the MEK inhibitor U0126 is a non-ATP competitive inhibitor that targets MEK1 and MEK2 and effectively inhibits downstream Erk
  • Rho-family GTPases are involved in Akt regulation and also act downstream of Akt to regulate cytoskeletal dynamics and cell movement (Vanhaesebroeck et al., Nat. Rev. Mol. Cell. Biol. 11 : 329-341 , 2010;
  • Rho A, B and C inhibitor Treatment of the Rho A, B and C inhibitor, exoenzyme C3 transferase, to DRRov generates predicted changes in cytoskeletal architecture and cell morphology including reduced stress fibers and a collapsed cell structure. Treatment with this Rho inhibitor did not affect pAKT levels in DRRov cells (Fig. 31 b).
  • Integrin-linked kinase functions between integrins and RTKs and is an important activator of Akt (Hannigan et al., Nat. Rev. Cancer, 5: 51 -63, 2005; Legate et al., Nat. Rev. Mol. Cell. Biol. 7: 20-31 , 2006).
  • Akt Integrin-linked kinase
  • SFKs are well-characterized effectors of integrin signaling and are key regulators of focal adhesion (FA) dynamics (Parsons and Parsons,
  • FAK focal adhesion kinase
  • PI3K involvement was assessed by applying the inhibitor LY294002.
  • concentrations of LY294002 at 5, 10 and 20 ⁇ for pre-treatment times of 2, 12 and 24 hours and found that while Akt phosphorylation was effectively inhibited in CTL cells after 2 hours, LY294002 did not prevent Akt phosphorylation in DRRov cells. (Fig. 31 g). Because we found that SFK block of AKT phosphorylation was adhesion-dependent, we also tested PI3K inhibition in an adhesion-dependent manner.
  • the stem cell marker Sox was used to identify all implanted cells while cy5 labeling was used to identify tumor cells that had been treated with AOs.
  • cancer cells treated with Cy5-conjgated control AOs readily invaded the peritumoral brain (Fig. 34b, upper panels)
  • cancer cells treated with Cy5-conjugated AOs targeting DRR did not invade normal brain, and remained within the well-circumscribed tumor mass (Fig. 34b, lower panels).
  • Akt is phosphorylated at FAs and this elevated level of pAkt remains detectable for at least 6 hours, suggesting that this recruitment generates a constitutively active form of Akt.
  • the results support a novel mode of Akt activation following its recruitment to a specialized membrane complex.
  • Akt is activated in the large majority of GBMs, and emerging evidence suggests that Akt plays a role in GBM invasion (Molina et al., Neoplasia, 12: 453-463, 2010). Since Akt is not frequently mutated in GBM, its activation is presumed to be under the control of upstream RTKs. Our findings that Akt phosphorylation is not under the control of EGFR in DRR positive GBMs may provide an explanation for the negative results that EGFR inhibitors have yielded in clinical trials. Similarly, our results suggest that DRR may prove to be a useful biomarker for EGFR independent brain cancer invasion.
  • Antisense oligonucleotides (AOs) delivered to the resection cavity of GBM patients via implanted catheters, thereby bypassing the need for systemic delivery, is a globally approved treatment modality.
  • AOs Antisense oligonucleotides
  • catheters can be placed directly into the resection cavity providing a simple mechanism for routine AO delivery. Since GBM invasion into normal brain is a local event in over 80% or more of patients (data not shown), delivery of AO targeting invasion directly into the resection will allow for treatment to the most relevant area with minimized toxicity.
  • DRR was highly expressed in peripheral edges of glioma tumour mass. Its expression pattern within a tumour sample correlated with its pro-invasive phenotype observed in vivo and in vitro. We tested whether increased DRR expression was also correlated with an invasive phenotype in other tumour types. Analysis of various malignant tumour samples (primary site and/or correlated metastasis site) along with their corresponding normal tissues revealed that DRR is commonly expressed in normal and malignant tissue (Fig. 35). Interestingly, in almost all breast, prostate and squamous cell carcinoma samples analyzed, DRR mRNA was preferentially expressed in metastasized samples compared to primary site samples. These results indicate a correlation between highly invasive malignant cells and DRR expression in a range of tumour types, including breast, prostate and squamous cell carcinoma.
  • RNA was purified from samples according to Qiagen DNA/RNAasyTM kit instructions.
  • cDNA synthesis was performed as follows: cDNA first strand synthesis was performed from purified RNA by mixing ⁇ 5ug RNA, oligo dT primers and dNTP together and incubating at 60 °C for 5 minutes. The reaction was cooled on ice and a prepared master mix of reverse transcriptase (RT) buffer, MgCI 2 , DTT, and RNase inhibitor was added. The reaction was then incubated at 42 °C for 2 minutes and superscript II or III was added for 50 minutes at 42 °C.
  • RT reverse transcriptase
  • qRT-PCR Quantitative real time PCR experiments were performed on a Bio-Rad CFX96. Primers (200 nM) and 1 ul of cDNA were mixed with Ssofast EvaGreenTM (Bio-Rad) and run at cycles of 95 °C, 2", 95 °C, 5', 60 oC , 5' (two step cycle, 40 cycles) and melt curve (95 °C, 5", gradient).
  • DRR Antisense Oligonucleotides Reduce DRR Expression and Block Cell Migration and Invasion
  • DRR antisense oligonucleotides G5 and G6
  • G1 non-targeting antisense oligonucleotide
  • DRR+ cells were transfected with each AON. 72h post- transfection, cells were lysed and DRR expression level was analyzed by Western blot (Fig. 36). Both G5 and G6 AONs at a concentration of 20nM significantly decreased DRR expression levels relative to the control antisense, G1 .
  • DRR+ cells were immunolabeled with anti-vinculin and rhodamine phalloidin to visualize focal adhesion and actin, respectively (Fig. 37). Indeed, reduction of DRR expression level induced cells to round-up with significantly larger focal adhesion in contrast to control non-targeting antisense, where cells were more elongated with smaller focal adhesions.
  • DsredDRR DsredDRR cells were made by transfecting a human glioma cell line (U251 ) with a dsred-DRR plasmid, and sorting cells overexpressing dsredDRR using flow cytometry (FACS) to obtain a homogeneous population.
  • FACS flow cytometry
  • DRR AONs untagged or Cy5 tagged, as well as Cy5-tagged control non-targeting AON (G1 ) were tested on DsRed DRR- overexpressing stable cell lines.
  • DsredDRR cells were transfected with Cy5-tagged AONs. At 72h post-transfection, cells were fixed and labeled with the focal adhesion marker vinculin. Dsred cells and Cy5-AONs were directly detected in the red or blue channel, respectively (Fig. 39). From this experiment, we
  • hGSC cells were first transfected with control non-targeting antisense (G1 -cy5) or with targeted AONs (G5-cy5 or G6-cy5) and 72h post-transfection, cells were implanted in the subcallosal brain region of mice. Sections of mice brain are shown in Fig. 43 in which cy5 labeling was used to identify tumor cells that had been treated with AONs and H&E stained sections are shown to identify the tumor mass. With G1 transfection, significant cy5-G1 expressing cells were invading the peritumoral brain (upper panels), whereas with G5 and G6 transfection, cy5 labelled cells remained within circumscribed tumor mass area (lower panels). These results indicate that DRR AONs could be transfected in human glioma stem cells and induced changes in the cells that reduce their capacity to invade.
  • DRR siRNAs Reduce DRR Expression and Induce Changes in Cell Morphology
  • DRR siRNAs were designed, as well as a non-targeting siRNA as control (Fig. 44).
  • DRR+ cells were transfected with each DRR siRNA. 72h post-transfection, cells were lysed and DRR expression levels were analyzed by Western blot (Fig. 44).
  • the most potent DRR siRNA was siRNAI (also referred to as DRR1 siRNA), where DRR expression level was minimal compared to non- targeting DRR siRNA (DRR4).
  • DRR+ cells were transfected with non-targeting siRNA or with DRR siRNAI (also referred to as DRR1 siRNA) and immunolabeled with rhodamine phalloidin and anti-vinculin to visualize actin and focal adhesion (Fig. 45). Indeed, reduction of DRR expression level induced cells to roundup with significantly larger focal adhesion in contrast with control non- targeting siRNA, where DRR+ cells were more elongated.
  • DRR siRNA-2 (also referred to as DRR2 siRNA) was conjugated to Cy-5 and, following DRR+ cell transfection with DRR siRNA-2Cy5, cells were labelled with rhodamine- phalloidin and anti-vinculin (Fig. 46). Again, we observed changes in cell morphology and bigger focal adhesion with reduced DRR expression.
  • Antisense oligonucleotides (G5, Cy5-G5, G6, and Cy5-G6) were designed to target DRR mRNA (NM_007177) in the open reading frame at position 576- 595.
  • G1 and Cy5-G1 are non-targeting negative control sequences. All antisense oligonucleotides were synthesized on an ABI 3400 DNA
  • Oligonucleotides were purified by reverse phase HPLC using a Waters 1525 HPLC and a Varian Pursuit 5 semi-preparative reverse phase C18 column. A stationary phase of 100mM triethylammonium acetate in water with 5% ACN (pH 7) and a mobile phase of HPLC-grade ACN was used. Purifications employed a gradient of 5%-35% ACN over 35min. Purified samples were lypophilized to dryness from water 3 times. All oligonucleotides were quantitated by UV absorbance on a Cary 300 UV, using extinction coefficients calculated used the online IDT OligoAnalyzer tool
  • Oligonucleotides were characterized by LC-MS on a Waters Q-TOF2 using an ESI NanoSpray source. A CapLC (Waters) with a C18 trap column was used for LC prior to injections.
  • DRR+ and dsRed-DRR expressing cells were cultured as described (see Le et al., Oncogene, 29: 4636-47, 2010).
  • 46EF stem cells were kindly provided by Dr. Samuel Weiss (University of Calgary).
  • 46EF stem cells were isolated as previously performed (Kelly et al., Stem Cells 27: 1722-33, 2009) and expanded in neurosphere cultures.
  • Spheres were cultured in complete Neurocult-NS-A proliferation Medium (Neurocult basal medium containing: Neurocult NS-A differentiation supplement at a concentration of 1/10 dilution, 20 ng/ml rh EGF, 20 ng/ml rh bFGF and 2 ⁇ g/ml Heparin) from stem cells technologies. When spheres appeared large enough for passaging ( ⁇ 300 ⁇ in diameter), they were collected in a tube and spun at 1200rpm for 3 minutes.
  • Neurocult-NS-A proliferation Medium Neurocult basal medium containing: Neurocult NS-A differentiation supplement at a concentration of 1/10 dilution, 20 ng/ml rh EGF, 20 ng/ml rh bFGF and 2 ⁇ g/ml Heparin
  • DRR+ and dsRed-DRR cells were plated in 24 well or 6 well plates such that they reached 75% confluency at the time of transfection.
  • 46 EF stem cells were plated at 400 000 cells/well in a 6 well plate and were transfected on the same day. All transfection was done using lipofectamine 2000 reagent according to the manufacturer's indications. Briefly, lipofectamine was gently mixed in opti-MEM and left at room temperature for 5min. DRR oligomer was first mixed with opti-MEM (such that the final concentration added to the cells was 20nM) and gently mixed with lipofectamine.
  • Lipofectamine-DRR oligomer complexes were incubated at room temperature for 20 minutes before being added to the cells. The day after transfection, fresh cell media was added to the transfected cells. Cells were fixed or lysed following 72h post-transfection.
  • Immunoreactive bands were detected by a goat anti-rabbit antibody linked to horseradish peroxidase (Jackson), and visualized by chemiluminescence (super ECL, Pierce).
  • Fluorescently labelled cells were visualized with a Zeiss LSM700 confocal microscope using 63x objectives.
  • 3D-lnvasion assay We plated cell drops in a cover of 10 cm culture dish (25,000 cells/drop (20 ⁇ )). Tumor spheroids were generated using the hanging drop method and implanted in a collagen type 1 matrix as previously described (Werbowetski-Ogilvie et al., Cancer Research 66: 1464-1472, 2006). The implanted spheroids were imaged after the following time points (0, 24, 48 and 72 hours). Invading areas were measured by calculating the extreme diameter at 4 different angles and by subtracting the extreme diameter of the spheroids at time zero.
  • mice Female CD1 athymic nude mice (Charles River, Canada) were anesthetized at six weeks of age using intraperitoneal injection containing Ketamine, Xylazine, and
  • Acepromazine The mice were placed on a stereotaxic apparatus and a midline scalp incision was made. A burr-hole (3-5 mm) was created 2.2 mm lateral to the bregma using a high-powered drill. The injection needle containing 100,000 cells 72h post-transfected with cy5-taged antisense was then lowered into the burr-hole to a depth of 3.0 mm to allow tumor implantation at the center of the caudate nucleus. Animals were euthanized 3 weeks post-implantation, and their brains were harvested following
  • Formalin Fixation, Tissue Processing & sectioning Harvested brain specimens were placed in 10% neutral buffered formalin (Surgipath) for 72 hours at room temperature immediately following animal sacrifice. The specimens were then incubated in 70% ethanol for 24 hours at 4 degrees. Following formalin fixation, the brain specimens were taken to the tissue processor for dehydration and tissue infiltration with paraffin at 60 degrees. Finally, the processed brains were embedded in paraffin blocks for tissue sectioning. After paraffin processing and embedding, 5 urn tissue sections were prepared using a microtome, and were mounted on a poly-L-lysine- coated glass slides (Fisher Scientific).
  • Antigen Retrieval & Immunofluorescence Prior to immunostaining; samples were baked in a standard laboratory oven at 60 °C for 1 hour, then deparaffinized and rehydrated using a graded series of xylene and ethanol, respectively. Antigen retrieval was done using citrate buffer (pH 6.0) and pressure cooking for 10 minutes. The slides were then blocked for 40 minutes with a commercial protein block (Spring Bioscience), incubated for 1 hour with anti-human Sox-2 antibody (R&D), and 20 minutes with Alexa-567 conjugated secondary antibody (Invitrogen). Washing with 0.05% TBS- Tween for 15 minutes was carried out between each step throughout the staining process. After the slides were mounted, they were imaged using the LSM 700 confocal microscope.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Microbiology (AREA)
  • Analytical Chemistry (AREA)
  • Public Health (AREA)
  • Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Hospice & Palliative Care (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Plant Pathology (AREA)
  • Epidemiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention concerne de nouvelles compositions et des procédés thérapeutiques pour le traitement du cancer, en particulier du gliome malin, du carcinome du sein, du carcinome de la prostate, du carcinome épidermoïde, du carcinome du poumon, du carcinome du côlon ou du carcinome des cellules rénales. Les compositions contiennent des molécules d'ARNi, des ARN antisens ou des vecteurs les codant qui réduisent l'expression de régulation à la baisse dans le carcinome des cellules rénales (DRR) dans les cellules tumorales et inhibent l'invasion des cellules tumorales, par exemple, l'invasion des cellules à gliome malin.
PCT/CA2012/050829 2011-11-21 2012-11-20 Procede de traitement du cancer du cerveau WO2013075233A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201161562098P 2011-11-21 2011-11-21
US61/562,098 2011-11-21

Publications (1)

Publication Number Publication Date
WO2013075233A1 true WO2013075233A1 (fr) 2013-05-30

Family

ID=48468949

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2012/050829 WO2013075233A1 (fr) 2011-11-21 2012-11-20 Procede de traitement du cancer du cerveau

Country Status (1)

Country Link
WO (1) WO2013075233A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10329560B2 (en) 2013-09-23 2019-06-25 Georgia Tech Research Corporation Targeting non-coding RNA for RNA interference
WO2022051365A3 (fr) * 2020-09-01 2022-04-14 Brown University Ciblage d'arn activateurs pour le traitement de tumeurs cérébrales primaires

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050245475A1 (en) * 2002-11-14 2005-11-03 Dharmacon, Inc. Functional and hyperfunctional siRNA directed against Bcl-2
US20050244851A1 (en) * 2004-01-13 2005-11-03 Affymetrix, Inc. Methods of analysis of alternative splicing in human
US20070134655A1 (en) * 2002-11-14 2007-06-14 Itzhak Bentwich Bioinformatically detectable group of novel regulatory genes and uses thereof
CN101474413A (zh) * 2009-02-10 2009-07-08 四川大学 Drr1基因在制备抗肿瘤药物中的用途
WO2011143762A1 (fr) * 2010-05-18 2011-11-24 The Royal Institution For The Advancement Of Learning / Mcgill University Procédé de réduction de l'expression de gènes régulés à la baisse dans des hypernéphromes dans des gliomes malins

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050245475A1 (en) * 2002-11-14 2005-11-03 Dharmacon, Inc. Functional and hyperfunctional siRNA directed against Bcl-2
US20070134655A1 (en) * 2002-11-14 2007-06-14 Itzhak Bentwich Bioinformatically detectable group of novel regulatory genes and uses thereof
US20050244851A1 (en) * 2004-01-13 2005-11-03 Affymetrix, Inc. Methods of analysis of alternative splicing in human
CN101474413A (zh) * 2009-02-10 2009-07-08 四川大学 Drr1基因在制备抗肿瘤药物中的用途
WO2011143762A1 (fr) * 2010-05-18 2011-11-24 The Royal Institution For The Advancement Of Learning / Mcgill University Procédé de réduction de l'expression de gènes régulés à la baisse dans des hypernéphromes dans des gliomes malins

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
LE, P. U. ET AL.: "DRR drives brain cancer invasion by regulating cytoskeletal-focal adhesion dynamics", ONCOGENE, vol. 29, no. 33, 14 June 2010 (2010-06-14), pages 4636 - 4647, XP055069624, ISSN: 1476-5594, Retrieved from the Internet <URL:http://wwww.nature.com/onc/jounnal/v29/n33/extref/onc2010216x9.doc> [retrieved on 20130211] *
WANG, L. ET AL.: "Loss of expression of the DRR 1 gene at chromosomal segment 3p21.1 in renal cell carcinoma", GENES, CHROMOSOMES AND CANCER, vol. 27, no. 1, January 2000 (2000-01-01), pages 1 - 10, XP055069625 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10329560B2 (en) 2013-09-23 2019-06-25 Georgia Tech Research Corporation Targeting non-coding RNA for RNA interference
WO2022051365A3 (fr) * 2020-09-01 2022-04-14 Brown University Ciblage d'arn activateurs pour le traitement de tumeurs cérébrales primaires
US12060557B2 (en) 2020-09-01 2024-08-13 Brown University Targeting enhancer RNAs for the treatment of primary brain tumors

Similar Documents

Publication Publication Date Title
JP2023123743A (ja) ＧＳＴ－π遺伝子を調節するためのＲＮＡ干渉剤
US9683237B2 (en) Multiple targeted RNAI for the treatment of cancers
WO2013173307A1 (fr) Modulation multi-cibles pour traiter la fibrose et des affections inflammatoires
US20100088775A1 (en) Methods of modulating epithelial-mesenchymal transition and mesenchymal-epithelial transition in cells and agents useful for the same
US10792299B2 (en) Methods and compositions for treating malignant tumors associated with kras mutation
US11976279B2 (en) Methods and compositions for managing vascular conditions using miR-483 mimics and HIF1alpha pathway inhibitors
US12037585B2 (en) Oligonucleotides for tissue specific gene expression modulation
EP3134528A1 (fr) Arni à cibles multiples permettant le traitement de cancers
US9493772B2 (en) Method for reducing expression of downregulated in renal cell carcinoma in malignant gliomas
US20200140859A1 (en) COMPOUNDS THAT TARGET MYC microRNA RESPONSIVE ELEMENTS FOR THE TREATMENT OF MYC-ASSOCIATED CANCER
CN106999608A (zh) 为了治疗脂质相关病症而下调mir‑132
JP2013534410A6 (ja) 悪性神経膠腫においてｄｏｗｎ ｒｅｇｕｌａｔｅｄ ｉｎ ｒｅｎａｌ ｃｅｌｌ ｃａｒｃｉｎｏｍａの発現を減少させる方法
WO2013075233A1 (fr) Procede de traitement du cancer du cerveau
CN113350527A (zh) 靶向lucat1的反义寡核苷酸及在癌症治疗中的应用
AU2013327393B2 (en) Modulation of RNA activity and vascular permeability
US20130259926A1 (en) BI-FUNCTIONAL shRNA TARGETING MESOTHELIN AND USES THEREOF
WO2011074652A1 (fr) Acide nucléique capable d&#39;inhiber l&#39;expression de hif-2a
JP7454207B2 (ja) 膵癌細胞浸潤転移阻害剤
US20220275373A1 (en) Methods and compositions for treating malignant tumors associated with kras mutation
WO2024076781A1 (fr) Polynucléotides pour le silençage d&#39;une variante de transcription 1 d&#39;un facteur d&#39;assemblage pour des microtubules spindle et leurs applications
JP2011188849A (ja) 抗腫瘍効果を有するｍｉＲ−７発現プラスミド
JP2013018754A (ja) 悪性胸膜中皮腫治療剤
CN117642508A (zh) 用于IFN-γ信号传导途径调节的寡核苷酸
JP2019033741A (ja) 悪性腫瘍に対する治療方法及び治療用組成物
TW201718854A (zh) 供ｐ２１基因調控之ＲＮＡ干擾劑

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12851447

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 12851447

Country of ref document: EP

Kind code of ref document: A1