WO2013068445A1

WO2013068445A1 - Diacylglycerol lipase and uses thereof

Info

Publication number: WO2013068445A1
Application number: PCT/EP2012/072109
Authority: WO
Inventors: Joel CAPDEVIELLE; Edgardo FERRAN; Pascual Ferrara; Jean-Claude Guillemot; Richard Legoux; Thierry VERMAT
Original assignee: Sanofi
Priority date: 2011-11-09
Filing date: 2012-11-08
Publication date: 2013-05-16
Also published as: AR088699A1

Abstract

The inventors have found that the ABHD11 protein (alias Abhydrolase domain-containing protein 11, PP1226, WBSCR21, Williams-Beuren syndrome chromosomal region 21 protein) exhibits diacylglycerol lipase activity provided the N-terminal mitochondrial targeting sequence is absent. The present invention thus pertains to a purified and enzymatically active diacylglycerol (DAG) lipase comprising a sequence at least 50% identical to SEQ ID NO: 2, 3 or 4, or a sequence consisting of a fragment of at least 50 consecutive amino acids of SEQ ID NO: 2, 3 or 4, wherein said DAG lipase is capable of catalyzing the hydrolysis of 1-stearoyl 2-arachidonoyl-sn-glycerol into 2-arachi-donoylglycerol. The invention also pertains to nucleic acids encoding such a DAG lipase, as well as related expression vectors and host cells. The invention further pertains to methods for producing such a DAG lipase, to methods for screening for modulators of such a DAG lipase, and to methods for testing the quality of a composition comprising an inhibitor of such a DAG lipase.

Description

DIACYLGLYCEROL LIPASE AND USES THEREOF

The inventors have found that the ABHD1 1 protein exhibits diacylglycerol lipase activity provided the N-terminal mitochondrial targeting sequence is absent. The present invention thus pertains to a purified and enzymatically active diacylglycerol (DAG) lipase comprising a sequence at least 50% identical to SEQ ID NO: 2, 3 or 4, or a sequence consisting of a fragment of at least 50 consecutive amino acids of SEQ ID NO: 2, 3 or 4, wherein said DAG lipase is capable of catalyzing the hydrolysis of 1 -stearoyl 2- arachidonoyl-sn-glycerol into 2-arachidonoylglycerol. The invention also pertains to nucleic acids encoding such a DAG lipase, as well as related expression vectors and host cells. The invention further pertains to methods for producing such a DAG lipase, to methods for screening for modulators of such a DAG lipase, and to methods for testing the quality of a composition comprising an inhibitor of such a DAG lipase. BACKGROUND OF THE INVENTION

1. The diacylglycerol lipase family

Diacylglycerol lipases (DAGL) are key enzymes in the biosynthesis of the endocannabinoid 2-arachidonoylglycerol. They catalyze the hydrolysis of diacylglycerol (DAG), thereby releasing a free fatty acid and a monoacylglycerol (2-AG). 2-AG is a full agonist of the cannabinoid receptor CB1 , which is part of the endocannabinoid (eCB) signaling system (Sugiura et al. 1999 J. Biol. Chem. 274:2794-2801 ).

Bisogno et al. describe the cloning and the characterization of two DAG lipases referred to as DAG La and DAGL3 (Bisogno et al. 2003 J Cell Biol. 163:463-8). Both enzymes are membrane proteins with four transmembrane domains. They exhibit the canonical "GXSXG" lipase consensus. They are equally sensitive to Ser/Cys hydrolase inhibitors such as p-hydroxy-mercuri-benzoate, HgCI₂, and PMSF. In addition, they are also inhibited by RHC80267, a 2-AG formation blocking drug.

Farooqui et al. describe the presence, in bovine brain, of two differently glycosylated DAG lipases, but fail to purify and identify the corresponding proteins (Farooqui et al. 1989 Ann N Y Acad Sci. 559:25-36).

Diacylglycerol lipase activity has also been identified in bovine brain microsomes, human platelets and bovine aorta using multiple column chromatographic techniques (Rosenberger et al. 2007 Lipids. 42:187-95; Moriyama et al. 1999 J. Biochem. 125:1077- 85; Lee and Severson 1994 J. Biochem. 298:213-9). However, the proteins linked to these DAG lipase activities have neither been purified nor identified. The DAG lipase family is thus a poorly characterized family, with only two fully characterized members, namely the DAGLa and DAGL-β membrane proteins.

2. ABHD11

ABHD1 1 is an abhydrolase domain-containing protein that is 315 amino acids long

(Swissprot entry No. Q8NFV4, version 68 last modified April 5, 201 1 ). It has been inferred from electronic annotation that ABHD1 1 may be a hydrolase. However, the biochemical reaction catalyzed by ABHD1 1 is unknown.

The gene coding for ABHD1 1 is located in the genomic region that is deleted in the Williams-Beuren syndrome (see e.g. Schubert 2009 Cell Mol Life Sci. 66:1 178-97 for a review). The Williams-Beuren syndrome is characterized by an "elfin" facial appearance, an unusually cheerful demeanor and ease with strangers, developmental delay coupled with strong language skills, and cardiovascular problems. It results from a hemizygous deletion of several genes on chromosome 7q1 1 .23, thought to arise as a consequence of unequal crossing over between highly homologous low-copy repeat sequences flanking the deleted region.

Bachovchin et al. (2010 Proc Natl Acad Sci U S A. 107:20941 -6) disclose some ABHD1 1 inhibitors. These inhibitors were identified through activity-based protein profiling (ABPP) using a chemical probe directed to the active site of serine hydrolases from mouse cells and tissues, the assays being performed in crude cell lysates. While this article discloses inhibitors, it fails to elucidate the biological activity of ABHD1 1. In particular, it neither teaches the substrate nor the products of the ABHD1 1 enzyme.

U.S. Patent No. 6,500,657 teaches that ABHD1 1 expression is increased in tumor cell lines such as those derived from breast, colon and lung tumors.

Recently, shRNA-mediated silencing of ABHD1 1 has been shown to inhibit the formation of lung metastases derived from breast cancer cells (WO 201 1/034421 ).

The role played by ABHD1 1 in metastatic development is further confirmed by another recent publication that teaches that ABHD1 1 is a biomarker predicting the development of distant metastases derived from lung adenocarcinoma (Wiedl et al., 201 1 , J. Proteomics, 74:1884-94).

In view of the critical role of ABHD1 1 in metastasis formation and its possible involvement in the Williams-Beuren syndrome, there is a need in the art for elucidating the biological activity of ABHD1 1. This would for example allow setting up a specific and accurate screening assay for identifying ABHD1 1 inhibitors, said inhibitors being useful for treating and/or preventing metastases. Identification of ABHD1 1 substrates and products is also expected to help with defining biomarkers to predict the development of these pathologies.

SUMMARY OF THE INVENTION

The inventors of the present patent application have isolated a microsomal 29 kD diacylglycerol lipase from pig brain. Surprisingly, the inventors have found that this diacylglycerol lipase corresponds to ABHD1 1. This finding is all the more unexpected as ABHD1 1 only exhibits remote sequence similarity to other known diacylglycerol lipases such as DAG La and DAGL-β. The inventors have also shown that the ABHD1 1 DAG lipase is expressed in mitochondria and not in plasma membranes, unlike DAGLa and DAGI-β. The inventors have thus identified a new family of diacylglycerol lipases.

The inventors have cloned the sequence coding for the human ABHD1 1 protein, and expressed it as a recombinant protein in E. coli, S. cerevisiae and human HEK cells. They unexpectedly found that the full-length protein of 315 amino acids does not present any diacylglycerol lipase activity. The inventors further identified an N-terminal mitochondrial targeting sequence (MTS), and have shown that this N-terminal mitochondrial targeting sequence must be absent in order for ABHD1 1 to be active.

DETAILED DESCRIPTION OF THE INVENTION

1. DAG lipase according to the invention

The inventors have found that ABHD1 1 is a diacylglycerol (DAG) lipase. The inventors have further identified an N-terminal mitochondrial targeting sequence, and found that the N-terminal mitochondrial targeting sequence must be absent in order for ABHD1 1 to be active. Therefore, a first aspect of the invention is drawn to an isolated and/or purified and/or recombinant diacylglycerol (DAG) lipase that comprises or consists of:

- a sequence of SEQ ID NO: 2, 3 or 4; or

- a sequence at least 50, 60, 70, 75, 80, 85, 90, 95, 96, 97, 98 or 99% identical to SEQ ID NO: 2, 3 or 4; or

- a sequence consisting of a fragment of at least 50, 75, 100, 125, 150, 175, 200,

225 or 250 consecutive amino acids of SEQ ID NO: 2, 3 or 4;

wherein said DAG lipase is characterized in that it is enzymatically active, i.e., it is capable of catalyzing the hydrolysis of diacylglycerol (and more specifically of 1 -stearoyl 2- arachidonoyl-sn-glycerol) into 2-arachidonoylglycerol. Such a DAG lipase will further be referred to as "DAG lipase according to the invention". The polypeptides of SEQ ID NO: 2, 3 and 4 are specific examples of such enzymatically active DAG lipases according to the invention. More specifically, the polypeptide of SEQ ID NO: 2 is a fragment of human ABHD1 1 that has been shown to be enzymatically active when produced as a recombinant protein in bacterial or yeast host cells. The polypeptides of SEQ ID NO: 3 and 4 correspond to mature isoforms of human ABHD1 1 , which are devoid of the native N-terminal mitochondrial targeting sequence of ABHD1 1 .

As used herein, an "isolated" polypeptide is a polypeptide that is isolated from cells, tissues, organs, organisms or microorganisms (it may for example correspond to a crude cell extract or to crude cell proteomes).

As used herein, the terms "purified" and "recombinant" have their usual meaning in the art. In particular, a "purified" protein refers to a protein that has not only been isolated, but that has also undergone at least one purification step. In one embodiment, the polypeptide according to the invention has a degree of purity of at least 50, 60, 70, 80, 90, 95, 96, 97, 98 or 99% (e.g. as measured by mass spectrometry). In one embodiment, the purified ABHD1 1 polypeptide represents at least 50, 60, 70, 80, 90, 95, 96, 97, 98 or 99% of the amount of total proteins. More specifically, the present inventors have obtained a purified ABHD1 1 polypeptide that has a degree of purity of about 99% (see Figure 15).

The DAG lipase according to the invention is capable of hydrolyzing diacylglycerol (and more specifically 1 -stearoyl 2-arachidonoyl-sn-glycerol) into 2-arachidonoylglycerol. Those skilled in the art can verify whether a protein exhibits this capacity using e.g. the protocols provided in Example 3.

In a specific embodiment according to the invention, the DAG lipase according to the invention is devoid of an N-terminal mitochondrial targeting sequence and/or its native N-terminal mitochondrial targeting sequence. The polypeptides consisting of SEQ ID NO: 2, 3 and 4 are specific examples of such DAG lipases.

The DAG lipase according to the invention may for example be devoid of its native N-terminal mitochondrial targeting sequence.

By "native" N-terminal mitochondrial targeting sequence is meant an N-terminal mitochondrial targeting sequence that is naturally present on a nuclearly-encoded mitochondrial protein before entry into the mitochondrion, and that is cleaved upon entry into the mitochondrion.

More specifically, two alternative N-terminal MTSs have been identified for the ABHD1 1 protein: one MTS located from position 1 to position 40 of SEQ ID NO: 1 , and one MTS located from position 1 to position 30 of SEQ ID NO: 1 . The native N-terminal mitochondrial targeting sequence (MTS) of an ABHD1 1 protein of SEQ ID NO: 1 is thus located from position 1 of SEQ ID NO: 1 to a position comprised between position 30 and position 40 of SEQ ID NO: 1 .

The native N-terminal mitochondrial targeting sequence of variants and/or orthologs of an ABHD1 1 protein of SEQ ID NO: 1 can be easily identified by sequence alignment and/or by sequence comparison with SEQ ID NO: 1 .

Therefore, the DAG lipase according to the invention can be devoid of an amino acid sequence selected from the group consisting of (i) amino acid 1 to amino acid 30 of SEQ ID NO: 1 , (ii) amino acid 1 to amino acid 40 of SEQ ID NO: 1 , and (iii) amino acids sequences corresponding to (i) or (ii) in variants and/or orthologs of the ABHD1 1 protein of SEQ ID NO: 1 (e.g. in DAG lipases comprising a sequence at least 50, 60, 70, 75, 80, 85, 90, 95, 96, 97, 98 or 99% identical to SEQ ID NO: 2, 3 or 4).

In a specific embodiment, the DAG lipase according to the invention does not comprise any N-terminal mitochondrial targeting sequence at all. Those skilled in the art can determine whether a protein comprises an N-terminal mitochondrial targeting sequence using methods well known in the art. For instance, those skilled in the art can determine whether the DAG lipase according to the invention is targeted to the mitochondrion, and thus comprises an N-terminal mitochondrial targeting sequence, by determining its cellular localization either by isolating mitochondria or by immunocytofluorescence (see e.g. Example 4.4).

In another specific embodiment, the DAG lipase according to the invention comprises a heterologous N-terminal mitochondrial targeting sequence, i.e., the N- terminal mitochondrial targeting sequence of a nuclearly-encoded mitochondrial protein that is not a DAG lipase.

In one embodiment, the DAG lipase according to the invention is a eukaryotic DAG lipase, such as a mammalian DAG lipase. In some embodiments, the DAG lipase of the invention is a human DAG lipase. A human DAG lipase according to the invention may for example comprise or consist of a sequence of SEQ ID NO: 2, 3 or 4.

The DAG lipase according to the invention may comprise or consist of a sequence at least 50, 60, 70, 75, 80, 85, 90, 95, 96, 97, 98 or 99% identical to SEQ ID NO: 2, 3 or 4. By a polypeptide having an amino acid sequence at least, for example, 95% "identical" to a query amino acid sequence of the present invention, it is intended that the amino acid sequence of the subject polypeptide is identical to the query sequence except that the subject polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the query amino acid sequence. In other words, to obtain a polypeptide having an amino acid sequence at least 95% identical to a query amino acid sequence, up to 5% (5 of 100) of the amino acid residues in the subject sequence may be inserted, deleted, or substituted with another amino acid.

In the present application, the percentage of identity is calculated using a global alignment (i.e., the two sequences are compared over their entire length). Methods for comparing the identity and homology of two or more sequences are well known in the art. The « needle » program, which uses the Needleman-Wunsch global alignment algorithm (Needleman and Wunsch, 1970 J. Mol. Biol. 48:443-453) to find the optimum alignment (including gaps) of two sequences when considering their entire length, may for example be used. The needle program is for example available on the ebi.ac.uk world wide web site. The percentage of identity in accordance with the invention may be calculated using the EMBOSS::needle (global) program with a "Gap Open" parameter equal to 10.0, a "Gap Extend" parameter equal to 0.5, and a Blosum62 matrix.

Proteins consisting of an amino acid sequence at least 50, 60, 70, 75, 80, 85, 90, 95, 96, 97, 98 or 99% identical to a reference sequence may comprise mutations such as deletions, insertions and/or substitutions compared to the reference sequence. In case of substitutions, the substitution may correspond to a conservative substitution as indicated in the table below.

The protein consisting of an amino acid sequence at least 50, 60, 70, 75, 80, 85,

90, 95, 96, 97, 98 or 99% identical to a reference sequence may for example correspond to a homologous sequence derived from another species than the reference sequence (e.g. the mature, processed form of an ortholog of human ABHD1 1 , for example one of the orthologs presented on Figure 10), to a splice variant of the reference sequence, or to an allelic variant of the reference sequence.

The DAG lipase according to the invention may also comprise or consist of a sequence consisting or a fragment of at least 50, 75, 100, 125, 150, 160, 175, 200, 225 or 250 consecutive amino acids of SEQ ID NO: 2, 3 or 4. In some embodiments, the fragment comprises or consists of: - amino acids 94 (G94) to 98 (G98) of SEQ ID NO: 2, which includes the lipase motif; and

- amino acids 96 (S96) to 251 (H251 ) of SEQ ID NO: 2, which includes the catalytic triad; and

- amino acids 94 (G94) to 251 (H251 ) of SEQ ID NO: 2, which includes both the lipase motif and the catalytic triad.

Those skilled in the art can easily identify the corresponding positions on SEQ ID NO: 3 and 4, e.g. by looking at Figure 5 or by performing a sequence alignment.

In addition to the sequence at least 50% identical to SEQ ID NO: 2, 3 or 4 or the fragment of at least 50 consecutive amino acids of SEQ ID NO: 2, 3 or 4, the DAG lipase according to the invention may comprise one or more additional sequences such as a signal peptide (in order for the DAG lipase to be secreted), a purification tag (e.g. a His- Tag or a Flag-Tag), a heterologous N-terminal mitochondrial targeting sequence (in order for the DAG lipase to be directed to the mitochondrion), and/or an N-terminal methionine (as a signal for start of translation of the recombinant protein).

2. Nucleic acids, expression vectors and host cells according to the invention

A second aspect of the invention is drawn to an isolated nucleic acid comprising or consisting of a sequence encoding the DAG lipase according to the invention, as defined in the above paragraph.

Such a nucleic acid according to the invention may for example comprise or consist of a sequence selected from the group consisting of:

- a sequence of SEQ ID NO: 9;

- a sequence differing from SEQ ID NO: 9 by the degeneracy of the genetic code; - a sequence at least 50, 60, 70, 75, 80, 85, 90, 95, 96, 97, 98 or 99% identical to

SEQ ID NO: 9; or

- a sequence comprising or consisting of a fragment of at least 150 consecutive nucleotides of SEQ ID NO: 9. In one embodiment, said fragment encodes a DAG lipase according to the invention comprising or consisting of amino acids 94 to 98, amino acids 96 to 251 , or amino acids 94 to 251 of SEQ ID NO: 2.

In a specific embodiment, such a nucleic acid according to the invention does not comprise any sequence coding for an N-terminal mitochondrial targeting sequence and/or any sequence coding for the native N-terminal mitochondrial targeting sequence of the encoded DAG lipase. A third aspect of the invention is drawn to an expression vector comprising the above nucleic acid according to the invention. In such an expression vector, the nucleic acid according to the invention is operatively linked to genetic elements suitable for expression of the DAG lipase according to the invention (e.g. a promoter, an enhancer, a terminator, a 3'UTS and/or a 5' UTS).

The expression vector according to the invention may for example correspond to the p4216, p4413 or p4423 vector, said vectors being described in the Examples. More specifically, Example 2 and Figures 7 and 8 demonstrate that such expression vectors allow the expression of enzymatically active ABHD1 1 polypeptides.

In a specific embodiment, for instance when the expression vector is intended for transfection into a non-human or non-mammalian cell, the expression vector according to the invention does not comprise any sequence coding for an N-terminal mitochondrial targeting sequence and/or any sequence coding for the native N-terminal mitochondrial targeting sequence of the encoded DAG lipase. Examples of such expression vectors include the p4413 and p4423 vectors.

A fourth aspect of the invention is drawn to a host cell comprising the above nucleic acid according to the invention or the above expression vector according to the invention. Such a host cell is capable of expressing the DAG lipase according to the invention when cultivated under appropriate conditions.

The host cell may be transiently or stably transfected with said nucleic acid or expression vector. In some embodiments, the cell is stably transfected.

The host cell may be a eukaryotic or prokaryotic cell, including bacterial cells (e.g. E. coli or B.subtilis), fungal cells (e.g. S. cerevisiae, A. niger or P. pastoris), insect cells and mammalian cells (e.g. a CHO cell or a human cell such as HEK or PER.C6).

The host cell according to the invention may for example be a human cell line transfected with p4216 vector, a bacterial cell transfected with the p4413 vector, or a yeast cell transfected with the p4423 vector. 3. Methods of producing the DAG lipase according to the invention

The DAG lipase according to the invention may be produced by any method known in the art, including recombinant technologies and chemical synthesis.

In a specific embodiment, the DAG lipase according to the invention is produced through recombinant technologies. Therefore, a fifth aspect of the invention is drawn to a method for producing a DAG lipase according to the invention, said method comprising or consisting of the steps of: a) providing a host cell according to the invention as described in the above paragraph;

b) cultivating said host cell under conditions suitable for expression of a DAG lipase according to the invention;

c) isolating said DAG lipase and purifying said DAG lipase; and

d) optionally formulating said DAG lipase into a composition, such as e.g. a composition suitable for its storage.

Examples of methods that may be used for cultivating host cells, and/or for isolating and purifying the DAG lipase according to the invention, are described in Examples 1 and 2.

In a specific embodiment, the host cell that is used in the above method is characterized in that it comprises an expression vector according to the invention that does not comprise any sequence coding for an N-terminal mitochondrial targeting sequence and/or any sequence coding for the native N-terminal mitochondrial targeting sequence of the encoded DAG lipase.

The above method for producing a DAG lipase according to the invention may further comprise the step of determining whether the DAG lipase obtained at step (c) or (d) is capable of catalyzing the hydrolysis of diacylglycerol (and more specifically of 1 - stearoyl 2-arachidonoyl-sn-glycerol) into 2-arachidonoylglycerol. For instance, this may be done by detecting the presence of the molecule referred to as having an m/z of 287.02(+), such a method being described in Examples 1.3 and 3.

4. Methods of use of the DAG lipase according to the invention

shRNA-mediated silencing of ABHD1 1 inhibits the formation of lung metastases derived from beast cancer cells (WO 201 1/034421 ). Therefore, a method for screening for inhibitors of the DAG lipase according to the invention is a valuable tool for identifying new anti-cancer agents. A sixth aspect of the invention thus provides a method for screening for modulators of a DAG lipase according to the invention, said method comprising or consisting of the steps of:

a) providing a DAG lipase according to the invention or a host cell according to the invention;

b) contacting said DAG lipase or host cell with a candidate compound and with diacylglycerol (in some embodiments, 1 -stearoyl 2-arachidonoyl-sn-glycerol); and c) determining whether said candidate compound reduces or enhances the hydrolysis of diacylglycerol into 2-arachidonoylglycerol as compared to a control; wherein the determination that a candidate compound reduces or enhances the hydrolysis of diacylglycerol into 2-arachidonoylglycerol at step (c) indicates that said candidate compound is a modulator of said DAG lipase.

One or more controls may be used at step (c). The control(s) may for example correspond to a negative control (i.e. a DAG lipase or a host cell that has not been contacted by any candidate compound or modulator). The control(s) may be a DAG lipase or a host cell that has been contacted with a known modulator that is used as a reference (e.g. an inhibitor such as PMSF, RHC80267, or WWL222).

In a specific embodiment, the method involves identifying compounds that are inhibitors of the DAG lipase according to the invention. In such a method, the determination that the candidate compound reduces the hydrolysis of diacylglycerol into 2- arachidonoylglycerol as compared to a control indicates that said candidate compound is an inhibitor of the DAG lipase.

By "inhibitor" of the DAG lipase according to the invention is meant a compound in the presence of which the hydrolysis of diacylglycerol into 2-arachidonoylglycerol is significantly reduced and/or inhibited as compared to a negative control. In some embodiments, the hydrolysis of diacylglycerol into 2-arachidonoylglycerol can be reduced and/or inhibited by at least 5, 10, 25, 50, 75 or 90% as compared to the negative control.

Inhibitors of ABHD1 1 include, but are not limited to, agents that interfere with the catalytic site of ABHD1 1 , agents that interfere with the interaction of ABHD1 1 with its natural ligand(s) in the mitochondrial compartment, and agents that reduce ABHD1 1 expression, either at transcriptional level or at the translational level. The inhibitor may for example directly interact and/or bind to the ABHD1 1 protein, or the ABHD1 1 mRNA, or the ABHD1 1 gene.

Such inhibitors may be any type of compound. For example, the inhibitor may be selected from the group consisting of a chemical and/or organic molecule (e.g. a small molecule), an aptamer, a peptide, an interfering RNAs targeting ABHD1 1 (e.g. a siRNA or a shRNA), an antisense nucleic acid and an antibody specifically binding to ABHD1 1 (e.g. a monoclonal antibody, including chimeric, humanized and fully human antibodies).

Some inhibitors of mouse ABHD1 1 are already known in the art.

In particular, Bachovchin et al. (2010 Proc Natl Acad Sci U S A. 107:20941 -6) disclose nineteen ABHD1 1 inhibitors which are referred to as WWL151 , WWL209, WWL210, WW21 1 , WWL214, WWL215, WWL216, WWL219, WWL220, WWL222, WWL223, WWL225, WWL226, WWL227, WWL228, WWL229, WWL230, WWL231 and WW232, respectively. The structure of these inhibitors is shown at page 20945, Table 3, of Bachovchin et al., which is hereby incorporated by reference. These inhibitors notably include the WWL222 optimized inhibitor.

The DAG lipase according to the invention is also inhibited by unspecific Ser/Cys hydrolase inhibitors such as PMSF, and by 2-AG formation blocking drugs such as RHC80267.

Finally, ABHD1 1 inhibitors also include compounds such as interfering RNAs targeting ABHD1 1 , antibodies specifically binding to ABHD1 1 and antisense nucleic acids. Such compounds can easily be obtained through methods well-known in the art. For instance, interfering RNAs targeting ABHD1 1 may be designed using the Whitehead siRNA algorithm (available at the jura.wi.mit.edu/bioc/siRNAext website) or the siRNA designer software from Clontech (available at the bioinfo.clontech.com/rnaidesigner/ website). Specific examples of interfering RNA targeting ABHD1 1 include, e.g., the shRNAs used in the examples of WO 201 1/034421. Likewise, various methods for obtaining monoclonal antibodies specifically binding to ABHD1 1 are well-known in the art (see e.g. Yamashita et al. 2007 Cytotechnology. 55:55-60).

The elucidation of the biological activity of ABHD1 1 provides a method for testing the quality of a composition comprising the above inhibitors. Such a testing is useful e.g. when optimizing a formulation before or during clinical trials, and/or for quality tests before batch release. A seventh aspect of the invention thus provides a method for testing the quality of a composition comprising an inhibitor of a DAG lipase according to the invention, said method comprising or consisting of the steps of:

a) providing an inhibitor of the DAG lipase according to the invention;

b) formulating said inhibitor into a composition;

c) providing a DAG lipase according to the invention or a host cell according to the invention;

d) contacting said DAG lipase or said host cell with diacylglycerol (such as 1 - stearoyl 2-arachidonoyl-sn-glycerol) and with said composition; and

e) determining whether said composition reduces the hydrolysis of diacylglycerol into 2-arachidonoylglycerol as compared to a control;

wherein the determination made at step (e) is indicative of the quality of the composition.

One or more controls may be used at step (e). The control(s) may for example correspond to a negative control (i.e. a DAG lipase or a host cell that has neither been contacted any candidate compound nor with any inhibitor) or to a DAG lipase or a host cell that has been contacted with a known inhibitor that is used as a reference (e.g. PMSF, RHC80267 or WWL222). Additionally or alternatively, step (e) may comprise determining whether said composition hydrolyses diacylglycerol into 2-arachidonoylglycerol to a similar extent as a positive control (i.e. a reference composition having the desired quality).

In a specific embodiment, the method for testing the quality of a composition comprising an inhibitor of a DAG lipase according to the invention is carried out to test an inhibitor selected from the group consisting of an interfering RNA targeting ABHD1 1 , an antibody specifically binding to ABHD1 1 , PMSF, RHC80267, WWL151 , WWL209, WWL210, WW21 1 , WWL214, WWL215, WWL216, WWL219, WWL220, WWL222, WWL223, WWL225, WWL226, WWL227, WWL228, WWL229, WWL230, WWL231 and WW232.

The host cell that can be used in the above methods may comprise an expression vector according to the invention that does not comprise any sequence coding for an N- terminal mitochondrial targeting sequence and/or any sequence coding for the native N- terminal mitochondrial targeting sequence of the encoded DAG lipase.

The invention further provides the in vitro or ex vivo use of the DAG lipase or host cell according to the invention for catalyzing the hydrolysis of diacylglycerol (including 1 - stearoyl 2-arachidonoyl-sn-glycerol) into 2-arachidonoylglycerol, and a method for synthesizing 2-arachidonoylglycerol comprising the step of contacting the DAG lipase or host cell according to the invention with diacylglycerol (such as 1 -stearoyl 2-arachidonoyl- sn-glycerol).

Several documents are cited throughout the text of this specification. Each of the documents herein (including any journal article or abstract, published or unpublished patent application, issued patent, manufacturer's specifications, instructions, etc.) are hereby incorporated by reference. However, there is no admission that any document cited herein is indeed prior art as to the present invention.

The invention will further be described by reference to the following drawings and examples, which are illustrative only, and are not intended to limit the present invention. Indeed, the invention is defined by the claims, which should be interpreted with the help of the description and the drawings. BRIEF DESCRIPTION OF THE FIGURES

Figure 1 shows Gel-based ABPP (activities based protein profiling) profiles of chromatographic steps. Labels +/- indicate PMSF (+) or vehicle (-). Labeling with the FP- bodipy probe was done at 10^"7 M for monitoring the purification process. (A) Triton TX100 (TX100) whole pig brain extract showing a 29KD band (arrow), which is inhibited by PMSF and represents the potential DAG lipase targeted for purification. The two upper bands represent the monoacylglycerol lipase (MGL), another serine hydrolase, confirmed by Western blot analyses (Data not shown). (B) Pool after Heparin Sepharose step. DAG lipase activities were retained on Heparine and separated from MonoAcyl glycerol. Lipase and sample were free from Triton TX100, allowing enzymatic assays and mass detection analyses. (C) Pool from S75 superdex Gel filtration. The selected pool around 30 Kd contained the targeted protein. (D) Detection by ABPP of 29 Kd proteins eluted from MonoQ, indicating a purification of DAG activity to homogeneity, which was associated with a protein as shown with Sypro ruby staining, (E). The lower band below 15Kda represents residual hemoglobin from pig brain

Figure 2 illustrates the reverse phase C4 HPLC (Brownlee column) separation of the MonoQ eluted fraction, FP-Bodipy pre-labeled. The column was equilibrated with 70% eluent A and 30% eluent B for 10 minutes after injection. Sample was eluted with a linear gradient to 50 % eluent B in 40 minutes. Fractions were collected at 2 minute intervals and absorbance was monitored at 210 nm. (A) UV monitoring of proteins eluted by reverse phase chromatography. The potential DAG lipase was pre-labeled with the FP- bodipy probe to circumvent enzymatic activity inhibition by acidic and denaturing HPLC conditions. Fractions 16-17-18 were collected from 32 min to 36 min. (B) SDS-PAGE analyses of the HPLC-eluted fractions. The numbers below each gel image correspond to the eluted fractions. The 29Kd FP-Bodipy labeled protein eluted around 43% acetonitrile in fraction 16-17-18 was submitted to trypsin digestion and LC-MSMS experiments for protein characterization.

Figure 3 shows the enzymatic DAG lipase activity of the 29 Kd FP-Bodipy labeled protein that eluted from heparin. 2-AG synthesis with purified brain ABHD1 1 and the effects of inhibitors PMSF & RHC80267 is shown. Heparin eluted fraction is tested on DAG lipase assay: preincubation with inhibitors (1 mM), or buffer, followed by 6 hr DAG lipase incubation with DAG-encapsulated liposomes. All data were normalized on m/z 287.2 intensity and represent the average of 2 individual experiments. DAG lipase activity of brain purified enzyme was inhibited by RHC80267 and slightly by PMSF.

Figure 4 summarizes the process that allowed the isolation and identification of ABHD1 1 (on the left), as well as the purification process used upon recombinant protein expression (on the right).

Figure 5 shows the sequence of human ABDH1 1 (SEQ ID NO: 1 ). The underlined bold amino acids indicate the lipase consensus sequence. The boxes indicate the amino acids of the catalytic triad. The arrows indicate the N-terminal extremity of the DAG lipases of SEQ ID Nos. 2, 3 and 4.

Figure 6. Left panel (6-1): ABPP profiles of proteins eluted after Heparin-

Sepharose from TX100 extracts (containing crude mitochondria) from HEK cells transfected with ABHD1 1. Labels +/- indicate PMSF (+) or vehicle (-). TX100 Extracts were purified on Heparine Sepharose and the eluate was submitted to ABPP profiling. The transfected ABHD1 1 eluted from Heparin by 0.5M NaCI was detected (black arrow) only in the absence of PMSF (1 mM). ABHD1 1 molecular weight is around 29 Kd, suggesting cleavage of a mitochondria signal peptide. Right panel (6-2): Mass spectrometry analyses of 2-AG synthesis with recombinant ABHD1 1 , and effects of inhibitors PMSF & RHC80267. Recombinant proteins were analyzed by the DAG lipase assay after heparine step. The samples were pre-incubated with inhibitors (1 mM) or vehicle for 30 minutes, and then the enzymatic assay was carried out with DAG- encapsulated liposomes for 6 hours. The values are normalized on m/z 287.2 intensity from heparin eluate, and represent the average of two individual experiments. Profiles of inhibitors RHC and PMSF are the same as in ABPP profiling.

Figure 7 illustrates expression of full length and mature ABHD1 1 in E. coli. strains transfected with the p4412 and p4413 plasmids. Left panel: SDS-PAGE gels with ABPP profiles. Soluble extracts were prepared by sonication in MOPS 0.2%TX100 buffer. "+" and "-" indicate PMSF or vehicle, respectively. Lanes 1 & 2 were loaded with brain ABHD1 1 (positive labeling of the 29 Kd DAG lipase is seen in the absence of PMSF). Lanes 3 & 4 were loaded with ABHD1 1 expressed from the p4413 plasmid (positive labeling of the 29 Kd DAG lipase is seen with PMSF). Lanes 5 & 6 were loaded with ABHD1 1 expressed from the p4412 plasmid (labeling of the 34 Kd DAG lipase is not seen). This data indicates that the 29 Kd processed ABHD1 1 protein exhibits DAG lipase activity, whereas the full length ABHD1 1 protein is inactive. Right panel: selective visualization of human ABHD1 1 expressed in E. coli by Western blot. "4412" indicates transfection with the p4412 plasmid (expressing full length ABHD1 1 ), and "4413" indicates transfection with the p4413 plasmid (expressing mature ABHD1 1 ).

Figure 8 illustrates expression of the ABHD1 1 genes in S. cerevisiae. Plasmids coding for full length ABHD1 1 (p441 1 ) and mature ABHD1 1 (p4423) were used. Left panel: SDS-PAGE gels showing ABPP profiles. Soluble extracts were prepared by sonication in MOPS 0.2% TX100 buffer. "+" and "-" indicate PMSF or vehicle, respectively. Lane 1 was loaded with labeled 29 Kd pig brain ABHD1 1. Lanes 4 & 5 were loaded with ABHD1 1 expressed from p4423 (positive labeling of the 29 Kd DAG lipase is seen with PMSF). Lanes 2 & 3 were loaded with ABHD1 1 expressed from p441 1 (labeling of the 34 Kd DAG lipase was not seen). The arrow highlights the 29 Kd protein. Right panel: selective visualization of human ABHD1 1 expressed in S. cerevisiae by Western blot. "441 1 " indicates transfection with the p441 1 plasmid (expressing full length ABHD1 1 ), and "4423" indicates transfection with the p4423 plasmid (expressing mature ABHD1 1 ). Figure 9 shows a sequence comparison between human mature ABDH1 1 (SEQ ID NO: 3), human DAG La (SEQ ID NO: 19) and human DAGL-β (SEQ ID NO: 20). SEQ ID NO: 3 exhibits 5.2% identity with DAGLa, and 8.4% identity with DAGL-β, the percentage of identity being calculated with the EMBOSS::needle (global) program using default parameters.

Figure 10 shows a dendogram profiling of human ABHD1 1 and various orthologs of ABHD1 1 , representing several different species. The nomenclature used on the figure is "Gene_Species" with:

"Gene" is either the gene name, when found in the NCBI gene file (see gene2refseq and geneinfo at the ftp.ncbi.nlm.nih.gov/gene/DATA ftp site), or the RefSeq identifier when no gene name was found; and

"Species" is the first letter of the genus, followed by the name of the species as taken from the Refseq sequence definition line.

Figure 1 1 depicts the Lineweaver-Burk plot showing 2-AG formation with varying concentrations of ABHD1 1. The purified recombinant ABHD1 1 protein (2.7 μg) was added to varying concentrations of 1 -stearoyl-2-arachidonoyl-sn-glycerol (75 μΜ-150 μΜ-300 μΜ-1000 μΜ) and the reaction mixture was incubated at 37°C for 5 minutes.

Figure 12 illustrates the purification of mitochondria from whole mouse brain by ultracentrifigation on gradient percoll density. Mitochondrial enrichment was tracked by analysis of the endoplasm reticulum protein (calregulin), cytoplasm protein L-lactate dehydrogenase A chain (P00338, LDH), and mitochondrial protein Voltage-dependent anion-selective channel protein 1 (P21796, VDAC-1 ). Lane 1 contains the highly enriched mitochondrial fraction. Lane 2 & 3 accumulated at the top of the gradient and contain the majority of synaptosomes (and probably other membrane-enclosed structures containing cytosol), some myelin and mitochondria. Lane 4 was obtained after a wash step. Lanes 5 & 6 were supernatants obtained at 20000 g and at 1500 g, respectively. Lane 7 corresponds to a control brain extract.

Figure 13 shows the gene expression pattern of ABHD1 1 , which was obtained as described in Example 3.4. Expression of the following genes was studied for each tissue: DAGbeta (white, on the left), ABHD1 1 (grey, at the second position), DAGalpha (dark grey, at the third position), and Ribosomal Protein, Large, P0 (RPLP0, white, on the right).

Figure 14 and 15 show proteomic mass spectrometry characterization of recombinant human ABHD1 1. For ESI-QTOF analyses (Figure 14), the sample was introduced by LCMS in an acetonitrile gradient (0.2% aqueous formic acid) and the m/z spectrum shows a Gaussian-type distribution of multiply charged ions. In addition, Figure 15 show the molecular mass profile generated from the m/z spectra of high molecular mass multiply charged sample with the processing software associated, Maximum Entropy processing (MaxEnt from MassLynx: micromass). The mass profile is dominated by a component of molecular mass 30278 daltons, with a series of minor peaks at higher masses indicating purity of the protein. Purified human ABHD1 1 was further characterized after in-solution trypsin digestion by peptide fingerprinting and tandem LTQ MSMS in order to determine its exact sequence (see paragraph 4.1 ).

BRIEF DESCRIPTION OF THE SEQUENCES

SEQ ID NO: 1 is the sequence of full length ABDH1 1.

SEQ ID NO: 2 is the sequence of an enzymatically active ABHD1 1 protein devoid of any N-terminal mitochondrial targeting sequence.

SEQ ID NO: 3 is the sequence of a mature, processed isoform of ABHD1 1 , devoid of its native N-terminal mitochondrial targeting sequence.

SEQ ID NO: 4 is the sequence of an alternative mature, processed isoform of ABHD1 1 .

SEQ ID NO: 5 is the sequence of the p4216 plasmid.

SEQ ID NO: 6 is the sequence of the p4412 plasmid.

SEQ ID NO: 7 is the sequence of the p441 1 plasmid.

SEQ ID NO: 8 is a nucleotide sequence encoding full length ABHD1 1 .

SEQ ID NO: 9 is a nucleotide sequence encoding an ABHD1 1 protein devoid of its native N-terminal mitochondrial targeting sequence.

SEQ ID Nos. 10 to 20 are the sequences of primers used in the Examples.

SEQ ID NO: 21 is the sequence of DAGLa.

SEQ ID NO: 22 is the sequence of DAGI-β.

SEQ ID Nos. 23 to 47 are the sequences of peptides identified in MALDI TOF MS fingerprinting and tandem MSMS experiments.

SEQ ID Nos. 48 to 58 are the sequences of putative targets of the FP-Bodipy probe.

SEQ ID NO: 59 is the GXSXG lipase consensus sequence.

EXAMPLES

As described in detail below, the inventors purified a DAGL to homogeneity from whole pig brain with chromatographic steps, and identified ABHD1 1 as being a DAGL responsible for 2-AG synthesis from 1 -stearoyl 2-arachidonoyl-sn-glycerol (DAG). Two different isoforms of the ABDH1 1 protein were expressed in HEK cells, S. cerevisiae and E.coli. It was shown that the purified, mature enzyme hydrolyses DAG to 2-AG. 1. Purification of ABHD11 from pig brain

1.1. Material and Methods

Extraction from Frozen pig brain

One pig brain about 90 g was homogenized in 200 ml of homogenizing buffer A

(0.1 M MOPS pH 7.4 - 0.2% TX100 ) without protease inhibitors in a motor-driven stainless steel mixer, transferred and left in a glass container for 18 hours, with constant stirring. The suspension was centrifuged at 10000 g for 15 minutes to remove debris. The 200 ml supernatant (SN1 ) was centrifuged at 100000 g for 1 hour and subjected to (NH4)2S04 precipitation. All these steps were carried out at 4 °C.

(NH4)2SQ4 precipitations

The SN1 supernatant was adjusted from 0% to 30 % (NH4)2S04 and equilibrated overnight, then centrifuged at 4°C at 100000 g for 30 minutes in centrifuge polycarbonate bottles. The pellets after centrifugation were resuspended in up to 30ml of buffer A, and the suspension was centrifuged for additional 30 minutes at 100000 g in order to remove insoluble material. The resulting TX100 extract (SN2) was analyzed by ABPP analyses with FP-Bodipy probe and used as starting material for further purification.

Heparin-Sepharose affinity chromatography

The pooled fractions were then applied to a 5 ml heparin-Sepharose Hitrap column (GE Healthcare) equilibrated with 0.1 M MOPS buffer ph7.4. The column was washed with this buffer at a flow rate of 1 ml/min and then eluted with a step gradient of 0.5 M NaCI in the same buffer. Fractions of 5ml were collected and 1 % of each fraction was labeled with FP-Bodipy, and analyzed as described next.

ABPP Experiments

Activity-based protein profiling (ABPP) reactions with a probe referred to as FP-

Bodipy were performed in a 100 μΙ format in 0.1 M MOPS buffer at pH 7.4, on about 25 μg of total protein from cells or tissue lysis. Inhibitors were added at the indicated concentration, and the mixtures were incubated for 30 min at 4°C. FP-Bodipy was then added at a final concentration of 0.1 μΜ.

After an additional 30 minute incubation at 4°C, the labeling reaction was stopped by adding 50 μΙ_ of 2X gel loading buffer and heating at 60°C for 15 min. The samples were then centrifuged, concentrated to 50 μΙ, loaded on a 10% Bis-tris SDS-PAGE gel, and separated by electrophoresis at 130V in MOPS buffer.

Labeled proteins were in-gel visualized by using a flatbed fluorescence scanner (Typhoon-Biorad). Concentration-dependent inhibition curves were obtained from integrated gel band intensities (Quantity one software-BIORAD). A heparine enriched fraction was treated with 1 mM PMSF inhibitor (Sigma Aldrich, Catalog reference No. P7626) or DMSO for 30 minutes and then incubated with a biotinylated FP-Bodipy probe for 60 minutes. Probe-labeled proteins were enriched and characterized by a combination of avidin affinity and liquid chromatography-mass.

The probes referred to as FP-Bodipy and FP-Biotin are probes identical to the probe shown on Figure 1 of Jessani and Cravatt (2004 Curr Opin Chem Biol. 8:54-9), except that the Tag is bodipy or biotin instead of rhodamine.

Superdex S-75 Gel Filtration

Soluble extracts from a 30%-saturated-(NH4)2SO4-sample were loaded on Hiload Superdex-75-26/60 equilibrated with 50mM MOPS pH 7.4, at a flow rate of 5ml/mn. 1 % of each fraction eluted from gel filtration was analyzed for serine hydrolase activity by ABPP using the FP-Bodipy probe, and the positive fractions were pooled for Heparin affinity chromatography. All of the chromatography procedures were performed in a 4°C cold room.

RP-HPLC purification and Trypsin digestions

500 μΙ of the positive Heparin-Sepharose fraction were labeled with FP-Bodipy, before RP-HPLC, mixed with the remaining 4500 μΙ, and loaded on a C4 reverse phase column (Brownlee Labs cartridge), mounted on an HP1 100 Agilent on line with a fraction collector (Gilson FC203B). The column was equilibrated with 70% eluent A (H20 0.1 % TFA) and 30% eluent B (CH3CN-0.1 % TFA) at 300 μΙ/m, followed by a linear gradient to 50% B in 40 min, and monitored at 210 nm. 1 .2 ml fractions were collected, and 10% of each fraction was dried under vacuum with Laemmli buffer for SDS-PAGE analyses and ABPP profiling. Fractions containing FP-Bodipy labeled proteins were pooled, freeze-dried and dissolved in 50 μΙ of 50 mM Tris, pH 8.9 and 1 M urea. The trypsin digestion was performed for at least 12 hours after denaturation with 6 M urea and reduction with 10 mM DTT in 25 mM ammonium bicarbonate pH 8.9 at 56 °C for 30 minutes, lodoacetamide was then added to a final concentration of 50 mM. The resulting mixture was incubated at room temperature in darkness for 45 minutes. The mixture was then diluted 4-fold to reduce urea concentration, and after addition of trypsin (1 :50 protease-to-protein ratio), was incubated at 37 °C overnight, and submitted to LC-MSMS Orbitrap analyses.

LC-MSMS experiments

NanoLC-MS/MS analysis was performed on an Ultimate/Famos/Switchos suite of instruments (Dionex) connected to a hybrid LTQ Orbitrap mass spectrometer (Thermo Fisher Scientific) equipped with a nanoelectrospray source. Tryptic digests were loaded onto a pre-column (100 A Ci₈ Pepmap, Dionex, 5 mm x 300 μηη,) and washed with 0.2% HCOOH at 30 μΙ/min using the Switchos pump for 5 minutes. Peptides were then eluted on a Ci₈ reverse-phase nanoflow column (100 A C18 Pepmap, Dionex, 150 mm x 75 μηη) with a linear gradient of 5-40% solvent B (H2O/CH₃CN/HCOOH, 10:90:0.2, by volume) for 125 minutes, 40-90% solvent B for 20 minutes, and 90% solvent B for 5 minutes, at a flow rate of 200 nL/min. The mass spectrometer was operated in the data-dependent mode to automatically switch between MS and MS/MS acquisition. Survey full scan MS spectra (from m/z 300-1700) were acquired in the Orbitrap with a resolution of 60,000 at m/z: 400. The AGC was set to 1 x 10⁶ with a maximum injection time of 500 ms. The most intense ions (up to 5) were then isolated for fragmentation in the LTQ linear ion trap using a normalized collision energy of 35% at the default activation q of 0.25 with an AGC settings of 1 x 10⁵ and a maximum injection time of 100 ms. The dynamic exclusion time window was set to 900 s. Samples were injected in triplicate. All m/z selected for MS/MS during the first LC-MS/MS experiment were excluded of MS/MS process for the next LC-MS/MS run (generation of a reject mass list with a 10 ppm m/z window and a 10 minute retention time window, see LC-MS/MS data processing). The third run was then performed with a reject mass list generated from the 1^st and 2^nd LC-MS/MS experiments. Ion selection threshold was set to 80,000 counts for the 1^st LC-MS/MS run and to 40000 and 20000 for the 2^nd and 3^rd LC-MS/MS experiments, respectively.

LC-MS/MS data processing

LC-MS/MS data, acquired using the Xcalibur software (version 2.07, Thermo- Fisher Scientific), were processed using a home made Visual Basic program software developed using XRawfile libraries (distributed by Thermo-Fisher Scientific). Four different files were generated by this program: the first one corresponds to a MS/MS peak list (MGF file) which was used for database searching. This MGF file contains the exact parent mass and the retention time (RT) associated with each LTQ-MS/MS spectrum. The exact parent mass is the ¹²C isotope ion mass of the most intense isotopic pattern detected on the high resolution Orbitrap MS parallel scan and included in the LTQ-MS/MS selection window. The RT is issued from the LTQ-MS/MS scan. The second file is an MS/MS log file which reports, for each acquired MS/MS, the scan number, the ¹²C isotope exact mass, the RT and the parent filter (LTQ selection window). The third file corresponds to the conversion of the high resolution MS raw data file into a ".csv" format file which was used for quantitative analysis. The last file generated by the home made Visual Basic program software is an exclude list text file which contains the ¹²C isotope precursor ion mass with the corresponding start/end exclude RT 10 minute window. The Xcalibur software uses this exclude list as the reject mass list (specifies which parent ions cannot trigger a dependent scan) during the 2^nd and 3^rd LC-MS/MS experiments (see nanoLC-MS/MS analysis). Database Searching

Database searches were done using an internal MASCOT server (version 2.1 , matrix Science, available on the matrixscience.com world wide web site) using the Swiss- Prot database containing 402,482 entries. The search parameters used for post- translational modifications were a fixed modification of +57.02146 Da on cysteine residues (carboxyamidomethylation) and dynamic modifications of +15.99491 on methionine residues (oxidation), +42.010565 on protein N-terminal residues (N-terminal acetylating) and -17.026549 on N-terminal glutamine residues (N-Pyroglu). The precursor mass tolerance was set to 5 ppm and the fragment ion tolerance was set to 0.5 Da. The number of missed cleavage sites for trypsin was set to 3. Mascot result files (".dat" files) were imported into Scaffold software (available on the proteomesoftware.com world wide web site). Queries were also used for XTandem parallel Database Search. The compiled results of both database searches were exported.

Liposome preparation

10 μΙ DAG (10 mg/ml in CH3CN) was mixed with 50 μΙ Lyso phosphatidyl choline

(LPC-SIGMA at 5 mg/ml in CHCL3), evaporated to dryness, solubilized with 30 μΙ CHCI3 followed by 100μΙ of homogenizing buffer (0.1 M MOPS pH 7.4, 0, 25% BSA) and then submitted to ultrasound using a warming ultrasonic bath (Deltasonic) in an open tube at 37°C for 15 minutes, allowing slow CHCL3 evaporation and liposome generation.

Enzymatic reaction essay

DGL activity was measured at 37°C for 20 hours with 90 μΙ of 100 mM MOPS pH 7.4, 100 μΙ of purified fraction from brain, or subsequent quantity of recombinant ABHD1 1 , and 10 μΙ DAG in LPC liposome as substrate (150 μΜ final DAG), or variable amount for enzymatic characterization.

For PMSF and RHC80267 inhibition, preincubation was done for 30 minutes at 3 mM and 1 mM, respectively, before adding DAG. RHC80267 from Sigma Aldrich was used (Catalog reference No. R2028). The reactions were stopped by adding chloroform supplemented with internal standard 2-AG-D8 (Cayman chemicals) for extraction. After centrifugation at 1 ,500.g for 5 minutes, the organic layers were collected and dried under vacuum. The residues were suspended with 50 μΙ of an 80:20 mix of H20/CH3CN and analyzed by high performance liquid chromatography/mass spectrometry in "MRM-like" mode.

LC-MSMS "MRM-like" experiment

The HPLC system consisted of an Ultimate (DIONEX) mounted with a NanoColumn POROS R1 - 150 mm x 75 μπι, equilibrated with 70% eluent A (H20 0.2% HCOOH) and 30% eluent B (CH3CN 0.2% HCOOH). 2-AG was eluted with a linear gradient from 30% eluent B to 100% eluent B in 12 minutes with a flow rate of 200 nl/min , followed by an isocratic wash with 100% eluent B. Experiments were performed on a Q- TOF instrument (Waters-Micromass) in positive ionization mode operating in the MS/MS mode. MS/MS analyses were performed over a mass range of m/z 250-300 ,and mass set 379.29(+) during LC-MS run at retention time of 2-AG in a window of 10 minutes. Energy collision was set to 28ev. The transition 379.29(+) -> 287.1 (+) was extracted for quantifitation purposes, and normalized with m/z 637.3 (from LPC) .

1.2. Results

ABHD1 1 has been isolated using "activity based protein profiling" (ABPP) using the protocols described in the above paragraph 1 .1. ABPP was initially developed as a screening technique (Jessani and Cravatt 2004 Curr Opin Chem Biol. 8:54-9) but has been applied here to the isolation of a protein. ABPP is based on the fact that the presence of PMSF inhibits the binding of the FP-Bodiby probe to the targeted hydrolase, which thus does not fluoresce in the presence of PMSF. To the contrary, the targeted hydrolase fluoresces in the absence of PMSF.

Figure 1 shows the detection of a 29 kDa band from pig brain, which only fluoresces in the absence of PMSF.

The fraction containing the 29 kDa band was analyzed by HPLC. Figure 2 illustrates the HPLC separation of MonoQ eluted fraction, pre-labeled with FP-Bodipy. Fractions 16-17-18 (i.e. those that eluted from 32 to 36 minutes) were collected for identification of the proteins contained therein.

The following table provides a list of:

the major proteins characterized in LCMSMS experiments of tryptic digests of fractions 16-17-18, and

the most FP-Biotin probed-enriched proteins that comprise the canonical lipase consensus "GXSXG" in their active sites.

As shown in the table, these criteria identified ABHD1 1 as the putative target of the FP-Bodipy probe. Ratio FP-

Identified Proteins: SwissProt biotin SEQ

Molecular peptide

included GXSXG active Accession ID

Weight number (-)

site motif Number PMSF/(+) NO:

PMSF

Abhydrolase domain-

Q3SZ73 34 kDa 2 100 1 containing protein 1 1

Acyl-CoA dehydrogenase P1 1310 unknown 1 0 48

Valacyclovir hydrolase Q8R164 33 kDa 1 2 49

Chloride intracellular

Q9QYB1 29 kDa 4 15 50 channel protein 4

1 Epsin-1 088339 60 kDa 2 51

Malate dehydrogenase,

P00346 36 kDa 4 12 52 mitochondrial

Alpha-enolase P04764 47 kDa 1 53

Lon protease homolog,

Q59HJ6 107 kDa 2 0 54 mitochondrial

Disks large homolog 3 P70175 93 kDa 1 0 55

Probable G-protein coupled

Q6PRD1 257 kDa 1 0 56 receptor 179

Dihydropteridine reductase Q3T0Z7 26 kDa 1 3.8 57

Heterogeneous nuclear

088569 37 kDa 1 6 58 ribonucleoproteins

The fact that the 29 kDa band comprises a DAGL was further confirmed using an enzymatic reaction assay followed by a LC-MSMS "MRM-like" experiment, as described in the above paragraph 1.1. In this experiment, the synthesis of 2-AG from DAG is specifically detected by the presence of the following molecule, referred to as 287.02(+):

Figure 3 shows that an enzyme found in Fractions 16-17-18 allows synthesis of 2- AG from DAG. More specifically, this DAG lipase activity is inhibited by RHC80267 and slightly inhibited by PMSF. It may be noted that lipases are usually only slightly inhibited by PMSF because the lid structure covering the serine residue of the active site becomes inaccessible to the reagent.

The process that allowed the isolation and identification of ABHD1 1 is summarized in Figure 4 (left panel). Whole brain solubilization was performed by the use of additional 0.2% TX100 in MOPS buffer. The first step allowed obtaining an extract containing the desired protein in soluble form. For recombinant ABHD1 1 , an initial purification was done by isolation of mitochondria containing the ABHD1 1 protein. After extraction, soluble ABHD1 1 does not require any detergent, and conventional purification steps can be done. Enzymatic activities are not allowed after reverse phase separation chromatography so DAGL activity tests were performed with ABHD1 1 eluted from MonoQ purification step. Reverse phase purification is a "polishing" high-resolution procedure that removes traces of non proteins and protein contaminants before full MS and MSMS characterization.

In summary, the 29 kDa fraction from pig brain comprises a protein with a DAGL activity. The inventors have found that this fraction comprises a protein that corresponds to ABHD1 1 .

2. Expression of human recombinant ABHD11 proteins

2.1. Material and methods

RT-PCR and cloning

Human Brain Poly A+ RNA (Clontech, reference 636101 ) was used to generate first strand cDNA with Superscript II reverse transcriptase (Invitrogen, reference 18064- 014) and oligodT primers.

2μΙ of the cDNA synthesis reaction was prepared in a 50 μΙ final reaction volume for PCR amplification. The 50 μΙ reaction also contained 0.25 μΜ of each oligonucleotide primer and 2 IU of Taq polymerase Phusion® DNA Polymerase (Finzymes, reference F- 530S). The primer sequences were:

5'GCCGCCACCATGCGAGCCGGCCAACAG 3' (sense primer, SEQ ID NO: 10) - 5TTAGACCAGGAAGCCTCGG 3' for ABHD1 1 (reverse primer, SEQ ID NO: 1 1 ) and

5'GCCGCCACCATGGACTACAAAGACGATGACGACAAACGAGCCGGCCAACA GCTT 3' (reverse primer with C-terminal FLAG tag, SEQ ID NO: 12).

Thirty five cycles of PCR amplification were performed. Each cycle consisted of: denaturation at 98°C for 30 sec, annealing at 60°C for 30 sec, and enzymatic extension for 120 sec at 72°C.

After PCR, ABHD1 1 PCR-product DNA was electrophoresed on 2% agarose gels and visualized after ethidium bromide staining by UV fluorescence.

Plasmid construction:

All PCR products were purified from agarose gels using GFX micro plasmid prep kit (Amersham, reference 279601 ) and inserted into the pcDNA3.1A 5-His TOPO TA plasmid (Invitrogen, reference K4800) by TOPO cloning strategy for the direct insertion of Taq-polymerase- amplified PCR products into a plasmid vector. 2.2. cDNA synthesis of the sequence encoding full length human ABHD1 1

To generate the cDNA, a reverse transcriptase isolated from a MMLV retrovirus was used (Superscript III First-Strand Synthesis System for RT-PCR, Invitrogen, reference 18080-051 ). As with other polymerases, a short double-stranded sequence is needed at the 3' end of the mRNA to act as a start point for the polymerase. This is provided by the poly (A) tail found at the 3' end of most eukaryotic mRNAs to which a short complementary synthetic oligonucleotide (oligo dT primer) is hybridized (polyT-polyA hybrid). cDNA synthesis was performed according to the recommendation of the enzyme provider (Invitrogen) using 10 g of total human brain RNA (Clontech, reference 636530) primed with oligo(dT), together with all 4 deoxynucleotide triphosphates, magnesium ions and at neutral pH. The reverse transcriptase thus allows synthesizing a complementary DNA on the mRNA template. Each mRNA molecule in the mixture with a poly(A) tail can be a template and will produce a cDNA in the form of a single stranded molecule bound to the mRNA (cDNA:mRNA hybrid). The cDNA is then converted into a double stranded DNA before it can be manipulated and cloned.

The first-strand cDNA obtained from the above synthesis reaction may be amplified directly by PCR. The enzyme was used according to the recommendations of the provider (Phusion, reference F-530S). The buffer was the HF buffer, and the synthetic primers are shown the table below.

Primer organism mitochondrial LocaliSequence SEQ ID targeting zation NO: peptide

201001 19 E. coli yes 5' GATCGATCGATCCAT 13

ATGCGAGCCGGCCAA

CAGCTTGC

20100120 E. coli no 5' GATCGATCGATCCAT 14

ATGGGCGCCGAGCC GAGGCCGC

20100125 S. cerevisiae Not relevant 3' GATCGATCGTCGACT 15

TAGACCAGGAAGCCT CGGATGG

20100121 E. coli Not relevant 3' GAG C G G C C G CTTAG A 16

CCAGGAAGCCTCGGA TGG

20100151 S. cerevisiae yes 5' TAATATTAATAAAAAA 17

TGCGAGCCGGCCAAC

AGCTTGC

20100190 S. cerevisiae no 5' TAATATTAATAAAAAA 18

TGGGCGCCGAGCCG CCGAGGCCGCTTCCG

C

20090054 Animals yes 5' GCCGCCACCATGCGA 19

cells GCCGGCCAACAG

20090055 Animals Not relevant 3' TTAG AC C AG G AAG C C 20

cells TCGG

The DNA sequence cut by different restriction enzymes are indicated in bold (cut by Ndel, Sail and Notl, respectively). New England Biolabs (NEB Inc 240 County road Ipswich, MA 01938-2723 USA) was the provider of these restriction enzymes.

2.3. Cloning of the sequence encoding full length ABHD1 1 in mammalian cell expression vector

A PCR experiment was performed on the mixture of cDNA obtained as described in paragraph 2.2. The full length ABHD1 1 gene was specifically amplified with the 20090054 and 20090055 primers in a PCR reaction of 30 cycles in the following conditions: 1 X Phusion HF Buffer, 2 μΙ of cDNA template, 0.5 μΜ primers, 200 μΜ dNTPs and 1 unit of Phusion DNA Polymerase in a total reaction volume of 50 μΙ. Each cycle was the composed of the following steps:

Denaturation: 30 seconds at 98°C

- Hybridizing: 30 seconds at 60°C and

Synthesis: 2 minutes at 72°C

The first step was preceded of an additional denaturation step of 2 minutes at

98°C. The DNA fragment thus obtained was cloned in the pCDNA3TOPO plasmid (Invitrogen, reference K4800-01 ). The plasmid expressing the gene encoding the full length ABHD1 1 gene was referred to as p4216. Its sequence is shown as SEQ ID NO: 5. 2.4. Cloning of the sequence encoding full length and mature ABHD1 1 in E. coli and S. cerevisiae expression vectors

PCR experiments were carried out to clone full length ABHD1 1 (F-L ABHD1 1 ) and mature ABHD1 1 (M-ABHD1 1 ), both in E. coli and in S. cerevisiae.

The expression vector used for expression in E. coli was derived from the p338 vector (Joseph-Liauzun, 1990, Gene, 86:291 -25). The expression vector used for expression in S. cerevisiae was derived from the pEMR515 vector (U.S. Patent No. 5,407,822 in the name of Sanofi).

The vectors and procedures implemented to clone full length ABHD1 1 gene in p4216 were used again. The table below shows the pair of primers used in each experiment. Approximately 50 ng of the p4216 plasmid was used as template in these experiments.

The sequences of the £. coli p4412 and S. cerevisiae p441 1 expression plasmids are shown as SEQ ID NO: 6 and SEQ ID NO: 7, respectively. The p4413 plasmid has the same sequence as the p4412 plasmid, with the exception that p4413 expresses a predicted mature ABHD1 1 instead of a full length ABHD1 1 , and the p4423 plasmid has the same sequence as the p441 1 plasmid with the exception that p4423 expresses a predicted mature ABHD1 1 . In other terms:

- p441 1 , p4412 and p4216 express a full length ABHD1 1 protein of SEQ ID NO: 1 (encoded by a nucleotidic sequence of SEQ ID NO: 6); and

p4413 and p4423 express an ABHD1 1 polypeptide of SEQ ID NO: 2 (encoded by a nucleotidic sequence of SEQ ID NO: 9). The plasmids were prepared according to a kit from Genomed (Jet Star Plasmid transformation Kit, reference 220020).

2.5. Expression of full length ABHD1 1 in mammalian cells

The expression experiments were carried out using the FreeStyle™ 293

Expression system (Invitrogen, reference K9000-01 ). The FreeStyle™ 293 Expression System is designed to allow large-scale transfection of suspension 293 human embryonic kidney (HEK) cells in a defined, serum-free medium. The system includes FreeStyle™ 293-F cells that have been adapted to serum-free, suspension culture in FreeStyle™ 293 Expression Medium. Transfection and expression experiments may be performed directly in FreeStyle™ 293 Expression medium without the need to change media.

The transfection and culture protocols described in the user Manual of the kit were stringently observed.

After the expression period, usually about 72 hours, the cells were washed with DPBS (Gibco, reference 14190) and pelleted. The samples were analyzed extemporaneously or freezed at -80°C immediately.

2.6. Expression of ABHD1 1 in E. coli

The experiments consisted in cultivating the host-vector system, prepared beforehand, under conditions to yield an adequate biomass, and such that the induced cells produced full length ABHD1 1 or mature ABHD1 1. The proteins contained in the cytosol of the bacteria were collected.

Preparation of the host-vector systems

The host-vector systems were prepared according to the bacterial transformation techniques known to those skilled in the art, which are for example described especially in the following books:

Molecular cloning - A Laboratory Manual (T. Maniatis, E. F. Fritsch and J. Sambrook, Cold Spring Harbor Laboratory, 1982).

Experiments in Molecular Genetics (J. H. Miller, Cold Spring Harbor Laboratory, 1972).

The E. coli strain was strain I-528 (described in U.S. Patent No. 4,945,047).

Culture

An isolated colony obtained on a solid medium (LB medium and agar-agar) was suspended in 5 ml of a LB medium. (To prepare the LB medium, 10 g of Bactotryptone, 5 g of yeast extract and 5 g of sodium chloride were first added to 900 ml of water, the pH was adjusted to 7.3, and the volume adjusted to 1 liter; 100 μg ml of ampicillin was added after autoclaving.) The suspension culture was incubated at 37°C for 18 hours in order to allow the culture to reach the stationary growth phase. The dense suspension obtained was diluted in LB medium to give an optical density value close to 0.03 when read at 600 nm OD, and 25 ml of this bacterial suspension were then incubated at 37°C, with agitation, until the OD at 600 nm was about 0.3.

1 mM isopropyl-3-D-thiogalactose (or IPTG) was added to the bacterial suspension, and the suspension was agitated at 37°C for 2 h 30 min.

The OD was read at 600 nm and the volume of culture corresponding to 1 ml at OD 0.2 was loaded in an eppendorf tube, centrifuged, and the cells were resuspended in 20 μΙ of loading buffer (50 mM Tris-HCI pH 6.8, 2% SDS, 10% Glycerol, 1 % β- Mercaptoethanol, 12.5 mM EDTA, 0.02 % Bromophenol Blue). The unused culture was centrifuged and the cells or samples freezed immediately at -80°C or used without delay.

PAGE/SDS coloration

The different proteins contained in each of the cell extracts obtained as described above were separated by gel electrophoresis (according to the protocol described by Laemmli et al. 1970 Nature, 227:680-5). The gel was made of polyacrylamide gel (4-12% w/v, Invitrogen, reference NP0321 ). The coloration was either made using Commassie blue or sypro ruby (Molecular Probe, Invitrogen, reference S21900). These compounds were used according to the recommendations of the provider, and in the case of the sypro ruby coloration, the gel reader was the "Typhoon 8600" apparatus (Molecular dynamics) and the picture analyzer software was "Quantity" ( Biorad).

Western Blot analyses

Western blot analyses were performed using the following steps:

Separating by gel electrophoresis as described above.

- Transferring the proteins contained in the gel on to a nitrocellulose filter.

Performing an immunodetection, which entails the following successive operations: Rinsing the nitrocellulose filter (GE Hybond ECL RPN 3031 ) for 10 min in Buffer A (Tris saline Buffer 1X, Sigma T5912).

Bringing the nitrocellulose filter into contact with buffer B (buffer A with bovine serum albumin added at a rate of 3 g per 100 ml and supplemented with 0.1 % Tween 20 from Biorad) for one hour at room temperature.

Bringing the nitrocellulose filter into contact buffer B further containing an immune serum (a polyclonal commercially available antibody recognizing ABHD1 1 , namely reference HPE 024042 from Sigma) for 18 hours at 4° C and used according to the recommendations of the provider.

Rinsing the nitrocellulose filter with buffer B. Bringing the nitrocellulose filter into contact with a solution of secondary antibody directed against rabbit antibodies and carrying the HRP (horse radish peroxydase protein) (Santa Cruz Biotechnology reference sc 2077) for one hour at room temperature and used according to the recommendations of the provider.

- Rinsing the filter with buffer B.

Bringing the filter into contact with the ECL mixture according to the recommendations of the provider, followed by exposing the filter to an X-ray film, and developing the film. 2.7. Expression of ABHD1 1 in S. cerevisiae

Preparation of the host-vector systems

The EMY761 strain yeast strain (Mata, Ieu2, ura3, his3, gal) was transformed with the p441 1 and p4423 plasmids. Three non-isogenic strains of Saccharomyces cerevisiae were used as recipient strains. These strains contain mutations (Ieu2 and ura3) capable of being complemented by the LEU2d defective selection marker and the URA3 selection marker, which are present in each of the p441 1 and p4423 plasmids. Only the URA3 selector marker is used. The transformation technique was derived from that described by Beggs et al. (1978, Nature, 275:104-109). It consists of subjecting the culture to a protoplastization treatment in the presence of an osmotic stabilizer, 1 M sorbitol. EMY761 strains, transformed with p441 1 or EMY761 p4423, were thus retained.

Culture

As a first step, a colony of each of the EMY761 p441 1 and EMY761 p4423 strains was cultured in 25 ml of uracil-free liquid medium. This made it possible to obtain and maintain a large number of copies of plasmids by carrying out the selection for complementation through use of the ura3 gene carried by plasmids p441 1 and p4423.

After 22 hours at 30°C under agitation, the two cultures were centrifuged for 10 minutes at 7000 rpm. The residues were resuspended in 10 ml of sterile distilled water and centrifuged again for 10 minutes at 7000 rpm. Expression of full-length ABHD1 1 and mature ABHD1 1 was induced by resuspending the cells in 20 ml of ethanol-glycerol- galactose YP medium. The cultures were incubated at 30°C for 27 hours, under agitation.

Preparation of protein extracts

The yeast cells cultivated were centrifuged and the supernatant was removed. The residues were resuspended in 10 ml of distilled water and centrifuged for 10 minutes at 7000 rpm. The washed cells were resuspended in about 1 ml of Tris/EDTA buffer, pH 8.0. About 300 μΙ of the cell suspension was lysed in the presence of glass beads (from 400 to 500 μηη in diameter), representing about half the final volume. This mixture was agitated vigorously in a Vortex 4 times for 1 minutes, and the samples were placed on ice for 30 seconds between grinding operations. The liquid was withdrawn from the tubes with a Pasteur pipette and transferred to a microtube. The glass beads were washed once with about 200 μΙ of Tris/EDTA buffer of pH 8.0. The beads were agitated in a Vortex once for 1 minute and the liquid was withdrawn with a Pasteur pipette and added to the above lysate. The lysate was then centrifuged in a microtube for 5 minutes at 7000 rpm. The supernatant was carefully withdrawn and stored at -20° C for Western blot analysis of the ABHD1 1 activity and assay of the total soluble proteins. The residue of the lysed cells was stored separately at -20° C. for Western blot analyses. The samples were frozen immediately at -80°C or used without delay.

Immunodetection of the ABHD11 and mature ABHD11 by Western blot:

The residues and the supernatants of the different samples were subjected to a Western blot using well-known protocols (see e.g. Laemmli et al., 1970, Nature, 227:680-5, and the above paragraph 2.6).

2.8. Results

In order to determine whether ABHD1 1 indeed exhibits DAGL activity, human ABHD1 1 was expressed as a recombinant protein in a bacterial cell, a yeast cell and a mammalian cell.

The sequence of ABHD1 1 that is present in databases (see e.g. Swissprot

Accession No. Q8NFV4) was analyzed. Based on the hypothesis that ABHD1 1 could be a mitochondrial protein, two different isoforms of ABHD1 1 were expressed: the full-length isoform (SEQ ID NO: 1 ), and a putative mature isoform devoid of the 46 amino-terminal amino acids (SEQ ID NO: 2) (see Figure 5).

The aim of these experiments was double:

- cloning and expressing the full length ABHD1 1 cDNA in a mammalian vector such as the pCDNA3.1TOPO vector (Invitrogen, reference K490040) in order to study the biological activity of ABHD1 1 and the cleavage of the putative mitochondrial signal peptide in animal cells; and

- cloning and expressing two different forms of ABHD1 1 (carrying or not the mitochondrial signal peptide of ABHD1 1 putatively identified by bioinformatics) in order to study the biological activity of these two forms upon expression in E. coli and Saccharomyces cerevisiae microorganisms.

The cloning and expression experiments were performed as described above in paragraphs 2.1 to 2.7. As shown in Figures 6 to 8, recombinant and purified ABHD1 1 proteins were obtained. After purification of the recombinant proteins, their DAGL lipase activity was tested. It was surprisingly found that the full length ABHD1 1 protein of SEQ ID NO: 1 did not exhibit any DAGL activity (see Figures 7 and 8). On the other hand, the ABHD1 1 polypeptide of SEQ ID NO: 2 did exhibit DAGL activity (see Figures 7 and 8).

In summary, the inventors have found that full length ABHD1 1 is inactive. They have further found a fragment of ABDH1 1 that exhibits DAGL activity, said fragment corresponding to the polypeptide of SEQ ID NO: 2. They have produced active ABHD1 1 polypeptides using three different expression systems, which are based on human, bacterial and yeast cells, respectively.

The human recombinant ABHD1 1 produced in HEK cells was further characterized as described in paragraphs 4.1 and 4.2 below.

3. Methods for measuring ABHD11 activity

Two different protocols were used to measure ABHD1 1 activity.

ABHD1 1 activity was measured by detecting the presence of the molecule referred to as m/z 287.02(+). This method is described, e.g. in Thomas et al. (The Rapid Commun. Mass Spectrom. 2009. 23:629-638) and in Rimmerman et al. (British Journal of Pharmacology. 2008. 153:380-389).

In a second protocol, ABHD1 1 activity was measured by activity based protein profiling (ABPP), using the protocols described in paragraph 1.1 , above. To this end, a probe identical to the probe shown on Figure 1 of Jessani and Cravatt (2004 Curr Opin Chem Biol. 8:54-9) was used, except that the Tag was bodipy or biotin instead of rhodamine.

4. Characterization of the ABHD11 protein

4.1. Characterisation of the primary structure of ABHD1 1

As shown on Figure 15, the observed molecular mass of human recombinant

ABHD1 1 produced in HEK cells is in agreement with the molecular mass of 30278 +/- 3

Da corresponding to the polypeptide of SEQ ID NO: 3.

In addition of the electrospray data, molecular mass profile was generated from the m/z spectra of high molecular mass multiply charged sample with the processing software associated, Maximum Entropy processing (MaxEnt, Masslynx). Molecular mass can be read directly. The mass profile was dominated by a component of molecular mass

30278 Da, with a series of minor peaks at higher mass. Figure 15 illustrates the very high degree of purity of the obtained recombinant protein.

Purified hABHD1 1 was further characterized after in-solution trypsin digestion by peptide fingerprinting and tandem LTQ MSMS. LTQ MSMS experiments analyses also unambiguously identified a peptide having a sequence of VPAPSSSSGGRGGAEPR (SEQ ID NO: 4), thereby indicating the presence of a longer N-terminal peptide that is not detected in ESI LC-MS experiments carried out with the entire recombinant protein.

The tryptic fragments identified by MALDI MS correspond to theoretical fragments obtained from the tryptic digestion of the hABHD1 1 . As shown in the table below, the sequence of hABHD1 1 was confirmed unambiguously using high-confidence mass matching, with less than 40 ppm error between exact and experimental masses.

Position

Theoretic Experimentals

on SEQ peptide sequence SEQ ID al MH(+) M/z MH(+)

ID NO: 3 No.

1 100.560 VPVAPSSSSGGR 1 100.6 24

1030.5 1-1 1 SSGGRGGAEPR 1030.587 25

1412.7644 6-18 GGAEPRPLPLSYR 1412.801 26

2154.1957 19-39 LLDGEAALPAVVFLHGLFGSK 2154.324 27

894.4679 40-47 TNFNSIAK 894.518 28

1761.9606 40-55 TNFNSIAKILAQQTGR 1762.049 29

886.5105 48-55 ILAQQTGR 886.55 30

1042.61 16 48-56 ILAQQTGRR 1042.713 31

929.5527 56-63 RVLTVDAR 929.608 32

773.4515 57-63 VLTVDAR 773.508 33

1739.9836 106-120 TAMLLALQRPELVER 1740.071 34

1756.14 106-120 TAMLLALQRPELVER(Met-Ox) 1756.14 34

2634.3595 121-145 LIAVDISPVESTGVSHFATYVAAMR 2634.562 35

1 1 1 1.6106 146-155 AINIADELPR 1 1 1 1.656 36

1354.74 146-157 AINIADELPRSR 37

617.38 156-160 SRARK 617.198 38

1902.9953 160-176 KLADEQLSSVIQDMAVR 1903.079 39

1774.9003 161-176 LADEQLSSVIQDMAVR 1775.005 40

1790.9 161-176 LADEQLSSVIQDM(ox)AVR 1790.9 40

1493.807 177-189 QHLLTNLVEVDGR 1493.891 41

607.3351 190-193 FVWR 607.352 42

1366.7325 194-205 VNLDALTQHLDK 1366.751 43

2192.2186 194-212 VNLDALTQHLDKILAFPQR 2192.488 44

844.5039 206-212 ILAFPQR 844.514 45

532.3242 242-245 LFPR 532.373 46

2943.4794 246-271 AQMQTVPNAGHWIHADRPQDFIAAIR 2943.747 47 Together, the intact mass and peptide fingerprint results accurately and confidently identify the sequence of the purified recombinant human ABHD1 1 that is produced from HEK cells. There is a major isoform having a sequence of SEQ ID NO: 3, and a minor isoform having a sequence of SEQ ID NO: 4.

4.2. Kinetics of ABHD1 1

The kinetic parameters of recombinant human ABHD1 1 produced from HEK cells were determined using 1 -stearoyl-2-arachidonoyl-sn-glycerol as a substrate. The results are presented in Figure 1 1. The calculated mean Vmax value is 2500 nmol/min/mg protein. The calculated mean Kmax value is 18,6 μΜ. Interestingly, these Vmax and Kmax values are much more potent than those of the two previously published DAG lipases. Indeed, Bisogno et al. (2003 J Cell Biol. 163:463-8) show that for DAG lipase alpha and beta, the Vmax values are of 33.3 +/- 4.5 and 3.45 +/- 0.16 nmol/min/mg protein, respectively. 4.3. Sequence analysis and comparison with other proteins

The sequence of ABHD1 1 was determined, and identified the following features (see Figure 5):

- a lipase motif (located from amino acid 94 to amino acid 98 of SEQ ID NO: 2); and

- the catalytic triad (S96, D192 and H251 of SEQ ID NO: 2).

Surprisingly, the sequence of the ABHD1 1 DAG lipase is very different from the sequences of DAGLa and DAGI-β, the sole diacylglycerol lipases known in the art (Figure 9). Indeed, the mature ABHD1 1 polypeptide of SEQ ID NO: 3 only exhibits 5.2% of identity with DAGLa, and only 8.4% with DAGL-β (the percentage of identity being calculated with the EMBOSS::needle (global) program using default parameters).

To identify orthologs of ABHD1 1 that are present in sequence databases, a search was performed. The "Homologene server" and the "Ensembl! Orthology prediction server" were used to identity orthologs. The results are presented on Figure 10. Orthologs of ABHD1 1 exist in primates and mammals, but also in various microorganisms such as yeast (S. cerevisiae and K. lactis), filamentous fungi (N. crassa, A.gossypii, M. grisea, S.pombe), insects (D. melanogaster), parasites {P. falciparum, A. gambiae), domestic fowls (G. gallus), fishes (D. rerio), nematodes (C. elegans) and amphibians (X. laevis). The present invention allows assigning a biological function to these orthologs.

The inventors have thus identified a new family of DAG lipases. 4.4. Cellular localization of ABHD1 1

Material and methods for studying the cellular localization ofABHD11

Mitochondria were isolated by Percoll density gradient using the protocol described in Nielsen et al. (2000 J Mol Biol. 300) and Western blot analyses were performed for VDAC-1 (mitochondrial marker), LDH, Calregulin and ABHD1 1 .

To analyze the localization through immunocytofluorescence, SW480 cells (10⁴ cells/wells) were seeded on 8 well Poly-D-lysine coated glass slides and grown in Dulbecco's modified Eagle's medium (GIBCO) supplemented with 10% fetal bovine serum, cyprofloxacine (100 U/ml), and maintained at 37°C in 5% C02 with cells seeding monitoring every day until cells adhered to support.

Mitochondria were stained with TOM-20 antibody (Red) for 30 min at 37°C in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum. After the treatment, the cells were washed 6 times in sterile phosphate buffered saline (PBS) at room temperature and fixed with cold methanol (-20°C) for 3 minutes. The fixed coverslips were washed three times for 5 minutes each with PBS, and then permeabilized with 0.1 % Triton X-100 for 10 minutes and saturated with 1 % gelatin, 1 %BSA in PBS for 10 minutes. The coverslips were then incubated with the specific Rabbit Antibody anti-ABHD1 1 (1 :100 dilution in 1 % gelatin in PBS) at 4°C for 3 hours, washed three times for 5 minutes each with blocking buffer,and incubated at room temperature for 2 hours with the Alexa Fluor 488 goat anti rabbit immunoglobulin G secondary antibody conjugate (1 :1000 dilution in blocking buffer ). The coverslips were then washed three times with PBS for 5 minutes each, mounted with anti-fade and covered with a glass cover slip.

Confocal visualization was performed on Axiovert 200 wildfield fluo microscope with 488 nm and 543 nm laser lines and appropriate filter sets.

Imaging was done with a camera, HQ2 cooled CDD (-30°C) and Metamorph software for data analysis and treatment.

As a control, non-permeabilized cells were hybridized with ABHD1 1 antibodies and the permeable Mitotracker red label of mitochondria. Under these conditions the detected signal for ABHD1 1 was very low. Mitotraker red reveals the same morphology (mitochondria filaments) than observed with TOM-20 antibodies.

Results

Mitochondria were isolated from mouse brain and it was determined whether these mitochondria contained ABHD1 1. As shown on Figure 12, ABHD1 1 is contained within the highly enriched mitochondrial fraction, and is thus unambiguously located in mitochondria.

The cellular localization was further studied by immunocytofluorescence (data not shown). Characteristic mitochondria morphology (filamentous structures) were visualized in SW480-PFA fixed cells. In SW480 cells, anti-ABHD1 1 antibodies labeled mitochondria like-structures. Similar structures were labeled with anti-TOM20 antibodies, which are a mitochondrial marker. In SW480 PFA-fixed cells, anti-ABHD1 1 antibodies recognized a protein that is localized in mitochondria.

4.5. Expression profile of ABHD1 1

Material and methods for studying the gene expression pattern of the ABHD11 gene

RNA polyA+ samples were obtained from Clontech (purified Premium Poly A+ RNA ).

For cDNA synthesis from mRNA, the first strand of the cDNA was generated using the superscript VI LO cDNA synthesis Kit (1 mg RNA in a 20 ml for each reaction). The cDNA was diluted by 5 before using in PCR reaction.

Regarding TaqMan probes, a specific gene expression assay of was designed for each sequence using a tool for TaqMan® gene expression assays from Applied Biosystems. Each gene expression assay consisted of a FAM dye-labeled TaqMan MGB probe and two PCR primers formulated into a single tube (250 nM for the probe and 900 nM for each primer).

Regarding the real-time PCRs, the reactions were carried out using 20 ng of cDNA by reaction. PCR amplification were performed using cDNA as the template, TaqMan universal PCR master mix with AmpliTaq Gold enzyme (2X) and TaqMan Gene expression assay (20 ml by sample). Standard run conditions were as follows: 2 min at 50°C, 10 min at 95°C and 40 cycles each consisting of 95°C for 15 sec and 60°C for 1 min.

Quantitative data analyses were performed using Applied Biosystems 7900HT Real time PCR system.

RPLP0 was used as an endogenous control.

Results

As shown on Figure 13, ABHD1 1 is generally expressed ubiquitously in all tissues. Highest expression was seen in placenta, prostate, small intestine and thyroid. On the other hand, ABHD1 1 is poorly expressed in aorta and colon.

Claims

1 . A purified and enzymatically active diacylglycerol (DAG) lipase comprising a sequence selected from the group consisting of:

- a sequence of SEQ ID NO: 2, 3 or 4;

- a sequence at least 50% identical to SEQ ID NO: 2, 3 or 4; or

a sequence consisting of a fragment of at least 50 consecutive amino acids of SEQ ID NO: 2, 3 or 4;

wherein said DAG lipase is capable of catalyzing the hydrolysis of diacylglycerol into 2- arachidonoylglycerol.

2. The DAG lipase according to claim 1 , wherein said DAG lipase is devoid of its native N-terminal mitochondrial targeting sequence.

3. The DAG lipase according to claim 1 or 2, wherein said DAG lipase is a mitochondrial DAG lipase.

4. The DAG lipase according to any one of claims 1 to 3, wherein said DAG lipase is a human DAG lipase.

5. The DAG lipase according to any one of claims 1 to 4, wherein said DAG lipase consists of a sequence of at least 80% identical to SEQ ID NO: 2, 3 or 4.

6. The DAG lipase according to any one of claims 1 to 4, wherein said DAG lipase consists of a sequence of SEQ ID NO: 2, 3 or 4.

7. The DAG lipase according to any one of claims 1 to 4, wherein said fragment of at least 50 consecutive amino acids of SEQ ID NO: 2, 3 or 4 comprises:

- amino acids 94 to 98 of SEQ ID NO: 2; or

- amino acids 96 to 251 of SEQ ID NO: 2; or

- amino acids 94 to 251 of SEQ ID NO: 2.

8. An isolated nucleic acid comprising a sequence encoding the DAG lipase as defined in any one of claims 1 to 7.

9. The nucleic acid according to claim 8, wherein said nucleic acid does not comprise a sequence coding for the native N-terminal mitochondrial targeting sequence of said DAG lipase.

10. The isolated nucleic acid according to claim 8 or 9, wherein said nucleic acid comprises a sequence selected from the group consisting of:

- a sequence of SEQ ID NO: 9;

a sequence differing from SEQ ID NO: 9 by the degeneracy of the genetic code; a sequence at least 50% identical to SEQ ID NO: 9; and

- a sequence consisting of a fragment of at least 150 consecutive nucleotides of SEQ ID NO: 9.

1 1 . An expression vector comprising a nucleic acid as defined in any one of claims 8 to 10.

12. The expression vector according to claim 1 1 , wherein said expression vector does not comprise a sequence coding for the native N-terminal mitochondrial targeting sequence of the DAG lipase as defined in any one of claims 1 to 7.

13. A host cell comprising an expression vector as defined in claim 1 1 or 12.

14. The host cell according to claim 13, wherein said host cell comprises an expression vector as defined in claim 12.

15. A method for producing a recombinant DAG lipase as defined in any one of claims 1 to 7, comprising the steps of:

a) providing a host cell as defined in claim 13 or 14;

b) cultivating said host cell under conditions suitable for expression of said DAG lipase;

c) isolating and purifying said DAG lipase; and

d) optionally formulating said DAG lipase into a composition.

16. The method according claim 15, wherein said host cell is a host cell as defined in claim 14.

17. The method according to claim 15 or 16, wherein said method further comprises the step of verifying that the DAG lipase obtained at step (c) or (d) is capable of catalyzing the hydrolysis of diacylglycerol into 2-arachidonoylglycerol.

18. A method for screening for modulators of a DAG lipase as defined in any one of claims 1 to 7, said method comprising the steps of:

a) providing a DAG lipase as defined in any one of claims 1 to 7 or a host cell as defined in claim 13 or 14;

b) contacting said DAG lipase or said host cell with a candidate compound and with diacylglycerol;

c) determining whether said candidate compound reduces or enhances the hydrolysis of diacylglycerol into 2-arachidonoylglycerol as compared to a control; wherein the determination at step (c) that a candidate compound reduces or enhances the hydrolysis of diacylglycerol into 2-arachidonoylglycerol indicates that said candidate compound is a modulator of said DAG lipase.

19. The method according to claim 18, wherein said method is for screening for inhibitors of said DAG lipase, and wherein the determination at step (c) that a candidate compound reduces the hydrolysis of diacylglycerol into 2-arachidonoylglycerol indicates that said candidate compound is an inhibitor of said DAG lipase.

20. The method according to claim 18 or 19, wherein said candidate compound is selected from the group consisting of a chemical and/or organic molecule, an aptamer and a peptide.

21 . A method for testing the quality of a composition comprising an inhibitor of a DAG lipase as defined in any one of claims 1 to 7, said method comprising the steps of:

b) providing a composition comprising an inhibitor of said DAG lipase;

c) contacting said DAG lipase or said host cell with diacylglycerol and with said composition;

d) determining whether said composition reduces the hydrolysis of diacylglycerol into 2-arachidonoylglycerol as compared to a control;

wherein the determination made at step (d) is indicative of the quality of the composition.

22. The method according to claim 21 , wherein said inhibitor is selected from the group consisting of an interfering RNA targeting ABHD1 1 , an antibody specifically binding to ABHD1 1 , PMSF, RHC80267, WWL151 , WWL209, WWL210, WW21 1 , WWL214, WWL215, WWL216, WWL219, WWL220, WWL222, WWL223, WWL225, WWL226, WWL227, WWL228, WWL229, WWL230, WWL231 and WWL232.

23. In vitro or ex vivo use of the DAG lipase according to any one of claims 1 to 7 for catalyzing the hydrolysis of diacylglycerol into 2-arachidonoylglycerol.