WO2013057485A1 - Oligonucléotides antisens pour saut d'exon dans apob - Google Patents

Oligonucléotides antisens pour saut d'exon dans apob Download PDF

Info

Publication number
WO2013057485A1
WO2013057485A1 PCT/GB2012/052563 GB2012052563W WO2013057485A1 WO 2013057485 A1 WO2013057485 A1 WO 2013057485A1 GB 2012052563 W GB2012052563 W GB 2012052563W WO 2013057485 A1 WO2013057485 A1 WO 2013057485A1
Authority
WO
WIPO (PCT)
Prior art keywords
aso
exon
splicing
skipping
asos
Prior art date
Application number
PCT/GB2012/052563
Other languages
English (en)
Inventor
Bernard KHOO
James Stuart OWEN
Paul Simons
Original Assignee
Ucl Business Plc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ucl Business Plc filed Critical Ucl Business Plc
Publication of WO2013057485A1 publication Critical patent/WO2013057485A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111—General methods applicable to biologically active non-coding nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/33—Alteration of splicing

Definitions

  • the invention relates to antisense oligonucleotides (ASOs), especially for use in producing truncated proteins, particularly a truncated version of APOBIOO.
  • ASOs antisense oligonucleotides
  • the ASOs can be used in therapy, particularly in the treatment of high cholesterol and related conditions.
  • FH familial hypercholesterolemia
  • statins drugs that reduce cholesterol and LDL levels decrease the incidence of heart attacks and strokes.
  • patients may experience side effects, or cholesterol levels may not be sufficiently lowered, even at high doses. The latter is particularly true for those that suffer from familial hypercholesterolemia, who continue to have an increased risk of death from atherosclerosis despite high-dose drug treatment. There is therefore a need for new drugs to reduce cholesterol levels.
  • Apolipoprotein B is a protein that transports cholesterol in the circulation, largely in the LDL particle.
  • the inventors have identified that APOB's function can be altered by altering its RNA splicing.
  • the alternative R A splicing causes the expression of a shortened isoform of APOB called APOB87 S KIP27.
  • APOB87 S TP27 reduces the secretion of LDL, and increase LDL clearance and removal from the circulation. This dual action causes a marked reduction of LDL and cholesterol levels.
  • APOB exists in two isoforms: APOBIOO (in LDL) is implicated in atherosclerosis; ⁇ 48 (in chylomicrons) is involved in dietary fat transport from the intestine.
  • a cholesterol- lowering agent should interfere with APOBIOO only, and should not affect APOB48 to preserve normal fat absorption.
  • Non-specifically reducing both isoforms causes a reduction in chylomicron assembly. For example, with APOB RNA interference, there is a 50% reduction in chylomicron levels.
  • PCSK9 down-regulation to increase LDL receptor levels is of no use in FH, where the defect lies in the binding of LDL receptor to APOB100.
  • ASOs which can be used to specifically target APOB100.
  • Their inventive treatment has a unique dual action in reducing LDL levels by reducing secretion and increasing clearance which directly treats the physiological problems in FH. It is selective for the APOB100 isoform, and leaves APOB48 alone, evading the mechanism- based toxicity of solutions that knock-down all APOB isoform expression.
  • polygenic hypercholesterolaemia for example in those who are intolerant of conventional treatments such as statins.
  • a first aspect of the invention provides an isolated antisense oligonucleotide (ASO) for use in exon skipping comprising at least three targeting regions, each of which binds specifically to a splicing region within a target nucleic acid, the splicing regions being selected from a 5' splicing site, a 3 ' splicing site, a branchpoint splicing site, one or more exon-intron junctions, and one or more splicing enhancer elements, and a splicing site within the exon.
  • the target nucleic acid is preferably a pre-mRNA molecule.
  • the pre-mRNA is preferably the pre- mRNA produced during the expression of APOB.
  • the ASO is particularly efficient at bringing about exon skipping because it targets three sites.
  • the mechanisms that underlie this phenomenon include better binding to the target nucleic acid, interference with spliceosome and other splicing factor association or binding of the ASO to form a secondary structure that prevents efficient splicing.
  • the sites are within a target nucleic acid, preferably a pre-mRNA.
  • the pre-mRNA is preferably the pre-mRNA produced during the expression of APO-B.
  • the inventors have found that by altering R A splicing it is possible to produce the shortened form of APOB. It is preferable that the exon to be skipped is exon 27. Alternatively, the exon to be skipped is exon 28.
  • the ASO may have any appropriate nucleotide sequence in order to bind the three selected regions in the target nucleic acid.
  • the splicing regions preferably include at least two, more preferably all three of the 5' splicing site, the 3' splicing site, the branchpoint splicing site.
  • the ASO preferably comprises at least one of the following sequences: CCAUAC; CUGUAUAGGAGAGA; AUUAGAUUCAUA; CCATAC; CTGTATAGGAGAGA; and ATTAGATTCATA, or at least five, six, seven, eight, nine or ten contiguous amino acids taken from one of these sequences. More preferably, it comprises at least one of the following sequences: CCAUAC; CUGUAUAGGAGAGA; and AUUAGAUUCAUA. Even more preferably, it comprises at least two, even more preferably all three of those sequences.
  • sequences are preferably arranged in the order provided.
  • the sequences may be contiguous or may be separated by one or more bases. It is preferred that sequences CCAUAC and CUGUAUAGGAGAGA are contiguous. It is preferable that sequences CUGUAUAGGAGAGA and AUUAGAUUCAUA are separated by between 5 and 15 bases.
  • the ASO comprises or consists of one of the following nucleotide sequences:
  • the ASO comprises or consists of any one of the nucleotide sequences shown in table A or table C, optionally including the modifications mentioned.
  • it preferably comprises or consists of a nucleotide sequence having at least 50%, more preferably at least 55%, preferably at least 57%, more preferably at least 60%, even more preferably at least 70%, more preferably at least 80%, more preferably at least 90% homology with that sequence. Further, it preferably shows similar binding affinity, such as at least 65%, more preferably at least 70%, more preferably at least 75% even more preferably at least 80% of the binding affinity of that sequence for APOB pre-mRNA.
  • the ASO according to the invention may comprise components other than nucleotides.
  • it may comprise a molecule, such as biotin, cholesterol or fluorescein, preferably at its 5' end.
  • oligonucleotide is considered, herein, to encompass any molecule which has a base sequence with a structure similar to that of DNA or RNA so that the base sequence of the molecule can base pair with a complementary base sequence such as an oligodeoxyribonucleotide or an oligoribonucleotide, a phosphorodiamidate morpholino oligonucleotide (PMO), a 2'-0-methyl (2'OMe) oligonucleotide, a locked nucleic acid (LNA) or a peptide nucleic acid (PNA), oligonucleotides containing phosporothioate bonds, 2'-fluoro oligonucleotides, hexitol nucleic acid, 2'-0-meth
  • the ASO may be modified in order to increase its effectiveness.
  • it may contain phosphorothioate (PTO) backbone modifications.
  • PTO phosphorothioate
  • the PTO modification in which a sulphur atom is substituted for one of the non-bridging oxygen atoms in the phosphate backbone of oligonucleotides, particularly in 2'-Omethyl ribose oligonucleotides is a common modification to increase the ASO resistance to exonuclease degradation in vivo.
  • the inventors surprisingly found that partial PTO modification improved exon skipping more than full PTO modification.
  • the ASO preferably comprises modified phosphate backbones in between 5 and 12 phosphate groups at one or both of its 5' and 3' ends,
  • Other backbone modifications may also be made, such as using phosphoramidate morpholinos, locked nucleic acids, and 2'-0-methoxyethyl modifications.
  • a vector especially a viral vector, such as an AAV vector, comprising a nucleotide sequence according to the invention.
  • a second aspect of the invention provides a method of exon- skipping, comprising targeting a nucleic acid, with at least one splicing agent wherein the splicing agent specifically binds to at least three splicing regions within a target nucleic acid, the splicing regions being selected from a 5' splicing site, a 3' splicing site, a branchpoint splicing site, one or more exon-intron junctions, and one or more splicing enhancer elements and an internal exon sequence
  • the method preferably comprises using at least one splicing agent which binds to three splicing regions.
  • the one or more splicing agents may be, for example an oligonucleotide, especially an antisense oligonucleotide, especially an ASO according to the first aspect of the invention.
  • they may be one or more small molecules, or a combination of small molecules and oligonucleotides,
  • a third aspect of the invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising the ASO of the first aspect of the invention and a pharmaceutically acceptable carrier or excipient.
  • the composition may comprise a carrier which enables the ASO to be delivered to the relevant site for use.
  • the carrier may target a particular site or otherwise improve delivery to that site. It may also comprise an excipient which stabilises the ASO.
  • Such stabilisers are well known in the art. Any appropriate stabiliser may be used.
  • compositions of this invention comprise any of the molecules of the present invention, and pharmaceutically acceptable salts thereof, with any pharmaceutically acceptable carrier, adjuvant or vehicle.
  • Pharmaceutically acceptable carriers, adjuvants and vehicles that may be used in the pharmaceutical compositions include, but are not limited to, ion exchangers, alumina, aluminium stearate, lecithin, serum proteins, such as human serum albumin, buffer substances such as phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes, such as protamine sulphate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinyl pyrrolidone, cellulose- based substances, polyethylene glycol, sodium carboxymethylcellulose, polyacrylates, waxes, polyethylene- polyoxypropylene-block polymers, polyethylene glycol and wool fat.
  • the molecule of the invention may be provided in a nanoparticle, for example, to enhance delivery.
  • nanoparticles may be lipid based, for example, the molecule being encapsulated in a lipid membrane.
  • the composition itself may be a lipid formation, or may comprise, for example cell penetrating peptides.
  • compositions of this invention may be administered orally, parenterally, by inhalation spray, topically, rectally, nasally, buccally, vaginally or via an implanted reservoir.
  • the pharmaceutical compositions are administered orally or by injection.
  • the pharmaceutical compositions may contain any conventional non-toxic pharmaceutically-acceptable carriers, adjuvants or vehicles.
  • parenteral as used herein includes subcutaneous, intracutaneous, intravenous, intramuscular, intra- articular, intrasynovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques.
  • the route of administration of the composition is transdermal or intrathecal administration.
  • the pharmaceutical compositions may be in the form of a sterile injectable preparation, for example, as a sterile injectable aqueous or oleaginous suspension.
  • This suspension may be formulated according to techniques known in the art using suitable dispersing or wetting agents (such as, for example, Tween 80) and suspending agents.
  • the sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally- acceptable diluent or solvent, for example, as a solution in 1,3-butanedioi.
  • the acceptable vehicles and solvents that may be employed are mannitol, water, Ringer's solution and isotonic sodium chloride solution.
  • sterile, fixed oils are conventionally employed as a solvent or suspending medium.
  • any bland fixed oil may be employed including synthetic mono- or diglycerides.
  • Fatty acids, such as oleic acid and its glyceride derivatives are useful in the preparation of injectables, as are natural pharmaceutically-acceptable oils, such as olive oil or castor oil, especially in their polyoxyethylated versions.
  • These oil solutions or suspensions may also contain a long-chain alcohol diluent or dispersant such as Ph, Helv or a similar alcohol.
  • compositions of this invention may be orally administered in any orally acceptable dosage form including, but not limited to, capsules, tablets, and aqueous suspensions and solutions.
  • carriers which are commonly used include lactose and corn starch.
  • Lubricating agents such as magnesium stearate, are also typically added.
  • useful diluents include lactose and dried com starch.
  • aqueous suspensions are administered orally, the active ingredient is combined with emulsifying and suspending agents. If desired, certain sweetening and/or flavouring and/or colouring agents may be added.
  • compositions of this invention may also be administered in the form of suppositories for rectal administration.
  • These compositions can be prepared by mixing a molecule of this invention with a suitable non- irritating excipient which is solid at room temperature but liquid at the rectal temperature and therefore will melt in the rectum to release the active components.
  • suitable non- irritating excipient include, but are not limited to, cocoa butter, beeswax and polyethylene glycols.
  • Topical administration of the pharmaceutical compositions of this invention is especially useful when the desired treatment involves areas or organs readily accessible by topical application.
  • the pharmaceutical composition should be formulated with a suitable ointment containing the active components suspended or dissolved in a carrier.
  • Carriers for topical administration of the molecules of this invention include, but are not limited to, mineral oil, liquid petroleum, white petroleum, propylene glycol, polyoxyethylene polyoxypropylene compound, emulsifying wax and water.
  • the pharmaceutical composition can be formulated with a suitable lotion or cream containing the active compound suspended or dissolved in a carrier.
  • Suitable carriers include, but are not limited to, mineral oil, sorbitan monostearate, polysorbate 60, cetyl esters wax, cetearyl alcohol, 2-octyldodecanol, benzyl alcohol and water.
  • the pharmaceutical compositions of this invention may also be topically applied to the lower intestinal tract by rectal suppository formulation or in a suitable enema formulation. Topically-transdermai patches are also included in this invention.
  • compositions of this invention may be administered by nasal aerosol or inhalation.
  • Such compositions are prepared according to techniques well-known in the art of pharmaceutical formulation and may be prepared as solutions in saline, employing benzyl alcohol or other suitable preservatives, absorption promoters to enhance bioavailability, fluorocarbons, and/or other solubilising or dispersing agents known in the art.
  • the invention further provides the ASO of the first aspect or the pharmaceutical composition according to the third aspect, for use in therapy especially for use in the treatment of high cholesterol or to reduce levels of low density lipoprotein particles.
  • the ASO or pharmaceutical composition may be used in the treatment of conditions related to or worsened by high cholesterol, such as atherosclerosis.
  • the ASO or pharmaceutical composition may be used in the treatment of familial hypercholesterolaemia due to defects in the LDL receptor or gain-of-function mutations in PCSK9, and familial defective APOB100.
  • the invention also provides a method of treating high cholesterol and related conditions by administering the ASO or pharmaceutical composition to a subject.
  • the inventors have also identified that the efficiency of exon skipping can be improved by modifying the ASOs used.
  • a method of increasing the efficiency of exon skipping using an ASO comprising tagging the 5' end of the ASO with biotin, cholesterol or fluorescein.
  • a method of increasing the efficiency of exon skipping using an ASO comprising making partial phosphorothioate backbone modifications to the ASO.
  • Figure 1 shows the Principle of cholesterol reduction using exon 27 skipping to truncate Apolipoprotein B100 (APOB 100)
  • Middle of figure the partial genomic structure of APOB is shown, with boxes representing exons and interconnecting lines representing introns.
  • the red box within exon 26 ('edit') represents the RNA editing site that changes the CAA codon to a UAA termination codon).
  • red box red box: 'PTC'
  • APOB48 is expressed as normal in the intestine, as RNA editing proceeds as normal in exon 26.
  • Figure 2 shows the results of the comparison of exon 27 skipping induced by test skip27 ASOs in vitro.
  • All ASOs are 2'-0-methyl ribose ASOs.
  • Fluo 5' fluorescein group added;
  • PTO phosphorothioate modification to backbone of ASOs at all phosphates;
  • 53PTO phosphorothioate modification to ASO backbone only for the 10 phosphates at either end of the ASO.
  • the table underneath the graph shows the mean, S.D. and S.E.M. for each ASO.
  • Figure 3 Effect of skip27 ASO 53B4 53PTO-Fluo on exon 27 skipping in vivo.
  • Figures 4 to 1 1 show the sequence of introns 26-27 and 27-28 surrounding exon 27 and associated branch point splice sites and the 3' and 5' splice sites with the position of the various ASOs. PTO modifications are indicated by the pattern, for example, ASO #27 contains the same nucleotide sequence as ASO #14, but has 5 PTO modifications on each end. Skipping efficiency (%) was determined using our established RT-qPCR assays and calculated as copy number of skipped divided by copy number of skipped plus non-skipped.
  • Example 1 Inducing exon skipping.
  • the inventors have tested new ASO sequences that target three splice sites, i.e. the 5', 3' and branchpoint sequence, simultaneously in the same ASO. They have found that this strategy is able to increase the efficiency of exon skipping.
  • WinList 6.0 Acquire data without compensation, use WinList 6.0 to auto-compensate and analyse data.
  • tissue culture flow hood Wash cells in PBS, add 500 ⁇ 0.05% Trypsin-EDTA and incubate 8 min at 37 °C, 5% C0 2 .
  • RNA bench in lab • Move to RNA bench in lab • For each sample, add 1 volume of 70% ethanol to the lysate and mix well by pipetting, immediately transfer to an RNeasy MinElute column placed in a 2 ml collection tube.
  • Figure 2 shows the summarised results of screening of 36 skip27 ASOs.
  • the new ASOs which target three splice sites (named 53B4) were compared with the former benchmark ASO, 3B, which targets only two splice sites. 3B showed a mean skipping percentage of 4.14%. Scramble controls 3Bs and 53B4s were also tested and did not affect skipping to a significant degree (0.21 % and 0.09% respectively). Targeting all three splice sites in 53B4 increased efficiency by 3.6-fold [compare 53B4 (15.01%) to 3B (4.14%)].
  • 53B4 is a 50-mer with the sequence 5'- AGCUCCAUACCUGUAUAUAGGAGAGAUUUUGUAUUUUAUUAGAUUCAUAACA— 3'.
  • Example 2 The use of 5' fluoresceination of ASOs to increase exon skipping efficiency of ASOs.
  • the inventors used fluorescent dyes to label ASOs to allow for visualisation of transfection efficiency as well as subcellular localisation.
  • the skip27 ASOs were tagged with 5' fluorescein (Fluo in Figure 2).
  • the inventors also tested adding other groups to the 5' end of the ASO, adding biotin increased efficiency two fold.
  • Example 3 The use of partial phosphorothioate backbone modification to increase exon skipping efficiency of ASOs.
  • PTO phosphorothioate
  • the inventors then tested the effect of partial PTO protection, with the addition of PTO to the 10 phosphate groups at the 5' and the 10 phosphate groups at the 3' end (the 53PTO modification). This increased the efficiency of exon-skipping by 3.9-fold [compare 53B4 (15.01%) vs 53B4_53PTO (58.73%)]. It therefore appears that the partial PTO protect modification does increase efficiency.
  • Example 4 The combination of the modifications to increase exon skipping efficiency of ASOs.
  • the inventors have synthesised a skip27 ASO, 53B4_53PTO-Fluo, which incorporates all three modifications referred to above, namely targeting three splice sites, having partial PTO backbone modifications and being modified by the addition of fluorescein.
  • the inventors have tested the efficiency of this ASO using human APOB transgenic mice (Figure 3).
  • the mice were injected with doses of the skip27 ASO formulated in Invivofectamine 2,0 IV, available from Life Technologies.
  • the mice were sacrificed 24 hours later and liver RNA was subjected to quantification for exon 27 skipping using qRT-PCR as described above. The results are shown in figure 3.
  • the ASO effectively brought about skipping of exon 27.
  • the inventors focussed on reducing the size of the skip27 ASOs from the 50 nucleotide (nt) length of the lead ASO 53B4 (ASO #27) while screening sequence variants. As previous attempts to delete larger fragments from the sequence had been unsuccessful we tested ASOs with only a few reductions (Fig. 4). In order to keep costs to a minimum, initially we used 2'- O-methyl RNA ASOs without phosphorthio te (PTO) modifications. As shown in Fig. 4, these reductions affected skipping efficiency positively. The smallest ASO contained 45 nt.
  • FIG 1 the structure and sequence of the introns 26-27 and 27-28 surrounding the mouse exon 27 sequence with the human sequence and structure shown in comparison. Nucleotide differences in the mouse sequence are delineated by orange fill, Various sequence motifs in the mouse sequence are indicated below the sequence. ASOs #10-34 and #10-01 contain a 5' fluorescein (star) and PTO modifications as indicated by the pattern.
  • ASO #14/2-7 sequence variants can induce exon 27 skipping to varying degrees.
  • ASO #56 AGCUCCAUGUAUAGGAGAGAUUAGAUUCAUAACA
  • ASO #52 AGCUCCAUGUAUAGGAGAGAUUUUAUUAGAUUCAUAACA

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Cette invention concerne des oligonucléotides antisens (ONA), destinés notamment à être utilisés pour produire des protéines tronquées, en particulier, une forme tronquée d'APO100.
PCT/GB2012/052563 2011-10-17 2012-10-17 Oligonucléotides antisens pour saut d'exon dans apob WO2013057485A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB201117880A GB201117880D0 (en) 2011-10-17 2011-10-17 Antisense oligonucleotides
GB1117880.3 2011-10-17

Publications (1)

Publication Number Publication Date
WO2013057485A1 true WO2013057485A1 (fr) 2013-04-25

Family

ID=45219810

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2012/052563 WO2013057485A1 (fr) 2011-10-17 2012-10-17 Oligonucléotides antisens pour saut d'exon dans apob

Country Status (2)

Country Link
GB (1) GB201117880D0 (fr)
WO (1) WO2013057485A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016164602A1 (fr) * 2015-04-08 2016-10-13 The University Of Chicago Compositions et méthodes de correction de la dystrophie musculaire des ceintures de type 2c par saut d'exon
WO2023168427A1 (fr) 2022-03-03 2023-09-07 Yale University Compositions et procédés d'administration de polynucléotides thérapeutiques pour saut d'exon

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006000057A1 (fr) * 2004-06-28 2006-01-05 SMITHKLINE BEECHAM CORPORATION, doing business as GLAXOSMITHKLINE Oligonucleotides antisens permettant d'induire un saut d'exon et leurs procedes d'utilisation
US20090142391A1 (en) * 2007-08-14 2009-06-04 Mutz Mitchell W Conjugated RNAi Therapeutics
WO2011154427A1 (fr) * 2010-06-08 2011-12-15 Amsterdam Molecular Therapeutics (Amt) Ip B.V. Petits arn nucléaires à usage thérapeutique

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006000057A1 (fr) * 2004-06-28 2006-01-05 SMITHKLINE BEECHAM CORPORATION, doing business as GLAXOSMITHKLINE Oligonucleotides antisens permettant d'induire un saut d'exon et leurs procedes d'utilisation
US20090142391A1 (en) * 2007-08-14 2009-06-04 Mutz Mitchell W Conjugated RNAi Therapeutics
WO2011154427A1 (fr) * 2010-06-08 2011-12-15 Amsterdam Molecular Therapeutics (Amt) Ip B.V. Petits arn nucléaires à usage thérapeutique
WO2011154851A1 (fr) * 2010-06-08 2011-12-15 Amsterdam Molecular Therapeutics (Amt) Ip B.V. Arnsn modifiés pour une utilisation en thérapie

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
AARTSMA-RUS A. ET AL.: "Antisense-induced multiexon skipping for Duchenne Muscular Dystrophy makes more sense", AMERICAN JOURNAL OF HUMAN GENETICS, vol. 74, no. 1, 1 January 2004 (2004-01-01), AMERICAN SOCIETY OF HUMAN GENETICS, CHICAGO, IL, US, pages 83 - 92, XP008084158, ISSN: 0002-9297 *
AARTSMA-RUS A. ET AL.: "Exploring the Frontiers of Therapeutic Exon Skipping for Duchenne Muscular Dystrophy by Double Targeting within One or Multiple Exons - Supplemental Table 1 and Table2", 12 August 2006 (2006-08-12), XP002691021, Retrieved from the Internet <URL:http://www.nature.com/mt/journal/v14/n3/suppinfo/mt20061311s1.html?url=/mt/journal/v14/n3/full/mt20061311a.html> [retrieved on 20130125] *
AARTSMA-RUS A. ET AL.: "Exploring the frontiers of therapeutic exon skipping for Duchenne Muscular Dystrophy by double targeting within one or multiple exons", MOLECULAR THERAPY, vol. 14, no. 3, 12 August 2006 (2006-08-12), ACADEMIC PRESS, SAN DIEGO, CA, US, pages 401 - 407, XP005844833, ISSN: 1525-0016, DOI: 10.1016/J.YMTHE.2006.02.022 *
INCITTI TANIA ET AL.: "Exon skipping and Duchenne Muscular Dystrophy therapy: selection of the most active U1 snRNA-antisense able to induce Dystrophin exon 51 skipping", MOLECULAR THERAPY, ACADEMIC PRESS, SAN DIEGO, CA, US, vol. 18, no. 9, 1 September 2010 (2010-09-01), pages 1675 - 1682, XP008131506, ISSN: 1525-0016, [retrieved on 20100615], DOI: 10.1038/MT.2010.123 *
KHOO BERNARD ET AL.: "Antisense oligonucleotide-induced alternative splicing of the APOB mRNA generates a novel isoform of APOB", BMC MOLECULAR BIOLOGY, BIOMED CENTRAL LTD, GB, vol. 8, no. 1, 3, 17 January 2007 (2007-01-17), pages 13 pp., XP021022525, ISSN: 1471-2199, DOI: 10.1186/1471-2199-8-3 *
KHOO BERNARD ET AL.: "Supplementary Information:Two potential secondary structures formed by exon 27 and adjacent intronic regions.", 17 January 2007 (2007-01-17), XP002691020, Retrieved from the Internet <URL:http://www.biomedcentral.com/1471-2199/8/3/additional> [retrieved on 20130125] *
VAN OMMEN GERT-JAN ET AL.: "The therapeutic potential of antisense-mediated exon skipping", CURRENT OPINION IN MOLECULAR THERAPEUTICS, vol. 10, no. 2, 1 April 2008 (2008-04-01), CURRENT DRUGS, LONDON, GB, pages 140 - 149, XP009107079, ISSN: 1464-8431 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016164602A1 (fr) * 2015-04-08 2016-10-13 The University Of Chicago Compositions et méthodes de correction de la dystrophie musculaire des ceintures de type 2c par saut d'exon
US10273483B2 (en) 2015-04-08 2019-04-30 The University Of Chicago Compositions and methods for correcting limb girdle muscular dystrophy type 2C using exon skipping
US10801029B2 (en) 2015-04-08 2020-10-13 The University Of Chicago Compositions and methods for correcting limb girdle muscular dystrophy type 2C using exon skipping
WO2023168427A1 (fr) 2022-03-03 2023-09-07 Yale University Compositions et procédés d'administration de polynucléotides thérapeutiques pour saut d'exon

Also Published As

Publication number Publication date
GB201117880D0 (en) 2011-11-30

Similar Documents

Publication Publication Date Title
US11697811B2 (en) Oligomers
JP5535076B2 (ja) 肝臓癌を治療するための標的化ミクロｒｎａ
KR20200064164A (ko) 마이크로rna 화합물 및 mir-21 활성 조절 방법
JPH11511128A (ja) リポソームオリゴヌクレオチド組成物
US20210095282A1 (en) Modified Oligonucleotides for Treatment of Polycystic Kidney Disease
JP2019500428A (ja) タウ発現を減少させるための組成物および方法
US20240141350A1 (en) Methods for treatment of polycystic kidney disease
EP4221719A1 (fr) Compositions et méthodes pour le traitement de maladies liées à l&#39;angiopoïétine 7 (angptl7)
WO2013057485A1 (fr) Oligonucléotides antisens pour saut d&#39;exon dans apob
NZ524274A (en) Antisense insulin-like growth factor binding protein (IGFBP)-2-oligodeoxynucleotides for prostate and other endocrine tumor therapy
US11149274B2 (en) Methods and compositions for managing vascular conditions
WO2004002535A1 (fr) Utilisation d&#39;un antagoniste du recepteur npy y2 pour traiter des troubles apparentes a l&#39;angiogenese
JP7427227B2 (ja) 腫瘍細胞の生存を低下させるｋｒａｓアンチセンスオリゴヌクレオチド及びその用途
US20220380767A1 (en) Methods and compositions for treatment of polycystic kidney disease
WO2020184700A1 (fr) Complexe d&#39;acide nucléique pour moduler l&#39;expression d&#39;ihh
JP2024516168A (ja) がんを治療するための組成物および方法
WO2023064809A1 (fr) Oligonucléotides pour le ciblage du complément c5

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12781414

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 12781414

Country of ref document: EP

Kind code of ref document: A1